CA2332573A1 - Mammalian genes; dendritic cell prostaglandin-like transponder (dc-pgt), hdtea84, hsljd37r and rankl, hcc5 chemokine, deubiquitinating 11 and 12 (dub11, dub12), md-1, md2 and cyclin e2, related reagents and methods - Google Patents

Abstract

Purified genes from a mammal, reagents related thereto including purified proteins, specific antibodies, and nucleic acids encoding the polypeptides a re provided. Methods of using said reagents and diagnostic kits are also provided. Characterization of genes and products relating to DC-PGT (Dendrit ic cell prostaglandin-like transporter), HDTEA84, HSLJD37R and RANKL (related t o TNF receptor family), HCC5 chemokine, Dub 11 and Dub 12 (Deubiquitinating 11 and 12), MD-1 and MD-2 (proteins which exhibit properties of ligands for proteins exhibiting a leucine-rich protein motif (LRR)) and cyclin E2.</SDOA B>

Description

WO 00/01817 PCT/t1S99/12366 MAMMALIAN GENES: DENDRTTIC CELL PROSTAGLANDW-LIKE TRANSPONDER (DC-PGT7, HDTEA84, HSLJD37R AND RANKL. HCCS CHEMOKINE. DEUBIQUT1TNATING 11 AND 12 (DU811, DUB12), MD-1, MD2 AND
CYCLIN E2, RELATED REAGENTS AND METHODS
FIELD OF THE INVENTION
The present invention pertains to compositions related to proteins which: function :in cellular physiology, development, and differentiation of marranalian cells; exhibit sequence similarity to TNF receptors which function in controlling activation and expansion of mammalian cells, e.g., cells of a mammalian immune system; or function in controlling the cell cycle and growth. In particular, it provides purified genes, proteins, antibodies, and related reagents useful, e:.g., to separate or identify particular cell types, or to regulate activation, development, differentiation, and func;_ion o. va=ious cel= types, including 25 hematopoietic cells; which exhibit high structural similarity to proteins that exhibit the biological capacity to serve as a carrier mediated transport:ers of charged organic anions across cellular membranes, which typically can be used in prostaglandin and thromboxane physiology, e.g., transportation, influx, efflux, clearance, or degradation; which regulate or evidence development, differentiation, and function of various cell types, including hematopoietic cells; or to regulate cell division and proliferation of various cell types, including tumor cells.
BACKGROUND OF THE INVENTION
Prostaglandins (PGs) and thromboxanes (TXs) play widespread physiological, and therapeutic roles in health and disease such as glaucoma; pregnancy, labor, delivery, and abortion; gastric protection and peptic ulcer formation; intestinal fluid secretion;
liver protection and damage; airway resistance and asthma; blood pressure control; and modulation of inflammatory cells.
PGs are charged anions at physiological pH that diffuse poorly across biological membranes. This limited simple diffusion appears to be augmented by carrier mediated transport in many diverse tissues such as the lung, choroid plexus, liver, anterior chamber of the eye, vagina, uterus, and placenta.
- SUBSTITUTE SHEET ( rule 26 ) Understanding the role of prostaglandins in the development and functioning of the immune system is presently incomplete.
Specifically, the influence of prostaglandins (PGs) on antigen presenting cells (APCs) of the immune system (e. g., dendritic cells) is, as yet, poorly understood.
Dendritic cells (DCs) are the most potent of antigen presenting cells. See, e.g., Paul (ed. 1993) Fundamental Immunoloav 3d ed., Raven ~?ress, NY. DCs are highly responsive to inflammatory stimuli such as bacterial lipopolysaccharides (LPS) and cytokines such as tumor necrosis factor alpha (TNFOC). The presence of cytokines and LPS can induce a series of phenotypic and functional changes in DC that are collectively referred to as maturation. See, e.g., Banchereau and Schmitt Dendritic Cells in Fundamental and Clinical lmmunolocrv Plenum Press, NY.
Maturational changes in DCs include, e.g., silencing of antigen uptake by endocytosis, upregulation of surface molecules related to T cell activation, and active production of a number of cytokines including TNFa <~.nd IL-12. Upon local accumulation of TNFa, DCs migrate to the T cell areas of secondary lymphoid organs to activate antigen specific T cells.
Recent data indicate that DCs secrete PGs. See, e.g., Cormann, et al. (1986) Ann. Inst. Pasteur 137:369-382.
Furthermore, PGE2 has been shown to have an influence on DC
maturity and the production of cytokines by DCs. Seem e.g., Kalinski, et al. (1997) J.. Immunol. 159:28-35; Kuhn, et al. (1997) Eur. J. Immunol. 27:3135-x142; and Rieser, et al. (1997) J. Ex~.
186:1603-1608.
Currently, a need ex_i.sts to understand the manner in which PGs influence cells of thE, immune system. It seems likely that PGs, like eytokines, effects immune system development and activation. The present invention contributes to satisfying that need and is directed genez:ally to a novel mammalian gene encoding a prostaglandin-like transporter (PGT).
In other aspects, the activation of resting T cells is critical to most immune responses and allows these cells to exert SUBSTITUTE SHEET ( rule 26 ) their regulatory or effector capabilities. See, e.g., Paul (ed.
1993) Fundamental Immunoloav 3d ed., Raven Press, N.Y. Increased adhesion between T cells and antigen presenting cells (APC) or other forms of primary stimuli, e.g., immobilized monoclonal antibodies (mAb), can pot:entiate the T-cell receptor signals. T-cell activation and T cell expansion depends upon engagement of the T-cell receptor (TCR) and co-stimulatory signals provided by accessory cells. See, e.g., Jenkins and Johnson (1993) a r.
loin. Immunol. 5:361-367; Bierer and Hahn (1993) Semin. Immunol.
5:249-261; June, et al. (1990) Immunol. Todav 11:211-216; and Jenkins (1994) Immunity 1:443-446. A major, and well-studied, co-stimulatory interaction for T cells involves either CD28 or CTLA-4 on T cells with either B7 or B70 (Jenkins (1994) immunity 1:443-446). Recent studies on CD28 deficient mice (Shahinian, et al.
(1993) Science 261:609-612; Green, et al. (1994) Immunity 1:501-508) and CTLA-4 immunoglobulin expressing transgenic mice (Ronchese, et al. (1994) J. Exro. Med. 179:809-817) have revealed deficiencies in some T-cell responses though these mice have normal primary immune responses and normal CTL responses to lymphocytic choriomeningitis virus and vesicular stomatitis virus.
As a result, both these studies conclude that other co-stimulatory molecules must be supporting T-cell function. However, identification of these molecules which mediate distinct costimulatory signals has been difficult.
Tumor Necrosis Factor (TNF) is the prototypic member of an emerging family of cytokines that function as prominent mediators of immune regulation and the inflammatory response. These ligands are typically type II membrane proteins, with homology at the carboxy terminus. A proteolytic processed soluble protein often is produced. See, e.g., Smith, et al. (1994) Cell 76-959-962;
Armitage (1994) Current opinion in Immunoloq5r 6:407-413; Gruss and Dower (1995) B-lood 85:3378-3404; Wiley, et al. (1995) Immunity 3:673-682; and Baker and Reddy (1996) Oncoaene 12:1-9. Crucial roles for these family members are evidenced by a number o:f studies, and they are implicated in regulation of apoptosis, peripheral tolerance, Ig maturation and isotype switching, and SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCTlUS99/12366 general B cell and T cell functions. See, e.g., Thomson (ed.
1994) The Cytokine Handbook Academic Press, San Diego, CA;
Naismith and Sprang (1998) Trends Biochem. Sci. 23:74-79; Lucas, et al. (1997) J. Leukoc. :8101. 61:551-558; Reddi (1997) 89:159-161; Van Deventer (1997) Gut 40:443-448; Jablonska (1997) Poste~y. Hia. Med. Dosw. !51:567-575; Hill and Lunec (1996) Mo Aspects Med. 17:455-509; :~derka (1996) Cvtokine Growth Factor Rev 7:231-240; Lotz, et al. (:1.996) J. Leukoc. Biol. 60:1-7; and Gruss and Dower (1995) ~ytokinea Mol. Ther. 1:75-105. These imply fundamental roles in immune and developmental networks relevant to human therapeutic needs. The identification of ligands and cell surface receptors allow determination of pairs, which will be useful in modulating such signal transduction.
The discovery of new cell markers is always potentially useful. Moreover, the inability to modulate activation signals prevents control of inappropriate developmental or physiological responses in the immune system. The present invention provides at least one alternative costimulatory molecule, which will be useful as a marker for cell type,, and agonists and antagonists of which will be useful in modulating a plethora of immune conditions or responses.
The circulating component of the mammalian circulatory system comprises various cell types, including red and white blood cells of the erythroid and myeloid cell lineages. See, e.g., Rapaport (1987) Introduction to Hernatoloav (2d ed.) Lippincott, Philadelphia, PA; Jandl (:1987) Blood: Textbook of Hematology, Little, Brown and Co., Boston, MA.; and Paul (ed. 1993) Fundamental Immuno~.oav (3d ed.) Raven Press, N.Y.
For some time, it has been known that the mammalian immune response is based on a series of complex cellular interactions, called the "immune network." Recent research has provided new insights into the inner workings of this network. While it remains clear that much of_ the response does, in fact, revolve around the network-like interactions of lymphocytes, macrophages, granulocytes, and other cf:lls, immunologists now generally hold the opinion that soluble proteins, known as lymphokines, SUBSTITUTE SHEET ( rule 26 ) cytokines, or monokines, play a critical role in controlling these cellular interactions. Thus, there is considerable interest in the isolation, characterization, and mechanisms of action of cell modulatory factors, an understanding of which should lead to 5 significant advancements in the diagnosis and therapy of numerous medical abnormalities, e.g., immune system and other disorders.
Lymphokines apparently mediate cellular activities in a variety of ways. They have been shown to support the proliferation, growth, and differentiation of the pluripotential hematopoietic stem cells into vast numbers of progenitors comprising diverse cellular lineages making up a complex immune system. These interactions between the cellular components are necessary for a healthy immune response. These different cellular lineages often respond in a different manner when lymphokines are administered in conjunction with other agents.
The chemokines are a. large and diverse superfamily of proteins. The superfamily is subdivided into two classical branches, based upon whether the first two cysteines in the chemokine motif are adjacent (termed the "C-C" branch), or spaced by an intervening residue ("C-X-C"). A more recently identified branch of chemokines lacks two cysteines in the corresponding motif, and is represented by the chemokines known as lymphotactins. Another recently identified branch has three intervening residues between the two cysteines, e.g., CX3C
chemokines. See, e.g., Schall and Bacon (1994) Current Opinion in Immunology 6:865-873; and Bacon and Schall (1996) Int. Arch.
Allergy & Immunol. 109:97-109.
Because the physiology mediated by these soluble molecules is so important, the discovery of novel chemokines will be important, both in diagnostic and therapeutic contexts.
In addition, while the general importance of the regulation of protein synthesis is universally accepted, the general importance of protein degradation has not been fully appreciated.
One mechanism of protein degradation is via ubiquitination signals and degradation pathways. Ubiquitin (Ub) is a highly conserved 76 amino acid polypeptide that plays an important role in the regulation of protein degradation, cell-cycle progression, gene SUBSTITUTE SHEET ( rule 26 ) transcription and signal transduction. The ubiquitination pathway is fine tuned and controlled, in part, by deubiquitination enzymes, which remove ubiquitin from proteins. Misregulation of the ubiquitination pathway may contribute problems in the protein quantity regulation, which may be associated, e.g., with malignant transformation, and oncogenesis through oncogenic counterparts of normally processed ubiquitinated proteins. Other clinical problems will often result from excessive or insufficient protein levels. Therefore, understanding the ubiquitination roles, e.g., in immune function, will :increase our understanding of cell biology, which should have relevance, e.g., to malignant transformation.
Furthermore, growth of normal resting B cells (also referred to as "B lymphocytes") involves two distinct steps. First, the resting cells are activated to pass from the GO to G1 phase of the cell cycle. See, e.g., Alberts, et al. (eds. 1989) Molecular Bioloav of the Cell Garland Publ., NY; and Darnell, et al. (1990) Molecular Cell Biology Freeman, NY. Next, the activated cells are induced to proliferate. See, e.g., Paul, ed. (1989) Fundamental Tmmunolocrv, 2nd ed., Raven Press, NY; and the third edition.
Several factors have been identified that induce growth of B
cells, including interleukin-1 (IL-1), IL-2, IL-4, IL-10, and IL-13. In addition, antibodies against certain B cell surface molecules have been demon:~trated to promote B cell proliferation.
T cells (also referred to as "T lymphocytes") are also induced to proliferate by certain factors, which include phytohemagglutinin, anti-T cell receptor monoclonal antibodies, anti-CD3 monoclonal antibodies, and other agents.
B7 (CD80) and B70 (CI)86) are the second "group" of molecules which strongly mediate B and T cell interaction. These molecules, on B cells, interact with their ligands CD28 and CTLA-4 on T
cells. These interactions. are major co-stimulatory signals for activation of both B and T cells.
During the last 15 years, it has become apparent that B'/
(CD80) and B70 (CD86) play fundamental functions in T cell and B
cell activation Numerous in vitro and in vivo experiments have demonstrated that these twa pairs of molecules represent important SUBSTITUTE SHEET ( rule 26 ) targets for immunosuppression. See, e.g., Banchereau, et al.
(1994) Ann. Rev. Immunol. 12:881-922; van Kooten, et al. (1996) Adv. Immunol. 61:1-77; Linsley and Ledbetter (1993) Ann. Rev.
Immunol. 11:191-212).
In 1995, another molecule called RP105 was cloned from mouse splenic cells. See Miyake, et al (1995) J. Immunol. 154:3333-3340. Monoclonal antibodies against RP105 also induce strong proliferation of mouse B c ells and protects mouse B cells from irradiation-induced apoptosis in a similar fashion to anti-~CD40 antibody or CD40-ligand. See Miyake, et al. (1994) J. Ext~. Med.
180:1217-1224.
The RP105 molecule and its ligand MD-1 may be an additional pair of molecules that play key roles in the activation of T cells and B cells. See Miyake, et al. (1998) J. Immpnol. 161:1349-1353;
and Chan, et al., (1998) ~~. Exp. Med. 188:93-101 However, the human sequence of MD-1, has remained undetermined. The present invention provides this and also provides a previously undescribed second human homolog of me>use MD-1, (i.e., MD-2).
Many factors have been identified which influence the differentiation process of precursor cells, or regulate the physiology or migration properties of specific cell types. These observations indicate that: other factors exist whose functions in immune function were heretofore unrecognized. These factors provide for biological activities whose spectra of effects may be distinct from known differentiation or activation factors. The absence of knowledge about. the structural, biological, and physiological properties of the regulatory factors which regulate cell physiology in vivo prevents the modulation of the effects of such factors. Thus, medical conditions where regulation of the development or physiology of relevant cells is required remains unmanageable.
Thus, significant therapeutic needs exist in the areas of cytokine regulation of physiology, protein degradation, and B cell signaling. The present invention provides important insights and developments in these areas.
Cancer can occur in many tissues of the body. It results from a change in certain cells that causes them to evade the SUBSTITUTE SHEET ( rule 26 ) normal growth limiting mechanisms, e.g., to escape the feedback controls that normally stop cellular growth and reproduction after a given number of such ceI_Ls have developed. Cell division and transcription are highly coordinated processes that play important roles in this feedback control. See, e.g., Beeson, et al. (eds.
1979) Textbook of Medicine, 15th ed., W.B. Sounders Co., Philadelphia, PA.; DeVita, et al. (eds. 1997) Cancer Princiules a.nd Practice of Oncoloav, 5th ed., Lippincott, Philadelphia., PA;
Neal and Hoskin (1997) c'linicaT Oncology Basic Principles and Practice Oxford University Press, NY; Kastan (1997) Checkpoint Controls and Cancer CSH Press, NY; and Thomas (ed. 1996) Apobtosis and Cell Cvcle Contro~ in c'ancer~ Basic Mechanisms and Implications for Treating Malignant Disease BIOS Scientific, Oxford .
Molecules which function to regulate cell division play important roles in the controlled growth of various types of cells. Aberrations in these controls can lead to various disease states, e.g., oncogenesis, improper wound healing, developmental abnormalities, and metabolic problems.
The cell cycle can be divided into four phases: the presynthetic phases (GO and G1); the phase of DNA synthesis (S);
and the postsynthetic phase (G2). See, e.g., Guyton (ed. 1976) Textbook of Medical Phvsioloc~v, 5th ed., W.B. Sounders Co., Philadelphia, PA.; Alberts, et al. (eds. 1994) Molecular Biolocrv of the Cell, 3rd ed., Garland Publishing, New York, NY; and Darnell, et al. (eds. 1990) Molecular Ceil Bioloav, 2nd ed., W.H.
Freeman, New York, NY. Effective chemotherapeutic agents are often those which target diseased cells in the S phase, e.g., choriocarcinoma, acute Iymphocytic leukemia, lyphocytic lymphosarcoma, Burkitt's lymphoma, Hodgkin's disease, testicular neoplasms, Wilm's tumor, and Ewing's sarcoma. Unfortunately, oncogenic cells not actively dividing are less sensitive to these agents.
The lack of knowledge regarding the control of the cell cycle has hampered the ability of medical science to specifically regulate cell division or immune responses. The present invention SUBSTITUTE SHEET ( rule 26 ) provides compositions which will be important in the control of cell division and transcription.
StTNlL~fARY OF THE INVENTION
The present invention is based, in part, upon the characterization of the genes and products relating to the DC-PGT, HDTEA84, HSLJD37R, RANKL, HCC5 chemokine, Dubll, Dubl2, I~-1, Nm-2, and cyclin E2. It provides nucleic acids, polypeptides, antibodies, and methods fo:r making and using such compositions.
In the DC-PGT embodiments, the invention provides an isolated or recombinant antigenic polypeptide comprising: a plurality of distinct segments, wherein each segment has identity to at least 12 contiguous amino acids from the mature SEQ ID NO: 2; or at least 17 contiguous amino acids from the mature SEQ ID NO: 2. In certain embodiments, the plurality of segments includes one of at least 19 contiguous amino acids; or two of at least 15 contiguous amino acids. Other polypeptides include those wherein the polypeptide: comprises thE~ mature SEQ ID NO: 2; binds with specificity to a polyclonal antibody which specifically binds to SEQ ID NO: 2; or the polypeptide: is a natural allelic variant of SEQ ID NO: 2; is at least 30 amino acids in length; exhibits at least two non-overlapping epitopes specific for SEQ ID NO: 2; is a synthetic polypeptide; is attached to a solid substrate; or :is a 5-fold or less conservative substitution from SEQ ID N0: 2.
Fusion polypeptides are a7_so provided, e.g., comprising first and second portions, the first. portion comprising a sequence as described and the second portion comprising a detectable marker.
Pharmaceutical compositions are made available, e.g., comprising a sterile polypeptide, as desscribed, in a pharmaceutically acceptable carrier.
Polynucleotide embodiments include an isolated or recombinant polynucleotide encoding a described polypeptide. Preferred forms will be such a polynucleot:ide which: comprises the mature polypeptide coding portion of SEQ ID NO: 1; or encodes the mature SEQ ID NO: 2. Preferred embodiments include wherein the polynucleotide is: a PCR product; a hybridization probe; a SUBSTITUTE SHEET ( rule 26 ) mutagenesis primer; or made by chemical synthesis. Alternatively, the polynucleotide is~ detectably labeled; a deoxyribonucleic acid; or double stranded. Also provided is an expression vector:
comprising the described polynucleotide, including wherein the 5 polypeptide specifically binds polyclonal antibodies generated against an immunogen of mature SEQ ID N0: 2; which selectively hybridizes under stringent. hybridization conditions to a target polynucleotide sequence having at least 60 contiguous nucleotides from SEQ ID NO: 1; encodes a polypeptide having at least 50 10 contiguous amino acid residues from mature SEQ ID NO: 2; or is suitable for transfection into a prokaryote or eukax-yote host cell. Preferably, the ho:~t cell is: a mammalian cell; a bacterial cell; an insect cell; a px-okaryote; a eukaryote; or a COS cell. A
method is provided, e.g., of making a polypeptide comprising expressing the vector in t:he host cell.
Other polynucleotides include an isolated or recombinant polynucleotide which hybridizes to the coding portion of SEQ ID
NO: 1 under stringent hybridization and wash conditions of at least 50' C, a salt concentration of less than 400 mM, and 50~
fox-mamide. Such a nucleic' acid may be an expression vector, which may hybridize to the coding portion of SEQ ID NO: 1 under stringent hybridization and wash conditions of at least 60' C, a salt concentration of less than 200 mM, and 50~ fox-mamide.
Preferably, the vector encodes a polypeptide which specifically binds an antibody generated against a mature SEQ ID NO: 2.
Another embodiment will be such a polynucleotide which hybridizes to SEQ ID NO: 1, wherein the polynucleotide is: a PCR product; a hybridization probe; a mutagenesis primer; or made by chemical synthesis.
Methods are provided, e.g., of modulating the physiology or development of a cell, comprising contacting the cell with an agonist or antagonist of a described polypeptide; of detecting the presence of a complementary polynucleotide in a sample, comprising contacting a described polynucleotide that selectively hybridizes with the complementary polynucleotide in the sample to form a detectable duplex; thereby indicating the presence of the polynucleotide in the sample; or for identifying a compound that SUBSTITUTE SHEET ( rule 2G ) binds to a described polypeptide, comprising: incubating components comprising the compound and the polypeptide under conditions sufficient to allow the components to interact; and measuring the binding of the compound to the polypeptide.
In TNF receptor-like embodiments, the invention further provides an isolated or recombinant polynucleotide encoding an antigenic polypeptide comprising at least l7.contiguous amino acids from: the mature polypeptide from SEQ ID N0: 6; the mature polypeptide from SEQ ID N0: 8; the mature polypeptide from SEQ ID
N0: 10; the mature polypeptide from SEQ ID NO: 12; the mature polypeptide from SEQ ID N0: 17; the mature polypeptide from SEQ ID
NO: 19; the mature polypeptide from SEQ ID NO: 21; or the mature polypeptide from SEQ ID N0: 23. In preferred embodiments, such polynucleotide will encode all of the polypeptide of: signal processed SEQ ID NO: 6; signal processed SEQ ID NO: 8; signal processed SEQ ID NO: 10; ;signal processed SEQ ID NO: 12; signal processed SEQ ID N0: 17; SEQ ID NO: 19; SEQ ID NO: 21; or SEQ ID
NO: 23. Other embodiments include such a polynucleotide, which hybridizes at 55° C, less than 500 mM salt, and 50~ formamide to the: mature protein coding portion of SEQ ID NO: 5; signal processed coding portion of SEQ ID NO: 7; signal processed coding portion of SEQ ID N0: 9; signal processed coding portion of SEQ ID
N0: 11; mature protein coding portion of SEQ ID NO: 16;
polypeptide coding portion of SEQ ID NO: 18; polypeptide coding portion of SEQ ID N0: 20; or polypeptide coding portion of SEQ ID
NO: 22. Other forms include those polynucleotides, comprising at least 35 contiguous nucleotides of: mature protein coding portion of SEQ ID NO: 5; signal processed coding portion of SEQ ID N0: 7;
signal processed coding portion of SEQ ID NO: 9; signal processed coding portion of SEQ ID N0: 11; mature protein coding portion of SEQ ID N0: 16; polypeptidE~ coding portion of SEQ ID NO: 18;
polypeptide coding portion of SEQ ID N0: 20; or polypeptide coding portion of SEQ ID NO: 22. Various expression vectors are provided comprising such a polynucleotide. The invention also provides a host cell containing the expression vector, including a eukaryotic cell.
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCTIfJS99/12366 Methods are provided, e.g., making an antigenic polypeptide comprising expressing a recombinant polynucleotide; for detecting a polynucleotide, comprising contacting the polynucleotide with a probe that hybridizes, under stringent conditions, to at least 25 contiguous nucleotides of the: mature protein coding portion of SEQ ID NO: 5; signal processed coding portion of SEQ ID NO: 7;
signal processed coding portion of SEQ ID N0: 9; signal processed coding portion of SEQ ID :ISO: 11; mature protein coding portion of SEQ ID NO: 16; polypeptide coding portion of SEQ ID NO: 18;
polypeptide coding portion of SEQ ID NO: 20; or polypeptide coding portion of SEQ ID N0: 22; to form a duplex, wherein detection of the duplex indicates the presence of the polynucleotide. hits are provided, e.g., for the detection of a described polynucleatide, comprising a compartment containing a probe that hybridizes, under stringent hybridization conditions, to at least 17 contiguous nucleotides of a described polynucleotide to form a duplex.
Preferably, the probe is detestably labeled.
Binding compounds are provided, including antibodies, comprising an antibody binding site which specifically binds to a polypeptide comprising at least 17 contiguous amino acids from:
signal processed SEQ ID N0: 6; signal processed SEQ ID N0: 8;
signal processed SEQ ID NO: 10; signal processed SEQ ID NO: 12;
signal processed SEQ ID NC>: 17; SEQ ID N0: 19;SEQ ID NO: 21; or SEQ ID NO: 23. Preferably, the antibody binding site is:
selectively immunoreactive with the: signal processed SEQ ID NO:
6; signal processed SEQ ID N0: 8; signal processed SEQ ID N0: 10;
signal processed SEQ ID NO: 12; signal processed SEQ ID NO: 17;
SEQ ID NO: 19; SEQ ID N0: 21; or SEQ ID NO: 23; raised against a purified or recombinantly produced human HDTEA84 protein; raised against a purified or recombinantly produced human HSLJD37R
protein; or in a monoclonal antibody, Fab, or F(ab)2; or the binding compound is: an antibody molecule; a polyclonal antiserum;
detestably labeled; sterile; or in a buffered composition.
Such compositions allow various methods, including using the binding compound, comprising contacting the binding compound with a biological sample comprising an antigen, thereby forming a binding compound: antigen complex. Preferably, the biological SUBSTITUTE SHEET ( rule 26 ) sample is from a human, and the binding compound is an antibody.
Such also allow for production of a detection kit comprising the binding compound, and: instructional material for the use of the binding compound for the detection; or a compartment providing segregation of the binding compound.
Polypeptides are also made available, e.g., a substantially pure or isolated antigenic polypeptide, which binds to the described binding composition, and further comprises at least 17 contiguous amino acids from: signal processed SEQ ID N0: 6; signal processed SEQ ID NO: 8; signal processed SEQ ID N0: 10; signal processed SEQ ID NO: 12; signal processed SEQ ID NO: 17; SEQ ID
NO: 19; SEQ ID NO: 21; or SEQ ID NO: 23. Preferred polypeptides include those which: comprise at least a fragment of at least 25 contiguous amino acid residues from: a primate HDTEA84 protein; a primate HSLJD37R protein; or a rodent or primate RANKL protein; or are soluble polypeptides; .are detectably labeled; are in a sterile composition; are in a buffered composition; bind to an sialic acid residue; are recombinantly produced; or have a naturally occurring polypeptide sequence. In other embodiments, the polypeptide comprises at least 17 contiguous amino acids from the: signal processed SEQ ID NO: 6; signal processed SEQ ID NO: 8; signal processed SEQ ID NO: 12; signal processed SEQ ID NO: 17; SEQ ID
NO: 19; SEQ ID NO: 21; or SEQ ID N0: 23.
Methods are provided, including a method of modulating a precursor cell physiology or function comprising a step of contacting the cell with: a binding compound which binds to a described polypeptide; an HDTEA84 polypeptide; an HSLJD37R
polypeptide; or a RANKL po:Lypeptide. The method may be one wherein the contacting is :in combination with a TNF family ligand, or an antagonist of the TNF family ligand.
In other embodiments, the present invention provides compositions related to other chemokine, Dub, or surface protein genes. Polypeptide embodiments include: a substantially pure or recombinant HCCS polypepti<ie exhibiting identity over a length of at least 12 amino acids to SEQ ID NO: 25; an isolated natural sequence HCCS of mature SEQ ID N0: 25; a fusion protein comprising HCC5 sequence; a substantially pure or recombinant Dubl1 SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCT/US99112,366 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID N0: 32 or 34; an isolated natural sequence Dubl1 of mature SEQ ID NO: 32 or 34; a fusion protein comprising Dubl1 sequence; a substantially pure or recombinant Dubl2 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID N0: 36 or 38; an isolated natural sequence Dubl2 of mature SEQ ID N0: 36 or 38; a fusion protein comprising Dubl2 sequence; a substantially pure or recombinant 1~-1 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID N0: 42; an isolated natural sequence Na7-1 of mature SEQ ID NO: 42; a fusion protein comprising primate 1~-1 sequence; a substantially pure or recombinant Nm-2 polypeptide exhibiting identity over a, length of at least about 12 amino acids to SEQ ID N0: 44 or 46; ar; isolated natural sequence 1~-2 of mature SEQ ID NO: 44 or 46; a fusion protein comprising primate Nm-2 sequence; a substantially pure or recombinant Nm-2 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID N0: 48 or 49; an isolated natural sequence I~7-2 of mature SEQ ID NO: 48; or a fusion protein comprising murine Nm-2 sequence. Preferred embodiments include substantially pure or isolated polypeptides which match the sequences over a stretch of at least 17 amino acids; more preferably over a stretch of at least 21 amino acids; over 25, 30, 35, 50, 75 or more. In other preferred embodiments, the HCCS polypeptide: is from a primate, including a human; comprises at least one polypeptide segment of SEQ ID NO: 25; exhibits a plurality of portions exhibiting the identity; is a natural allelic variant of HCC5; has a length at least about 30 amino acids; exhibits at least two non-overlapping epitopes which are specific for a primate HCCS;
exhibits a sequence identity over a length of at least 35 amino acids to a HCCS; is glycosyylated; is a synthetic polypeptide; is attached to a solid substrate; is conjugated to another chemical moiety; is a 5-fold or less substitution from natural sequence; or is a deletion or insertion variant from a natural sequence; or the Dubl1 polypeptide: is from a primate, including a human; comprises at least one polypeptide segment of SEQ ID NO: 32 or 34; exhibits a plurality of portions exhibiting the identity; is a natural SUBSTITUTE SHEET ( rule 26 ) allelic variant of Dubll; has a length at least about 30 amino acids; exhibits at least t:wo non-overlapping epitopes which. are specific for a primate Dubll; exhibits a sequence identity over a length of at least about 35 amino acids to a Dubll; is 5 glycosylated; is a synthetic polypeptide; is attached to a solid substrate; is conjugated t.o another chemical moiety; is a 5-fold or less substitution from natural sequence; or is a deletion or insertion variant from a natural sequence; or the Dubl2 polypeptide: is from a primate,. including a human; comprises at 10 least one polypeptide segment of SEQ ID NO: 36 or 38; exhibits a plurality of portions exhibiting the identity; is a natural allelic variant of Dubl2; has a length at least about 30 amino acids; exhibits at least two non-overlapping epitopes which are specific for a primate Dubl2; exhibits a sequence identity over a 15 length of at least about 35 amino acids to a Dubl2; is glycosylated; is a synthetic polypeptide; is attached to a solid substrate; is conjugated to another chemical moiety; is a 5-fold or less substitution from natural sequence; or is a deletion or insertion variant from a natural sequence; or the primate 1~-1 polypeptide: is from a human; comprises at least one polypeptide segment of SEQ ID NO: 42; exhibits a plurality of portions exhibiting the identity; is a natural allelic variant of primate Nm-1; has a length at least about 30 amino acids; exhibits at least two non-overlapping epitopes which are specific for a primate MD-1; exhibits a sequence identity over a length of at least about 35 amino acids to a primate 1~-1; is glycosylated; is a synthetic polypeptide; is attached to a solid substrate; is conjugated to another chemical moiety; is a 5-fold or less substitution from natural aequence; or is a deletion or insertion variant from a natural sequence; or the primate ML7-2 polypeptide:
is from a human; comprises at least one polypeptide segment of SEQ
ID N0: 44 or 46; exhibits a plurality of portions exhibiting the identity; is a natural allelic variant of primate Nm-2; has a length at least about 30 amino acids; exhibits at least two non-overlapping epitopes which are specific for a primate Na7-2;
exhibits a sequence identity over a length of at least about 35 amino acids to a primate MD-2; is glycosylated; is a synthetic SUBSTITUTE SHEET ( rule 26 ) polypeptide; is attached to a solid substrate; is conjugated to another chemical maiety; :is a 5-fold or less substitution from natural sequence; or is a deletion or insertion variant fram a natural sequence; or the rodent 1~-2 polypeptide: is from a mouse;
comprises at least one polypeptide segment of SEQ ID NO: 4S or 49;
exhibits a plurality of portions exhibiting the identity; is a natural allelic variant of. rodent 1~-2; has a length at least about 30 amino acids; exhibits at least two non-overlapping epitopes which are specific for a rodent 1~-2; exhibits a sequence identity over a length of at least about 35 amino acids to a rodent MD-2; is glycosylat:ed; is a synthetic polypeptide; is attached to a solid substrate; is conjugated to another chemical moiety; is a 5-fold or less substitution from natural sequence; or is a deletion or insertion variant from a natural sequence.
Sterile compositions comprising such polypeptides are also provided, along with those comprising: the HCC5 polypeptide and: a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration; another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4; or an antibody antagonist for a chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4; the Dubl1 polypeptide and a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration; the Dubl2 ;polypeptide and a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration; the Nm-1 polypeptide and a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration; the Na7-2 polypeptide and a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration.
Fusion proteins are provided, e.g., comprising: mature protein sequence of SEQ ID NO: 25; mature protein sequence of SEQ
SUBSTITUTE SHEET ( rule 26 ) ID NO: 32, SEQ ID N0: 34, SEQ ID NO: 36 or SEQ ID N0: 38; mature protein sequence of SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID N0: 48, or SEQ ID N0: 49; a detection or purification tag, including a FLAG, His6, or Ig sequence; or sequence of another chemokine protein with the chemokine polypeptide Kits are provided, e.g., comprising a described polypeptide and: a compartment comprising the polypeptide; and/or instructions for use or disposal of reagents in the kit.
Binding compounds, including antibodies, are provided, e.g., i0 comprising an antigen binding portion from an antibody, which specifically binds to a natural: HCCS polypeptide, wherein the antibody: is raised against a peptide sequence of a mature HCCS
polypeptide sequence of SEQ ID NO: 25; is raised against a mature HCC5; is raised to a purified HCC5; is immunoselected; is a polyclonal antibody; binds to a denatured HCC5; or exhibits a Kd to HCCS antigen of at least 30 EIM; or Dubl1 polypeptide, wherein the antibody: is raised ag<~inst a peptide sequence of a mature Dubl1 polypeptide sequence of SEQ ID NO: 32 or SEQ ID NO: 34; is raised against a mature Dubll; is raised to a purified Dubll; is immunoselected; is a polyc:Lonal antibody; binds to a denatured Dubll; or exhibits a Kd to Dubll antigen of at least 30 E1.M; or Dubl2 polypeptide, wherein the antibody: is raised against a peptide sequence of a mature Dubl2 polypeptide sequence of SEQ ID
NO: 36 or SEQ ID N0:38; is raised against a mature Dubl2; is raised to a purified Dubl2; is immunoselected; is a polyclonal antibody; binds to a denatured Dubl2; or exhibits a Kd to Dubl2 antigen of at least 30 E.~M; or a primate I~-1 polypeptide, wherein the antibody: is raised against a peptide sequence of a mature polypeptide sequence of SEQ ID NO: 42; is raised against a mature Nm-1; is raised to a purified Nm-1; is immunoselected; is a polyclonal antibody; binds to a denatured Nm-1; or exhibits a Kd to Nm-1 antigen of at least: 30 ~1M; or a primate 1~-2 polypeptide, wherein the antibody: is raised against a peptide sequence of a mature Nm-2 polypeptide sequence of SEQ ID NO: 44, or SEQ ID NO:
46; is raised against a mature Nm-2; is raised to a purified I~-2;
is immunoselected; is a pol.yclonal antibody; binds to a denatured SUBSTITUTE SHEET ( rule 2b ) MD-2; or exhibits a Kd to 1~-2 antigen of at least 30 ~.tM; or a rodent MD-2 polypeptide, wherein the antibody: is raised against a peptide sequence of a mature MD-2 polypeptide sequence of SEQ ID
N0: 48, or SEQ ID NO: 49; is raised against a mature rodent MD-2;
is raised to a purified rodent MD-2; is immunoselected; is a polyclonal antibody; bind: to a denatured rodent MD-2; or exhibits a Kd to antigen of at lea:~t 30 E.4M. In certain embodiments, the binding composition will k>e one wherein: the polypeptide is from a primate or rodent; the binding compound is an Fv, Fab, or Fab2 fragment; the binding compound is conjugated to another chemical moiety; is attached to a ssolid substrate, including a bead or plastic membrane; is in a sterile composition; or is detectably labeled, including a radioactive or fluorescent label.
Kits are provided comprising the binding compound, and: a compartment comprising they binding compound; a compartment comprising purified antigen; and/or instructions for use or disposal of reagents in the kit. Methods are provided for producing an antigen:antibody complex, comprising contacting an antibody and: a primate HCC5 polypeptide; a primate Dubl1 polypeptide; a primate Dubl2 polypeptide; a primate MD-1 polypeptide; a primate MD-2 polypeptide; or a rodent MD-2 polypeptide; thereby allowing the complex to form. Other compositions are provided, e.g., the binding compound and: a carrier, wherein the carrier is: an aqueous compound, including water, saline, and/or buffer; and/or formulated for oral, rectal, nasal, topical, or parenteral administration; or an antibody antagonist for another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4.
Nucleic acid embodiments include, e.g., an isolated or recombinant nucleic acid encoding a polypeptide or fusion protein described, wherein: the HCC5: polypeptide is from a primate, including a human; or nucleic acid: encodes an antigenic HCC5 peptide sequence of SEQ ID NO: 25 encodes a plurality of antigenic HCCS peptide sequences of SEQ ID NO: 25; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the HCC5 segment;
is a hybridization probe for a gene encoding the HCCS polypeptide;
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/ITS99/12366 or further encodes another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4; or the Dubll: polypeptide is from a primate, including a human; or nucleic acid: encades a Dubl1 antigenic peptide sequence of SEQ ID NO: 32; or SEQ ID NO:
34; encodes a plurality of antigenic peptide sequences of SEQ ID
NO: 32 or SEQ ID N0: 34; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the Dubl1 segment; or is a hybridization probe for a gene encoding the Dubl1 polypeptide; the Dubl2: polypeptide is from a primate, including a human; or nucleic acid: encodes an antigenic Dubl2 peptide sequence of SEQ
ID NO: 36 or SEQ ID NO: 38; encodes a plurality of antigenic peptide sequences of SEQ ID N0: 36 or SEQ ID NO: 38; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the DUB12 segment; is a hybridization probe for a gene encoding the Dubl2 polypeptide; or the primate Nm-1: polypeptide is from a primate, including a human; or nucleic acid: encodes an antigenic I~7-1 peptide sequence of SEQ ID N0: 42; encodes a plurality of antigenic peptide sequences of SEQ ID NO: 42; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the 1~-1 segment; is a hybridization probe for a gene encoding the Dubl1 polypeptide; or the primate MD-2: polypeptide is from a human; or nucleic acid: encodes an antigenic 1~-2 peptide sequence of SEQ ID
NO: 44, or SEQ ID N0: 46; encodes a plurality of antigenic peptide sequences of SEQ ID NO: 44, or SEQ ID NO: 46; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the segment; is a hybridization probe for a gene encoding the primate Nm-2 polypeptide; or the rodent I~-2: polypeptide is from a mouse;
or nucleic acid: encodes an antigenic Nm-2 peptide sequence of SEQ
ID NO: 48, or SEQ ID NO: 49; encodes a plurality of antigenic peptide sequences of SEQ ID N0: 48, or SEQ ID NO: 49; exhibits identity over at least 25 nucleotides to a natural cDNA encoding the Nm-2 segment; or is a hybridization probe for a gene encoding the rodent I~-2 polypeptide. Other nucleic acid embodiments include the described, which: is an expression vector; further comprises an origin of replication; is from a natural source;
comprises a detectable label; comprises synthetic nucleotide sequence is less than 6 kb, preferably less than 3 kb; is from a SUBSTITUTE SHEET ( rule 26 ) primate, including a human; comprises a natural full length coding sequence; or is a PCR primer, PCR product, or mutagenesis primer.
Various cells are provided, including a cell or tissue comprising a described recombinant nucleic acid, including wherein 5 the cell is: a prokaryotic cell; a eukaryotic cell; a bacterial cell; a yeast cell; an insect cell; a mammalian cell; a mouse cell; a primate cell; or a human cell.
Kits are provided, e.g., comprising a described nucleic acid, and: a compartment comprising the nucleic acid; a compartment 10 comprising a nucleic acid encoding another chemokine, including HCC1, HCC2, HCC3, and HCC4; or instructions for use or disposal of reagents in the kit.
Alternative nucleic acids include those which: hybridize under wash conditions of 45° C and less than 2M salt to the 15 polypeptide coding portion of SEQ ID N0: 24; hybridize under wash conditions of 45° C and less than 2M salt to the polypeptide coding portions of SEQ ID NO: 31 or 33; hybridize under wash conditions of 45° C and less than 2M salt to the coding portions of SEQ ID NO: 35 or 37; hybridize under wash conditions of 45° C

20 and less than 2M salt to the coding portion of SEQ ID N0: 41;
hybridize under wash conditions of 45° C and less than 2M salt to the coding portion of SEQ ID NO: 43 or 45. or hybridize under wash conditions of 45° C and less than 2M salt to the coding portion of SEQ ID NO: 47. Preferably, the wash conditions are at 55° C
and/or 500 mM salt; or at 65° C and/or 150 mM salt.
Additionally, methods are provided, e.g., of modulating physiology or development of a cell or tissue culture cells comprising exposing the cell to an agonist or antagonist of HCC5, primate MD-1, primate Nm-2, or rodent MD-2. Others include methods of detecting specific binding to a compound, comprising:
contacting the compound to a composition selected from the group of: an antigen binding site which specifically binds to: an HCC5 chemokine; a Dubll; a Dubl2; a primate MD-1; a primate MD-2; a rodent MD-2; or an expression vector encoding: an HCCS chemokine or fragment thereof; a Dub:l1 or fragment thereof; a Dubl2 or.
fragment thereof; a primate Nm-1 or fragment thereof; a primate MD-2 or fragment thereof; or a rodent I~-2 or fragment thereof; a SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC1'/US99/12366 substantially pure protein which is specifically recognized by the antigen binding site of the described antigen binding sites; a substantially pure HCC5 chemokine or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of HCC5 chemokine sequence; a substantially pure Dubl1 or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of Dubll sequence; a substantially pure Dubl2 or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of Dubl1 sequence; a substantially, pure primate NIi~-1 or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of primate Nm-1 sequence; a substantially pure primate I~-2 or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of primate 1~.~-2 sequence; a substantially pure rodent Na7-2 or peptide thereof, or a fusion protein comprising a 30 amino acid sequence portion of rodent Nm-2 sequence; and then detecting binding of the compound to the composition.
Particular polynucleotide embodiments include an isolated or recombinant polynucleotide which: encodes at least 17 contiguous amino acid residues of SEQ ID NO: 54; encodes at least two distinct segments of at least 10 contiguous amino acid residues of SEQ ID NO 54; or comprises one or more segments at least 21 contiguous nucleotides of SEQ ID NO: 53. Such polynucleotides allow methods of making: a polypeptide comprising expressing a described expression vector, thereby producing the polypeptide; a duplex nucleic acid compri=>ing contacting a polynucleotide with a complementary nucleic acid, thereby resulting in production of the duplex nucleic acid; a synthetic polynucleotide, comprising chemically polymerizing nucleotides to produce the polynucleotide;
or a polynucleotide comprising using a PCR method.
Cyclin polypeptide embodiments include an isolated or recombinant antigenic polypeptide comprising at least: one segment comprising at least 17 contiguous amino acids from SEQ ID N0: 54;
or at least two distinct segments of at least 11 contiguous amino acids from SEQ ID N0: 54. Such polypeptide may: comprise at least one segment comprising at least 17 contiguous amino acids from SEQ
ID N0: 54; and exhibit at least two non-overlapping epitopes which SUBSTITUTE SHEET ( rule 26 ) are selective for primate protein of SEQ ID N0: 54. Other embodiments include those wherein the polypeptide: is a 5-fold or less substitution from a natural sequence; is a deletion or insertion variant from a natural sequence; or comprises at least two distinct segments of at least 11 contiguous amino acids from SEQ ID N0: 54. Preferably the polypeptide is antigenic, and will typically comprise at least one sequence from (SEQ ID N0: 54) KESRYVHD (residues 120-127), DKHFEVLH (residues 127-134), HSDLEPQM
(residues 134-141), QKDINKNM (residues 177-184), YAPKLQEF
(residues 203-210), SEEDI:GRM (residues 229-226), LRMELIIL
(residues 224-231), ELCPV'rII (residues 237-244), and LFLQVDAL
(residues 249-256); and/o:r the segments of at least 11 contiguous amino acids comprise one the segment with at least 14 contiguous amino acids from SEQ ID NO: 54. Such polypeptides may further exhibit at least two non-overlapping epitopes which are selective for primate protein of SEQ ID N0: 54; and/or may: comprise a mature sequence of SEQ ID NO: 2; bind with selectivity to an antibody generated against. an immunogen of SEQ ID NO: 54; comprise a plurality of polypeptide segments of 17 contiguous amino acids of SEQ ID NO: 54; or be a natural allelic variant of SEQ ID NO:
54. The polypeptide may: be in a sterile composition; have a length at least 30 amino acids; be not glycosylated; be denatured;
be a synthetic polypeptide; be attached to a solid substrate; or be a fusion protein with a detection or purification tag, including a FLAG, His6, or Ig sequence. Other embodiments include those wherein the polypeptide: is a 5-fold or less substitution from a natural sequence; or is a deletion or insertion variant from a natural sequence.
Various kits are provided, e.g., which comprise such polypeptides and instructions fox the use or disposal of the polypeptide or other reagents of the kit.
Methods are provided, e.g., to label the polypeptide, comprising labeling the polypeptide with a radioactive label; to separate the polypeptide from another polypeptide in a mixture, comprising running the mixture on a chromatography matrix, thereby separating the polypeptides; to identify a compound that binds selectively to the polypeptide, comprising incubating the compound SUBSTITUTE SHEET ( rule 26 ) with the polypeptide under appropriate conditions; thereby causing the component to bind to the polypeptide; to conjugate the polypeptide to a matrix, comprising derivatizing the polypeptide with a reactive reagent, and conjugating the polypeptide to the matrix; or inducing an antibody response to the polypeptide, comprising introducing the polypeptide as an antigen to an immune system, thereby inducing the response.
Binding compounds are provided, e.g., antibodies, comprising an antigen binding portion from an antibody which binds with selectivity to described polypeptides. Methods are made available for evaluating the selectivity of binding of a compound to cyclin E2, comprising contacting the compound to a recombinant cyclin E2 polypeptide and at least one other cyclin; and comparing binding of the compound to the cyclins.
SUBSTITUTE SHEET ( rule 26 ) DETAILED DESCRIPTION OF THE PREFERRED E1~ODIMENTS
All references cited herein are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
I. General It is to be understood that this invention is not limited to the particular compositions, methods, and techniques described herein, as such compositions, methods, and techniques may vary.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention which is to be limited by the appended claims.
As used herein, including the appended claims, singular forms of words such as "a," "an," and "the" include their corresponding plural referents unless the context clearly dictates otherwise.
Thus, e.g., reference to ".a polynucleotide" includes one or more different polynucleotides, reference to "a composition" includes one or more of such compositions, and reference to "a method"
includes reference to equivalent steps and methods known to a person of ordinary skill in the art, and so forth.
Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art t:.o which this invention belongs.
Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. Ali publications, patent applications, patents, and other references discussed above are provided for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate any such disclosure by virtue of its prior invention.
The present invention also provides amino acid sequences and DNA sequences encoding various mammalian proteins, e.g., which are polypeptides produced by selected cells. Among these proteins are SUBSTITUTE SHEET ( ruie 26 ) those which: mediate uptake of substrates, e.g., prostaglandin-like molecules, modulate or mediate, e.g., induce or prevent trafficking, proliferation, or differentiation of, interacting cells, or are intracellular proteins which are important in 5 various cellular processes, e.g., deubiquitination of proteins or cell cycle regulation.
The Prostaglandin-like Transporter (PGT) of the present invention is expressed particularly in antigen presenting cells of the immune system, e.g., dendri.tic cells. As such, the 10 transporter is designated a dendritic cell prostaglandin-like transporter (DC-PGT). Consequently, the DC-PGT of the present invention offers the mean~> to establish fundamental understanding on the role of PG influence on immune function.
The present invention provides DNA sequence encoding a 15 mammalian protein that exriibits structural features characteristic of functionally significar~t proteins, particularly which serve as organic anion transporters~. This family of organic anion transporters includes: the prostaglandin transporters of man (Lu, et al. (1996) ~. Clin. Invest. 98:1142-1149) and rat; organic 20 anion transporters in man and rat; brain digoxyin transporters and Matrin F/G of rat (Ranai, et al. (1995) Science 268:866-869).
Transporters of this family typically axe 12 transmembrane proteins of approximately 650 amino acids in length.
Characteristic of this group of proteins is a cysteine rich region 25 located in one of the extracellular loops, which resembles a zinc finger motif. It is not entirely certain whether these polypeptides mediate primarily the influx or efflux of prostaglandins and organic anions, and they may, under different circumstances produce influx or efflux depending, e.g., on the intracellular concentration of the organic anions concerned.
The DC PGT protein of the present invention is closest in homology to the prostaglandin transporters and it is probable that a prostaglandin is the major anion transported. The human gene embodiment described herein, isolated as designate DC-PGT or clone 240, contains an open reading frame encoding a presumptive protein of about 709 amino acids. 'This protein exhibits intracellular, transmembrane, and extracellular protein segments, revealing novel SUBSTITUTE SHEET ( rule 2b ) aspects of organic anion transport that may be relevant during mamnnalian development, e.g., development of dendritic cells of the immune system.
The introduction of evolutionary information in the form of sequence homologs simplifies the structural analysis considerably for related molecules which share a common structural framework in spite of considerable sequence divergence, see, e.g., Chothia and Lesk (1986) EMBO J. 5:823-826. This concept can be effectively extended to the strong prediction of TM regions across an aligned protein family, whereas any single sequence may provide an uncertain topology. See Persson and Argos (1994) J. Mol. Biol 237:182-192; and Rost, et al. (1995) Protein Sci. 4:521-533. For the DC PGT, a number of sequence homologs were first assembled by comparative matching to protein and translated nucleotide databases (Altschul, et al. (1994) Nature Genet 6:119-129;
Koonin, et al. (1994) F,~BO ~ 13:493-503). These relatives of DC-PGT include a ubiquitously expressed PGT from primate, e.g., human (GenBank: locus HSU70867, accession U70867), and a PGT from rodent, e.g., rat (prostaglandin transporter - rat, GenBank Acc.
:~To. 1083766; Kanai, et al. (1995) Science 268:866-869). These sequences were subjected to parallel analyses by a suite of ~~omputer programs that have greatly improved on the initial :Kyte ,end Doolittle (1982) hydropathic profile as a means of predicting the topology of integral membrane proteins. Four algorithms (ALOM, MTOP, MEMSAT and TopPredII) (Klein, et al. (1985) Biochim.
]3ionhys. Acta 815:468-476; Hartmann, et al. (1989) Proc. Nat'1 ~~cad. Sci. USA 86:5786-5790; Jones, et al. (1994) Biochem.
:33:3038-3049; and Claros and von Heijne (1994) Comp. Applic.
~3iosci. 10:685-686) were used to individually predict TM
extensions and orientations; these predictions were pooled and mapped onto the multiple sequence alignment produced by ClustalW
~~nd MACAW (Thompson, et al. (1994) Nucl Acids Res 22:4673-4680;
and Schuler, et al. (1991) Proteins 9:180-190). Furthermore,.
i:hese multiply aligned sequence files were used as input to PHD
and TMAP (Rost, et al. (1995) Protein Sci. 4:521-533; Persson and ~~rgos (1994) J. Mol. Biol. 237:182-192) for a familial prediction SUBSTITUTE SHEET ( rule 26 ) wo ooio~sm Pcrms99n~s of shared TM regions. Structural features that persisted in this two-step analysis are likely to be shared topological traits present in all members of: this organic anion transporter family.
HDTEA84, HSLJD37R, and RANKL genes and proteins are also provided, which are related to the TNF signaling pathways. The antigens HDTEA84, HSLJD3i'R, and RANKL, and fragments, or antagonists will be useful. in physiological modulation of cells expressing receptors for, e.g., ligands of the TNF family. Some of these antigens appear to lack a membrane spanning segment, suggesting that they are soluble forms of receptor. This suggests that the soluble proteins can serve as antagonists o~ the TNF-like ligands. In addition, it is likely that membrane spanning forms exist, which sexve as signaling receptors mediating cellular response to the ligands.
The HDTEA84 gene has. been detected in cDNA libraries derived form Hodgkin's lymphoma, endothelial cells, keratinocytes, prostrate, and cerebellum.. It exhibits significant sequence similarity to the osteoprotegerin ligand receptor reported by Lacey, et al. (1998) Cell 93:165-176. The HDTEA84 will likely modulate proliferation or development by antagonizing its respective ligand. Membrane associated forms should exist, likely alternatively spliced transcription products.
The HSLJD37R exhibits like similarity to receptors for TNF.
While the first embodiment is an incomplete sequence, the available portion currently lacks an identified transmembrane segment. Additional efforts provide a full length sequence, and an alternative splice variant.
The rodent 427152#4 Rank-like (RANKL) was detected in a rodent cDNA library panel probed with Mouse 427152#4 (204 bp).
Positive signals were detected in CH12 (B cell line); rag-1 thymus; rag-1 heart; rag-1 brain (best signal); rag-1 testes; rag-1 liver; normal lung; rag-1 lung; asthmatic lung; tolerized and challenged lung; Nippo-infected lung; Nippo IL-4 K.O. lung; Nippo anti-IL-5 treated lung; influenza lung; guinea pig allergic lung;
w.t. stomach; and w.t. colon on a 3 day exposure at -80° C with an intensiyier screen. On a 2 week exposure at -80° C with screen, signals were also detected in the following libraries: Me114+
SUBSTITUTE SHEET ( ruie 26 ) wo ooioism pcr~s~nz~ss naive; Me114+ Thl; Me114+ Th2; Thl 3 week B1/6; large B cell;
bEnd3 + TNFa + IL-10, guinea pig normal lung; and Rag Hh- colon.
The primate, e.g., human, Rank-like (RANKL) homologs of rodent 427152#4 were detected in a human cDNA library panel probed with mouse 427152#4 (204 bp). Signals were detected in monkey asthma lung 4 h (1.6-2.0 kb) and adult placenta (2.5-3.0 kb) on a 3 day exposure at -80° C with screen. On a 2 week exposure at -80° C with screen, signals were also detected in the following libraries: CDla+ 95~ DC activated CHA (kidney epithelial carcinoma cell line); monkey lung normal; psoriasis skin; fetal lung; fetal ovary; fetal testes; and fetal spleen.
Each of these proteins will also be useful as antigens, e.g., immunogens, for raising antibodies to various epitopes on the protein, linear and/or conformational epitopes. The molecules may be useful in defining various cell subsets, either by the molecules produced by, oz- by expression of membrane forms of the receptors. Such cells should be responsive to the respective ligands. Soluble forms of. the receptors should serve as antagonists of the ligand, binding to the ligand and preventing interaction with membrane' forms, which would mediate signaling.
Both genes express proteins which exhibit structural motifs characteristic of a member of the TNF receptor family. SEQ ID NO: 5 and SEQ ID NO: 6, respectively, provide the nucleic acid and predicted amino acid sec~aences for primate, e.g., human, HDTEA84.
SEQ ID NO: 7 and SEQ ID N0: 8, respectively, provide the nucleic acid and predicted amino acid sequences for primate, e.g., human, HSLJD37R.
Interesting features of the HDTEA84 include: signal sequence from about 1-11; TNF receptor Cys rich domains I (about 32-72), II
(about 73-113), III (about 114-150), and IV (about 151-293); and unique region from about 194-300. Features for the HSLJD37R (SEQ
ID NO: 10 form), partly based on alignment with HDTEA84: signal sequence from about 1-41; TNF receptor Cys rich domains I (about 42-90), II (about 91-131), III (about 132-168), and IV (about 169-211); transmembrane segment from about 354-370. Similar alignment of the other variants will identify similar features. Segments including combinations or excluding such segments may be desired.
SUBSTITZ1TE SHEET ( rule 26 ) WO 00/01817 PC'TIUS99/12366 The structural homology of HDTEA84, HSLJD37R, and RANKL to members of the TNF receptor family suggests related function of these molecules. See, e.g., Lacey, et a1. (1998) dell 93:165-176.
The sequences, however, mostly lack a transmembrane segment, ' 5 suggesting that the proteins are soluble receptor forms. They may well also have membrane bound forms resulting, e.g., from alternatively spliced transcript variants. The soluble forms are likely to be antagonists of the ligand, e.g., blocking the binding of ligand to a membrane bound form of signaling receptor. Thus, these molecules may be useful in the treatment of abnormal immune or developmental disorders.
The natural antigens should be capable of modulating various biochemical responses whi<:h lead to biological or physiological responses in target cells. The embodiments characterized herein are from primate, e.g., htunan, but other species variants almost surely exist, e.g., rodenta, etc. See below. The descriptions below are directed, for e~:emplary purposes, to primate HDTEA84, HSLJD37R, or RANKL, but are likewise applicable to related embodiments from other species.
The HDTEA84, HSLJD37R, and RANKL clones were assembled through the careful analysis of ESTs present in various databases, e.g., Merck-WashU public database. These genes exhibit structural motifs characteristic of a. member of the TNF receptor family.
Compare, e.g., with the TNF receptor, NGF-receptor, and FAS
receptor. Table 3 discloses the nucleic acid and predicted amino acid sequences for primate, e.g., human, HDTEA84. The ESTs were identified from several different libraries.
SEQ ID N0: 7 AND SEQ ID N0: 8, respectively, disclose partial nucleic acid and predicted amino acid sequences for primate, e.g., human, HSLJD37R. The ESTs were identified from several different libraries derived from: smooth muscle, pancreas tumor, adipocytes, HUVEC cells, adult pulmonary, endothelial cells, prostate cell line PC3, microvascular endothelial cells, fetal heart, and dendritic cells. Other sequences were detected in libraries from:
multiple sclerosis lesions, breast, kidney, and germinal center B
cells.
SUBSTITUTE SHEET ( rule 2b ) SEQ ID NO: 16, SEQ .CD N0: 18, SEQ ID NO: 20 and SEQ ID NO: 22 provide the sequences of various mammalian genes designated RANKL.
Interesting feature: of the rodent RANKL include: signal sequence from about 1-29; TNF receptor Cys rich domain I (about 5 33-74), II (about 75-114), and III (about 115-135). Interesting features of the primate RANKI, include: TNF receptor Cys rich domain I (about 1-43), II (about 44-83), and III (about 84-104);
transmembrane segment from about 139-155. Alignment with other TNF receptors will identify additional interesting corresponding 10 features. Segments with boundaries at these positions may be especially interesting.
Hybridization signals with RANKL were detected with rodent, e.g., mouse sequence, in CH12 (B cell line), rag-1 thymus, rag-1 heart, rag-1 brain (strongest signal), rag-1 testes, rag-1 liver, 15 normal lung, rag-1 lung, .asthmatic lung, tolerized and challenged lung, Nippo-infected lung, Nippo IL-4 K.O. lung, Nippo anti-IL-5 lung, influenza lung, guinea pig allergic lung, w.t. stomach, and w.t. colon on a 3 day exposure at -80° C with a screen. On a 2 week exposure at -80° C vuith screen, signals were also detected 20 in the following libraries: Mel 14+ naive, Me114+ Thl, Me114+ Th2, Th1 3 week B1/6, large B cell, bEnd3 + TNFot + IL-10, guinea pig normal lung, and Rag Hh- r_olon. Probes of human libraries with rodent sequence provided: detectable signals in Monkey asthma lung 4 h (1.6-2.0 kb) and adult placenta (2.5-3.0 kb) on a 3 day 25 exposure at -80° C with :screen. On a 2 week exposure at --80° C
with screen, signals were also detected in the following libraries: CDla+ 95~ DC activated, CHA (kidney epithelial carcinoma cell line), monkey lung normal, psoriasis skin, fetal lung, fetal ovary, fetal testes, and fetal spleen.

30 In another embodiment:, the invention provides a chemokine.
For a review of the chemolc:ine family, see, e.g., Lodi, et al.
(1994) Science 263:1762-1i'67; Gronenborn and Clore (1991) protein Enaineerincr 4:263-269; Miller and Kranger (1992) Froc. Nat~l Acad Sci. USA 89:2950-2954; Mataushima and Oppenheim (1989) Cytokine 1:2-13; Stoeckle and Baker (1990) New Biol. 2:313-323; Oppenheim, et al. (1991) Ann. Rev. Immunol 9:617-648; Schall (1991) ~rtokine SUBSTITUTE SHEET ( rule 26 ) 3:165-183; and Thomson (ed. 1994) The Cvtokine HancLbook 2d ed.
Academic Press, NY.
The new chemokine described herein is designated HCC5 which is a CC chemokine. See SEQ ID NO: 24 and SEQ ID NO: 25. The descriptions are directed,, for exemplary purposes, to the human HCC5 natural allele described, but are likewise applicable to allelic and/or polymorphic variants, e.g., from other individuals, as well as splicing variants, e.g., natural forms. Based on sequence analysis of the c:hemokine protein sequences described below, it is apparent that: HCC5 belongs to the CC chemokine family. See, e.g., stem cell mobilizing chemokine (CKbeta-1) from Kreider, et al. (1997) Patient WO 9715594 (SEQ ID NO: 26) and GenBank Accession number 97P-W17659; macrophage inflammatory protein-1-gamma (MIP-1) from Adams, et al. (1995) Patent WO
9517092 (SEQ ID N0: 27) and GenBank Accession number 95P-876128;
human MIP-4, a chemoattractant for leukocytes from Adams, et al.
(1997) Patent WO 9634891 (SEQ ID NO: 28) and GenBank Accession number 96P-W07203; pituitary expressed chemokine (PGEC) from Bandman, et al., Patent WO 9616979 (SEQ ID NO: 29) and GenBank Accession number 96P-895691; and human chemokine HCC-1 from Forsmann, et al. (1998) Patent WO 9741230 (SEQ ID NO: 30) and GenBank Accession number 97P-W38171.
The HCC5 chemokine was discovered through searches and careful analysis of database sequences. The HCC5 sequence was discovered in a cDNA library from pooled bulk breast tumor tissue.
Absence of overlapping sequences from other sources suggests extremely specific tissue .expression, or highly regulated expression. Amino acid homology analysis suggests that the HCC5 gene encodes a member of a group of related family of chemokines.
The primate, e.g., human, HCC5 chemokine is most closely related in sequence to the chemokines, human chemokine HCC1; human pituitary expressed chemok:ine (PGEC); human MIP-4 (a chemoattractant for leukocytes); human macrophage inflammatory protein-1-gamma (MIP-1y); and human stem cell mobilizing chemokine (CKbeta-1).
The HCC5 chemokine is seemingly specifically expressed, since its sequence has not appeared from many sources. The structural SUBSTITUTE SHEET ( ruie 26 ) similarity to other chemokines suggests that signals important in inflammation, cell differentiation, and development are mediated by it.
It is possible that the HCCS may actually be an antagonist of one, some, or all, of many related chemokines. In such case, combination compositions may be desired. For example, a combined group of functional agonists and antagonists for specific receptors may be called for, e.g., a combination of chemokines and antibody antagonists of others. In addition, HCC5 may be useful to block HIV or HTLV infection, which viruses may use the respective receptors for ~_nfection.
The HCC5 chemokine exhibits limited similarity to portions of known chemokines. See, e.g., Matsushima and Oppenheim (1989) Cytokine 1:2-13; Oppenheim, et al. (1991) Ann. Rev. Immunol_ 9:617-648; Schall (1991) ~'ytokine 3:165-183; and Gronenborn and Clore (1991) Protein Enqir~eerincr 4:263-269. Other features of comparison are apparent between the HCCS chemokine and chemokine families. See, e.g., Lodi, et al. (1994) Science 263:1762-1766.
In particular, (3-sheet and. a-helix residues can be determined using, e.g., RASMOL program, see Sayle and Milner-White (1995) TIBS 20:374-376; or Gronenberg, et al. (1991) Protein Enaineerina 4:263-269; and other structural features are defined in Lodi, et al. (1994) Science 263:1762-1767. These secondary and tertiary features assist in defining further the C, CC, CXC, and CX3C
structural features, along with spacing of appropriate cysteine residues.
Antagonists might be created by N-terminal modification, e.g., either truncation of addition of an N-terminal methionine.
Since HCCS is structurally related to the HCC chemokines, it may well exhibit similar behaviors and functions.
The distribution of the HCC5 chemokines, especially in dendritic cells, or in Thl T cells, B cells, and macrophages, suggest roles in immune functions, e.g., it will likely attract T
cells and monocytes.. Thus, the HCCS chemokine is likely to recruit these cell types in vivo, thereby enhancing the immune response mediated by these cell types. The expression patterns SUBSTITUTE SHEET ( rule 2G ) appear consistent with a functional importance of the ligands in a TH1/TH2 regulation and/or response, including, e.g., in a cancer therapy. Thus, ligands and homologs are identified as possible immune adjuvants, e.g., for cellular responses, but also as possible adjuvants to modulate soluble antigen responses, e.g., vaccines.
The invention further provides mammalian, e.g., primate, DNA
sequences encoding proteins which exhibit structural properties of likely intracellular deubiquitinating protein enzymes. These proteins are designated deubiqutinating 11 (Dubl1) and deubiqutinating 12 (Dubl2). For a review of the superfamily of deubiquitinating enzymes see, e.g., Hochstrasser (1995) Curr.
Qpin. Cell Biol. 7:215-229; Wilkinson, et al. (1995) Biochemistry 34:14535-14546; Baker, et al. (1992) J. Biol. Chem. 267:23364-23375; and Papa and Hochstrasser (1993) Nature 366:313-319.
However, the deubiquitinat:ing enzymes have also been reported to have additional functions besides deubiquitination. See, e.g., Hochstrasser (1996) Cell 84:813-815; Hicke and Riezman (1996) Cell 84:277-287; and Chen, et al. (1996) Cell 84:853-862.
The descriptions typically are directed, for exemplary purposes, to the human Dubl1 and human Dubl2 natural alleles described, but are likewise applicable to allelic and/or polymorphic variants, e.g., from other individuals, as well as splicing variants, e.g., natural forms, and species variants from other primates or other species. These genes will allow isolation of other primate genes encoding proteins related to this, further extending the family beyond the specific embodiments described.
The Dubl1 or Dubl2 proteins (naturally occurring or recombinant), fragments thereof, and antibodies thereto, along with compounds identified as having binding affinity to Dubll or Dubl2, may be useful in the treatment of conditions associated with abnormal physiology or development, such as, e.g., uterine carcinoma associated with p53 dysregulation associated with human papilloma virus or mental retardation of Angelman syndrome (AS) due to disruption of the 5' end of the UBE3A (E6-AP) gene which codes for a disubiquitination protein. Pharmacological intervention which alters the half-lives of cellular proteins SUBSTITUTE SHEET ( rule 26 ) associated with these diseases may have wide therapeutic potential. Specifically, prevention of p53 ubiquitination (and subsequent degradation) in human papilloma virus positive tumors, and perhaps all tumors ret:aining wild-type p53 but lacking the retinoblastoma gene function, could lead to programmed cell death.
Additionally, specific inhibitors of p27 and cyclin B
ubiquitination are predicted to be potent antiproliferative agents. Inhibitors of IkappaB ubiquitination should prevent NFkappaB activation and may have utility in a variety of autoimmune and inflammatory conditions. Finally, deubiquitination enzymes may be novel, potential drug targets as they also appear to regulate cell proliferation. These conditions or disease states may be modulated by appropriate therapeutic treatment using the deubiquitination compositions provided herein.
Conversely, methods for blocking the enzymatic activities should have the opposite effects. Small molecule drug screening to block enzymatic activity of the protein can be performed to identify entities which will block the deubiquitination, thereby affecting protein degradation pathways, as appropriate.
The T cell growth factor interleukin-2 (IL-2) regulates lymphocyte proliferation by inducing the expression of growth promoting genes. HTLV-1 transformed cell lines derived from Adult T-cell Leukemia (ATL) can exhibit constitutive activation of the IL-2-induced JAK/STAT pathway. See Migone, et al. (1998) Proc.
Wit' ,Acad. Sci. USA 95:3845-3850. ATL cell lines were examined for expression of IL-2 induced genes. It was found that the deubiquitinating enzyme Du:b2 is constitutively expressed. See Zhu, et al. (1997) J. Biol. Chem. 272:51-57. Moreover, Dub2 expression conferred cytokine-independent proliferation on the interleukin-3-dependent mu:rine Ba/F3 hematopoietic cell line.
SCID mice (n = 18) subcutaneously injected with Ba/F3 cells expressing Dub2, (but not a C to S inactive mutant of Dub2) developed tumors with a six week latency. Cells derived from these tumors exhibited constitutive tyrosine phosphorylation of STAT5 and also mimicked the ATL cell lines by exhibiting down-regulation of the protein tyrosine phosphatase SHP-1. These findings strongly indicate that Dubl2 is an oncogene that, when SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCT/US99/i2366 constitutively expressed, can induce cytokine-independent growth in lymphocytes and may be implicated in leukemogenesis. It is likely that Dub2 controls cell growth by regulating the ubiquitin-dependent proteolysis or the ubiquitin-dependent state of a 5 critical intracellular substrate. Functional similarity of the Dubl1 and Dubl2 would be expected. Thus, the biological rale of Dub2 suggests similar important roles for the other Dub family members.
Screening for inhibitors of the DUB enzymes can also be 10 easily accomplished using the known assays for activity. Such assays can be developed into high throughput screening efforts, testing, particularly, cornpounds known to affect protein turnover, or similar enzymatic sites. Small molecule antagonists of the enzymes, which will be membrane permeable, would be particularly 15 desirable therapeutically.
In the MD embodiment: of the present invention, mammalian, e.g., primate, and rodent, e.g., mouse, DNA sequences are provided encoding proteins which e~;hibit structural properties of ligands for proteins exhibiting a leucine-rich protein motif (LRR) that is 20 important, e.g., in immune' function. These proteins are designated herein human MD-1, human MD-2, and murine MD-2. The human MD-1 is a primate homolog of the previously described rodent MD-1, see, e.g., Miyake, eat al. (1998) J. Immunol. 161:1348-7_353, while human MD-2 and mouse MD-2 are newly discovered MD-1 homolog.
25 For a general review of LRR proteins, see, e.g., Kobe and Deisenhofer (1994) Trends Biochem. Sci. 19:412. For the role of LRR in specific immune defenses, see, e.g., Jones, et al. (1994) Science 266:789; Dixon, et al. (1996) dell 84:451; and Baker, et al. (1997) Sc.'ence 276:726.
30 Similar sequences for' proteins in other species should also be available. The descriptions below are directed, for exemplary purposes, to the primate, e.g., human, MD-1 and MD-2, and rodent, e.g., mouse, MD-2 natural alleles described, but are likewise applicable to allelic and/or polymorphic variants, e.g., from 35 other individuals, as well as splicing variants, e.g., natural forms, and species variants.
SUBSTITUTE SHEET ( ruie 26 ) The MD-1 or MD-2 proteins (naturally occurring or recombinant), fragments truereof, and antibodies thereto, along with compounds identified as having binding affinity to MD-1 or MD-2, should be useful in the treatment of conditions associated with abnormal physiology or development, such as, e.g., the recognition of specific pathogenic molecules and the activation of B cell physiology. As indicated above, MD-1 and MD-2 exhibit structural motifs characteristic of ligands for the RP105 or BAS-1 surface receptors. Thus, soluble forms, antibodies, or small molecule drugs which disrupt intercellular signaling mediated by these receptors, will find use in modulating cellular response.
These responses will be important in normal or abnormal clinical situations.
The matching of the MD and RP105 may also be easily tested.
Identification of the counter receptor for the Nm-2 may include testing both the RP105 and BAS-1 genes, along with other screening methods, as described. The likely counter receptor structure for the MDs are RP105, BAS-I, and related genes. Associated proteins which bind to these, including the DUB proteins, may be identified using these techniques, among others.
Another aspect of the invention provides members of the cyclin proteins. The cycl:ins and their partner catalytic subunits, the cyclin-dependent kinases (Cdks), play key roles in the regulation of eukaryot:ic cell cycle events. See, e.g., Draetta (1994) Curr. Opin. Cell Biol. 6:842-846; Sherr (1994) Cell 79:551-555; and Ohtsubo, et al. (1995) Mol. Cell. Biol 15:2612-2624. Cyclins were first identified in marine invertebrates on the basis of their dramatic cell cycle periodic expression during meiotic and mitotic divisions.
A large family of cyc:lins, designated cyclins A-H, bind and activate different Cdks which are serine/threonine kinases essential for cell cycle progression. The timing of the expression of the various cyclins is key in determining at which phase of the cell cycle (S,. Gp, G1, or G2) their associated Cdk is active. D-type cyclins are synthesized early in G1 and bind and activate CDK4 and CDK6. Cyclin E-Cdk2 and Cyclin A-Cdk2 complexes form later in G1 as cells prepare to begin DNA synthesis. Cyclin SUBSTITUTE SHEET ( rule 26 ) B-cdc2 is active during G;2 and mitosis. See, e.g., Lees (1995) Curr. Opin Cell Biol 7:'773-780.
Other Cyclin-Cdk complex associated proteins are critical for modulation of cyclin activity. Proteins that co-y immunoprecipitated with cyclin E were visualized by SDS-PAGE.
However, viability of the cyclin E "knockout" mouse, suggested the existence of redundancy. Moreover, work in other species also suggested that a homolog might exist in human.
Cdks can also exert control on cell division and proliferation by phosphorylating specific intracellular target proteins. This phosphory7_ation event can induce the cellular transition from the G1 to the S phase of the cell cycle. See, e.g., Strahler, et al. (1992) Biochem Biophys Res Comm 185:197-203; Brattsand, et: al. (1994) Eur. J. Biochem 220:359-368; and Li, et al. (1996) Cell 85:319-329. Regulation of the cell cycle machinery is important in development and control of cellular proliferation. Misregulation may lead to proliferative disorders, e.g., neoplastic conditions and cancer. See, e.g., Sherr (1998) Science 274:1672-1677.
The novel cyclin gene, designated cyclin E2, exhibits about 49~ structural identity to the known human cyclin E. See, e.g., Lew, et al. (1991) Cell 66:1197-1206; and NCBI Entrez accession number M74093. The new variant cyclin E2 sequences are provided in SEQ ID NO: 52 and SEQ ID N0: 53. Notable features on the E2 sequence include the cyclin box running from about residue 120-254; and a putative phosphorylation site at thr392. The phosphorylation site is trigger in cyclin E for ubiquitin dependent degradation. See Clurman, et al. (1996) Genes and Development 10:2979-1990. Particularly interesting segments include, e.g., from about 93-100; 98-106; 104-113; 107-121; 120-128; 124-134; 131-137; 172-177; 176-185; 189-193; 196-202; 200-210; 218-223; 228-232; 236-242; 240-245; and 248-252.
The structural homology of these genes to identified families suggests related function of these molecules. For example, PGT
homologs should function in transport across cell membranes; TNF
receptor family antagonists, or agonists, may act as a co-SUBSTITUTE SHEET ( rule 26 ) stimulatory molecule for :regulation of T cell mediated cell activation, and may in fact, cause a shift of T helper cell types, e.g., between Thl and Th2; chemokines have recognized functional properties; intracellular Dubs have been described and the role in oncogenesis established; membrane associated or soluble forms of signaling proteins such as the MDs are well known; and the role of cyclins in cell cycle regulation are recognized. Alternatively, the ligands or binding structures for the cell surface antigens may serve to regulate cell proliferation or development.
For the TNF ligand molecules, they typically modulate cell proliferation, viability, and differentiation. For example, TNF
and FAS can kill cells expressing their respective receptors, including fibroblasts, liver cells, and lymphocytes. Some members of this class of ligands exhibit effects on cellular proliferation of cells expressing their respective receptors, e.g., B cells expressing CD40. These effects on proliferation may also effect subsequent differentiation steps, and may lead, directly or indirectly, to changes in cytokine expression profiles.
The members of the TNF ligand family also exhibit costimulation effects, which may also regulate cellular differentiation or apoptosis. Receptor expressing cells may be protected from activation induced cell death (AICD) or apoptosis.
For example, CD40 ligand can have effects on T and B lymphocytes.
The embodiments characterized herein are mostly from human, but additional sequences for proteins in other mammalian species, e.g., primates and rodents, will also be available. See below.
In particular, with the polypeptide sequences provided, reverse translation, e.g., using the genetic code, software is available, which will indicate what nucleic acid sequences could encode them.
See, e.g., MacVector, Oxford Molecular Group Software. Thus, artificial genes, or redundant oligonucleotides may be selected to isolate natural variants or species counterparts.
II. Purified Protein Primate, e.g., human, DC-PGT polypeptide sequence is shown in SEQ ID N0: 2; primate, e.g., human, HDTEA84 polypeptide sequence is shown in SEQ ID NO: 6; ;primate, e.g., human, HSLJD37R
SUBSTITUTE SHEET ( rule Zb ) polypeptide sequences are shown in SEQ ID NO: 8, 10, and 12;
rodent, e.g., murine, RAN~L polypeptide sequence is shown in SEQ
ID NO: 17; primate forms of RANKL polypeptide sequence are shown in SEQ ID N0: 19, 21, and 23; primate, e.g., human, HCC5 chemokine polypeptide sequence is shown in SEQ ID NO: 25; primate, e.g., human, Dubl1 polypeptide :sequences are shown in SEQ ID NO: 32 and 34; primate, e.g., human, Dubl2 polypeptide sequences are shown in SEQ ID NO: 36 and 38; primate, e.g., human, MD-1 polypeptide sequence is shown in SEQ 7.D N0: 42; primate, e.g., human, MD-2 polypeptide sequence is shown in SEQ ID NO: 44 and 46; rodent, e.g., mouse, MD-2 polypeptide sequences are shown in SEQ ID NO: 48 and 49; and primate, e.g., human, cyclin E2 is shown in SEQ ID NO:
54.
These amino acid sequences, provided amino to carboxy, are important in providing sequence information in the antigen allowing for distinguishing the protein from other proteins and exemplifying numerous variants. Moreover, the peptide sequences allow preparation of peptides to generate antibodies to recognize such segments, and nucleotide sequences allow preparation of oligonucleotide probes, both of which are strategies for detection or isolation, e.g., cloning, of genes or cDNAs encoding such sequences.
The purified protein, or proteins will typically comprise a plurality of distinct, e.g., nonoverlapping, segments of the specified length. Typically, the plurality will be at least two, more usually at least three, and preferably 5, 7, or even mare.
While the length minima are provided, longer lengths, of various sizes, may be appropriate, e.g., one of length 7, and two of length 12. Such peptides are useful for generating antibodies by standard methods, as described herein. Synthetic peptides or purified protein can be presented to an immune system to generate a specific binding composition, e.g., monoclonal or polyclonal antibodies. See, e.g., Coligan (1991) current Protocols in Immunology Wiley/Greene; and Harlow and Lane (Current ed.) Axa,tibodies: A Laboratorv M nua Cold Spring Harbor Press.
For example, the specific binding composition could be used for screening of an expression library made from a cell line which SUBSTITUTE SHEET ( rule 26 ) expresses a clone encoding, e.g., a prostaglandin transporter.
The screening can be standard staining of surface expressed protein, or by panning. Screening of intracellular expression can also be performed by various staining or immunofluorescence 5 procedures. The binding compositions could be used to affinity purify or sort out cells a_xpressing the protein. The binding compositions may also be useful in determining qualitative and quantitative expression levels of the proteins in various biological samples, including, e.g., cell types or tissues.
10 As used herein, the term, e.g., "human DC-PGT", shall encompass, when used in a protein context, a protein having amino acid sequence shown in SE(~ ID NO: 2. Significant polypeptide fragments of such a protein should preserve some of the properties, biological or physical, of the full length protein.
15 Other essentially identical or equivalent proteins may be found in other primates or related species. In addition, binding components, e.g., antibodies, typically bind to, e.g., a DC-PGT, with high affinity, e.g., at least about 100 nM, usually better than about 30 nM, preferably better than about IO nM, and more 20 preferably at better than about 3 nM. Homologous proteins would be found in mammalian species other than human, e.g., primates or rodents. Non-mammalian species should also possess structurally or functionally related genes and proteins, e.g., birds or amphibians. Similar meanings apply in reference to HDTEA84, 25 HSLJD37R, RANKL, HCCS, Dubll, Dubl2, Na7-2, Nm-2, and cyclin E2.
The term polypeptide, as used herein, includes a significant fragment or segment, and encompasses a stretch of amino acid residues of at least about 8 amino acids, generally at least 10 amino acids, more generally at least 12 amino acids, often at 30 least 14 amino acids, more often at least 16 amino acids, typically at least 18 amino acids, more typically at least 20 amino acids, usually at least 22 amino acids, more usually at least 24 amino acids, preferably at least 26 amino acids, more preferably at least 28 amino acids, and, in particularly preferred 35 embodiments, at least about 30 or more amino acids. The segments may have lengths of at least 37, 45, 53, 61, 70, 80, 90, etc., and often will encompass a plurality of such matching sequences. The SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 specific ends of such a segment will be at any combinations within the protein. In certain embodiments, there will be a plurality of distinct, e.g., nonoverlapping, segments of the specified length.
Typically, the plurality will be at least two, more usually at least three, and preferably 5, 7, or even more. While the length minima are provided, longa_r lengths, of various sizes, may be appropriate, e.g., one of length 7, and two of length 12.
The term "binding composition" refers to molecules that bind with specificity to the respective protein or polypeptide, e.g., DC-PGT, e.g., in a cell adhesion pairing type fashion, or an antibody-antigen interaction. Other compounds include, e.g.;
proteins, which specifically associate with DC-PGT, including in a natural physiologically rE~levant protein-protein interaction, either covalent or non-covalent. The molecule may be a polymer, or chemical reagent. A functional analog may be an antigen with structural modifications, or it may be a molecule which has a molecular shape which interacts with the appropriate binding determinants. The compounds may serve as agonists or antagonists of the binding interaction, see, e.g., Goodman, et al. (eds. 1990) Goodman & Gilman's~ The yharmacoloaical Bases of Therapeutics (8th ed.) Pergamon Press.
Substantially pure, in the polypeptide context, typically means that the protein is free from other contaminating proteins, nucleic acids, and other biologicals derived from the original source organism or cell. Purity may be assayed by standard methods, and will ordinarily be at least about 40~ pure, more ordinarily at least about 50g pure, generally at least about 60~
pure, more generally at least about 70~ pure, often at least about 75~ pure, more often at least about 80~ pure, typically at least about 85~ pure, more typically at least about 90~ pure, preferably at least about 95~ pure, more preferably at least about 98~ pure, and in most preferred embodiments, at least 99~ pure. The analysis may be weight or molar percentages, evaluated, e.g., by gel staining, spectrophotometry, or terminus labeling. Carriers or excipients will often be subsequently added.
Solubility of a polypeptide or fragment depends upon the environment and the polypeptide. Many parameters affect SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCT/fJS99/12366 polypeptide solubility, including temperature, electrolyte environment, size and molE~cular characteristics of the polypeptide, and nature of: the solvent. Typically, the temperature at which the polypeptide is used ranges from about 4°
C to about 65° C. Usually the temperature at use is greater than about 18° C. For diagnostic purposes, the temperature will usually be about room temperature or warmer, but less than the denaturation temperature of components in the assay. For therapeutic purposes, the temperature will usually be body temperature, typically about 37° C for humans and mice, though under certain situations the temperature may be raised or lowered in situ or in vitro.
The size and structure of the polypeptide should generally be in a substantially stable state, and usually not in a denatured state. The polypeptide may be associated with other polypeptides in a quaternary structure, e.g., to confer solubility, or associated with lipids or .detergents in a manner which approximates natural lipid bilayer interactions.
The solvent and electrolytes will usually be a biologically compatible buffer, of a type used for preservation of biological activities, and will usually approximate a physiological aqueous solvent. Usually the solvent will have a neutral pH, typically between about 5 and 10, and preferably about 7.5. On some occasions, one or more detergents will be added, typically a mild non-denaturing one, e.g., CHS (cholesteryl hemisuccinate) or CHAPS
(3-[3-cholamidopropyl)dimethylammonio]-1-propane sulfonate), or a low enough concentration as to avoid significant disruption of structural or physiological properties of the protein.
Solubility is reflecta_d by sedimentation measured in Svedberg units, which are a measure of the sedimentation velocity of a molecule under particular conditions. The determination of the sedimentation velocity was classically performed in an analytical ultracentrifuge, but is typically now performed in a standard ultracentrifuge. See, Freifelder (1982) Physical Biochemistry (2d ed.), W.H. Freeman; and Cantor and Schimmel (1980) Biophysical Chemistry, parts 1-3, W.H. Freeman & Ca., San Francisco; each of which is hereby incorporated herein by reference. As a crude SUBSTITUTE SHEET ( rule 26 ) determination, a sample containing a putatively soluble polypeptide is spun in a standard full sized ultracentrifuge at about 50K rpm for about 10 minutes, and soluble molecules will remain in the supernatant. A soluble particle or polypeptide will typically be less than about 30S, more typically less than about 15S, usually less than about lOS, more usually less than about 6S, and, in particular embodiments, preferably less than about 4S, and more preferably less than about 3S.
The human complimentary DNA and deduced amino acid sequence provided here for DC-PGT contains sequences corresponding to twelve putative transmembrane (TM) segments, based upon a hydropathicity and structural analysis of DC-PGT. A TopPredII
(Claros and von Heijne (1994) Comp. Applic Biosci 10:685-686) profile of the DC-PGT sequence showing peaks that reach beyond 'putative' or 'certain' baselines. The 12 transmembrane segments correspond to hydrophobic stretches which run approximately from amino acids 47-68 (TM1); 88-107 (TM2); 117-136 (TM3}; 188-208 (TM4); 225-244 (TM5); 279-294 (TM6) 367-386 (TM7); 412-431 (TM8};
450-474 (TM9); 561-578 (TM10); 597-616 (TM11); and 651-675 (TM12).
Charged amino residues located within the transmembrane domains are: glutamine at amino residues 59, 62, 196, 207, 380, 469, 602, 655, and 675; glutamic acid at residue 95; and arginine at residues 607 and 674. Ext:racellular loops correspond approximately to amino acid residues 69-87, 137-187, 295-366, 432-449, 579-596, and 617-650. Putative N-glycosylation sites in the exposed, extracellular face of the molecule are located in the second and fifth extracellular loops at Asn-X-Ser/Thr motifs (e. g., 146-148; 176-178; and 538-540). Intracellular portions correspond approximately to amino acid residues 1-46, 108-116, 209-224, 295-366, 432-449, 579-596, and 676-709. These boundaries will often be the boundaries of segments of interest, which be include multiple described segments.
Transporters of this family are typically 12 transmembrane proteins of approximately 650 amino acids in length and include the organic anion transporters in man and rat, prostaglandin transporters of man (Lu, et al. (1996) J. Clin. Invest. 98:1142-1149) and rat; brain digoxyin transporters and Matrin F/G of rat SUBSTITUTE SHEET ( rule 26 ) (Kanai, et al. (1995) Science 268:866-869). Characteristic of this family of organic anion transporter proteins is a cysteine rich region located in one of the extracellular loops, which resembles a zinc finger motif. The DC-PGT cysteine rich region is located in extracellular loop 5 with cysteines approximately at positions 489, 493, 495, 504, 516, 520, 539, 541, 554, and 557.
Other particularly interesting segments of the TNF receptors, Dubs, MDs, and cyclin E are pointed out. These may also be segments of comparison with other proteins or genes.
III. Physical Variants This invention also encompasses proteins or peptides having substantial amino acid sequence homology with the amino acid sequences of the described proteins. The variants include species and polymorphic variants, e.g., naturally occurring forms.
Amino acid sequence homology, or sequence identity; is determined by optimizing residue matches, if necessary, by introducing gaps as required. See also Needleham, et al. (1970) J. Mol. Biol. 48:443-453; Sankoff, et al. (1983) Chapter One in Time Warps, Strina Edits, and Macromolecules: The Theory and Practice of Sequence Comparison, Addison-Wesley, Reading, MA; and software packages from IntelliGenetics, Mountain View, CA; and the University of Wisconsin Genetics Computer Group, Madison, WI.
Sequence identity changes when considering conservative substitutions as matches. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine;
and phenylalanine, tyrosine. Homologous amino acid sequences are typically intended to include natural polymorphic or allelic and interspecies variations in. each respective protein sequence.
Typical homologous proteins or peptides will have from 25-100 identity (if gaps can be introduced), to 50-100 identity (if conservative substitutions are included) with the amino acid sequence of the HDTEA84. Identity measures will be at least about 35~k, generally at least about 40~, often at least about 50~, typically at least about 60~, usually at least about 70~, SUBSTITUTE SHEET ( rule 26 ) preferably at least about 80~, and more preferably at least about 90~.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When 5 using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.. The sequence comparison algorithm then calculates the percent sequence identity for the test sequences) 10 relative to the reference sequence, based on the designated program parameters.
Optical alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981) Adv. A_g8~'~ Math. 2:482, by the homology alignment 15 algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Nat'1 Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics 20 Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al., supra).
One example of a usei_ul algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwi~;e alignments to show relationship and 25 percent sequence identity. It also plots a tree or dendrogram showing the clustering relationships used to create the alignment.
PILEUP uses a simplificati.an of the progressive alignment method of Feng and Doolittle (19Ec7) J. Mol. Evol. 35:351-360. The method used is similar to the method described by Higgins and Sharp 30 (1989) CABI 5:151-153. The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple aligr:ment procedure begins with the paixwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the 35 next most related sequence' or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final SUBSTITLrTE SHEET ( rule 26 ) alignment is achieved by a. series of progressive, pairwise alignments. The program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters.
For example, a reference sequence can be compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST
algorithm, which is described Altschul, et al. (1990) J. Mol.
Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http:www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T
when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul, et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix Csee Henikoff and Henikoff (1989) P oc.
Nat'1 Acad. ~~i. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul SUBSTITUTE SHEET ( ruie 26 ) WO 00/01817 PCT/US99/1236b (1993) roc. Nat'1 Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the: BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most.preferably less than about 0.001.
A further indication that two nucleic acid sequences of polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypept.ide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
Another indication that two nucleic acid sequences are substantially identical is. that the two molecules hybridize to each other under stringent. conditions, as described below.
The isolated DC-PGT, HDTEA84, HSLJD37R, RANKL, HCC5, Dub, MD-1, MD-2, or cyclin E2 DNAs can be readily modified by nucleotide substitutions, nucleotide deletions, nucleotide insertions, and inversions of nucleotide stretches. These modifications result in novel DNA sequences which encode these antigens, their derivatives, or proteins raving similar physiological, immunogenic, antigenic, or other functional activity. These modified sequences can be used to produce mutant antigens or to enhance expression. Enhar.~ced expression may involve gene amplification, increased transcription, increased translation, and other mechanisms. For example, "Mutant HDTEA84" encompasses a polypeptide otherwise falling within the sequence identity definition of the HDTEA84 as set forth above, but having an amino acid sequence which differs from that of HDTEA84 as normally found in nature, whether by way of deletion, substitution, or insertion.
This generally includes proteins having significant identity with a protein having sequence of SEQ ID NO: 6, and as sharing various biological activities, e.d., antigenic or immunogenic, with those SUBSTITIJTE SHEET ( rule 26 ) sequences, and in preferred embodiments contain most of the full length disclosed sequences. Full length sequences will typically be preferred, though truncated versions, e.g., soluble constructs and intact domains, will also be useful, likewise, genes or proteins found from natural sources are typically most desired.
Similar concepts apply to different HDTEA84 proteins, particularly those found in various warm blooded animals, e.g., mammals and birds, or fish. These desscriptions are generally meant to encompass all HDTEA84 proteins, not limited to the particular human embodiment specifically discussed. Similar concepts apply to the other polypeptides provided.
DC-PGT, HDTEA84, HSL~TD37R, RANKL, HCC5, Dub, MD-1, MD-2, or cyclin E2 mutagenesis can also be conducted by making amino acid insertions or deletions. Although site specific mutation sites are predetermined, mutants need not be site specific. Protein mutagenesis can be conducted by making amino acid insertions or deletions, or combinations may be generated to arrive at a final construct. Insertions include amino- or carboxy- terminal fusions. Random mutageneais can be conducted at a target codon and the expressed mutants can then be screened for the desired activity. Methods for making substitution mutations at predetermined sites in DNA having a known sequence are well known in the art, e.g., by M13 primer mutagenesis or polymerase chain reaction (PCR) techniques. See, e.g., Sambrook, et al. (1989);
Ausubel, et al. (1987 and Supplements); and Kunkel, et al. (:L987) Methods in Enzvmol. 154:3f7-382.
The mutations in the DNA normally should not place coding sequences out of reading i_rames and preferably will not create complementary regions that. could hybridize to produce secondary mRNA structure such as loops or hairpins.
The present invention also provides recombinant proteins, e.g., heterologous fusion proteins using segments from these proteins. A heterologous fusion protein is a fusion of proteins or segments which are naturally not normally fused in the same manner. Thus, the fusion product of an immunoglobulin with a polypeptide is a continuous protein molecule having sequences fused in a typical peptide linkage, typically made as a single SUBSTITL1TE SHEET ( rule 26 ) translation product and e:Khibiting properties derived from each source peptide. A similar concept applies to heterologous nucleic acid sequences.
The present invention also provides recombinant proteins, e.g., heterologous fusion proteins using segments from these proteins. A heterologous fusion protein is a fusion of proteins or segments which are naturally not normally fused in the same manner. A similar concept applies to heterologous nucleic acid sequences. Fusion proteins will be useful as sources for cleaving, separating, and purifying portions thereof.
In addition, new constructs may be made from combining similar functional domains from other proteins. For example, target-binding or other segments may be "swapped" between different new fusion polypeptides or fragments. See, e.g., Cunningham, et al. (1989) Science 243:1330-1336; and 0'Dowd, et al. (1988) J. Biol. Chem. 263:15985-15992.
The phosphoramidite method described by Beaucage and Carruthers (1981) Tetra. Le ts. 22:1859-1862, will produce suitable synthetic DNA fragments. A double stranded fragment will often be obtained either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence, e.g., PCR techniques.
IV. Functional Variants The blocking of phy:~iological response with, e.g., HDTEA84, HSLJD37R, RANKL, HCC5 che:mokine, Nm-1, or I~-2, may result from the inhibition of binding of the respective ligand to signaling form of receptor or binding counterstructure, e.g., through competitive inhibition. In others, binding affinity to substrate may be modifiable or competed with, e.g., DC-PGT, Dubs, or cyclin E2. Thus, in vitro assails of the present invention will often use isolated protein, solublE~ fragments comprising ligand or substrate binding segments of these proteins, or forms attached to solid phase substrates. These assays will also allow for the diagnostic determination of the effects of either binding segment mutations SUBSTIT1:1TE SHEET ( rule 26 ) WO 00/01817 PCT/US99/i2366 and modifications, or antigen mutations and modifications, e.g., HDTEA84, HSLJD37R, RANKL, MD-1, or MD-2 analogs.
This invention also contemplates the use of competitive drug screening assays, e.g., where neutralizing antibodies to antigen 5 or binding fragments compete with a test compound for binding to the protein, e.g., of natural protein sequence. This is applicable to substrate banding, e.g., competitive inhibitors, and in receptor interaction, where the protein has a binding counterstructure.
10 "Derivatives" of , e.g., receptor, antigens include amino acid sequence mutants from naturally occurring forms, glycosylation variants, and covalent or aggregate conjugates with other chemical moieties. Covalent derivatives can be prepared by linkage of functionalities to groups which are found in receptor 15 amino acid side chains or at the N- or C- termini, e.g., by standard means. See, e.g., Lundblad and Noyes (1988) Chemical Reaaents for Protein Modification, vols. 1-2, CRC Press, Inc., Boca Raton, FL; Hugli (ed. 1989) Techniques in Protein Chemistrv, Academic Press, San Diego, CA; and Wong (1991) Chemistry of 20 Protein Con~uaation and Cross Linkina, CRC Press, Boca Raton, FL.
In particular, glycosylation alterations are included, e.g., made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing, or in further processing steps. See, e.g., Elbein (1987) Ann. Rev. Biochem. 56:497--534.
25 Also embraced are versions of the peptides with the same primary amino acid sequence which have other minor modifications, including phosphorylated .amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine. ' Fusion polypeptides between these proteins and other 30 homologous or heterologous proteins are also provided. Many cytokine receptors or other surface proteins are multimeric, e.g., homodimeric entities, and a repeat construct may have various advantages, including lessened susceptibility to proteolytic cleavage. Typical examples are fusions of a reporter polypeptide, 35 e.g., luciferase, with a segment or domain of a protein, e.g., a receptor-binding segment, so that the presence or location of the fused ligand may be easily determined. See, e.g., Dull, et al., SUBSTITUTE SHEET ( rule 26 ) U.S. Patent No. 4,859,609.. Other gene fusion partners include bacterial f3-galactosidase, trpE, Protein A, f3-lactamase, alpha amylase, alcohol dehydrogenase, yeast alpha mating factor, and detection or purification tags such as a FLAG sequence of His6 sequence. See, e.g., Godowski, et al. (1988) Science 241:812-816.
Of particular interest are fusion constructs of receptor with a membrane attachment domain.
Fusion peptides will typically be made by either recombinant nucleic acid methods or by synthetic polypeptide methods.
Techniques for nucleic acid manipulation and expression are described generally, e.g., in Sambrook, et al. (1989) Molecular Clonincr: A Laboratory Manual (2d ed.), vols. 1-3, Cold Spring Harbor Laboratory; and Au:~ubel, et al. (eds. 1993) urrent Protocols in Molecular Biol~, Greene and Wiley, NY. Techniques for synthesis of polypepti_des are described, e.g., in Merrifield (1963) J. Amer. Chem. Soc._ 85:2149-2156; Merrifield (1986) ;zcience 232: 341-347; Atherton, et: al. (1989) ~~d Phase Pet~tide Synthesis: A Practical Approach, IRL Press, Oxford; and Grant (1992) SZmthetic Peptides: A User's Guide, W.H. Freeman, NY..
This invention also contemplates the use of derivatives of the proteins other than variations in amino acid sequence or glycosylation. Such derivatives may involve covalent or aggregative association with chemical moieties. Covalent or aggregative derivatives will be useful as immunogens, as reagents in immunoassays, or in purification methods such as for affinity purification of binding partners, e.g., other antigens. The desired proteins can be inunobilized by covalent bonding to a solid support such as cyanogen bromide-activated SEPHAROSE, by methods which are well known in the art, or adsorbed onto polyolefin surfaces, with or without glutaraldehyde cross-linking, for use in the assay or purification of antibodies or an alternative binding composition. The protein can also be labeled with a detectable group, e.g., for use in diagnostic assays. Purification may be effected by an immobilized antibody or complementary binding partner. Conversely, immunoabsorption or immunodepletion techniques may be developed.
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 A solubilized protein or fragment of this invention can be used as an immunogen for t:he production of antisera or antibodies specific for binding to the antigen or fragments thereof.
Purified antigen can be u:~ed to screen monoclonal antibodies or antigen-binding fragments, encompassing antigen binding fragments of natural antibodies, e.c~., Fab, Fab', F(ab)2, etc. Purified protein can also be used as a reagent to detect antibodies generated in response to t:he presence of elevated levels of the antigen or cell fragments containing the antigen, both of which may be diagnostic of an abnormal or specific physiological or disease condition. This invention contemplates antibodies raised against amino acid sequences encoded by nucleotide sequences described, or fragments oi: proteins containing it. In particular, this invention contemplates antibodies having binding affinity to or being raised against specific fragments, e.g., which are predicted to lie outside of the lipid bilayer, both extracellular or intracellular.
The present invention contemplates the isolation of additional closely related species variants. Southern and Northern blot analysis should establish that similar genetic entities exist in other m~~ccmals. It is likely that these proteins are widespread in species variants, e.g., rodents, lagomorphs, carnivores, artiodactyla, perissodactyla, and primates.
The invention also provides means to isolate a group of related antigens displaying both distinctness and similarities in structure, expression, and function. Elucidation of many of the physiological effects of the molecules will be greatly accelerated by the isolation and characterization of additional distinct species variants of them. In particular, the present invention provides useful probes for identifying additional homologous genetic entities in different species.
The isolated genes will allow transformation of cells lacking expression of a corresponding protein, e.g., either species types or cells which lack corre:~ponding antigens and exhibit negative background activity. Thia should allow analysis of the function of genes in comparison to untransformed control cells.
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/I1S99/12366 Dissection of critical structural elements which effect the various activation or differentiation functions mediated through these antigens is possible using standard techniques of modern molecular biology, particularly in comparing members of the related class. See, e.g., the homolog-scanning mutagenesis technique described in Curiningham, et al. (1989) Science 243:1339-1336; and approaches used in 0'Dowd, et al. (1988) J. Biol. Chem.
263:15985-15992; and Lechl.eiter, et al. (1990) EMBO J. 9:4381-4390.
The invention also provides, in the context of the DC-PGT, means to isolate a group of related organic anion transporters, e.g., other vertebrate prostaglandin transporters, displaying both distinctness and similarities in structure, expression, and function. Elucidation of many of the physiological effects of the antigens will be greatly accelerated by the isolation and characterization of distinct species variants. In particular, the present invention providesc useful probes for identifying additional homologous genetic entities in different species. The results described above indicate that sufficiently homologous genes exist in other species that cross-species hybridization is likely to allow successful. cloning.
The isolated genes will allow transformation of cells lacking expression of a described gene, e.g., prostaglandin transporter.
Various species types or cells which lack corresponding proteins can be isolated, and should exhibit negative background activity.
Expression of transformed genes will allow isolation of antigenically pure cell lines, with defined or single specie variants. This approach wi_11 allow for more sensitive detection and discrimination of the physiological effects of the gene, e.g., prostaglandin transporters. Subcellular fragments, e.g., cytoplasts or membrane fragments, can be isolated and used.
The DC-PGT genes may also be useful to increase the rate of transport of desired prost:aglandins into transformed cells. Thus, the transporter may be transformed into cells for targeting of incorporation of desired substrates or analogs. For instance, it may be useful to incorporate specific modified prostaglandins into those cells, which may become more susceptible to other SUBSTITUTE SHEET ( rule 26 ) treatments, or directly affected. Thus, specific dendritic cell subsets may be transformed to become more sensitive to prostaglandins or specific substrates. Conversely, such cells may be useful screening target=s to identify entities which can block transport, thereby preventing uptake of substrate.
Structural studies o:E the transporter will lead to design of new variants, particularly analogs exhibiting modified binding affinity, or perhaps, altered rate of transporter activity. This can be combined with previously described screening methods to isolate variants exhibiting desired spectra of activities.
Alternatively, many different prostaglandins and analogs thereof may be screened for either transporter binding affinity or transporter transfer. ThE~ transporter may require a direct energy source, e.g., ATP or other nucleotide triphosphate, or may depend upon an ion gradient, as described above.
In the context of the Dubs and cyclin E2, intracellular functions would probably :involve segments of the antigen which are normally accessible to the cytosol, as would segments of the receptors. However, protein internalization may occur under certain circumstances, and interaction between intracellular components and "extracellular" components may occur. The specific segments of interaction o:E protein with other intracellular components may be identified by mutagenesis or direct biochemical means, e.g., cross-linking or affinity methods.
Structural analysis :by crystallographic or other physical methods will also be applicable. Further investigation of the mechanism of signal transduction will include study of associated components which may be i;solatable by affinity methods or by genetic means, e.g., comp:lementation analysis of mutants.
Further study of the expression and control of the proteins will be pursued. The controlling elements associated with the antigens should exhibit differential physiological, developmental, tissue specific, or other expression patterns. Upstream or downstream genetic regions, e.g., control elements, are of interest. In particular, physiological or developmental variants, e.g., multiple alternatively processed forms of the antigen might be found. Thus, differential splicing of message may lead to an SUBSTITL1TE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 assortment of membrane bound forms, soluble forms, and modified versions of antigen.
Structural studies of the antigens will lead to design of new antigens, particularly an<~logs exhibiting agonist or antaganist 5 properties on the molecule. This can be combined with previously described screening methods to isolate antigens exhibiting desired spectra of activities.
V. Antibodies 10 Antibodies can be raised to the various described polypeptides, including species, polymorphic, or allelic variants, and fragments thereof, both in their naturally occurring farms and in their recombinant forms. Additionally, antibodies can be raised to the proteins in either their active forms or in their 15 inactive forms, including native or denatured versions. Anti-idiotypic antibodies are also contemplated.
Antibodies, including binding fragments and single chain versions, against predetermined fragments of the antigens can be raised by immunization of animals with conjugates of the fragments 20 with immunogenic proteins. Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies can be screened for binding to normal or defective polypeptide, or screened for agonistic or antagonistic activity. Antibodies may be agonistic or antagonistic, e.g., by sterically blocking partner 25 or substrate binding. Th~ase monoclonal antibodies will usually bind with at least a KD of about 1 mM, more usually at least about 300 EIM, typically at least about 100 ELM, more typically at least about 30 ~1M, preferably at least about 10 ~.1M, and more preferably at least about 3 ~tM or better. More preferred embodiments may 30 have even higher affinities, e.g., at least 300 nM, 30 nM, 3 nM, or perhaps even picomolar affinity.
The term "binding composition" refers to molecules that. bind with affinity and selectivity to, e.g., the DC-PGT, e.g., in an antibody-antigen interaction. However, other compounds, e.g., 35 accessory proteins, may also specifically and/or selectively associate with the antigen to the exclusion of other molecules.
Typically, the association will be in a natural physiologically SUBSTITCITE SHEET ( rule 26 ) relevant protein-protein interaction, either covalent or non-covalent, and may include members of a multiprotein complex, including carrier compounds or dimerization partners. The molecule may be a polymer,, or chemical reagent. No implication as to whether an antigen is necessarily a convex shaped molecule, e.g., the ligand or the rE=_ceptor of a ligand-receptor interaction, is necessarily represented, other than whether the interaction exhibits similar specificity, e.g., specific or selective affinity. A functional analog. may be a polypeptide with structural modifications, e.g., a mutein, or may be a wholly unrelated molecule, e.g., which has a molecular shape which interacts with the appropriate ligand binding determinants. The ligands may serve as agon:ists or antagonists of the receptor, see, e.g., Goodman, et al. Goodman & Gilman's: The Pharmacological Bases of Therapeutics (current edition) Pergamon Press, Tarrytown, N.Y.
The term "binding agent: antigen complex", as used herein, refers to a complex of a binding agent and antigen, e.g., a DC-PGT
protein, that is formed by specific binding of the binding agent to antigen. Specific or selective binding of the binding agent means that the binding agent has a specific binding site, e.g., antigen binding site, that recognizes a site on the antigen. For example, antibodies raised to a DC-PGT protein and recognizing an epitope on the protein are capable of forming a binding agent:DC-PGT protein complex by specific selective binding. Typically, the formation of a binding ag~~nt:DC-PGT protein complex allows the qualitative or quantitative measurement of DC-PGT protein in a mixture of other proteins and biologics. The term "antibody:DC-PGT protein complex" refers to an embodiment in which the binding agent, e.g., is the antigen binding portion from an antibody. The antibody may be monoclonal, polyclonal, or a binding fragment of an antibody, e.g., an Fab or F(ab)2 fragment. The antibody will preferably be a polyclonal antibody for cross-reactivity testing purposes.
The phrase "specifically binds to an antibody" or "specifically immunoreactive with", when referring to a protein or peptide, refers to a binding reaction which is determinative of SUBSTITUTE SHEET ( rule 26 ) the presence of the protein in the presence of a heterogeneous population of other proteins and other biological components.
Thus, under designated inanunoassay conditions, the specified antibodies bind to a part:i.cular protein and do not significantly bind other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity or selectivity for a particular protein. Often, the serum can be immunoselected or immunodepleted, to minimize crossreactivity with a specific target protein.
A DC-PGT polypeptide that specifically binds to, or that is specifically immunoreactive with, an antibody, e.g., such as a polyclonal antibody, generated against a defined immunogen, e.g., such as an immunogen consisting of an amino acid sequence of SEQ
ID NO: 2, or fragments thereof, or a polypeptide generated from the nucleic acid of SEQ ID N0: 1 is typically determined in an immunoassay. Included within the metes and bounds of the present invention are those nucleic acid sequences described herein, including functional variants, that encode polypeptides that.
selectively bind to polyclonal antibodies generated against the prototypical DC-PGT polyp~eptide as structurally and functionally defined herein. The immunoassay typically uses a polyclonal.
antiserum which was raised, e.g., to a protein of SEQ ID N0: 2.
This antiserum is selected to have low crossreactivity against appropriate other PGT family members, preferably from the same species, and any such crossreactivity is removed by immunoabsorption prior to use in the immunoassay. Appropriate selective serum preparations can be isolated, and characterized.
The purified proteir.~ or deffined peptides are useful for generating antibodies by standard methods, as described above.
Synthetic peptides or purified protein can be presented to an immune system to generate monoclonal or polyclonal antibodies.
See, e.g., Coligan (1991) Current Protocols in Immunology Wiley/Greene; and Harlow and Lane (1989) Antibodies: A Laboratory Manual, Cold Spring Harbor Press. Alternatively, the HDTEA84 can be used as a specific binding reagent, and advantage can be taken SUBSTITL1TE SHEET { rule 26 ) of its specificity of binding, much like an antibody would be used.
For example, the specific binding composition could be 'used for screening of an expre~~sion library made from a cell line which expresses an HDTEA84, HSL~TD37R, or RANKL. The screening can be standard staining of surface expressed antigen constructs, or by panning. Screening of intracellular expression can also be performed by various staining or immunofluorescence procedures.
The binding compositions <:ould be used to affinity purify ar sort out cells expressing the protein.
In order to produce <~.ntisera for use in an immunoassay, the protein, e.g., of SEQ ID rd0: 2, is isolated as described herein.
For example, recombinant protein may be produced in a mammalian cell line. An appropriate host, e.g., an inbred strain of mice such as Balb/c, is immuni::ed with the protein of SEQ ID NO: 2 using a standard adjuvant,. such as Freund's adjuvant, and a standard mouse immunization protocol (see Harlow and Lane).
Alternatively, a substantially full length synthetic peptide derived from the sequence: disclosed herein can be used as an immunogen. Polyclonal sera are collected and titered against the immunogen protein in an immunoassay, e.g., a solid phase immunoassay with the immunogen immobilized on a solid support.
Polyclonal antisera with a titer of 104 ar greater are selected and tested for their cros:~ reactivity against other PGT family members, e.g., human or r<~t PGT, using a competitive binding immunoassay such as the one described in Harlow and Lane, supra, at pages 570-573. Preferably at least two PGT family members are used in this determination in conjunction with the target. 'These PGT family members can be produced as recombinant proteins and isolated using standard molecular biology and protein chemistry techniques as described herein. Thus, antibody preparations can be identified or produced having desired selectivity or specificity for subsets of PGT family members.
Immunoassays in the competitive binding format can be used for the crossreactivity determinations. For example, the protein of SEQ ID NO: 2 can be immobilized to a solid support. Proteins added to the assay compete with the binding of the antisera to the SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 immobilized antigen. The ability of the above proteins to compete with the binding of the antisera to the immobilized protein is compared to the protein of: SEQ ID N0: 2. The percent crossreactivity for the above proteins is calculated, using standard calculations. Those antisera with less than 10~
crossreactivity with each of the proteins listed above are selected and pooled. The cross-reacting antibodies are then removed from the pooled antisera by immunoabsorption or immunodepletion with the above-listed proteins.
The immunoabsorbed and pooled antisera are then used in a competitive binding immunoassay as described above to compare a second protein to the immunogen protein. In order to make this comparison, the two prote~.ns are each assayed at a wide range of concentrations and the amount of each protein required to inhibit 50~ of the binding of the antisera to the immobilized protein is determined. If the amount: of the second protein required is less than twice the amount of t:he protein of, e.g., SEQ ID NO: 2 that is required, then the second protein is said to specifically bind to an antibody generated too the immunogen.
The antibodies of this invention can also be useful in diagnostic applications. As capture or non-neutralizing antibodies, they can be screened for ability to bind to the antigens without inhibiting binding by a partner. As neutralizing antibodies, they can be useful in competitive binding assays.
They will also be useful :in detecting or quantifying a described protein or its binding partners. See, e.g., Chan (ed. 1987) Immunology A Practical Guide, Academic Press, Orlando, FL; Price and Newman (eds. 1991) Pr:incigles and Practice of Immunoassay, Stockton Press, N.Y.; and Ngo (ed. 1988) Norli.sotopic Immunoassay, Plenum Press, N.Y. Cross absorptions or depletions and other tests will identify antibodies which exhibit various spectra of specificities, e.g., unique or shared species specificities.
Further, the antibodies, including antigen binding fragments, of this invention can be potent antagonists that bind to the antigen and inhibit functional binding or inhibit the ability of a binding partner to elicit a biological response. They also can be useful as non-neutralizing antibodies and can be coupled to toxins SUBSTITUTE SHEET ( rule 26 ) or radionuclides so that when the an~:~ibody binds to antigen, a cell expressing it, e.g., on its surface, is killed. Further, these antibodies can be conjugated to drugs or other therapeutic agents, either directly or indirectly by means of a linker,, and 5 may effect drug targeting. They may be labeled for histology evaluation.
Antigen fragments may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens. An antigen and its 10 fragments may be fused or covalently linked to a variety of immunogens, such as keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, etc. See Microbiology, Hoeber Medical Division, Harper and Row, 1969; Landsteiner (1962) Specificity of Serological Reactions, Dover Publications, New York; Williams, et 15 al. (1967) Methods in Immunoloav and Immunochemistry, vol. 1, Academic Press, New York; and Harlow and Lane (1988) Antibodies:
A Laboratorv Manual, CSH Press, NY, for descriptions of methods of preparing polyclonal antisera.
In some instances, it is desirable to prepare monoclonal 20 antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc. Description of techniques for preparing such monoclonal antibodies may be found in, e.g., Stites, et al.
(eds.) Basic and Clinical Immunology (4th ed.), Lange Medical Publications, Los Altos, CA, and references cited therein; Harlow 25 and Lane (1988) Antibodies: A Laboratorv Manual, CSH Press;
Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed.), Academic Press, New York; and particularly in Kohler and Milstein (1975) in Nature 256:495-497, which discusses one method of generating monoclonal antibodies.
30 Other suitable techniques involve in vitro a xposure of lymphocytes to the antigenic polypeptides or alternatively to selection of libraries of antibodies in phage or similar vectors.
See, Huse, et al. (1989) "Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda," Science 35 246:1275-1281; and Ward, ~et al. (1989) Na a 341:544-546. The polypeptides and antibodies of the present invention may be used SUBSTITUTE SHEET ( rule 26 ) with or without modification, including chimeric or humanized antibodies. Frequently, the polypeptides and antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides :for a detectable signal. A wide variety of labels and conjugation techniques are known and are reparted extensively in both the scientific and patent literature.
Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents, teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752;
3,939,350; 3,996,345; 4,2'77,437; 4,275,149; and 4,366,241. Also, recombinant immunoglobulins may be produced, see Cabilly, U.S.
Patent No. 4,816,567; Moo:re, et al., U.S. Patent No. 4,642,334;
and Queen, et al. (1989) Proc. Nat'1 Acad. Sci. U~A_ 86:10029-10033.
The antibodies of this invention can also be used for affinity chromatography in isolating the protein. Columns can be prepared where the antibodies are linked to a solid support, e.g., particles, such as agarosa_, Sephadex, or the like, where a cell lysate may be passed through the column, the column washed, followed by increasing concentrations of a mild denaturant, whereby the purified prota_in will be released. See, e.g., Wilchek et al. (1984) Meth. Enzvmol. 104:3-55.
Antibodies raised against each protein will also be useful to raise anti-idiotypic antibodies. These will be useful in detecting or diagnosing various immunological conditions related to expression of the respective antigens.
VI. Nucleic Acids The described peptide sequences and the related reagents are useful in detecting, isolating, or identifying a DNA clone encoding, e.g., the DC-PG'r, HDTEA84, HSLJD37R, RANKL, HCC5, Dubll, Dubl2, MD-1, MD-2, or cyclin E2 polypeptides, e.g., from a natural source. Typically, the mucleic acids, particularly natural genes, will be useful in isolating a gene from mammal, and similar procedures will be applied to isolate genes from other species, e.g., warm blooded animals, such as birds and mammals. They will SUBSTITUTE SHEET ( rule 26 ) be useful for isolating genes from domestic pets, e.g., dogs and cats, and livestock, e.g., horse, pigs, cattle, sheep, chickens, turkeys, fish, etc. Crosa hybridization will allow isolation of respective counterpart genes from other species. A number of different approaches shou:Ld be available to successfully isolate a suitable nucleic acid clone.
The peptide sequences allow preparation of peptides to generate antibodies to recognize such segments, and various different methods may be used to prepare such peptides. As used herein, e.g., the term prostaglandin transporter shall encompass, when used in a protein context, a protein having an amino acid sequence shown in Table 1, or a significant fragment of such a protein. It also refers ~to a vertebrate, e.g., mammal, including human, derived polypeptide which exhibits similar biological function, e.g., antigenic, or interacts with prostaglandin transporter specific binding components, e.g., specific antibodies. These binding components, e.g., antibodies, typically bind to a prostaglandin transporter with high affinity, e.g., at least about 100 nM, usual:ly better than about 30 nM, preferably better than about 10 nM, and more preferably at better than about 3 nM. Still higher affinities are possible, e.g., 100 pM, 30 pM, 100 fM, etc.
This invention contemplates use of isolated DNA or fragments of the present invention to encode a structurally related, e.g., antigenically related, or :biologically active protein, e.g., substrate binding or transporting, prostaglandin transporter, TNF
receptor-like proteins, chemokine, Dubs, surface receptors, or cell cycle regulatory proteins, or polypeptide fragments thereof.
In addition, this invention covers isolated or recombinant DNA
which encodes a structurally related or biologically active protein or polypeptide and that is capable of hybridizing under appropriate conditions with the DNA sequences described herein.
Said biologically active ;protein or polypeptide can be an intact antigen, or fragment, and have an amino acid sequence as disclosed in Tables 1-13. Further, this invention covers the use of isolated or recombinant DNA, or fragments thereof, which encode proteins which are homologous to the respective genes or which SUBSTITUTE SHEET ( rule 26 ) were isolated using cDNA encoding the proteins as a probe.
Preferably such homologous; genes or proteins will be natural forms isolated from other vertebrates, e.g., warm blooded animals, including mammals, such as. primates. The isolated DNA can have the respective regulatory sequences in the 5' and 3' flanks, e.g., promoters, enhancers, poly-A addition signals, and others.
An "isolated" nucleic: acid is a nucleic acid, e.g., an RNA, DNA, or a mixed polymer, which is substantially separated from other components which nat.urall,y accompany a native sequence, e.g., ribosomes, polymerases, and flanking genomic sequences from the originating species. The term embraces a nucleic acid sequence which has been removed from its naturally occurring intracellular environment, and includes recombinant or cloned DNA
isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule includes once or currently isolated forms of the molecule. Alternatively, a purified species may be separated from host components from a recombinant expression system.
Generally, the nucleic acid will be in a vector or fragment less than about 50 kb, usually less than about 30 kb, typically less than about 10 kb, and preferably less than about 6 kb.
An isolated nucleic acid will generally be a homogeneous composition of molecules, but will, in some embodiments, contain minor heterogeneity. This heterogeneity is typically found at the polymer ends or portions not critical to a desired biological.
function or activity.
The peptide segments can also be used to predict appropriate oligonucleotides to screen a library. The genetic code, e.g., reverse translation, can b~e used to select appropriate oligonucleotides useful as probes for screening. See, e.g., SEQ
ID NO: 1, 5, 7, 9, 11, 16, 18, 20, 22, 24, 31, 33, 35, 37, 41., 43, 47, or 53. In combination. with polymerase chain reaction (PCR) techniques, synthetic oligonucleotides will be useful in selecting correct clones from a library. Complementary sequences will also be used as probes, primers, or antisense strands. Various fragments should be particularly useful, e.g., coupled with SUBSTITUTE SHEET ( rule 26 ) anchored vector or poly-A complementary PCR techniques or with complementary DNA of other peptides.
This invention contemplates use of isolated DNA or fragments to encode a biologically active corresponding polypeptide. In addition, this invention covers isolated or recombinant DNA which encodes a biologically active protein or polypeptide which is capable of hybridizing under appropriate conditions with the DNA
sequences described herein. Said biologically active protein or polypeptide can be an intact antigen, or fragment, and have an amino acid sequence disclosed in, e.g., SEQ ID NO: 2, 6, 8, 10, 12, 17, 19, 21, 23, 25, 32, 34, 36, 38, 42, 44, 46, 48, 49, or 54.
Further, this invention covers the use of isolated or recombinant DNA, or fragments thereof, which encode proteins which are homologous to a described protein or which was isolated using cDNA
encoding such protein as a. probe. The isolated DNA can have the respective regulatory sequences in the 5' and 3' flanks, e.g., promoters, enhancers, poly-A addition signals, and others.
A "recombinant" nucleic acid is defined either by its method of production or its structure. In reference to its method of production, e.g., a product. made by a process, the process is use of recombinant nucleic acid techniques, e.g., involving human intervention in the nucleotide sequence, typically selection or production. Alternatively, it can be a nucleic acid made by generating a sequence comprising fusion of two fragments which are not naturally contiguous to each other, but is meant to exclude products of nature, e.g., naturally occurring mutants. Thus, e.g., products made by transforming cells with any unnaturally occurring vector is encompassed, as are nucleic acids comprising sequence derived using any synthetic oligonucleotide process.
Such is often done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site.
Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a single genetic entity comprising a desired combination of functions not found in the commonly available natural forms. Restriction enzyme recognition sites are often the target of such artificial manipulations, but SUBSTITUTE SHEET ( rule 26 ) other site specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporai;ed by design. A similar concept is intended for a recombinant:, e.g., fusion, polypeptide.
5 Specifically included are synthetic nucleic acids which, by genetic code redundancy, encode polypeptides similar to fragments of these antigens, and fu:~ions of sequences from various different species variants.
A significant "fragment" in a nucleic acid context is a 10 contiguous segment of at least about 17 nucleotides, generally at least about 22 nucleotide~~, ordinarily at least about 29 nucleotides, more often at: least about 35 nucleotides, typically at least about 41 nucleotides, usually at least about 47 nucleotides, preferably at: least about 55 nucleotides, and in 15 particularly preferred embodiments will be at least about 60 or more nucleotides.
A DNA which codes for a DC-PGT, HDTEA84, HSLJD37R, RANKL, HCC5, Dub, 1~-1, I~-2, or cyclin E2 protein will be particularly useful to identify genes, mRNA, and cDNA species which code for 20 related or homologous proteins, as well as DNAs which code far homologous proteins from different species. There are likely homologs in other species, including primates, rodents, birds, and fish. Various such proteins should be homologous and are encompassed herein. However, even genes encoding proteins that 25 have a more distant evolutionary relationship to the antigen can readily be isolated under appropriate conditions using these sequences if they are sufficiently homologous. Primate proteins are of particular interest.
Recombinant clones derived from the genomic sequences, e.g., 30 containing introns, will be useful for transgenic studies, including, e.g., transgenic cells and organisms, and for gene therapy. See, e.g., Goodnow (1992) "Transgenic Animals" in Roitt (ed.) Encyclopedia of Immunolocrv, Academic Press, San Diego, pp.
1502-1504; Travis (1992) _Science 256:1392-1394; Kuhn, et al.
35 (1991) Science 254:707-720; Capecchi (1989) Science 244:1288;
Robertson (1987 ed.) Teratocarcinomas and Embryonic Stem Cells A
SUBSTITUTE SHEET ( rule 26 ) Practical Approach, IRL Press, Oxford; and Rosenberg (1992) T~.
Clinical Oncology 10:180-199.
Substantial homology in the nucleic acid sequence comparison context means either that the segments, or their complementary strands, when compared, are identical when optimally aligned, with appropriate nucleotide insertions or deletions, in at least about 50~ of the nucleotides, generally at least about 58~, ordinarily at least about 65~, often at least about 71~, typically at least about 77~, usually at leant about 85~, preferably at least about 95 to 98~ or more, and in particular embodiments, as high as about 99~ or more of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions, ~o a strand, or its complement, typically using a sequencE~ of DC-PGT, e.g., in SEQ ID NO: 1.
Typically, selective hybridization will occur when there is at least about 55~ homology over a stretch of at least about 30 nucleotides, preferably ate least about 75~ over a stretch of about nucleotides, and most preferably at least about 90~ over about 20 nucleotides. See, Kanehisa (1984) Nuc. Acids Res. 12:203--213.
20 The length of homology comparison, as described, may be over longer stretches, and in certain embodiments will be over a stretch of at least about 17 nucleotides, usually at least about 28 nucleotides, typically at least about 40 nucleotides, and preferably at least about 75 to 100 or more nucleotides.
25 Stringent conditions, in referring to homology in the .hybridization context, will be stringent combined conditions of salt, temperature, organic' solvents, and other parameters, typically those controlled in hybridization reactions. Stringent temperature conditions will usually include temperatures in excess of about 30° C, usually in excess of about 37° C, typically in excess of about 55° C, preferably in excess of about 70° C.
Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 400 mM, typically less than about 250 mM, preferably less than about 150 mM. However, the combination of parameters is much more important than the measure of any single parameter. See, e.g., Wetmur and Davidson (1968) ,T. Mol.
iol. 31:349-370. Hybridization under stringent conditions should SUBSTITUTE SHEET ( rule 26 ) give a background of at least 2-fold over background, preferably at least 3-5 or more.
DC-PGT, HDTEA84, HSLJD37R, RANKL, HCC5, Dubll, Dubl2, MD-1, MD-2, or cyclin E2 from other mammalian species can be cloned and isolated by cross-species hybridization of closely related species. Homology may be relatively low between distantly related species, and thus hybridization of relatively closely related species is advisable. Alternatively, preparation of an antibody preparation which exhibits less species specificity may be useful in expression cloning approaches.
VII. Making Proteins; Mimetics Nucleic acids which encodes the described proteins, or fragments thereof, can be obtained by chemical synthesis, screening cDNA libraries, or screening genomic libraries prepared from a wide variety of cell lines or tissue samples. See, e.g., Okayama and Berg (1982) Mol. Cell. Biol 2:161-170; Gubler and Hoffman (1983) en 25:26.1-269; and Glover (ed. 1984) DNA Cloning:
A Practical Approach, IRL Press, Oxford. Alternatively, the sequences provided herein provide useful PCR primers or allow synthetic or other preparation of suitable genes encoding a receptor; including, naturally occurring embodiments.
DNA can be expressed in a wide variety of host cells for the synthesis of a full-length protein, or fragments, which can in turn, e.g., be used to generate polyclonal or monoclonal antibodies; for binding studies; for construction and expression of modified molecules; for structure/function studies; and for controls in detection assays. Each antigen or its fragments can be expressed in host cells that are transformed or transfected with appropriate expression vectors. These molecules can be substantially purified to be free of protein or cellular contaminants, other than those derived from the recombinant host, and therefore are particularly useful in pharmaceutical compositions when combined. with a pharmaceutically acceptable carrier and/or diluent. The antigen, or portions thereof, may be expressed as fusions with other proteins.
SUBSTITUTE SHEET ( rule 26 ) Vectors, as used herein, comprise plasmids, viruses, bacteriophage, integratab:le DNA fragments, and other vehicles which enable the integration of DNA fragments into the genome of the host. See, e.g., Pouwels, et al. (1985 and Supplements) Cloning Vectors A Laboral-or~r~anual, Elsevier, N.Y.; and Rodriguez, et al. (1988 eds.) Vectors: A Surrey of MolP~ular C~.onincr Vec-n-rs and Their s s, Buttersworth, Boston, MA.
Expression vectors are typically self-replicating DNA or RNA
constructs containing the desired antigen gene or its fragments, usually operably linked to suitable genetic control elements that are recognized in a suitable host cell. These control elements are capable of effecting expression within a suitable host. The specific type of control Elements necessary to effect expression will depend upon the eventual host cell used. Generally, the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system, and typically include a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers t:o elevate the level of mRNA expression, a sequence that encodes a suitable ribosome binding site, and sequences that terminate transcription and translation. Expression vectors also usually contain an origin of replication that allows the vector to replicate independently of the host cell.
For purposes of this invention, DNA sequences are operably linked when they are functionally related to each other. For example, DNA for a presequence or secretory leader is operably linked to a polypeptide if it is expressed as a preprotein or participates in directing the polypeptide to the cell membrane or in secretion of the polype:ptide. A promoter is operably linked to a coding sequence if it controls the transcription of the polypeptide; a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation.
Usually, operably linked means contiguous and in reading frame, however, certain genetic elements such as repressor genes are not contiguously linked but st ll bind to operator sequences that in turn control expression. See e.g., Rodriguez, et al., Chapter 10, pp. 205-236; Balbas and Bo:livar (1990) Methods in Enzvmol 185:14-SUBSTITUTE SHEET ( rule 26 ) 37; and Ausubel, et al. (1993) Current Proto- is in Molecular Biology, Greene and Wiley, NY.
Representative examples of suitable expression vectors include pCDNAI; pCD, see ~Okayama, et al. (1985) Mol. Cell Biol 5:1136-1142; pMClneo Poly-A, see Thomas, et al. (1987) Cell, 51:503-512; and a baculovirus vector such as pAC 373 or pAC 610.
See, e.g., Miller (1988) Ann. Rev. Microbiol 42:177-199.
Usually, expression vectors are designed for stable replication in their host cells or for amplification to greatly increase the total number of copies of the desirable gene per cell. It is not always necessary to require that an expression vector replicate in a host cell, e.g., it is possible to effect transient expression of the antigen or its fragments in various hosts using vectors that do not contain a replication origin that is recognized by the host cell. It is also po~~sible to use vectors that cause integration of a gene or i.ts fragments into the host DNA by recombination, or to integrate a promoter which controls expression of an endogenous gene.
Adenovirus techniques are available for expression of the genes in various cells anc~ organs. See, e.g., Hitt, et al. (1997) Adv. Pharmacol. 40:137-195; and literature from Quantum Biotechnologies, Montreal, Canada. Animals may be useful to determine the effects of the gene on various developmental or physiologically functional animal systems.
Suitable host cells include prokaryotes, lower eukaryotes, and higher eukaryotes. Prokaryotes include both gram negative and gram positive organisms, e.g., E. coli and B, subtilis. Lower eukaryotes include yeasts, e.g., S, cerevisiae and Pichia, and species of the genus Dictyostelium. Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
Prokaryotic host-vector systems include a wide variety of vectors for many different species. As used herein, E. coli and its vectors will be used generically to include equivalent vectors used in other prokaryotes. A representative vector for amplifying DNA is pBR322 or many of its derivatives. Vectors that can be SUBSTITUTE SHEET ( rule 26 ) used to express the prostaglandin transporter or its fragments include, but are not limited to, such vectors as those containing the lac promoter (pUC-se:ries); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or 5 hybrid promoters such as ptac (pDR540). See Brosius et al. (1988) "Expression Vectors Employing Lambda-, trp-, lac-, and Ipp-derived Promoters", in Rodriguez and Denhardt (eds.) Victors: A Survev of Ma1_ecular Cloning Vector~~ and Their Uses, Buttersworth, Boston, Chapter 10, pp. 205-236, which is incorporated herein by 10 reference.
Lower eukaryotes, e,.g., yeasts and Dictyostelium, may be transformed with vectors encoding vertebrate prostaglandin transporters. For purposes of this invention, the most common lower eukaryotic host is the baker's yeast, Saccharomyces 15 cerevisiae. It will be used to generically represent lower eukaryotes although a number of other strains and species are also available. Yeast vectors typically consist of a replication origin (unless of the integrating type), a selection gene, a promoter, DNA encoding th.e desired protein or its fragments, and 20 sequences for translation termination, polyadenylation, and transcription termination. Suitable expression vectors for yeast include such constitutive promoters as 3-phosphoglycerate kinase and various other glycolytic enzyme gene promoters or such inducible promoters as the alcohol dehydrogenase 2 promoter or 25 metallothionine promoter. Suitable vectors include derivatives of the following types: self-replicating low copy number (such as the YRp-series), self-replicating high copy number (such as the YEp-series); integrating types (such as the YIp-series), or mini-chromosomes (such as the YCp-series).
30 Higher eukaryotic tissue culture cells are the preferred host cells for expression of the functionally active prostaglandin transporter. In principle, most higher eukaryotic tissue culture cell lines are workable, e.g., insect baculovirus expression systems, whether from an :invertebrate or vertebrate source.
35 However, mammalian cells are preferred, in that the processing, both cotranslationally and posttranslationally is more likely to simulate natural forms. Transformation or transfection and _._,~~ ..y_ _. .
SUBSTITUTE SHEET ( ruie 26 ) propagation of such cells has become a routine procedure.
Examples of useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines.
Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA
splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also usually contain a selection gene or amplification gene. Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as from adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus. Representative examples of suitable expression vectors include pCDNAI; pCD, see Okayama et al. (1985) ~Iol. Cell Biol. 5:1136-1142; pMClneo Poly-A, see Thomas et al. (1987) Cell 51:503-512; and a baculov:irus vector such as pAC 373 or pAC 610.
It will often be desired to express a DC-PGT, HDTEA84, HSLJD37R, RANKI,, HCCS, Dubll, Dubl2, MD-1, MD-2, or cyclin E2 polypeptide in a system which provides a specific or defined glycosylation pattern. Sere, e.g., Luckow and Summers (1988) Bio/TechnoJiocrv 6:47-55; and Kaufman (1990) Meth. Enzvmol 1.8.5:487-511. Preferred prokaryotic forms lack eukaryotic glycosylation patterns. However, the pattern will be modifiable by exposing the polypeptide, e.g., an unglycosylated form, to appropriate glycosylating proteins introduced into a heterologous expression system. For example, the desired gene may be cotransformed with one or more genes encoding mammalian or other glycosylating enzymes. Using this approach, certain mammalian glycosylation patterns will be achievable or approximated in prokaryote or other cells.
The DC-PGT, HDTEA84, HSLJD37R, RANKL, HCC5, Dubll, Dubl2, MD-1, MD-2, or cyclin E2, or a fragment thereof, may be engineered to be phosphatidyl inositol (PI) linked to a cell membrane, but can be removed from membranes by treatment with a phosphatidyl inositol cleaving enzyme, e.g., phosphatidyl inositol phospholipase-C. This releases the antigen in a biologically active form, and allows purification by standard procedures of SUBSTITUTE SHEET ( rule 26 ) protein chemistry. See, e~.g., Low (1989) Biochim. Biox~hys. Ac~a 988:427-454; Tse, et al. (1985) Science 230:1003-1008; and Brunner, et al. (1991) Cell Bio~ 114:1275-1283.
Transformed cells include cells, preferably mammalian, that have been transformed or t.ransfected with vectors containing a prostaglandin transporter gene, typically constructed using recombinant DNA techniques.. Transformed host cells usually express the antigen or its fragments, but for purposes of cloning, amplifying, and manipulating its DNA, do not need to express the protein. This invention further contemplates culturing transformed cells in a nutrient medium, thus permitting the protein, or soluble fragments, to accumulate in the culture.
Soluble protein can be recovered, either from the culture or from the culture medium, and membrane associated proteins may be prepared from suitable cell subfractions.
Now that the genes have been characterized, fragments or derivatives thereof can be~ prepared by conventional processes for synthesizing peptides. These include processes such as are described in Stewart and Young (1984) Solid Phase Peptide ~~mthesis, Pierce Chemical Co., Rockford, IL; Bodanszky and Bodanszky (1984) The Practice of Peptide synthesis, Springer-Verlag, New York; and Boda.nszky (1984) The Principles of Peptide Synthesis, Springer-Verlag~, New York. For example, an azide process, an acid chloride process, an acid anhydride process, a mixed anhydride process, a.n active ester process (for example, p-nitrophenyl ester, N-hydrc~xysuccinimide ester, or cyanomethyl ester), a carbodiimidazole~ process, an oxidative-reductive process, or a dicyclohexyl.carbodiimide (DCCD)/additive process can be used. Solid phase and solution phase syntheses are both applicable to the foregoing processes.
The proteins, fragments, or derivatives are suitably prepared in accordance with the above processes as typically employed in peptide synthesis, generally either by a so-called stepwise process which comprises cc>ndensing an amino acid to the terminal amino acid, one by one in sequence, or by coupling peptide fragments to the terminal amino acid. Amino groups that are not SUBSTITUTE SHEET ( rule 26 ) being used in the coupling reaction are typically protected to prevent coupling at an incorrect location.
If a solid phase synthesis is adopted, the C-terminal amino acid is bound to an insoluble carrier or support through its carboxyl group. The insoluble carrier is not particularly limited as long as it has a binding capability to a reactive carboxyl group. Examples of such insoluble carriers include halomethyl resins, such as chlorometh~yl resin or bromomethyl resin, hydroxymethyl resins, phenol resins, tert-alkyloxycarbonyl-hydrazidated resins, and t:he like.
An amino group-protected amino acid is bound in sequence through condensation of its activated carboxyl group and the reactive amino group of the previously formed peptide or chain, to synthesize the peptide step by step. After synthesizing the complete sequence, the peptide is split off from the insoluble carrier to produce the peptide. This solid-phase approach is generally described by Mer:rifield et al. (1963) in J. Am. Chem.
Soci 85:2149-2156, which is incorporated herein by reference.
The prepared protein and fragments thereof can be isolated and purified from the reaction mixture by means of peptide separation, e.g., by extraction, precipitation, electrophoresis and various forms of chromatography, and the like. The proteins of this invention can be obtained in varying degrees of purity depending upon its desired use. Purification can be accomplished by use of the protein purification techniques disclosed herein or by the use of the antibodies herein described in immunoabsorbent affinity chromatography. ~rhis immunoabsorbent affinity chromatography is carried out by first linking the antibodies to a solid support and then contacting the linked antibodies with solubilized lysates of appropriate source cells, lysates of other cells expressing the protein, or lysates or supernatants of cells producing the desired protein as a result of DNA techniques, see below. Detergents may be necessary to include in the methods to maintain protein solubility .
VIII. Uses SUBSTITUTE SHEET ( rule 26 ) The present invention provides reagents which will find use in diagnostic application; as described elsewhere herein, e.g., in the general description for cell mediated conditions, or below in the description of kits for diagnosis. The genes will be useful in forensic analyses, e.g., to identify species, or to diagnose different cell subsets or types.
If DC-PGT is used to clear prostaglandins (PGs) and other metabolically active organic anions from the body (in the liver, fetal liver, lung and placenta) it is easy to suppose that an alteration in the capacit~l of this mechanism could augment the allergic response. Prostaglandin PGF2a and PGD2, and PGG2 and thrombaxane A2 can cause <~irway obstruction, particularly in the peripheral lung, while PGE2 and PGI2 are bronchodilators. Use of the transporter of the invention could help transport or remove these prostaglandins to modulate airway obstruction.
Additionally, prostaglandins play an important role in secondary immunosuppression seen following surgical stress.
Alexander (1990) J.~'raum-a_ 30:570; Faist, et al. (1987) J. Trauma 27:837; Ninneman, et al. (1984) J. Trauma 24:201; Wood, et al.
(1987) Arch. Surg~i 122:179; Polk, et al. in Eremin and Sewell (eds. 1992) The Immunoloqical Basis of Surgical Science and PracticeL Oxford U. Press. In particular, PGE2 inhibits lymphocyte proliferation, decreases IL-2 release, decreases response to IL-2, inhibits natural killer cells, and activates supressor cells. Major injury has been shown to result in increased production of P(3E2 from inhibitory macrophages, with a resulting decrease in production of IL-1 and IL-2. This effect may persist for 7 to 10 days after major injury. Other studies have shown no increase in circulating PGE2 following burns but did find increased local production with increased sensitivity of lymphocytes to the action of PGE2.
Prostaglandin E2, through locally produced vasodilatory effects, may play a role :in rheumatoid arthritis by promoting the entry of inflammatory cells into the joint. Once in the synovial fluid, polymorphonuclear :leukocytes can ingest immune complexes, which, in turn, cause neutrophils to produce reactive oxygen SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PGT/US99/123bb metabolites and other inflammatory mediators to further enchance an inflammatory cascade. Henson, et al. (1987) ~T. Clin. Invest.
79:699.
Accordingly, it is possible to use the present invention to 5 modulate prostaglandins in a subject suffering from trauma, injury, disease or in post.-surgical treatments.
Immune system cells may be synthesizing PGs and thus using DC-PGT in an efflux role f:or removing PGs from the intracellular space may be useful. Equally,. DC-PGT might transport a specific 10 organic anion. Abnormal proliferation, regeneration, degeneration, and atrophy may be modulated by appropriate therapeutic treatment using the compositions provided herein. For example, a disease or disorder associated with abnormal function of a prostaglandin transporter should be a likely target for a 15 substrate or blocking substrate. Alternatively, the transporter may be a useful means for supplying important metabolites or metabolite blockers to the respective cells.
For example, transformation with the transporter may increase availability of the substrate to the cell. In certain situations, 20 a prostaglandin analog might be advantageously supplied to the cell. The prostaglandin analog might confer high susceptibility to further treatment, e.g., radiation sensitivity or otherwise, or may directly affect normal. metabolism, e.g., nucleic acid related enzymes. Alternatively, the transporter may be useful to screen 25 for antagonists or inhibitors, which might be effective in blocking the normal availability to the cell of the natural substrate. Screening methods for such prostaglandin analogs are provided.
Screening using prostaglandin transporter for binding 30 metabolites or compounds rAaving binding affinity to the transporter can be performed, including isolation of associated components. Subsequent biological assays can then be utilized to determine if the compound has intrinsic biological activity and is therefore an agonist or antagonist in that it blocks an activity 35 of the transporter. In particular, prostaglandin analogs may be useful in blocking binding of the natural target or otherwise blocking transporter activity. Alternatively, various other SUBSTITUTE SHEET ( rule 26 ) analogs may be useful in :blocking an ion transporter, or organic anion source. This invention further contemplates the therapeutic use of antibodies to prostaglandin transporter as antagonists.
This approach should be particularly useful with other prostaglandin transporter species variants and other members of the family.
Antagonists of the transporter activity, e.g., antibodies which block the transport, may be useful in various medical conditions. These would .include immune, inflammatory or allergic abnormalities, all of which are important where transfer of organic anions take place. Certain congenital diseases of prostaglandin physiology will be susceptible to such a therapeutic approach.
The HDTEA84, HSLJD37R, RANKL, HCC5, I~-1, or I~-2 (naturally occurring or recombinant), fragments thereof, and antibodies thereto, along with compounds identified as having binding affinity to them, should loe useful in the treatment of conditions associated with abnormal physiology or development, including abnormal proliferation, e.g., cancerous conditions, or degenerative conditions. In particular, modulation of development of lymphoid cells will be achieved by appropriate therapeutic treatment using the compositions provided herein. For example, a disease or disorder associated with abnormal expression or abnormal signaling by a l:igand or receptor should be a likely target for an agonist or antagonist of the antigen. The antigen plays a role in regulation or development of hematopoietic cells, e.g., lymphoid cells, which affect immunological responses, e.g., autoimmune disorders.
In particular, the antigen may provide a costimulatory signal to cell activation, or be involved in regulation of cell proliferation or differentiation. Thus, the HDTEA84, HSLJD37R, RANKL, HCCS, MD-1, or 1~-:2 will likely modulate cells which possess a receptor therefor, e.g., T cell mediated interactions with other cell types. These interactions would lead, in particular contexts, to modulation of cell growth, cytokine synthesis by those or other cells, or development of particular effector cells.
SUBSTITUTE SHEET ( rule 26 ) Moreover, the HDTEA84, HSLJD37R, R.ANKL, HCCS, MD-1, or MD-2 or antagonists could redix:ect T cell responses, e.g., between Th1 and Th2 polarization, or with Th0 cells, or may affect B cells or other lymphoid cell subseta. Among these agonists should be various antibodies which x-ecognize the appropriate epitopes, e.g., which mimic binding of lic~and or receptor to its partner.
Alternatively, they may bind to epitopes which sterically can block receptor binding. F3one morphogenesis may be regulated by these receptor segments.
The ligands or receptors may provide a selective and powerful way to modulate immune re~~ponses in abnormal situations, e.g., autoimmune disorders, including rheumatoid arthritis, systemic lupus erythematosis (SLE), Hashimoto's autoimmune thyroiditis, as well as acute and chronic inflammatory responses in which T cell activation, expansion, and/or immunological T cell memory play an important role. See also Samter, et al. (eds) Immunological Diseases vols. 1 and 2, Little, Brown and Co. Regulation of bone morphogenesis, T cell activation, expansion, and/or cytokine release by the naturally accurring secreted form of HDTEA84, HSLJD37R, RANKL, HCCS, MD-~1, or MD-2, or an antagonist thereaf, may be effected.
In addition, certain combination compositions with other modulators of signaling wauld be useful, especially with the TNF
receptor-like genes. Such other signaling molecules might include, e.g., TCR reagents, CD40, CD40L, CTLA-8, CD28, SLAM, FAS, osteoprotegerin, and their respective antagonists, including antibodies.
Cyclin E2 nucleotide:, e.g., human cyclin E2 DNA or RNA, may be used as a component in a forensic assay. For instance, the nucleotide sequences provided may be labeled using, e.g., 32P or biotin and used to probe standard restriction fragment polymorphism blots, providing a measurable character to aid in distinguishing between individuals. Such probes may be used in well-known forensic techniques such as genetic fingerprinting. In addition, nucleotide probes made from cyclin E2 sequences may be used in in situ assays to detect chromosomal abnormalities. For instance, rearrangements i.n the human chromosome encoding a cyclin SUBSTITUTE SHEET ( rule 2b ) E2 gene may be detected vi.a well-known in situ techniques, using cyclin E2 probes in conjunction with other known chromosome markers. The cyclin E2 gene may have useful prognostic utility in various cancers, e.g., breast, etc.
Antibodies and other binding agents directed towards cyclin E2 proteins or nucleic acids may be used to purify the corresponding cyclin E2 molecule. As described in the Examples below, antibody purification of cyclin E2 protein components is both possible and practicable.. Antibodies and other binding agents may also be used in. a diagnostic fashion to determine whether cyclin E2 protein components are present in a tissue sample or cell population using well-known techniques described herein. The ability to attach a binding agent to a cyclin E2 protein provides a means to diagnose disorders associated with cyclin E2 protein misregulation. Antibodies and other cyclin E2 protein binding agents may also be useful as histological markers.
As described in the examples below, cyclin E2 protein expression is limited to specific tissue types. By directing a probe, such as an antibody or nucleic acid to a cyclin E2 protein it is possible to use the probe to distinguish tissue and cell types in situ or in vitro.
This invention also provides reagents with significant therapeutic value. The cyclin E2 protein (naturally occurring or recombinant), fragments thereof, and antibodies thereto, along with compounds identified as having binding affinity to a cyclin E2 protein, can be useful in the treatment of conditions associated with abnormal physiology or development, including abnormal proliferation, e.g., cancerous conditions, or degenerative conditions. Abnormal proliferation, regeneration, degeneration, and atrophy may be modulated by appropriate therapeutic treatment using the compositions provided herein. For example, a disease or disorder associated with abnormal expression or abnormal signaling by a cyclin E2 protein is a target for an agonist or antagonist of the protein. The proteins likely play a role in regulation or development of neuronal or hematopoietic cells, e.g., lymphoid cells, which affect immunological responses.
SUBSTITUTE SHEET ( rule 26 ) Various abnormal conditions are known in each of the cell types shown to possess, e.g., HDTEA84, mRNA by Northern blot analysis. See Berkow (ed.) The Merck Manual of Diacrnosis an,~
T er , Merck & Co., Rahway, NJ; Thorn, et al. Harrison's Principled of Internal Medicine, McGraw-Hill, NY; and Weatherall, et al. (eds.) Oxford Tex,~book of Medicine, Oxford University Press, Oxford. Many other medical conditions and diseases involve T cells or are T cell mediated, and many of these may be responsive to treatment by an agonist or antagonist provided.
herein. See, e.g., Stite;s and Terr (eds; 1991) Basic and Clinical nunoloav Appleton and L<~nge, Norwalk, CT; and Samter, et al.
(eds) Immunological Diseases Little, Brown and Co. These problems should be susceptible to prevention or treatment using compositions provided herein.
Specific, or selective, antibodies can be purified and then administered to a patient, veterinary or human. These reagents can be combined for therapeutic use with additional active or inert ingredients, e.g., :in conventional pharmaceutically acceptable carriers or di:Luents, e.g., immunogenic adjuvants, along with physiologicall~,r innocuous stabilizers, excipients, or preservatives. These combinations can be sterile filtered and placed into dosage forms as by lyophilization in dosage vials or storage in stabilized aqueous preparations. This invention also contemplates use of antibodies or binding fragments thereof, including forms which are not complement binding.
Drug screening using proteins or fragments thereof can be performed to identify compounds having binding affinity to or other relevant biological effects on antigen functions, including isolation of associated components. Subsequent biological assays can then be utilized to determine if the compound has intrinsic stimulating activity or i:~ a blocker or antagonist in that it blocks the activity of the antigen, e.g., mutein antagonists.
Likewise, a compound having intrinsic stimulating activity can activate the signal pathway and is thus an agonist in that it overcomes any blocking activity of these soluble forms of receptors. This invention further contemplates the therapeutic use of blocking antibodies to ligands or receptors as agonists or SUBSTITUTE SHEET ( rule 26 ) antagonists and of stimulatory molecules, e.g., muteins, as agonists. This approach should be particularly useful with other soluble receptor species ~,rariants.
Another therapeutic approach included within the invention 5 involves direct administration of reagents or compositions by any conventional administration techniques (e. g., but not restricted to local injection, inhalation, or administered systemically), to the subject with an immune, allergic, or trauma disorder. The reagents, formulations, or compositions included within the bounds 10 and metes of the invention may also be targeted to specific cells or transporters by methods described herein. The actual dosage of reagent, formulation, or composition that modulates an immune, allergic, or trauma disorder depends on many factors, including the size and health of an organism, however one of ordinary skill 15 in the art can use the following teachings describing the methods and techniques for determining clinical dosages. See, e.g., Spilker (1984) Guide to C:Linical Studies and Develoning~ Protocols Raven Press Books, Ltd., New York, pp. 7-13, 54-60; Spilker (1991) Guide to Clinical Trials, Raven Press, Ltd., New York, pp. 93-101;
20 Craig and Stitzel (eds. 1986) Modern Pharmacology. 2d ed., Little, Brown and Co., Boston, pp.. 127-33; Speight (ed. 1987) Avery's Drucr treatment: Principles and1'ractice of Clinical Pharmacology and therapeutics, 3d ed., Williams and Wilkins, Baltimore, pp. 50-56;
Tallarida, et al. (1988) Principles in General Pharmacology, 25 Springer-Verlag, New York,, pp. 18-20). Generally, the dose will be in the range of about between 0.5 fg/ml and 500 ~.g/ml, inclusive, final concentration administered per day to an adult in a pharmaceutically acceptable carrier.
The quantities of re<~gents necessary for effective therapy 30 will depend upon many different factors, including means of administration, target sine, physiological state of the patient, and other medicants administered. Thus, treatment dosages should be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful 35 for ~ situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide SUBSTITLrTE SHEET ( rule 26 ) further predictive indication of human dosage. Various considerations are described, e.g., in Gilman, et al. (eds. 1990) Gaadman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Reminaton's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Penn. Methods for administration are discussed, e.g., for oral, intravenous, intraperitoneal, or intramuscular administration, transdermal diffusion, and others. Pharnnaceutically acceptable carriers will include water, saline, buffers; and other compounds described, e.g., in the erck index, Merck & Co., Rahway, New Jersey. Dosage ranges would ordinarily bE~ expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ),tM concentrations, usually less than about 100 nM, preferably less than about 10 pM
(picomolar), and most preferably less than about 1 fM
(femtomolar), with an appropriate carrier. Slow release formulations, or a slow release apparatus will often be utilized for continuous or long term administration. See, e.g., Langer (1990) Science 249:1527-1~i33.
Ligands, receptors, enzymes, fragments thereof, and antibodies to it or its fragments, antagonists, and agonists, may be administered directly too the host to be treated or, depending on the size of the compounds, it may be desirable to conjugate them to carrier proteins such as ovalbumin or serum albumin prior to their administration. Therapeutic formulations may be administered in many conventional dosage formulations. While it is possible for the active ingredient to be administered alone, it is preferable to present it as a pharmaceutical formulation.
Formulations typically comprise at least one active ingredient, as defined above, together with one or more acceptable carriers thereof. Each carrier should be both pharmaceutically and physiologically acceptablE~ in the sense of being compatible with the other ingredients and not injurious to the patient.
Formulations include those' suitable for oral, rectal, nasal, topical, or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration. The formulations may conveniently be presented in unit dosage form and may be prepared by methods well known in t:he art of pharmacy. See, e.g., Gilman, SUBSTITI~TE SHEET ( rule 26 ) et al. (eds. 1990) Goodman anc~ Gilman's~ The Pharmacological Bases of Therapeutics, 8t',h Ed., Pergamon Press; and Reminaton's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Penn.; Avis, et a:l. (eds. 1993) Pharmaceutical Dosage Fgxms: Parenteral Medications, Dekker, New York; Lieberman, et al.
(eds. 1990) Pharmaceutical Dosage Forms: Tablets, Dekker, New York; and Lieberman, et a:l. (eds. 1990) Pharmaceutical Dosage Forms: Disperse Svstems, Dekker, New York. The therapy of this invention may be combined with or used in association with other agents, e.g., other modul<~tors of cell activation, e.g., CD40, CD40 ligand, CD28, CTLA-4, B7, B70, SLAM, T cell receptor signaling entities, or tha_ir respective antagonists.
Both the naturally occurring and the recombinant forms of the proteins of this invention are particularly useful in kits and assay methods which are c<~pable of screening compounds for binding activity to the proteins. Several methods of automating assays have been developed in recent years so as to permit screening of tens of thousands of compounds in a short period. See, e.g., Fodor, et al. (1991) Science 251:767-773, which describes means for testing of binding af:Einity by a plurality of defined polymers synthesized on a solid substrate. The development of suitable assays can be greatly facilitated by the availability of large amounts of purified, soluble proteins or nucleic acids as provided by this invention.
Other methods can be used to determine the critical residues in the substrate, ligand, or receptor binding interactions.
Mutational analysis can be performed, e.g., see Somoza, et al.
(1993) J. Exp. Med. 178:549-558, to determine specific residues critical in the interaction and/or signaling. This will allow study of both extracellular domains, involved in the soluble ligand interaction, or intracellular domain of a transmembrane form, which provides interactions important in intracellular signaling.
For example, antagonists can normally be found once the antigen has been structurally defined, e.g., by tertiary structure data. Testing of potential interacting analogs is now possible SUBSTITUTE SHEET ( rule 26 ) upon the development of highly automated assay methods using a purified protein. In particular, new agonists and antagonists will be discovered by using screening techniques described herein.
Of particular importance are compounds found to have a combined binding affinity for a spE~ctrum of protein molecules, e.g., compounds which can serve as antagonists for species variants of the antigens.
One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant DNA molecules expressing desired protein. Cells may be isolated which express a selected protein in isolation from other molecules. Such cells, either in viable or fixed form, can be used for standard bind_Lng partner binding assays. See also, Farce, et al. (1989) science 246:243-247; and Owicki, et al.
(1990) Proc. Nat'1 Acad. Sci. USA 87:4007-4011, which describe sensitive methods to detect cellular responses.
Another technique fo:r drug screening involves an approach which provides high throughput screening for compounds having suitable binding affinity to a desired target protein, and is described in detail in Geysen, European Patent Application 84/03564, published on September 13, 1984. First, large numbers of different small peptides test compounds are synthesized on a solid substrate, e.g., plastic pins or some other appropriate surface, see Fodor, et al. (1991). Then the pins are reacted with solubilized, unpurified or solubilized, purified target protein, and washed. The next step involves detecting bound protein.
Rational drug design may also be based upon structural studies of the molecular shapes of the protein and other effectors or analogs. Effectors ma~T be other proteins which mediate other functions in response to binding, or other proteins which normally interact. One means for determining which sites interact with specific other proteins is a physical structure determination, e.g., x-ray crystallography or 2 dimensional NMR techniques.
These will provide guidance as to which amino acid residues form molecular contact regions. For a detailed description of protein structural determination, see, e.g., Blundell and Johnson (1976) Protein Crvstallographv, Academic Press, New York.
SUBSTITU~~TE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 IX. Kits This invention also contemplates use of the proteins, fragments thereof, peptides, and their fusion products in a variety of diagnostic kits and methods for detecting, e.g., the presence of protein or binding partner. Typically the kit will have a compartment containing either a described polypeptide or gene segment or a reagent which recognizes one or the other, e.g., fragments or antibodies. Alternatively, kits may be nucleic acid based.
A kit for determining the binding affinity of a test compound to, e.g., an HDTEA84, would typically comprise a test compaund; a labeled compound, for example a binding partner or antibody having known binding affinity fo:r HDTEA84; a source of HDTEA84 (naturally occurring or recombinant); and a means for separating bound from free labeled compound, su~~h as a solid phase for immobilizing the molecule. Once compounds are screened, those having suitable binding affinity to the antigen can be evaluated in suitable biological assays, as are well known in the art, to determine whether they act as agonists or antagonists to the HDTEA84 signaling pathway. The availability of recombinant HDTEA84 polypeptides also provide well defined standards for calibrating such assays.
A preferred kit for determining the concentration of, e.g., an HDTEA84 in a sample would typically comprise a labeled compound, e.g., binding partner or antibody, having known binding affinity for the antigen, a source of antigen (naturally occurring or recombinant) and a means for separating the bound from free labeled compound, e.g., a solid phase for immobilizing the HDTEA84. Compartments containing reagents, and instructions, will normally be provided.
Antibodies, including antigen binding fragments, specific for, e.g., the HDTEA84 or fragments, are useful in diagnostic applications to detect the presence of elevated levels of HDTEA84 and/or its fragments. Such diagnostic assays can employ lysates, live cells, fixed cells, immunofluorescence, cell cultures, body fluids, and further can involve the detection of antigens related SUBSTITLfTE SHEET ( rule 26 ) WO 00/01817 PC'f/US99/12366 to the antigen in serum, or the like. Diagnostic assays may be homogeneous (without a separation step between free reagent and antigen-binding partner complex) or heterogeneous (with a separation step). Various. commercial assays exist, such as 5 radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), enzyme-multiplied immunoassay technique (EMIT), substrate-labeled fluorescent immunoassay (SLFIA), and the like. See, e.g., Van Vuna.kis, et al. (1980) Meth Enzymol. 70:1-525; Harlow and Lane (1980) Antibodies: A Laboratory Manual, CSH
10 Press, NY; and Coligan, et al. (eds. 1993) Current Protocols in Immunolouv, Greene and Wiley, NY.
Anti-idiotypic antibodies may have similar use to diagnose presence of antibodies against a described protein, as such may be diagnostic of various abnormal states. Overproduction of 15 prostaglandin transporter may reflect various medical conditions, which may be diagnostic of abnormal physiological states, particularly in proliferative cell conditions such as cancer or abnormal differentiation. For example, leukemias and lymphomas may exhibit altered transporter expression, which may reflect 20 their altered physiology and may provide means to selectively target. Alternatively, overproduction of HDTEA84, HSLJD37R, R.ANKL, HCC5, MD-1, or MD-2 may result in production of various immunological reactions which may be diagnostic of abnormal physiological states, particularly in proliferative cell 25 conditions such as cancer or abnormal activation or differentiation. Expression levels of DC-PGT, Dubs, or cyclin E2 may likewise be diagnostic of specific therapeutic conditions, advantageous or disadvantageous.
Frequently, the reagents for diagnostic assays are supplied 30 in kits, so as to optimize the sensitivity of the assay. For the subject invention, depending upon the nature of the assay, the protocol, and the label, either labeled or unlabeled antibody or binding partner, or labeled HDTEA84 is provided. This is usually in conjunction with other additives, such as buffers, stabilizers, 35 materials necessary for signal production such as substrates for enzymes, and the like. Preferably, the kit will also contain instructions for proper us;e and disposal of the contents after SUBSTITUTE SHEET ( rule 26 ) use. Typically the kit has compartments for each useful reagent.
Desirably, the reagents are provided as a dry lyophilized powder, where the reagents may be reconstituted in an aqueous medium providing appropriate concentrations of reagents for performing the assay.
Many of the aforementioned constituents of the drug screening and the diagnostic assays may be used without modification or may be modified in a variety c>f ways. For example, labeling may be achieved by covalently or non-covalently joining a moiety which directly or indirectly provides a detectable signal. In these assays, the binding partner, test compound, HDTEA84, or antibodies thereto can be labeled either directly or indirectly.
Possibilities for direct labeling include label groups:
radiolabels such as 1251, enzymes (U. S. Pat. No. 3,645,090) such as peroxidase and alkaline' phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) capable of monitoring the change in fluorescence intensity, wavelength shift, or fluorescence polarization. Possibilities for indirect labeling include biotinylation of one constituent followed by binding to avidin coupled to one of the above label groups.
There are also numerous methods of separating the bound from the free polypeptide, or alternatively the bound from the free test compound. The polypeptide can be immobilized on various matrixes followed by washing. Suitable matrices include plastic such as an ELISA plate, f~.lters, and beads. See, e.g., Coligan, et al. (eds. 1993) Current Protocols in Immunology, VoI. 1, Chapter 2, Greene and Wiley, NY. Other suitable separation techniques include, without limitation, the fluorescein antibody magnetizable particle method described in Rattle, et al. (1984) Clin. Chem. 30:1457-1461, and the double antibody magnetic particle separation as described in U.S. Pat. No. 4,659,678.
Methods for linking proteins or their fragments to the various labels have been extensively reported in the literature and do not require detailed discussion here. Many of the techniques involve the use' of activated carboxyl groups either through the use of carbodiimide or active esters to form peptide bonds, the formation of thioethers by reaction of a mercapto group SUBSTITI:~TE SHEET ( rule 26 ) with an activated halogen such as chloroacetyl, or an activated olefin such as maleimide, for linkage, or the like. Fusion proteins will also find use in these applications.
Another diagnostic aspect of this invention involves use of oligonucleotide or polynucleotide sequences taken from the sequence of a described protein. These sequences can be used as probes for detecting levels of the message in samples from patients suspected of having an abnormal condition, e.g., cancer or developmental problem. Since the antigen is a marker for activation, it may be useful to determine the numbers of activated T cells to determine, e.g., when additional suppression may be called for. The preparation of both RNA and DNA nucleotide sequences, the labeling of the sequences, and the preferred size of the sequences has received ample description and discussion in the literature. See, e.g., Langer-Safer, et al. (1982) roc.
Nat'l. Acad. Sci. 79:4381-4385; Caskey (1987) Science 236:962-967;
and Wilchek, et al. (1988) Anal. Biochem. 171:1-32.
Alternatively, antibodies may be employed which can recognize specific duplexes, including DNA duplexes, RNA duplexes, DNA-RNA
hybrid duplexes, or DNA-p:ratein duplexes. The antibodies in turn may be labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. The use of probes to the novel anti-sense RNA may be carried out in any conventional techniques such as nucleic acid hybridization, plus and minus screening, recombinational probing, hybrid released translation (HRT), and hybrid arrested translation (HART). This also includes amplification techniques such as polymerase chain reaction (PCR).
Diagnostic kits which also test for the qualitative or quantitative presence of other markers are also contemplated.
Diagnosis or prognosis may depend on the combination of multiple indications used as markers. Thus, kits may test for combinations of markers. See, e.g., V:iallet, et al. (1989) Proaress in Growth Factor Res. 1:89-97. Other kits may be used to evaluate T cell subsets.
SUBSTITUTE SHEET ( ruie 26 ) X. Methods for Isolating Substrates/Specific Partners The DC-PGT should interact with its substrate target. The substrate will be similar to the organic molecules which are subject to transport. The Dubs and cyclin E2 will also be screened for substrate identification.
The HDTEA84, HSLJD31R, and RANKL protein should interact with a TNF ligand, based, e.g., upon its similarity in structure and function to other cell surface antigens exhibiting similar structure and cell type specificity of expression. The MD-1 and MD-2 antigens are related to known proteins, which interact with B
cell antigens. Methods to isolate a ligand are made available by the ability to make purified protein for screening programs.
Similar techniques will be applicable to the HCC5 chemokine, and the MD-1 and MD-2 surface receptors.
Sequences provided herein will allow for screening or isolation of specific ligands. Many methods exist for expression cloning, panning, affinity isolation, or other means to identify a ligand. A two-hybrid selection system may also be applied making appropriate constructs with the available sequences, as appropriate. See, e.g., Fields and Song (1989) Nature 340:245-246.
The broad scope of this invention is best understood with reference to the following examples, which are not intended to limit the invention to specific embodiments.
SUBSTITUTE SHEET ( rule 26 ) EXAMPLES
General Methods Some of the standard methods are described or referenced, e.g., in Maniatis, et al. (1982) Molecular Clonincr, A Laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Press;
Sambrook, et al. (1989) Molecular Clonina: A Laboratory Manua_~. (2d ed.), vols. 1-3, CSH Press,, NY; Ausubel, et al., Bi o , Greene Publishing Associates, Brooklyn, NY; or Ausubel, et al. (1987 and Supplements) Current Protocols in Molecular Bioloav, Greene and Wiley, New York; Innis, et. al. (eds. 1990) PCR Protocols: A Guide t~ Methods and Applications, Academic Press, N.Y. Methods for protein purification include such methods as ammonium sulfate precipitation, column chromatography, electrophoresis, centrifugation, crystalli~:ation, and others. See, e.g., Ausubel, et al. (1987 and periodic supplements); Deutscher (1990) "Guide to Protein Purification" in Methods in Enzymol. vol. 182, and other volumes in this series; arid manufacturer's literature on use of protein purification products, e.g., Pharmacia, Piscataway, N.J., or Bio-Rad, Richmond, CA. Combination with recombinant techniques allow fusion to appropriate segments, e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence. See, e.g., Hochuli (1990) "Purification of Recombinant Proteins with Metal Chelat:e Absorbent" in Setlow (ed.) Genetic Enctineeringj Principle and Methods 12:87-98, Plenum Press, N.Y.;
and Crowe, et al. (1992) QIAexpress: The High Level Exaression &
Protein Purification System QIAGEN, Inc., Chatsworth, CA. Cell culture techniques are described in Doyle, et al. (eds. 1994) Cell and Tissue Culture Laboratory Procedures, John Wiley and Sons, NY.
Standard immunological techniques are described, e.g., in Hertzenberg, et al. (eds. 1996) Weir's Handbook of Experimental Immunolocrv vols. 1-4, Blackwell Science; Coligan (1991) Current Protocols in Immunology Wiley/Greene, NY; and Methods in Enzymoloav volumes. 70, 73, 74, 84, 92, 93, 108, 116, 121, 132, 150, 162, and 163.
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 FRCS analyses are described in Melamed, et al. (1990) Flow Cytometr3r and Sorting Wiley-Liss, Inc., New York, NY; Shapiro (1988) Practical Flow Cvt:ometrv Liss, New York, NY; and Robinson, et al. (1993) Handbook oi_ Flow Cytometry Methods Wiley-Liss, New 5 York, NY. Fluorescent labeling of appropriate reagents was performed by standard methods.
The FASTA (Pearson and Lipman, 1988) and BLAST (Altschul, et al. (1990) J. Mol. Biol. 215:403-410) programs were used to comb nonredundant protein and nucleotide databases (Benson, et a1.
10 (1994) Nucl. Acids Res. 22:3441-3444; Bairoch and Boeckmann (1994) Nucl. Acids Res. 22:3578-3580) with the resultant cDNA and encoded protein sequences. The sensitive search strategies of Altschul, et al. (1994) Nature Genet. 6:119-129; and Koonin, et al. (1994) EMBO J. 13:493-503; served as examples of how to locate distant 15 structural homologues of protein chains. Multiple alignments of collected homologues were carried out with ClustalW (Thompson, et al. (1994) Comp. Applic. Biosci. 10:19-29) and MACAW (Schuler, et al. (1991) Proteins 9:180-190).
The membrane topologies of proteins, e.g., DC-PGT, and a 20 cohort of putative homologues were analyzed by a variety of methods that sought to determine the consensus number of domains, e.g., hydrophobic membrane-spanning helices and the likely cytoplasmic or extracellular exposure of the hydrophilic connecting loops. For single sequence analysis, the ALOM and MTOP
25 (Klein, et al. (1985) Bio~chim. Biophys. Acta 815:468-476; and Hartmann, et al. (1989) P:roc Natl Acad Sci USA 86:5786-5790) programs were accessed from the PSORT World-Wide Web site (Nakai and Kanehisa (1991) Proteins 11:95-110; and Nakai and Kanehisa (1992) Genomics 14:897-91:1); in turn, the TopPredII program 30 (Claros and von Heijne (1994) Comp Applic Biosci 10:685-686;
Macintosh PPC version) wars used to parse chains into probable hydrophobic transmembrane and loop regions of DC-PGT, and further predict the localization of these latter regions by prevalence of charged residue types (von Heijne (1992) J. Mol. Biol. 225:487-35 494; and Sippos and von Heijne (1993) Eur. J. Biochem 213:1333-SUBSTITUTE SHEET ( rule 26 ) 1340). MEMSAT (Jones, et al. (1994) Biochem. 33:3038-3049r MS-DOS
PC version) was likewise 'used to fit individual sequences into statistically-based topology models that render judgment on membrane spanning and loop chain segments. Two Web-accessible programs that are able to make use of evolutionary data by analyzing multiply aligned sequences are PHD (Rost, et al. (1994) Comb Agplic Biosci 10:'.3:3-60; and Rost, et al. (1995) Protein ci. 4:521-533) and TMAP (Persson and Argos (1994) J. Mol. Biol.
237:182-192); the former utilizes a neural network system to accurately predict the shared location of helical transmembrane segments in a protein family. Similar analysis of other proteins can be performed.
I. Generation of Dendritic Cells Human CD34+ cells area obtained as follows. See, e.g., Caux, et al. (1995) pages 1-5 in Banchereau and Schmitt Dendritic Cells Fundamental and Clinical Immunoloav Plenum Press, NY.
Peripheral or cord blood cells, sometimes CD34+ selected, are cultured in the presence of Stem Cell Factor (SCF), GM-CSF, and TNF-a in endotoxin free RPMI 1640 medium (GIBCO, Grand Island, NY) supplemented with 10~ (v/v) heat-inactivated fetal bovine serum (FBS; Flow Laboratories, Irvine, CA), 10 mM HEPES, 2 mM L-glutamine, 5 X 10-5 M 2-me~rcaptoethanol, penicillin (100 ).~.g/ml).
This is referred to as complete medium.
CD34+ cells are seeded for expansion in 25 to 75 cm2 flasks (Corning, NY) at 2 x 104 cells/ml. Optimal conditions are maintained by splitting these cultures at day 5 and 10 with medium containing fresh GM-CSF anal TNF-a (cell concentration: 1-3 x 105 cells/ml). In certain cases, cells are FRCS sorted for CDla expression at about day 6.
In certain situations., cells are routinely collected after 12 days of culture, eventually adherent cells are recovered using a 5 mM EDTA solution. In other situations, the CDla+ cells are activated by resuspension in complete medium at 5 x 106 cells/ml and activated for the appropriate time (e.g., 1 or 6 h) with 1 SUBSTITUTE SHEET ( rule 26 ) ~Lg/ml phorbol 12-myristat.e 13-acetate (PMA, Sigma) and 100 ng/ml ionomycin (Calbiochem, La. Jolla, CA). These cells are expanded for another 6 days, and RNA isolated for cDNA library preparation.
Other specific cell types may be similarly isolated.
II. RNA Isolation and Library Construction Total RNA is isolated using, e.g., the guanidine thiocyanate/CsCl gradient procedure as described by Chirgwin, et al. (1978) Biochem. 18:5294-5299.
Alternatively, poly(A)+ RNA is isolated using the OLIGOTEX
mRNA isolation kit (QIAGRI~}. Double stranded cDNA are generated using, e.g., the SUPERSCRIPT plasmid system (Gibco BRL, Gaithersburg, MD) for cDNA synthesis and plasmid cloning. The resulting double stranded cDNA is unidirectionally cloned, e.g., into pSportl and transfected by electroporation into ELECTROMAX
DHlOBTM Cells (Gibco BRL, Gaithersburg, MD).
III. Sequencing DNA isolated from randomly picked clones, or after subtractive hybridization using inactivated cells, are subjected to nucleotide sequence analysis using standard techniques.
Alternatively, selected isolated clones can be selected. A Taq DiDeoxy Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) can be used. The labeled DNA fragments are separated using a DNA sequencing gel of an appropriate automated sequencer. Alternatively, the isolated clone is sequenced as described, e.g., in Maniat:is, et al. (Current ed.) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook, et al. (Current ed.) Molecular Cloning: A Laboratory Manual, (2d ed.), vols. 1-3, CSH Press, NY;
Ausubel, et al., Hi , Greene Publishing Associates, Brooklyn, NY; or Ausubel, et al. (Current ed., and Supplements) Currer~
Protocols in Molecular Biolocrv, Greene/Wiley, New York. Chemical sequencing methods are al~;o available, e.g., using Maxim and Gilbert sequencing techniques.
SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/1Z366 IV. Recombinant gene constructs Poly(A)+ RNA is isolated from appropriate cell populations, e.g., using the FastTrack mRNA kit (Invitrogen, San Diego, CA).
Samples are electrophorese:d, e.g., in a 1~ agarose gel containing formaldehyde and transferz-ed to a GeneScreen membrane (NEN
Research Products, Boston, MA). Hybridization is performed, e.g., at 65' C in 0.5 M NaHP04 pH 7.2, 7~ SDS, 1 mM EDTA, and 1~ BSA
(fraction V) with 32P-dCTP labeled DC gene cDNA at 107 cpm/mI.
After hybridization, filters are washed three times at 50° C in 0.2X SSC, 0.1~ SDS, e.g., for 30 min, and exposed to film for 24 h. A positive signal will typically be 2X over background, preferably 5-25X.
The recombinant gene construct may be used to generate a probe for detecting the message. The insert may be excised and used in the detection methods described above. Various standard methods for cross species hybridization and washes are well known in the art. See, e.g., Sambrook, et al. and Ausubel.
V: Gene Cloning The HDTEA84 was assembled by careful analysis of ESTs found in various databases. These ESTs were from cDNA libraries derived from Hodgkin's lymphoma, endothelial cells, keratinocytes, prostate, and cerebellum. PCR primers are designed and synthesized and a PCR product is obtained from any of these libraries. This product is used as a hybridization clone to screen these libraries for a full length clone, which may include a transmembrane segment.
Likewise, the HSLJD37R was identified from sequences derived from cDNA libraries from: smooth muscle, pancreas tumor, adipocytes, HUVEC cells, adult pulmonary, endothelial cells, prostate cell line PC3, microvascular endothelial cells, fetal heart, and dendritic cells,. A GenBank report by Pan, et al. has been submitted. See GenBank Accession 3549263. Other sequences were detected in libraries from: multiple sclerosis lesions, breast, kidney, and germinal center B cells. RT-PCT showed signal in B cells, PBL, granulocyt:es, T cells, monocytes, dendritic cell subpopulations including PDZA/ionomycin treated, U937 cells, JY
SUBSTITUTE SHEET ( ruie 26 ) cells, MRC5 cells, CHA, Jurkat, and YC1 cells. This suggests that the transcript is widely expressed.
RANKL was also identified in cDNA libraries from specific tissues, as described. Likewise, the HCCS chemokine sequence was identified. The Dubl1 and Dubl2 genes were identified, in part, from their similarity to ~;nown Dub1 and Dub2 genes. The MD-1 and MD-2 were identified, in part, from their similarity to the :Ligand for the RP105 gene. The c:yclin E2 was identified based upon its similarity to cyclin E.
VI. Expression Profile To examine DC-PGT mRNA expression standard Northern Blot Analysis using a RT-PCR fragment of DC-PGT were carried out against human tissue, e.g., Northern blots containing approximately 10 to 20 ~g of total RNA are run in formaldehyde gels and transferred to Nytran membranes (Schleicher & Schuell, Keene, NH) by standard methods, and blots were hybridized with a labeled PCR fragment of DC-PGT and washed at 65' C. cDNA can be isolated from cells, embryonic tissues, and adult organs using RNAzol solution (Tel-test, Inc., Friendswood, TX) according to manufacturer's instructions. Large amounts of plasmid DNA
containing differential display PCR products are prepared using the QIAGEN Plasmid Maxi Kit (QIAGEN) following the manufacturer's instructions. Plasmid DNA is cut with EcoRI (Boehringer Mannheim) or BstXI (NE Biolabs, Mass.), gel extracted with the QIAEX gel extraction kit (QIAGEN) and random primed with [32P]dCTP
(Amersham) using the Prime-It II kit (Stratagene, La Jolla, CA), all in accordance with man'ufacturer's instructions. Various primers may be used to guantitate expression of message. Means to block DNA hybridization signal, or RNA isolation, will be applicable to quantitate roughly the amount of expression of appropriate RNAs.
The results revealed mRNA of one band at approximately 9.0 kB, another band at approximately 3.0 kB, and a 4.4 kB size which is consistent with the size predicted for the SEQ ID N0: 1 nucleic acid. The smaller mRNA product band could be an alternatively spliced form of SEQ ID NO: 1. DC-PGT is highly expressed in both SUBSTITUTE SHEET ( rule 26 ) activated and non-activated dendritic cells (DC), activated monocytes, activated granulocytes and adult lung. No expression was found in T or PBL cells (either activated or non-activated).
Minor expression was detected in B cell (both activated and non-5 activated) and limited expression was detected in the brain. The results of the northern analysis suggests an expression in macrophages, rather than monocytes (Kuppfer cells in the liver, microglial cells in the brain, alveolar macrophages in the lung) particularly as there is r~o expression in PBL. Southern 10 expression analysis carried out using common techniques confirmed the expression pattern revealed in the Northern analysis.
For example, the DC-~PGT tissue distribution seems to have highest mRNA levels in kidney, placenta, liver, bone marrow, thymus, spleen, lung, and. some in testis. This distribution 15 corresponds to organs with especially important ion exchange features, e.g., Na, K, or Ca, or in hematopoietic organs.
Generally, the expression. is higher in fibroblast and hematopoietic cells compared to neuronal cells.
A probe specific for cDNA encoding the HDTEA84, HSLJD37R, or 20 RANKL is used to determine tissue distribution of message encoding the antigen. Standard hybridization probes may be used to do a Northern analysis of RNA from appropriate sources, either cells, e.g., stimulated, or in various physiological states, in various tissues, e.g., spleen, liver, thymus, lung, etc., or in various 25 species. Southern analysis of cDNA libraries may also provide valuable distribution information. Standard tissue blots on species blots are commercially available. Similar techniques will be useful for evaluating diagnostic or medical conditions which may correlate with expression in various cell types.
30 PCR analysis using appropriate primers may also be used.
Antibody analysis, including immunohistochemistry or FACS, may be used to determine~cellula~r or tissue distribution.
Southern blot analysis of primate cDNA libraries is performed on, e.g.,: U937 premonocytic line, resting (M100); elutriated 35 monocytes, activated with LPS, IFNy, anti-IL-10 for 4, 16 h pooled (M106); elutriated monocytes, activated with LPS, IFNy, IL-10 for 4, 16 h pooled (M107); elutriated monocytes, activated LPS for 1 h SUBSTIT~1TE SHEET ( rule 26 ) WO 00/01$17 PCT/US99/12366 (M108); elutriated monocytes, activated LPS for 6 h (M109);
dendritic cells (DC) 30~ CDla+, from CD34+ GM-CSF, TNFa 12 days, resting; DC 70$ CDla+, from CD34+ GM-CSF, TNFa 12 days, resting (D101); DC 70~ CDla+, from CD34+ GM-CSF, TNFa 12 days, activated with PMA and ionomycin for 1 hr (D102); DC 70~ CDla+, from CD34+
GM-CSF, TNFa 12 days, activated with PMA and ionomycin for 6 hr (D103); DC 95$ CDla+, from CD34+ GM-CSF, TNFa 12 days activated with PMA and ionomycin for 1 or 6 hr, pooled; DC from monocytes GM-CSF, IL-4 5 days, resting (D107); DC from monocytes GM-CSF, IL-4 5 days, resting (D108); DC from monocytes GM-CSF, IL-4 5 days, activated TNFa, monocyte supe for 4, 16 h pooled (D110); EBV
transfected B cell lines, resting; spleenocytes, resting;
spleenocytes, activated with PMA and ionomycin; 20 NK clones resting, pooled; 20 NK crones activated with PMA and ionomycin, pooled; NKL clone, IL-2 treated; NK cytotoxic clone, resting;
adipose tissue fetal 28 w:k male (0108); brain fetal 28 wk male (0104); gallbladder fetal 28 wk male (0106); heart fetal 28 'wk male (0103); small intestine fetal 28 wk male (0107); kidney fetal 28 wk male (0100); liver fetal 28 wk male (0102); lung fetal 28 wk male (0101); ovary fetal 25 wk female (0109); adult placenta 28 wk (0113); spleen fetal 28 w:k male (0112); testes fetal 28 wk male (0111); uterus fetal 25 w:k female (0110); THO clone Mot 72, resting (T102); T cell, THO clone Mot 72, activated with anti-CD28 and anti-CD3 for 3, 6, 12 h pooled (T103); T cell, THO clone Mot 72, anergic treated with ;specific peptide for 2, 7, 12 h pooled (T104); Th0 subtraction o:f resting from activated; T cell, TH1 clone HY06, resting (T107); T cell, TH1 clone HY06, activated with anti-CD28 and anti-CD3 fo:r 3, 6, 12 h pooled (T108); T cell, TH1 clone HY06, anergic treated with specific peptide for 2, 6, 12 h pooled (T109); Thl subtraction of resting from activated; T cell, TH2 clone HY935, resting (T110); T cell, TH2 clone HY935, activated with anti-CD28 and anti-CD3 for 2, 7, 12 h pooled (T111); and Th2 subtraction of resting from activated.
Samples for mouse mR:L~A distribution may include, e.g.,:
resting mouse fibroblastic L cell line (C200); Braf:ER (Braf SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PCT/US99/123bb fusion to estrogen receptor) transfected cells, control (C201); T
cells, TH1 polarized (Mel:L4 bright, CD4+ cells from spleen, polarized for 7 days with IFN-'y and anti IL-4; T200); T cells, TH2 polarized (Me114 bright, CD4+ cells from spleen, polarized for 7 days with IL-4 and anti-I1~N-y; T201); T cells, highly TH1 polarized (see Openshaw, et al. (1995) J. Exp. Med. 182:1357-1367; activated with anti-CD3 for 2, 6, 16 h pooled; T202); T cells, highly TH2 polarized (see Openshaw, Eat al. (1995) J. Exp. Med. 182:1357-1367;
activated with anti-CD3 for 2, 6, 16 h pooled; T203); CD44- CD25+
pre T cells, sorted from thymus (T204); TH1 T cell clone D1.1., resting for 3 weeks after last stimulation with antigen (T205);
TH1 T cell clone D1.1, 10 ~g/ml ConA stimulated 15 h (T206); TH2 T
cell clone CDC35, resting for 3 weeks after last stimulation with antigen (T207); TH2 T cel7_ clone CDC35, 10 ~,g/ml ConA stimulated 15 h (T208); Mel 14+ naive T cells from spleen, resting (T209);
Me114+ T cells, polarized to Thl with IFN-~y/IL-12/anti-IL-4 for 6, 12, 24 h pooled (T210); Me:l 14+ T cells, polarized to Th2 with IL-4/anti-IFN-'y for 6, 13, 24 h pooled (T211); unstimulated mature B
cell leukemia cell line A20 (8200); unstimulated B cell line CH12 (8201); unstimulated large' B cells from spleen (8202); B cells from total spleen, LPS activated (8203); metrizamide enriched dendritic cells from spleen, resting (D200); dendritic cells from bone marrow, resting (D201.); monocyte cell line RAW 264.7 activated with LPS 4 h (M2;00); bone-marrow macrophages derived with GM and M-CSF (M201); macrophage cell line J774, resting (M202); macrophage cell line J774 + LPS + anti-IL-10 at 0.5, 1, 3, 6, 12 h pooled (M203); macrophage cell line J774 + LPS + IL-10 at 0.5, 1, 3, 5, 12 h pooled (M204); aerosol challenged mouse lung tissue, Th2 primers, aero~;ol OVA challenge 7, 14, 23 h pooled (see Garlisi, et al. (1995) Clinical Immunology and Immunopatholocrv 75:75-83; X206); Nippostrongulus-infected lung tissue (see Coffman, et al. (1989) Science 245:308-310; X200); total adult lung, normal (0200); total lung, rag-1 (see Schwarz, et al. (1993) Immunodeficiency 4:249-252; 0205); IL-10 K.O. spleen (see Kuhn, et SUBSTITUTE SHEET ( rule 26 }

al. (1991) Cell 75:263-274; X201); total adult spleen, normal (0201); total spleen, rag-1 (0207); IL-10 K.O. Peyer's patches (0202); total Peyer's patches, normal (0210); IL-10 K.O.
mesenteric lymph nodes (X203); total mesenteric lymph nodes, normal (0211); IL-10 K.O. colon (X203); total colon, normal (0212); NOD mouse pancreas (see Makino, et al. (1980) ikken Dobutsu 29:1-13; X205); total thymus, rag-1 (0208); total kidney, rag-1 (0209); total heart, rag-1 (0202); total brain, rag-1 (0203); total testes, rag-1 (0204); total liver, rag-1 (0206); rat normal joint tissue (0300); and rat arthritic joint tissue (X300).
A. Direct protein detection by antibodies Various cells, tissues, and developmental stages are stained with labeled antibodies. The detection may be immuno-histochemical for solid tissue, by FRCS in disperse cells; and by other appropriate methods for other sample types. Antibodies specific for the various :Forms may be used to distinguish between membrane associated and soluble fragments. Various amplification means may be coupled to increase sensitivity.
B. Functional detection Specific neutralizing antibodies should provide means to specifically block the biological activity of the prostaglandin transporter. Activities :related to prostaglandin binding, o:r to prostaglandin transport may be measured by sensitive means based upon knowledge of the normal biological function of the various forms.
Further testing of populations of cells, e.g., hematopoietic progenitors, or of other cell or tissue types will be useful to further determine distribution and likely function. Other tissue types, at defined developmental stages, and pathology samples may be screened to determine whether pathological states or stages may be advantageously correlated with the biological activity of the transporter.
VII. Protein Expression PCR is used to make ,~ construct comprising the open reading frame, preferably in oper<~ble association with proper promoter, selection, and regulatory sequences. The resulting expression SUBSTITUTE SHEET ( rule 26 ) plasmid is transformed into an appropriate cell type, e.g., the Topp5, E. coli strain (St:ratagene, La Jolla, CA). Ampicillin resistant (50 ~,g/ml) transformants are grown in Luria Broth (Gibco) at 37' C until the optical density at 550 nm is 0.7.
Recombinant protein is induced with 0.4 mM
isopropyl-~iD-thiogalacto-pyranoside (Sigma, St. Louis, MO) and incubation of the cells continued at 20' C for a further 18 hours.
Cells from a 1 liter culture are harvested by centrifugation and resuspended, e.g., in 200 ml of ice cold 30~ sucrose, 50 mM Tris HC1 pH 8.0, 1 mM ethylenediaminetetraacetic acid. After 10 min on ice, ice cold water is added to a total volume of 2 liters. After min on ice, cells are removed by centrifugation and the supernatant is clarified by filtration via a 5 ).~M Millipak 60 (Millipore Corp., Bedford., MA).
15 The recombinant protein is purified via standard purification methods, e.g., various ion exchange chromatography methods.
Immunoaffinity methods using antibodies described below can also be used. Affinity methods may be used where an epitope tag is engineered into an expression construct.
20 Similar methods are used to prepare expression constructs and cells in eukaryotic cells. Eukaryotic promoters and expression vectors may be produced, as described above.
Further study of the: expression and control of prostaglandin transporter will be pursued. The controlling elements associated with the antigens may exhibit differential developmental, tissue specific, or other expression patterns. Upstream or downstream genetic regions, e.g., control elements, are of interest.
Multiple transfected. cell lines are screened for one which expresses the antigen, membrane bound, or soluble forms, at a high level compared with other cells. Various cell lines are screened and selected for their favorable properties in handling. Natural protein can be isolated from natural sources, or by expression from a transformed cell using an appropriate expression vector.
Purification of the expressed protein is achieved by standard procedures, or may be combined with engineered means for effective purification at high efficiency from cell lysates or supernatants.
FLAG or His6 segments can be used for such purification features.
SUBSTITUTE SHEET ( rule 26 ) VIII. Protein Purification The prostaglandin transporter is isolated by a combination of affinity chromatography using the prostaglandin transporter specific binding compositions, e.g., antibody, as a specific binding reagent in combination with protein purification techniques allowing separation from other proteins and contaminants. Various detergent combinations may be tested to determine what combinations will retain biological activity while solubilizing contaminants. The purification may follow bialogical activity, e.g., prostaglandin binding or transport into membranes, or by ELISA or other structural binding reagents.
Similar methods are .applied for purification of other polypeptides.
IX. Isolation of Homologous Genes The described genes, e.g., cDNA, can be used as a hybridization probe to screen a library from a desired source, e.g., a primate cell cDNA .library. Many different species can be screened both for stringency necessary for easy hybridization, and for presence using a probe=. Appropriate hybridization conditions will be used to select fo~~ clones exhibiting specificity of cross hybridization.
cDNA libraries from the desired species are collected, from appropriate cell types. ;3creening by hybridization or PCR using degenerate probes based upon the peptide sequences will also allow isolation of appropriate clones. Alternatively, use of appropriate primers for PCR screening will yield enrichment of appropriate nucleic acid clones.
Similar methods are applicable to isolate either species, polymorphic, or allelic v<~riants. Species variants are isolated using cross-species hybridization techniques based upon isolation of a full length isolate or fragment from one species as a probe.
Alternatively, antibodies raised against proteins will :be used to screen for cells which express cross-reactive proteins from an appropriate, e.g., cDNA library. The purified protein or defined peptides are useful for generating antibodies by standard SUBSTITE'TE SHEET ( rule 26 ) WO 00/01$17 PCT/US99/12366 methods, as described above. Synthetic peptides or purified protein are presented to an immune system to generate monoclonal or polyclonal antibodies. See, e.g., Coligan (1991) Current Protocols in Immunology W~iley/Greene; and Harlow and Lane (1.989) Antibodies: A Laboratory Manual Cold Spring Harbor Press. The resulting antibodies are used, e.g., for screening, panning, or sorting.
X. Antibody Preparation Synthetic peptides or purified protein, natural or recombinant, are presented to an immune system to generate monoclonal or polyclonal antibodies. See, e.g., Coligan (1991) Current Protocols in Immunoloav Wiley/Greene; and Harlow and Lane (1989) Antibodies: A Laboratory Manual Cold Spring Harbor Press. Polyclonal serum, or hybridomas may be prepared. In appropriate situations, the binding reagent is either labeled as described above, e.g., fluorescence or otherwise, or immobilized to a substrate for panning methods.
XI. Chromosome Mapping DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, Southern blot transfer and hybridization are performed according to standard techniques. See Jenkins, et al.
(1982) J. Virol.. 43:26-36. Blots may be prepared with Hybond-N
nylon membrane (Amersham). The probe is labeled with 32P-dCTP;
washing is done to a final stringency, e.g., of O.1X SSC, 0.1~
SDS, 65' C.
Alternatively, a BIOS Laboratories (New Haven, CT) mouse somatic cell hybrid panel may be combined with PCR methods. See Fan, et al. (1996) mmunogenetics 44:97-103.
Chromosome spreads are prepared. In situ hybridization is performed on chromosome preparations obtained from phytohemagglutinin-stimulated human lymphocytes cultured for 72 h.
5-bromodeoxyuridine is added for the final seven hours of culture (60 ~,g/ml of medium), to ensure a posthybridization chromosomal banding of good quality.
SUBSTITUTE SHEET ( rule 26 ) A PCR fragment, amplified with the help of primers, is cloned into an appropriate vector. The vector is labeled by nick-translation with 3H. The radiolabeled probe is hybridized to metaphase spreads at final concentration of 200 ng/ml of hybridization solution as described in Matter, et al. (1985) Hum.
en . 69:327-331.
After coating with nuclear track emulsion (KODAK NTB2), slides are exposed. To avoid any slipping of silver grains during the banding procedure, chromosome spreads are first stained with buffered Giemsa solution .and metaphase photographed. R-banding is then performed by the flu~orochrome-photolysis-Giemsa (FPG) method and metaphases rephotographed before analysis.
Using these techniques, the DC-PGT gene was mapped to marker SHGC-3911 on chromosome 11q13 with a resulting lod score of 1000Ø Other markers in the SHGC-3911 region at chromosome 11q13 include the FcERI receptor: which is alleged to be associated with allergic conditions. In comparison to the location of DC-PGT, the ubiquitously expressed human PGT homologue of Lu et al.,(described above) is localized to chromosome 7.
XII. Biochemical Characterization Constructs for the expression of, e.g., DC-PGT are made with a tag (FLAG) sequence (Hopp, et al. (1988) Biotechnoloav (NY) 6:1205-1210) introduced in the protein. The open reading frame of the DC-PGT cDNA of SEQ ID N0: 1 is amplified by appropriate PCR
primers using standard methods to introduce the FLAG peptide sequence (IBI, New Haven, CT) at the C-terminus of the protein.
For example, a PFU enzyme (Stratagene) with 12 cycles PCR: 94' C
sec; 55' C 1 min; 72' c~ 4 min. PCR constructs are cloned into 30 a PME18X vector (DNAX) using XhoI and XbaI sites incorporated into the 5' and 3' primers, respectively.
COS-7 cells are maintained in DMEM, 10~ FCS, 4 mM L-glutamine (JRH Biosciences, Lenexa, KS), 100 U/ml penicillin, and 100 ~,g/ml streptomycin. Plasmid DNA is transfected by electroporation (BIORAD, Hercules, CA) (2~0 ~.g / 1 x 107 cells) and plated into tissue culture dishes. The medium is replaced after 24 hours and SUBSTITUTE SHEET ( rule 26 ) WO 00!01817 PCT/US99I12366 cell lysates and media are collected three days after transfection. Lysis buffer (25 mM Hepes pH 7.5, 2 mM EDTA, 1.0~
NP-40, 150 mM NaCl, 0.01 Aprotinin (Sigma, St. Louis, MO), 0.01 Leupeptin (Sigma)) is added to the plates. Plates are kept on ice for 45 minutes. Lysates are centrifuged for 15 minutes to eliminate cell debris. Supernatants of centrifuged cell lysates and sterile-filtered media from cultured cells are incubated with anti-FLAG M2 Affinity Gel (IBI) at 4' C overnight and washed four times with PBS. Immunoprecipitates are eluted in a Econocolumn (BIORA.D) with 2.5 M Glyci:ne, pH 2.5. Eluates are neutralized with Hepes, pH 7.4 (JRH Biosciences) and concentrated by precipitation with 24~ TCA and 2~ deoxycholic sodium salt (Sigma). Pellets are eluted in 2 x Sample Buffer (NOVEX, San Diego, CA), electrophoresed on 4-20~ tris-glycine gels (Novex) and transferred to PVDF membranes (Immobilon-P, Millipore Corporation, Bedford, MA). Membranes are exposed to 3~ non-fat milk for 1 h at 37' C.
Anti-FLAG M2 antibody is used as recommended (IBI). Anti-mouse Ig horseradish peroxidase conjugate (Amersham) is used at 1:2,000 dilution and the peroxidase detection is performed with ECL
detection reagents (Amersham).
Other fusion proteins can be produced, e.g., a recombinant prostaglandin transporter construct is prepared, e.g., as a fusion product with a useful affinity reagent, e.g., FLAG peptide. This peptide segment may be useful for purifying the expression product of the construct. See, e.g., Crowe, et al. (1992) OIAexpress: The High Level Expression & Protein Purification System QUIAGEN, Inc.
Chatsworth, CA; and Hopp, et al. (1988) Bio/Technoloav 6:1204-1210. Membranes comprising the transporter are assayed to determine the natural prostaglandin substrate. Most likely the prostaglandin will be a u:racil related prostaglandin, but may also include, at various levels of efficiency of binding or transport, pyrimidine or purine analogs. See, e.g., Goodman and Gilman (Current ed.), The P armacolog~ical Basis of Therapeutics; Lukovics and Zablocka Nucleoside g,Ynthesis~ Oraanosilicon Methods Ellis Horwood, N.Y.; Townsend, ~2hemistrv of Nucleosides and Nucleotides,, vols. 1-3, Plenum Press, IV.Y.; Munch-Pertson (1983) Metabolism of Nucleotides, Nucleosides, and Prostacrlandins in Microorganisms SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 Academic Press, NY; Gehrke ( 1990 ) ~romatocrra~y & Modification of Nucleosides vols. A, B, and C, Elsevier; Bloch (1975) ~hemistrv, Bioloav. & Clinical Uses of Nucleoside Analogs Annals NY Acad.
Sci.; and Ulbricht (1964) Purines, Pvrimidines. & Nucleotides Franklin Co.
XIII. Expression Cloning; Partner Screening A. Antibodies and flow-cytometric sorting Expression cloning of cells transformed with an appropriate cDNA library may be sorted by FACS using antibody reagents described above. The sorted cells are isolated and expanded, and subjected to multiple selection cycles, leading to a high proportion of cells expressing the desired DNA.
B. Antibodies and staining The antibodies to, s~.g., DC-PGT, are used for screening of a library made from a cell line which expresses the polypeptide.
Standard staining techniques are used to detect or sort intracellular or surface expressed ligand, or surface expressing transformed cells are screened by panning. Screening of intracellular expression is performed by various staining or immunofluorescence procedures. See also McMahan, et al. (1991) FRO J. 10:2821-2832.
For example, on day 0, precoat 2-chamber permanox slides with 1 ml per chamber of fibronectin, 10 ng/ml in PBS, for 30 min at room temperature. Rinse once with PBS. Then plate COS cells at 2-3 x 105 cells per chamber in 1.5 ml of growth media. Incubate overnight at 37° C.
On day 1 for each sample, prepare 0.5 ml of a solution of 66 Elg/ml DEAE-dextran, 66 )1M chloroquine, and 4 ).t.g DNA in serum free DME. For each set, a positive control is prepared, e.g., of huIL-10-FLAG cDNA at 1 and 1/200 dilution, and a negative mock. Rinse cells with serum free DME. Add the DNA solution and incubate 5 hr at 37° C. Remove the medium and add 0.5 ml 10~ DMSO in DME for 2.5 min. Remove and wash once with DME. Add 1.5 ml growth medium and incubate overnight.
SUBSTITUTE SHEET ( rule 26 ) On day 2, change the medium. On days 3 or 4, the cells are fixed and stained. Rinse the cells twice with Hank's Buffered Saline Solution (HBSS} and fix in 4~ paraformaldehyde (PFA)/glucose for 5 min. Wash 3X with HBSS. The slides may be stored at -80° C after all liquid is removed. For each chamber, 0.5 ml incubations are performed as follows. Add HBSS/saponin (0.1~) with 32 ~,1/ml of 1M NaN3 for 20 min. Cells are then washed with HBSS/saponin 1X. Soluble antibody is added to cells and incubate for 30 min. Wash cells twice with HBSS/saponin. Add second antibody, e.g., Vector anti-mouse antibody, at 1/200 dilution, and incubate far 30 min. Prepare ELISA solution, e.g., Vector Elite ABC horseradLish peroxidase solution, and preincubate for 30 min. Use, e.g., 1 drop of solution A (avidin) and 1 drop solution B (biotin) per 2.5 ml HBSS/saponin. Wash cells twice with HBSS/saponin. Add ABC HRP solution and incubate for 30 min.
Wash cells twice with HBSS, second wash for 2 min, which clases cells. Then add Vector d.iaminobenzoic acid (DAB) for 5 to 1.0 min.
Use 2 drops of buffer plus 4 drops DAB plus 2 drops of H202 per 5 ml of glass distilled water. Carefully remove chamber and rinse slide in water. Air dry for a few minutes, then add 1 drop of Crystal Mount and a cover slip. Bake for 5 min at 85-90° C.
Alternatively, the antibodies to a selected protein are used to affinity purify or sort out cells expressing the antigen. See, e.g., Sambrook et al. or Ausubel et al, which are incorporated herein by reference. The antigen is typically expressed on the cell surface.
Hybridization approaches may also be utilized to find closely related variants of the antigen based upon nucleic acid hybridization.
XIV. Screening for DC-PGT Substrate Specificity The types of organic' anions transported by DC-PGT of the present invention can be directly tested using standard methods.
For example, DC-PGT cDNAs can be expressed in HeLa cell monolayers or in Xenopus oocytes to determine the ability of DC-PGT to uptake various tracer labeled substrates e.g., prostaglandins such as PGE1, PGE2, PGE2a, PGD2, thrombaxanes such as TxB2 or non-SUBSTITUTE SHEET ( rule 26 ) prostaglandin anionic substrates such as glutathione, p-amino hippurate, taurochoalate, urate, unconjugated and conjugated bilirubin, and estradiol glucouronide. For example, for oocyte expression, water or complementary RNA (cRNA) that has been transcribed in vitro from DC-PGT cDNA and capped is injected into Xenopus oocytes at approximately 50 ng of cRNA per oocyte. Uptake studies are performed 2 t.o 3 days after injection by washing of oocytes three times in Wa.ymouth's solution, incubating for various periods at 27°C with radioactive substrates (approx. 0.25 ~.C'i/ml;
total concentration, approx. 1 nM), washing three times with ice-cold Waymouth's solution, and lysing in 0.5 ml of 10~ SDS.
Oocyte-associated radioactivity is determined by liquid scintillation spectroscopy. For HeLa cell expression, cells are grown to approx. 80~ confluence on 35 mm dishes then infected with recombinant vaccinia virus vTF7-3 of 10 plaque forming units per cell according to a method of Fuesst, et al.(1986) Proc. Nat'1 Acad. Sci. USA 83:8122-8126. Thirty minutes after infection cells are transfected with DC-PGT cDNA (10 ~g/ml) plus lipofectin (20 ~.g/ml) according to a method of Blakely, et al. (1991) Anal.
Biochem. 194:302-310. After 3 hours of incubation, vaccinia virus an the DNA-lipofectin complex are removed, and the cells are maintained overnight in Dulbecco's modified Eagle's medium supplemented with 5~ feta:l bovine serum. Uptake studies are performed 19 hours after tra.nsfection. Monolayers are washed three times with culture medium without serum and incubated for various times at 27° C with radioactive substrate (0.5 ~,Ci/ml per dish; total concentration, approx. 0.2 nM). Uptake is stopped by washing cells once with ice-cold Waymouth's solution containing 5$
bovine serum albumin a.nd then four times with Waymouth's solution alone. Cells are scrapped and the associated radioactivity is measured by liquid scinti:L:lation spectroscopy.
XV. Measuring DC-PGT Substrate Uptake Kinetics Competitive tracer uptake kinetics using DC-PGT comparing various prostaglandins or thromboxanes (e. g., PGE1, PGE2, PGE2a, PGD2 or TxB2) are determined using standard competitive transport SUBSTITUTE SHEET ( rule 26 ) assays. For example for determining time dependent uptake of tracer labeled prostaglandin uptakes into HeLa cells expressing DC-PGT clones the following 3[H]-PGs final concentrations are used (New England Nuclear, Boston, MA): PGE2: 0.7 nM (176 cpm/fmol);
PGE1: 0.6 nM (62 cpm/fmol); PGD2: 0.9 nM (126 cpm/fmol); PGF2p~:
0.6 nM (185 cpm/fmol); TXB2: 1.0 nM (114 cpm/fmol); PGI2 analog 3[H]-iloprost (Amersham Corp., Arlington Heights, IL) at 7.9 nM
(14 cpm/fmol).
XVI. Determining DC-PGT uptake inhibition Compositions inhibiting DC-PGT uptake can also be measured.
For example to measure the' inhibition of tracer PGE2, uptakes at 10 min intervals (0.2 nM ~3[H]-PGE2) with or without various concentrations of unlabelE~d prostanoids PGE2, PGE1, PGD2, PGF2a,, TXB2, PGI2, (100-500 nM; Cayman Chemical, Ann Arbor MI) or inhibitors such as furosennide, probenecid, and indomethacin (10-100 ~.l.M, Sigma Chemical Co., St. Louis, MO) are determined in duplicate on a given tran:~fection for one or two separate transfections. Since the substrate concentrations are at least 500 times less than the concentration of unlabeled prostanoids an apparent affinity constant., K1/2 is determined from the equation:
K1/2 = fvi/(v-vi)] [i] where v = uptake without inhibitor, vi =
uptake with inhibitor, and i = inhibitor concentration as described by Neame and Richards (1972) in Elementary Kinetics of Membrane Carrier Transport, John Wiley & Sons, New York.
XVII. Screening for Agonists or Antagonists Using a HeLa or Xenopus system, described above, or a comparable system, one of ordinary skill in the art can use the DC-PGT of the invention to screen for inhibitors or agonists of DC-PGT mediated tracer transport. The efficacy of potential antagonists can be compared with known PG transport inhibitors such as furosemide, probenecid, or indomethacin. Potential agonist or antagonist compositions are incubated, using a system as described above, for a time sufficient to allow binding of the SUBSTITUTE SHEET ( rule 26 ) test composition and the I7C-PGT transporter. Enhancement or decrement in measures of tracer uptake can be correlated to the specific composition being tested. Accordingly, one can identify compounds or compositions that modulate organic anion transport via the DC-PGT transporter: of the invention by assessing the uptake of various anions :>uch as prostaglandins or thrombaxanes in the presence and absence of the compound or compositions being tested. Similar methods may be used to screen for substrates for the enzymes, e.g., Dubs and cyclin E2.
XVIII. Isolation of Ligand for Receptor A construct for expression of the product can be used as a specific binding reagent t:o identify its binding partner, e.g., ligand, by taking advantage of its specificity of binding, much like an antibody would be used. A receptor reagent is either labeled as described above, e.g., fluorescence or otherwise, or immobilized to a substrates for panning methods. See also Anderson, et al. (1997) a ure 390:175-179, which is incorporated herein by reference.
The binding composition is used to screen an expression library made from a cell line which expresses a binding partner, e.g., TNF family ligand. Standard staining techniques are used to detect or sort intracellular or surface expressed receptor, or surface expressing transformed cells are screened by panning.
Screening of intracellular expression is performed by various staining or immunofluorescence procedures. See also McMahan, et al. (1991) EMBO J. 10:2821-2832.
Alternatively, receptor reagents are used to affinity p~xrify or sort out cells expressing a receptor. See, e.g., Sambrook, et al. or Ausubel, et al.
Another strategy is t.o screen for a membrane bound ligand by panning. The cDNA containing ligand cDNA is constructed as described above. The ligand can be immobilized and used to immobilize expressing cells. Immobilization may be achieved by use of appropriate antibodies which recognize, e.g., a FLAG
sequence or a receptor fusion construct, or by use of antibodies raised against the first antibodies. Recursive cycles of SUBSTITUTE SHEET ( rule 26 ) selection and amplification lead to enrichment of appropriate clones and eventual isolation of ligand expressing clones.
Phage expression libraries can be screened by receptor.
Appropriate label techniques, e.g., anti-FLAG antibodies, will allow specific labeling of appropriate clones.
IX. Chemotaxis Assays Chemokine proteins are produced, e.g., in COS cells transfected with a plasmid carrying the chemokine cDNA by electroporation. See, Ha:ra, et al. (1992) k0 J. 10:1875-1884.
Physical analytical methods may be applied, e.g., CD analysis, to compare tertiary structure to other chemokines to evaluate whether the protein has likely fo:Lded into an active conformation. After transfection, a culture supernatant is collected and subjected to bioassays. A mock contro:L, e.g., a plasmid carrying the luciferase cDNA, is used. See, de G~iet, et al. (1987) Mol. Cell.
Biol. 7:725-757. A positive control, e.g., recombinant murine MIP-loc from R&D Systems (Minneapolis, MN), is typically used.
Likewise, antibodies may be used to block the biological activities, e.g., as a control.
Lymphocyte migration assays are performed as previously described, e.g., in Bacon, et al. (1988) ~. J. Pharmacol. 95:966-974. Other trafficking assays are also available. See, e.g., Quidling-Jarbrink, et al. (1995) Eur. s7. Immunol. 25:322-327;
Koch, et al. (1994) J Clinical Investiaation 93:921-928; and Antony, et al. (1993) J_7~mmunol. 151:7216-7223. Murine Th2 T
cell clones, CDC-25 (see Tony, et al. (1985) J. Exx~. Med. 161:223-241) and HDK-1 (see Cherwinski, et al. (1987) J. Exb. Med.
166:1229-1244), made avai7_able from R. Coffman and A. O'Garra (DNAX, Palo Alto, CA), respectively, are used as controls.
Ca2+ flux upon chemokine stimulation is measured according to the published procedure dEacribed in Bacon, et al. (1995) T~.
Immungl. 154:3654-3666.
Maximal numbers of migrating cells in response to MIP-1oc typically occur at a concentration of 10-8 M, in agreement with SUBSTITUTE SHEET ( rule 26 ) original reports for CD4+ populations of human T cells. See Schall (1993) J. Ex~~. Medz 177:1821-1826. A dose-response curve is determined, preferably giving a characteristic bell shaped dose-response curve.
After stimulation with CC chemokines, lymphocytes generally show a measurable intrace:l:lular Ca2+ flux. MIP-1a is capable of inducing immediate transients of calcium mobilization. Typically, the levels of chemokine used in these assays will be comparable to those used for the chemotaxis assays (1/1000 dilution of conditioned supernatants)..
XX. Biological Activitie:~
A robust and sensitive assay is selected as described above, e.g., on immune cells, neuronal cells, or stem cells. Chemokine is added to the assay in increasing doses to see if a dose response is detected. For example, in a proliferation assay, cells are plated out in plates. Appropriate culture medium is provided, and chemokine i~; added to the cells in varying amounts.
Growth is monitored over a period of time which will detect either a direct effect on the cells, or an indirect effect of the chemokine.
Alternatively, an activation assay or attraction assay is used. An appropriate cell. type is selected, e.g., hematopoietic cells, myeloid (macrophages, neutrophils, polymorphonuclear cells, etc.) or lymphoid (T cell, B cell, or NK cells), neural cells (neurons, neuroglia, oligodendrocytes, astrocytes, etc.), or stem cells, e.g., progenitor cells which differentiate to other cell types, e.g., gut crypt cells and undifferentiated cell types.
Retroviral infection assays have also been described using, e.g., the CCR1, CCR3, and CCR5 receptors. These receptors, which bind the RANTES and MIP-1 related chemokines, are likely alsa to be receptors for the HCC5 . Recent description of these chemokine receptors in retroviral infection processes, and the effects by the related RANTES and MIP~-1 chemokines, suggest similar effects may exist with the HCC5 . See, e.g., Balter (1996) Science 272:1740 (describing evidence for chemokine receptors as coreceptors for HIV); and Deng, et al. (1996) ature 381:661-666.
SUBSTITUTE SHEET ( ruie 26 ) Chemokines may also be assayed for activity in hemopoietic assays as described, e.g., by H. Broxmeyer. See Bellido, et al.
(1995) J. Clinical Inve.~t.ic~ation 95:2886-2895; and Jilka, et al.
(1995) ExBt'1 Hematoloav 23:500-506. They may be assayed for angiogenic activities as described, e.g., by Streiter, et al..
(1992) Am. J. Pathol. 141:1279-1284. Or for a role in inflammation. See, e.g., Wakefield, et al. (1996) J. Surgical Res. 64:26-31.
Other assays will include those which have been demonstrated with other chemokines. See, e.g., Schall and Bacon (1994) Current Qpinion in Immunoloc~r 6:865-873; and Bacon and Schall (1996) Int.
Arch. Allercrv & Immunol. 109:97-109.
The DUB genes will be screened for the deubiquitinating activities, as described. See, e.g., Hochstrasser (1995) Curr.
Onin. Cell Biol. 7:215-223; Wilkinson, et al. (1995) Biochemistry 34:14535-14546; Baker, et al. (1992) J. Biol. Chem. 267:23364-23375; Baek et al. (1998) J. Biol. Chem. 272:25560-25565; and Papa and Hochstrasser (1993) N_ tur 366:313-319. For example, for an in vitro assay for UBP Activity, 1251-labeled Ub-PESTc is used as a.substrate according to the method of Woo, et al.(1995) J. Biol.
Chem. 270:18766-18773. Reaction mixtures (0.1 ml) contain the proper amount of the enzyme preparations and 10-30 ~,g of 125I_ labeled Ub-PESTc in 100 m~i Tris-HC1 (pH 7.8), 1 mM dithiothreitol, 1 mM EDTA, and 5~ glycerol. After incubating the mixtures for appropriate periods, the :reaction is terminated by adding 50 ~1 of 40~ (w/v) trichloroacetic acid and 50 ~.1 of 1.2~ (w/v) bovine serum albumin. The samples axe centrifuged, and the resulting supernatants are counted for their radioactivities using a counter. The enzyme activity is expressed as a percentage of 125I_l~eled Ub-PESTc hydrolyzed to acid-soluble products. When assaying the hydrolysis of Ub-NH-carboxyl extension proteins and His-di-Ub, incubations are performed as above but in the presence of 5 ~Lg of the substrate. After incubation for appropriate periods, the samples are subjected to discontinuous gel electrophoresis as described by Baek, et al. (1998) J. Biol. Chem.
SUBSTITUTE SHEET ( rule 2b ) 272:25560-25565. Proteins in the gels were then visualized by staining with Coomassie B:Lue R-250 or by exposing to x-ray films (Fuji) at 70° C. To prepare 1251-labeled poly-Ub-NH-lysozyme conjugates, 2 ~,g of the 125I-labeled lysozyme (5 x 105 cpm) are incubated with 10 ~tg of Ub, 120 ~g of fraction II, and an ATP
regenerating system consisting of 10 mM Tris-HC1 (pH 7.8), units/ml creatine phosphokinase, 6.5 mM phosphocreatine, 1.5 mM
ATP, 1 mM dithiothreitol, 0.5 mM MgCl2, and 1 mM KC1 in a final volume of 0.05 ml. Incubations are performed for 2 h at 37° C in 10 the presence of 1 mM hemin to prevent proteolysis of the ubiquitinated protein conjugates by the 26 S proteosome. After incubation, the samples a:re heated for 10 min at 55° C for inactivation of endogenous UBPs. Alternatively, Dubl1 or Dubl2 can be expressed as a GST fusion protein according to the method 15 of Zhu, et al. (1997) J. Bioi. Chem. 272:51-57 by cloning into an appropriate expression vector and subsequently co-transformed with a plasmid encoding Ub-Met-(3-gal, in which ubiquitin is fused to the NH2 terminus of ~-galactosidase and testing for cleavage.
However, the deubiqu:itinating enzymes have also been reported to have additional functions besides deubiquitination. See, e.g., Hochstrasser (1996) Cell 84:813-815; Hicke and Riezman (1996) Cel 84:277-287; and Chen, et al. (1996) Cell 84:853-862.
The MD gene products will be screened for cell signaling activities. See, e.g., Miyake, et al. (1998) J. Immunol.
161:1348-1353; Kobe and Deisenhofer (1994) Trends Biochem. Sci.
19:412.
XXI. Antagonizing cyclin E2 proteins The inhibition of cell cycle progression is especially important for the control of abnormally proliferative diseases, e.g., cancer. Several methods are available to accomplish this control. The ability of cyclin binding is inhibited by the use, e.g., of antibodies raised against the cyclin binding proteins.
Other elements include, e.g., peptidomimetics which are peptides designed to mimic the binding site of cyclin associated proteins and disrupt the interaction of these proteins with cyclin. The SUBSTITUTE SHEET ( ruie 26 ) most effective method to block cell cycle progression is the use of small molecules, e.g., to block the interaction of the associated proteins with cyclin, or to block downstream activity of the associated proteins, as described, e.g., in Hung, et al.
(1996) Chemistry and Bioloav 3:623-639. Exposure of a cell to these permeable small mole=cules should cause a conditional loss of function of the target protein.
Also included in this category is the use of gene therapy to block the expression of the cyclin associated protein or gene transcription factors. ME~thods of using gene therapy are described, e.g., in Goodnow (1992) "Transgenic Animals" in Roitt (ed. ) Encyclo~e yia of Immunoloav, Academic Press, San Diego, pp.
1502-1504; Travis (1992) ;science 256:1392-1394; Kuhn, et al.
(1991) science 254:707-710; Capecchi (1989) Science 244:1288;
Robertson (1987)(ed.) Teratocarcinomas and Embryonic Stem Cells A
Practical Agproach, IRL Press, Oxford; and Rosenberg (1992) Clinical Oncolocrv 10:180-199. Also included is the use of antisense RNA in gene therapy to block expression of the target gene, or proper splicing of gene transcripts.
All citations herein are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the invention is to be limited by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.
SUBSTITUTE SHEET ( ruie 26 ) SEQUENCE LISTING
<110> Schering Corporation <120> Mammalian Genes; Related ReagentsMethods and <130> SF0819x(omnibusFF) <140>

<141>

<160> 56 <170> PatentIn Ver. 2.0 <210> 1 <211> 4064 2 <212> DNA

<213> Unknown <220>

<221> CDS

<222> (264)..(2390) <220>

<223> Description of Unknown Organism:
primate <400> 1 gtgaccaggg agacaaacac ttggagatac ttggggctgagtttgagcaagactccctaa cctgtgtctg gacaagtctg atgtcctgtg tggcccaagaagaactgaccccgtgtctgg agctcccacc gttattgcat ccctgctgtg gctcacctgctgctgtctccaggagcccct gagaagattt gcctcctctc ccctgctaag ctccaggtcctgagattgaattaggggctg gagctcactg cactccagca gtc atg gga ccc agg ata ggg cca gcg ggt gag 293 Met Gly Pro Arg Ile Gly Pro Ala Gly Glu gta ccc cag gta cca gac aag gaa acc aaa gcc aca atg ggc aca gaa 341 Val Pro Gln Val Pro Asp Lys Glu Thr Lys Ala Thr Met Gly Thr Glu aac aca cct gga ggc aaa gcc agc cca gac cct cag gac gtg cgg cca 389 Asn Thr Pro Gly Gly Lys Ala Ser Pro Asp Pro Gln Asp Val Arg Pro agt gtg ttc cat aac atc aag ctg ttc gtt ctg tgc cac agc ctg ctg 437 Ser Val Phe His Asn Ile Lys Leu Phe Val Leu Cys His Ser Leu Leu cag ctg gcg cag ctc atg atc tcc ggc tac cta aag agc tcc atc tcc 485 Gln Leu Ala Gln Leu Met Ile Ser Gly Tyr Leu Lys Ser Ser Ile Ser aca gtg gag aag cgc ttc ggc ctc tcc agc cag acg tcg ggg ctg ctg 533 60 Thr Val Glu Lys Arg Phe Gly Leu Ser Ser Gln Thr Ser Gly Leu Leu SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 gcc tcc ttc aac gag gtg ggg aac aca gcc ttg att gtg ttt gtg agc 581 Ala Ser Phe Asn Glu Val Gly Asn Thr Ala Leu Ile Val Phe Val Ser tat ttt ggc agc cgg gtg cac cga cec cga atg att ggc tat ggg get 629 Tyr Phe Gly Ser Arg Val His Arg Pro Arg Met Ile Gly Tyr Gly Ala atc ctt gtg gcc ctg gcg ggc ctg ctc atg act ctc ccg cac ttc atc 677 Ile Leu Val Ala Leu Ala Gly Leu Leu Met Thr Leu Pro His Phe Ile tcg gag cca tac cgc tac gac aac acc agc cct gag gat atg cca cag 725 Ser Glu Pro Tyr Arg Tyr Asp Asn Thr Ser Pro Glu Asp Met Pro Gln 2 0 gac tte aag get tcc ctg tge ctg cce aca ace teg gcc cca gcc tcg 773 Asp Phe Lys Ala Ser Leu Cys Leu Pro Thr Thr Ser Ala Pro Ala Ser gcc ccc tcc aat ggc aac tgc tca agc tac aca gaa acc cag cat ctg 821 Ala Pro Ser Asn Gly Asn Cys Ser Ser Tyr Thr Glu Thr Gln His Leu agt gtg gtg ggg atc atg ttc gtg gca cag acc ctg ctg ggc gtg ggc 869 Ser Val Val Gly Ile Met Phe Val Ala Gln Thr Leu Leu Gly Val Gly ggg gtg ccc att cag ccc ttt ggc atc tcc tac atc gat gac ttt gcc 917 Gly Val Pro Ile Gln Pro Phe Gly Ile Ser Tyr Ile Asp Asp Phe Ala cac aac agc aac tcg ccc ctc tac ctc ggg atc ctg ttt gca gtg acc 965 His Asn Ser Asn Ser Pro Leu Tyr Leu Gly Ile Leu Phe Ala Val Thr atg atg ggg cca ggc ctg gcc ttt ggg ctg ggc agc ctc atg ctg cgc 1013 Met Met Gly Pro Gly Leu Ala Phe Gly Leu Gly Ser Leu Met Leu Arg ctt tat gtg gac att aac cag atg cca gaa ggt ggt atc agc ctg acc 1061 Leu Tyr Val Asp Ile Asn Gln Met Pro Glu Gly Gly Ile Ser Leu Thr ata aag gac ccc cga tgg gtg ggt gcc tgg tgg ctg ggt ttc ctc atc 1109 Ile Lys Asp Pro Arg Trp Val Gly Ala Trp Trp Leu Gly Phe Leu Ile get gcc ggt gca gtg gcc etg get gcc ate cec tac ttc ttc ttc ccc 1157 Ala Ala Gly Ala Val Ala Leu Ala Ala Ile Pro Tyr Phe Phe Phe Pro aag gaa atg ccc aag gaa aaa cgt gag ctt cag ttt cgg cga aag gtc 1205 Lys Glu Met Pro Lys Glu Lys Arg Glu Leu Gln Phe Arg Arg Lys Val tta gca gtc aca gac tca cct gcc agg aag ggc aag gac tct ccc tct 1253 Leu Ala Val Thr Asp Ser Pro Ala Arg Lys Gly Lys Asp Ser Pro Ser SUBSTITUTE SHEET ( rule 26 ) aag cag agc cct ggg gag' tcc acg aag aag cag gat ggc cta gtc cag 1301 Lys Gln Ser Pro Gly Glu Ser Thr Lys Lys Gln Asp Gly Leu Val Gln att gca cca aac ctg act gtg atc cag ttc att aaa gtc ttc ccc agg 1349 Ile Ala Pro Asn Leu Thr Val Ile Gln Phe Ile Lys Val Phe Pro Arg gtg ctg ctg cag acc cta cgc cac ccc atc ttc ctg ctg gtg gtc ctg 1397 Val Leu Leu Gln Thr Leu Arg His Pro Ile Phe Leu Leu Val Val Leu tcc cag gta tgc ttg tca tcc atg get gcg ggc atg gcc acc ttc ctg 1445 Ser Gln Val Cys Leu Ser Ser Met Ala Ala Gly Met Ala Thr Phe Leu ccc aag ttc ctg gag cgc cag ttt tcc atc aca gcc tcc tac gcc aac 1493 Pro Lys Phe Leu Glu Arg Gln Phe Ser Ile Thr Ala Ser Tyr Ala Asn ctg ctc atc ggc tgc ctc tcc ttc cct tcg gtc atc gtg ggc atc gtg 1541 Leu Leu Ile Gly Cys Leu Ser Phe Pro Ser Val Ile Val Gly Ile Val gtg ggt ggc gtc ctg gtc aag cgg ctc cac ctg ggc cct gtg gga tgc 1589 Val Gly Gly Val Leu Val Lys Arg Leu His Leu Gly Pro Val Gly Cys ggt gcc ctt tgc ctg ctg ggg atg ctg ctg tgc ctc ttc ttc agc ctg 1637 Gly Ala Leu Cys Leu Leu Gly Met Leu Leu Cys Leu Phe Phe Ser Leu ccg ctc ttc ttt atc ggc tgc tcc agc cac cag att gcg ggc atc aca 1685 Pro Leu Phe Phe Ile Gly Cys Ser Ser His Gln Ile Ala Gly Ile Thr cac cag acc agt gcc cac cct ggg ctg gag ctg tct cca agc tgc atg 1733 His Gln Thr Ser Ala His Pro Gly Leu Glu Leu Ser Pro Ser Cys Met gag gcc tgc tcc tgc cca ttg gac ggc ttt aac cct gtc tgc gac ccc 1781 Glu Ala Cys Ser Cys Pro Leu Asp Gly Phe Asn Pro Val Cys Asp Pra agc act cgt gtg gaa tac atc aca ccc tgc cac gca ggc tgc tca agc 1829 Ser Thr Arg Val Glu Tyr Ile Thr Pro Cys His Ala Gly Cys Ser Ser tgg gtg gtc cag gat get ctg gac aac agc cag gtt ttc tac acc aac 1877 Trp Val Val Gln Asp Ala Leu Asp Asn Ser Gln Val Phe Tyr Thr Asn tgc agc tgc gtg gtg gag ggc aac ccc gtg ctg gca gga tcc tgc gac 1925 Cys Ser Cys Val Val Glu Gly Asn Pro Val Leu Ala Gly Ser Cys Asp tca acg tgc agc cat ctg gtg gtg ccc ttc ctg ctc ctg gtc agc ctg 1973 Ser Thr Cys Ser His Leu Val Val Pro Phe Leu Leu Leu Val Ser Leu SUBSTITUTE SHEET ( rule 26 ) ggc tcg gcc ctg gcc tgt: ctc acc cac aca ccc tcc ttc atg ctc atc 2021 Gly Ser Ala Leu Ala Cys. Leu Thr His Thr Pro Ser Phe Met Leu Ile cta aga gga gtg aag aaa. gaa gac aag act ttg get gtg ggc atc cag 2069 Leu Arg Gly Val Lys Lys Glu Asp Lys Thr Leu Ala Val Gly Ile Gln ttc atg ttc ctg agg att ttg gcc tgg atg ccc agc ccc gtg atc cac 2117 Phe Met Phe Leu Arg Ile Leu Ala Trp Met Pro Ser Pro Val Ile His ggc agc gcc atc gac acc acc tgt gtg cac tgg gcc ctg agc tgt ggg 2165 Gly Ser Ala Ile Asp Thr Thr Cys Val His Trp Ala Leu Ser Cys Gly cgt cga get gtc tgt cgc tac tac aat aat gac ctg ctc cga aac cgg 2213 Arg Arg Ala Val Cys Arg Tyr Tyr Asn Asn Asp Leu Leu Arg Asn Arg ttc atc ggc ctc cag ttc ttc ttc aaa aca ggt tct gtg atc tgc ttc 2261 2 5 Phe Ile Gly Leu Gln Phe Phe Phe Lys Thr Gly Ser Val Ile Cys Phe gcc tta gtt ttg get gtc ctg agg cag cag gac aaa gag gca agg acc 2309 Ala Leu Val Leu Ala Val Leu Arg Gln Gln Asp Lys Glu Ala Arg Thr aaa gag agc aga tcc agc cct gcc gta gag cag caa ttg cta gtg tcg 2357 Lys Glu Ser Arg Ser Ser Pro Ala Val Glu Gln Gln Leu Leu Val Ser ggg cca ggg aag aag cca gag gat tcc cga gtg tgagctgtct tggggcccca 2410 Gly Pro Gly Lys Lys Pro Glu Asp Ser Arg Val cctggccaag agtagcagcc ac:agcagtac ctcctctgag tcctttgccc aagattgggt 2470 gtcaagagcc ctgtgttcca tt:ctggctcc tccactaaat tgctgtgtga cttcaggcaa 2530 gacattgatc ctctctcagc ctatgcttgc tagtctgaac caaagagttg tttgggcatt 2590 tgctgtgttg gccatttctg gagcaagagg gtcttcttcc tccttccccc agccagccag 2650 ctgtcctggg gccaggcttt ccagggtgga aagaagtata cctttccctg gggccctagg 2710 atagcaaagt gagccatagt gggccaggct gccctccatg ctgggcccca gcccaggtct 2770 gcactcgcct ggatcacctt cta tgagcct tagccatctc ctgtcaggta ggaatgaact 2830 tgccagcctt caggctcgtt cagctatgac catctgtgcg gtcagggtac actcagctct 2890 cctccccaac tccagcagcc ttaaagaagt gtccctttgg cgccccctgg aggcagagca 2950 ctgagctgga ccctgggtag acacccacag ggaggacgga gctggcctca ggagtgggac 3010 acccagactt ggcagggcct tc:aagaggcc tgtgtggggg ccccaggaat ccttagctga 3070 agcggggaga ctcactctcc at.ctcaggaa attctagccc ttgccctcag ggagccacgg 3130 ttgagggtga ggcccaacac ct.gccttagg gccctgggtg ggcaagtctg ggccctgggg 3190 SUBSTITUTE SHEET ( ruie 26 ) tagggaggga gactcaggcc cacacttggg tattttctaa tttcagacaa acacacactc 3250 agcgcgcact cactgattcc tacacattgc caagatttca cacatgtgac caggggccac 3310 caaagtccct gtgacctttg tgactaggat cctaatttct ctattttctc ctgggtgcct 3370 gggtctgtgt cacctggggc agtgtggata atgtttagtt ctgtgacact gttttttggg 3430 ggtggcacct ggttctccga tgcctgggct ggtgtcaggc ccaggactgt agtgctggga 3490 gcagtaaagc tcagctctgt gtaatgagtg atgctatggc ttgctcgtgt cttatgatcc 3550 aatccttttc tacatcagcc cttgttttgt tttatggcta gtcttatctg gcctggttat 3610 ttccttgcgg ggaggagagg gtttgctaat ctgctcccag cccaacctat taccacccca 3670 cctcgctggg acctactgct c~gggaggcag cagacaggga gccaccagca gtggcttcct 3730 ggccctgtgc tgggggtggg gggaagctgg gggcacatgt ggcccttgcc ttctgagcag 3790 ctcccagtgc cagggctttg agactttccc acatgataaa agaaaaggga ggtacagaag 3850 ttccaattcc ctttttattt tgctggttgg tatctgtaaa tgtttaataa atatctgagc 3910 atgtatctat caacgccaag aatttcaaag tctccttcaa caatatgagg cttttaggat 3970 gtttatattc cttcatccct cttgtttccc aggttttgca gggaaaaaag tctggaatta 4030 tagatacagc ttattattaa atttgttctt gcat 4064 <210> 2 <211> 709 <212> PRT
<213> Unknown <400> 2 Met Gly Pro Arg Ile Gly Pro Ala Gly Glu Val Pro Gln Val Pro Asp Lys Glu Thr Lys Ala Thr Met Gly Thr Glu Asn Thr Pro Gly Gly Lys Ala Ser Pro Asp Pro Gln Asp Val Arg Pro Ser Val Phe His Asn Ile Lys Leu Phe Val Leu Cys His Ser Leu Leu Gln Leu Ala Gln Leu Met Ile Ser Gly Tyr Leu Lys Ser Ser Ile Ser Thr Val Glu Lys Arg Phe 70 75 8p Gly Leu Ser Ser Gln Thr Ser Gly Leu Leu Ala Ser Phe Asn Glu Val Gly Asn Thr Ala Leu Ile Val Phe Val Ser Tyr Phe Gly Ser Arg Val His Arg Pro Arg Met Ile Gly Tyr Gly Ala Ile Leu Val Ala Leu Ala SUBSTITUTE SHEET ( rule 26 ) Gly Leu Leu Met Thr Leu Pro His Phe Ile Ser Glu Pro Tyr Arg Tyr Asp Asn Thr Ser Pro Glu Asp Met Pro Gln Asp Phe Lys Ala Ser Leu 145 15(? 155 160 Cys Leu Pro Thr Thr Ser Ala Pro Ala Ser Ala Pro Ser Asn Gly Asn Cys Ser Ser Tyr Thr Glu Thr Gln His Leu Ser Val Val Gly Ile Met 180 185 lg0 Phe Val Ala Gln Thr Leu Leu Gly Val Gly Gly Val Pro Ile Gln Pro Phe Gly Ile Ser Tyr Ile Asp Asp Phe Ala His Asn Ser Asn Ser Pro Leu Tyr Leu Gly Ile Leu Phe Ala Val Thr Met Met Gly Pro Gly Leu Ala Phe Gly Leu Giy Ser Leu Met Leu Arg Leu Tyr Val Asp Ile Asn Gln Met Pro Glu Gly Gly Ile Ser Leu Thr Ile Lys Asp Pro Arg Trp Val Gly Ala Trp Trp Leu. Gly Phe Leu Ile Ala Ala Gly Ala Val Ala Leu Ala Ala Ile Pro Tyr Phe Phe Phe Pro Lys Glu Met Pro Lys Glu Lys Arg Glu Leu Gln Phe Arg Arg Lys Val Leu Ala Val Thr Asp Ser Pro Ala Arg Lys Gly Lys Asp Ser Pro Ser Lys Gln Ser Pro Gly Glu Ser Thr Lys Lys Gln Asp Gly Leu Val Gln Ile Ala Pro Asn Leu Thr Val Ile Gln Phe Ile Lys Val Phe Pro Arg Val Leu Leu Gln Thr Leu Arg His Pro Ile Phe Leu Leu Val Val Leu Ser Gln Val Cys Leu Ser Ser Met Ala Ala Gly Met Ala Thr Phe Leu Pro Lys Phe Leu Glu Arg Gln Phe Ser Ile Thr Ala Ser Tyr Ala Asn Leu Leu Ile Gly Cys Leu Ser Phe Pro Ser Val Ile Val Gly Ile Val Val Gly Gly Val Leu Val Lys Arg Leu His Leu Gly Pro Val Gly Cys Gly Ala Leu Cys Leu Leu SUBSTITUTE SHEET ( rude 26 ) Gly Met Leu Leu Cys Leu Phe Phe Ser Leu Pro Leu Phe Phe Ile Gly Cys Ser Ser His Gln Ilea Ala Gly Ile Thr His Gln Thr Ser Ala His Pro Gly Leu Glu Leu Ser Pro Ser Cys Met Glu Ala Cys Ser Cys Pro Leu Asp Gly Phe Asn Pro Val Cys Asp Pro Ser Thr Arg Val Glu Tyr Ile Thr Pro Cys His A:La Gly Cys Ser Ser Trp Val Val Gln Asp Ala Leu Asp Asn Ser Gln Val Phe Tyr Thr Asn Cys Sex Cys Val Val Glu Gly Asn Pro Val Leu Ala Gly Ser Cys Asp Ser Thr Cys Ser His Leu 2 5 Val Val Pro Phe Leu Leu Leu Val Ser Leu GIy Ser Ala Leu Ala Cys Leu Thr His Thr Pro Ser Phe Met Leu Ile Leu Arg Gly Val Lys Lys Glu Asp Lys Thr Leu Ala Val Gly Ile Gln Phe Met Phe Leu Arg Ile Leu Ala Trp Met Pro Ser Pro Val Ile His Gly Ser Ala Ile Asp Thr Thr Cys Val His Trp Ala Leu Ser Cys Gly Arg Arg Ala Val Cys Arg Tyr Tyr Asn Asn Asp Leu Leu Arg Asn Arg Phe Ile Gly Leu Gln Phe Phe Phe Lys Thr Gly Ser Val Ile Cys Phe Ala Leu Val Leu Ala Val Leu Arg Gln Gln Asp Lys Glu Ala Arg Thr Lys Glu Ser Arg Ser Ser Pro Ala Val Glu Gln Gln Leu Leu Val Ser Gly Pro Gly Lys Lys Pro Glu Asp Ser Arg Val <210> 3 <211> 643 <212> PRT
<213> Unknown <220>
<223> Description of Unknown Organism: primate SUBSTITUTE SHEET ( rule 26 ) <400>

Met GlyLeu LeuProLysLeu GlyValSer GlnGlySer AspThrSer Thr SerArg AlaGlyArgCys AlaArgSer ValPheGly AsnIleLys Val PheVal LeuCysGlnGly LeuLeuGln LeuCysGln LeuLeuTyr Ser AlaTyr PheLysSerSer LeuThrThr IleGluLys ArgPheGly Leu SerSer SerSerSerGly LeuIleSer SerLeuAsn GluIleSer Asn AlaIle LeuIleIlePhe ValSerTyr PheGlySer ArgValHis Arg ProArg LeuIleGlyIle GlyGlyLeu PheLeuAla AlaGlyAla Phe IleLeu ThrLeuProHis PheLeuSer GluProTyr GlnTyrThr Leu AlaSer ThrGlyAsnAsn SerArgLeu G1nAlaGlu LeuCysGln Lys HisTrp GlnAspLeuPro ProSerLys CysHisSer ThrThrGln 3 Asn ProGln LysGluThrSer SerMetTrp G1yLeuMet ValValAla Gln LeuLeu AlaGlyIleGly ThrValPro IleGlnPro PheGlyIle Ser Tyr Val Asp Asp Phe Ser Glu Pro Ser Asn Ser Pro Leu Tyr Ile Ser Ile Leu Phe Ala Ile Ser Val Phe Gly Pro Ala Phe Gly Tyr Leu Leu Gly Ser Ile Met Leu Gln Ile Phe Val Asp Tyr Gly Arg Val Asn Thr Ala Ala Val Asn Leu Val Pro Gly Asp Pro Arg Trp Ile Gly Ala Trp Trp Leu Gly Leu Leu Ile Ser Ser Ala Leu Leu Val Leu Thr Ser Phe Pro Phe Phe Phe Phe Pro Arg Ala Met Pro Ile Gly Ala Lys Arg Ala Pro Ala Thr Ala Asp Glu Ala Arg Lys Leu Glu Glu Ala Lys Ser Arg Gly Ser Leu Val Asp Phe Ile Lys Arg Phe Pro Cys Ile Phe Leu SUBSTITUTE SHEET { ruie 26 ) Arg Leu Leu Met Asn Se:r Leu Phe Val Leu Val Val Leu Ala Gln Cys Thr Phe Ser Ser Val Ile Ala Gly Leu Ser Thr Phe Leu Asn Lys Phe Leu Glu Lys Gln Tyr Gly Thr Ser Ala Ala Tyr Ala Asn Phe Leu Ile Gly Ala Val Asn Leu Pro Ala Ala Ala Leu Gly Met Leu Phe Gly Gly Ile Leu Met Lys Arg Phes Val Phe Ser Leu Gln Thr Ile Pro Arg Ile Ala Thr Thr Ile Ile Thr Ile Ser Met Ile Leu Cys Val Pro Leu Phe Phe Met Gly Cys Ser Thr Pro Thr Val Ala Glu Val Tyr Pro Pro Ser Thr Ser Ser Ser Ile Hip: Pro Gln Ser Pro Ala Cys Arg Arg Asp Cys Ser Cys Pro Asp Ser Ilea Phe His Pro Val Cys Gly Asp Asn Gly Ile Glu Tyr Leu Ser Pro Cys His Ala Gly Cys Ser Asn Ile Asn Met Ser Ser Ala Thr Ser Lys Gln. Leu Ile Tyr Leu Asn Cys Ser Cys Val Thr Gly Gly Ser Ala Ser Ala Lys Thr Gly Ser Cys Pro Val Pro Cys Ala His Phe Leu Leu Pro Ala Ile Phe Leu Ile Ser Phe Val Ser Leu Ile Ala Cys Ile Ser His Asn Pro Leu Tyr Met Met Val Leu Arg Val Val Asn Gln Glu Glu Lys Ser Phe Ala Ile Gly Val Gln Phe Leu Leu Met Arg Leu Leu Ala Trp Leu Pro Ser Pro Ala Leu Tyr Gly Leu Thr Ile Asp His Ser Cys Ile Arg Trp Asn Ser Leu Cys Leu Gly Arg Arg Gly Ala Cys Ala Tyr Tyr Asp Asn Asp Ala Leu Arg Asp Arg Tyr Leu Gly Leu Gln Met Gly Tyr Lys Ala Leu Gly Met Leu Leu Leu Cys Phe Ile Ser Trp Arg Val Lys Lys Asn Lys Glu Tyr Asn Val Gln Lys Ala Ala Gly Leu Ile SUBSTITUTE SHEET ( rule 26 ) 5 <210> 4 <211> 643 <212> PRT
<213> Unknown 10 <220>
<223> Description of Unknown Organism: rodent <400> 4 Met Gly Leu Leu Leu Lys Pro Gly Ala Arg Gln Gly Ser Gly Thr Ser 1 5 l0 15 Ser Val Pro Asp Arg Arg Cys Pro Arg Ser Val Phe Ser Asn Ile Lys 20 Val Phe Val Leu Cys His Gly Leu Leu Gln Leu Cys Gln Leu Leu Tyr Ser AlaTyrPhe LysSerSer LeuThrThrIleGlu LysArgPhe Gly Leu SerSerSer SerSerGly LeuIleSerSerLeu AsnGluIle Ser 65 70 75 g0 Asn AlaThrLeu IleIlePhe IleSerTyrPheGly SerArgVal Asn Arg ProArgMet IleGlyIle GlyGlyLeuLeuLeu AlaAlaGly Ala 3 Phe ValLeuThr LeuProHis PheLeuSerGluPro TyrGlnTyr Thr Ser ThrThrAsp GlyAsnArg SerSerPheGlnThr AspLeuCys Gln Lys HisPheGly AlaLeuPro ProSerLysCysHis SerThrVal Pro Asp ThrHisLys GluThrSer SerLeuTrpGlyLeu MetValVal Ala Gln LeuLeuAla GlyIleGly ThrValProIleGln ProPheGly Ile Ser TyrValAsp AspPheAla GluProThrAsnSer ProLeuTyr Ile Ser IleLeuPhe AlaIleAla ValPheGlyProAla PheGlyTyr Leu Leu GlySerVal MetLeuArg IlePheValAspTyr GlyArgVal Asp Thr AlaThrVal AsnLeuSer ProGlyAspProArg TrpIleGly Ala Trp TrpLeuGly LeuLeuIle SerSerGlyPheLeu IleValThr Ser SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PGT/(JS99I12366 Leu Pro Phe Phe Phe Phe Pro Arg Ala Met Ser Arg Gly Ala Glu Arg Ser Val Thr Ala Glu Glu Thr Met Gln Thr Glu Glu Asp Lys Ser Arg Gly Ser Leu Met Asp Phe Ile Lys Arg Phe Pro Arg Ile Phe Leu Arg Leu Leu Met Asn Pro Leu Phe Met Leu Val Val Leu Ser Gln Cys Thr Phe Ser Ser Val Ile Ala Gly Leu Ser Thr Phe Leu Asn Lys Phe Leu Glu Lys Gln Tyr Gly Ala Thr Ala Ala Tyr Ala Asn Phe Leu Ile Gly Ala Val Asn Leu Pro Ala Ala Ala Leu Gly Met Leu Phe Gly Gly Ile Leu MetLys ArgPheValPhe ProLeuGln ThrIlePro ArgValAla Ala ThrIle IleThrIleSer MetIleLeu CysValPro LeuPhePhe Met GlyCys SerThrSerAla ValAlaGlu ValTyrPro ProSerThr Ser SerSer IleHisProGln GlnProPro AlaCysArg ArgAspCys Ser CysPro AspSerPhePhe HisProVal CysGlyAsp AsnGlyVal Glu TyrVal SerProCysHis AlaGlyCys SerSerThr AsnThrSer 465 470 475 4g0 Ser GluAla SerLysGluPro IleTyrLeu AsnCysSer CysValSer Gly GlySer AlaSerGlnAsp ArgLeuMet ProHisVal LeuArgAla Leu LeuLeu ProSerIlePhe LeuIleSer PheAlaAla LeuIleAla Cys Ile Sex His Asn Pro Leu Tyr Met Met Val Leu Arg Val Val Asn Gln Asp Glu Lys Ser Phe Ala Ile Gly Val Gln Phe Leu Leu Met Arg Leu Leu Ala Trp Leu Pro Ala Pro Ser Leu Tyr Gly Leu Leu Ile Asp Ser Ser Cys Val Arg Trp Asn Tyr Leu Cys Ser Gly Arg Arg Gly Ala SUBSTITUTE SHEET ( rule 26 ) Cys Ala Tyr Tyr Asp Asn Asp Ala Leu Arg Asn Arg Tyr Leu Gly Leu Gln Met Val Tyr Lys Ala Leu Gly Thr Leu Leu Leu Phe Phe Ile Ser 1 0 Trp Arg Met Lys Lys Asn Arg Glu Tyr Ser Leu Gln Glu Asn Thr Ser Gly Leu Ile <210> 5 <211> 1137 <212> DNA
2 0 <213> Unknown <220>
<221> CDS
<222> (99)..(998) <220>
<221> misc_difference <222> (367) <223> may be A; translation would be Asn <220>

<223> iption Descr of Unknown Organism:
primate <400>

cgcaggcgga ccgggggcaa ggcacagcag ggtcctgtgt aggaggtggc atgtcggtca ccgcgctgag ccgcgctctc tg 116 cctgctccag gag caaggacc ggg atg agg gcg c Met eu Arg Glu Ala Gly L

cca ctgtcg ctgctgtgcctg gtgttggcg ctgcctgccctg ctg 164 ggc Pro LeuSer LeuLeuCysLeu ValLeuAla LeuProAlaLeu Leu Gly ccg ccgget gtacgcggagtg gcagaaaca cccacctacccc tgg 212 gtg Pro ProAla ValArgGlyVal AlaGluThr ProThrTyrPro Trp Val cgg gcagag acaggggagcgg ctggtgtgc gcccagtgcccc cca 260 gac Arg AlaGlu ThrGlyGluArg LeuValCys AlaGlnCysPro Pro Asp ggc tttgtg cagcggccgtgc cgccgagac agccccatgacg tgt 308 acc Gly PheVal GlnArgProCys ArgArgAsp SerProMetThr Cys Thr ggc ccg tgt cca ccg cgc cac tac acg cag ttc tgg aac tac ctg gag 356 Gly Pro Cys Pro Pro Arg His Tyr Thr Gln Phe Trp Asn Tyr Leu Glu cgc tgc cgc tac tgc tac gtc ctc tgc ggg gag cgt gag gag gag gca 404 Arg Cys Arg Tyr Cys Tyr 'Val Leu Cys Gly Glu Arg Glu Glu Glu Ala SUBSTITUTE SHEET ( rule 26 ) cgg get tgc cac gcc acc: cac aac cgt gcc tgc cgc tgc cgc acc ggc 452 Arg Ala Cys His Ala Thr His Asn Arg Ala Cys Arg Cys Arg Thr Gl.y ttc ttc gcg cac get ggt. ttc tgc ttg gag cac gca tcg tgt cca cct 500 Phe Phe Ala His Ala Gly Phe Cys Leu Glu His A1a Ser Cys Pro Pro ggt gcc ggc gtg att gcc ccg ggc acc ccc agc cag aac acg cag tgc 548 Gly Ala Gly Val Ile Ala Pro Gly Thr Pro Ser Gln Asn Thr Gln Cys cag ccg tgc ccc cca ggc acc ttc tca gcc agc agc tcc agc tca gag 596 Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala Ser Ser Ser Ser Ser Glu cag tgc cag ccc cac cgc aac tgc acg gcc ctg ggc ctg gcc ctc aat 644 Gln Cys Gln Pro His Arg Asn Cys Thr Ala Leu Gly Leu Ala Leu Asn gtg cca ggc tct tcc tcc cat gac acc ctg tgc acc agc tgc act ggc 692 Val Pro Gly Ser Ser Ser His Asp Thr Leu Cys Thr Ser Cys Thr Gly ttc ccc ctc agc acc agg gta cca gga get gag gag tgt gag cgt gcc 740 Phe Pro Leu Ser Thr Arg Val Pro Gly Ala Glu Glu Cys Glu Arg Ala gtc atc gac ttt gtg get ttc cag gac atc tcc atc aag agg ctg cag 788 Val Ile Asp Phe Val Ala Phe Gln Asp Ile Ser Ile Lys Arg Leu Gln cgg ctg ctg cag gcc ctc gag gcc ccg gag ggc tgg ggt ccg aca cca 836 Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu Gly Trp Gly Pro Thr Pro agg gcg ggc cgc gcg gcc ttg cag ctg aag ctg cgt cgg cgg ctc acg 884 Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys Leu Arg Arg Arg Leu Thr gag ctc ctg ggg gcg cag gac ggg gcg ctg ctg gtg cgg ctg ctg cag 932 Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu Leu Val Arg Leu Leu Gln gcg ctg cgc gtg gcc agg atg ccc ggg ctg gag cgg agc gtc cgt gag 980 Ala Leu Arg Val Ala Arg Met Pro Gly Leu Glu Arg Ser Val Arg Glu cgc ttc ctc cct gtg cac tgatcctggc cccctcttat ttattctaca 1028 Arg Phe Leu Pro Val His tccttggcac cccacttgca ctgaaagagg ctttttttta aatagaagaa atgaggtttc 1088 ttaaagctta tttttataaa gctttttcat aaaaaaaaaa aaaaaaaaa 1137 <210> 6 <211> 300 <212> PRT
SUBSTITUTE SHEET ( ruie 2fi ) <213> Unknown <400> 6 Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys Leu Val Leu Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro Cys Arg Arg Asp Ser Pro Met Thr Cys Gly Pro Cys Pro Pro Arg His Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Tyr Val Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His SUBSTITUTE SHEET ( rule 26 ) <210> 7 5 <211> 1031 <212> DNA
<213> Unknown <220>
10 <221> CDS
<222> (402)..(1031) <220>
<223> Description of Unknown Organism: primate <400> 7 ccgactcant ccctcgccga cc:agtctggg cagcggagga gggtggttgg cagtggctgg 60 aagcttcgct atgggaagtc gtacctttgc tctctcgcgc ccagtcctcc tccctggttc 120 tcctcagccg ctgtcggagg ac~agcacccg gagacgcggg ctgcagtcgc ggcggcttct 180 ccccgcctgg gcggccgcgc cc~ctgggcag gtgctgagcg cccctagagc ctcccttgcc 240 gcctccctcc tctgcccggc cc~cagcagtg cacatggggt gttggaggta gatgggctcc 300 cggcccggga ggcggcggtg gatgcggcgc tgggcagaag cagccgccga ttccagctgc 360 cccgcgcgcc ccgggcgccc ct:gcgagtcc ccggttcagc c atg ggg acc tct ccg 416 Met Gly Thr Ser Pro agc agc agc acc gcc ctc gcc tcc tgc agc cgc atc gcc cgc cga gcc 464 Ser Ser Ser Thr Ala Leu Ala Ser Cys Ser Arg Ile Ala Arg Arg Ala aca gcc acg atg atc gcg ggc tcc ctt ctc ctg ctt gga ttc ctt agc 512 Thr Ala Thr Met Ile Ala Gly Ser Leu Leu Leu Leu Gly Phe Leu Ser acc acc aca get cag cca gaa cag aag gcc tcg aat ctc att ggc aca 560 Thr Thr Thr Ala Gln Pro Glu Gln Lys Ala Ser Asn Leu Ile Gly Thr tac cgc cat gtt gac cgt gcc acc ggc cag gtg cta acc tgt gac aag 608 Tyr Arg His Val Asp Arg Ala Thr Gly Gln Val Leu Thr Cys Asp Lys tgt cca gca gga acc tat gtc tct gag cat tgt acc aac aca agc tgc 656 50 Cys Pro Ala Gly Thr Tyr Val Ser Glu His Cys Thr Asn Thr Ser Cys gcg tct ggc agc agt tgc cct gtg ggg acc ttt acc agg cat gag aat 704 Ala Ser Gly Ser Ser Cys Pro Val Gly Thr Phe Thr Arg His Glu Asn ggc ata gag aaa tgc cat gac tgt agt cag cca tgc cca tgg cca atg 752 Gly Ile Glu Lys Cys His Asp Cys Ser Gln Pro Cys Pro Trp Pro Met att gag aaa tta cct tgt get gcc ttg act gac cga gaa tgc act tgc 800 Ile Glu Lys Leu Pro Cys Ala Ala Leu Thr Asp Arg Glu Cys Thr Cys SUBSTITUTE SHEET ( rule 26 ) cca cctggc atgttccag tctaacgetacc tgtgccccc catacggtg 848 Pro ProGly MetPheGln SerAsnAlaThr CysAlaPro HisThrVal tgt cctgtg ggttggggt gtgcggaagaaa gggacagag actgaggat 896 Cys ProVal GlyTrpGly ValArgLysLys GlyThrGlu ThrGluAsp gtg cggtgt aagcagtgt getcgggggtac ttctcagat gtgccttct 944 Val ArgCys LysGlnCys AlaArgGlyTyr PheSerAsp ValProSer agt gtgatg aacgcaaag catacacagact gtctggatc agaacctgg 992 Ser ValMet AsnAlaLys HisThrGlnThr ValTrpIle ArgThrTrp ttg gtgatc aagccgggg ggaccaaggaga cagacaact 1031 Leu ValIle LysProGly GlyProArgArg GlnThrThr <210> 8 <211>

<212>
PRT

<213>
Unknown <400>

Met GlyThr SerProSerSer SerThrAla LeuAlaSerCys SerArg Ile AlaArg ArgAlaThrAla ThrMetIle AlaGlySerLeu LeuLeu Leu GlyPhe LeuSerThrThr ThrAlaGln ProGluGlnLys AlaSer Asn LeuIle GlyThrTyrArg HisValAsp ArgAlaThrGly GlnVal Leu ThrCys AspLysCysPro AlaGlyThr TyrValSerGlu HisCys 65 70 75 8p Thr AsnThr SerCysAlaSer GlySerSer CysProValGly ThrPhe Thr ArgHis GluAsnGlyIle GluLysCys HisAspCysSer GlnPro Cys ProTrp ProMetIleGlu LysLeuPro CysAlaAlaLeu ThrAsp Arg GluCys ThrCysProPro GlyMetPhe GlnSerAsnAla ThrCys Ala ProHis ThrValCysPro ValGlyTrp GIyValArgLys LysGly Thr GluThr GluAspValArg CysLysGln CysAlaArgGly TyrPhe SUBSTITUTE SHEET { ruie 26 ) Ser Asp Val Pro Ser Ser Val Met Asn Ala Lys His Thr Gln Thr Val leo ls5 190 Trp Ile Arg Thr Trp Leu Val Ile Lys Pro Gly Gly Pro Arg Arg Gln Thr Thr <210> 9 <211> 2877 <212> DNA
<213> Unknown <220>
<221> CDS
<222> (410)..(2374) <220>
<223> Description of Unknown Organism: primate <400> 9 ggcacgagcc gactcagtcc ctcgccgacc agtctgggca gcggaggagg gtggttggca 60 gtggctggaa gcttcgctat gggaagtcgt tcctttgctc tctcgcgccc agtcctcctc 120 cctggttctc ctcagccgct gtcggaggag agcacccgga gacgcgggct gcagtcgcgg 180 cggcttctcc ccgcctgggc ggccgcgccg ctgggcaggt gctgagcgcc cctagcgcct 240 cccttgccgc ctccctcctc tgcccggccg cagcagtgca catggggtgt tggaggtaga 300 tgggctcccg gcccgggagg cc,3gcggtgga tgcggcgctg ggcagaagca. gccgccgatt 360 ccagctgccc cgcgcgcccc gggcgcccct gcgagtcccc ggttcagcc atg ggg acc 418 Met Gly Thr tct ccg agc agc agc acc gcc ctc gcc tcc tgc agc cgc atc gcc cgc 466 Ser Pro Ser Ser Ser Thr Ala Leu Ala Ser Cys Ser Arg Ile Ala Arg 5 l0 15 cga gcc aca gcc acg atg atc gcg ggc tcc ctt ctc ctg ctt gga ttc 514 Arg Ala Thr Ala Thr Met Ile Ala Gly Ser Leu Leu Leu Leu Gly Phe ctt agc acc acc aca get cag cca gaa cag aag gcc tcg aat ctc att 562 Leu Ser Thr Thr Thr Ala Gln Pro Glu Gln Lys Ala Ser Asn Leu Ile ggc aca tac cgc cat gtt gac cgt gcc acc ggc cag gtg cta acc tgt 610 Gly Thr Tyr Arg His Val Asp Arg Ala Thr Gly Gln Val Leu Thr Cys gac aag tgt cca gca gga acc tat gtc tct gag cat tgt acc aac aca 658 Asp Lys Cys Pro Ala Gly Thr Tyr Val Ser Glu His Cys Thr Asn Thr SUBSTITUTE SHEET ( rule 26 ) agc ctgcgc gtctgcagcagt tgccctgtgggg acctttacc aggcat 706 Ser LeuArg ValCysSerSer CysProValGly ThrPheThr ArgHis gag aatggc atagagaaatgc catgactgtagt cagccatgc ccatgg 754 Glu AsnGly IleGluLysCys HisAspCysSer GlnProCys ProTrp cca atgatt gagaaattacct tgtgetgccttg actgaccga gaatgc 802 Pro MetIle GluLysLeuPro CysAlaAlaLeu ThrAspArg GluCys act tgccca cctggcatgttc cagtctaacget acctgtgcc ccccat 850 Thr CysPro ProGlyMetPhe GlnSerAsnAla ThrCysAIa ProHis acg gtgtgt cctgtgggttgg ggtgtgcggaag aaagggaca gagact 898 Thr ValCys ProValGlyTrp GlyValArgLys LysGlyThr GluThr gag gatgtg cggtgtaagcag tgtgetcggggt accttctca gatgtg 946 Glu AspVal ArgCysLysGln CysAlaArgGly ThrPheSer AspVal 165 1.70 175 cct tctagt gtgatgaaatgc aaagcatacaca gactgtctg agtcag 994 Pro SerSer ValMetLysCys LysAlaTyrThr AspCysLeu SerGln aac ctg gtg gtg atc aag ccg ggg acc aag gag aca gac aac gtc tgt 1042 Asn Leu Val Val Ile Lys Pro Gly Thr Lys Glu Thr Asp Asn Val Cys ggc aca ctc ccg tcc ttc tcc agc tcc acc tca cct tcc cct ggc aca 1090 Gly Thr Leu Pro Ser Phe Ser Ser Ser Thr Ser Pro Ser Pro Gly Thr gcc atc ttt cca cgc cct gag cac atg gaa acc cat gaa gtc cct tcc 1138 Ala Ile Phe Pro Arg Pro Glu His Met Glu Thr His Glu Val Pro Ser tcc act tat gtt ccc aaa ggc atg aac tca aca gaa tcc aac tct tct 1186 Ser Thr Tyr Val Pro Lys Gly Met Asn Ser Thr Glu Ser Asn Ser Ser gcc tct gtt aga cca aag gta ctg agt agc atc cag gaa ggg aca gtc 1234 Ala Ser Val Arg Pro Lys Val Leu Ser Ser Ile Gln Glu Gly Thr Val cct gac aac aca agc tca gca agg ggg aag gaa gac gtg aac aag acc 1282 Pro Asp Asn Thr Ser Ser Ala Arg Gly Lys Glu Asp Val Asn Lys Thr ctc cca aac ctt cag gta gtc aac cac cag caa ggc ccc cac cac aga 1330 Leu Pro Asn Leu Gln Val Val Asn His Gln Gln Gly Pro His His Arg cac atc ctg aag ctg ctg ccg tcc atg gag gcc act ggg ggc gag aag 1378 His Ile Leu Lys Leu Leu Pro Ser Met Glu Ala Thr Gly Gly Glu Lys SUBSTITUTE SHEET ( rule 26 ) tcc agc acg ccc atc aag ggc ccc aag agg gga cat cct aga cag aac 1426 Ser Ser Thr Pro Ile Lys Gly Pro Lys Arg Gly His Pro Arg Gln Asn cta cac aag cat ttt gac atc aat gag cat ttg ccc tgg atg att gtg 1474 Leu His Lys His Phe Asp Ile Asn Glu His Leu Pro Trp Met Ile Val ctt ttc ctg ctg ctg gtg ctt gtg gtg att gtg gtg tgc agt atc cgg 1522 Leu Phe Leu Leu Leu Val Leu Val Val Ile Val Val Cys Ser Ile Arg aaa agc tcg agg act ctg aaa aag ggg ccc cgg cag gat ccc agt gcc 1570 Lys Ser Ser Arg Thr Leu Lys Lys Gly Pro Arg Gln Asp Pro Ser Ala att gtg gaa aag gca ggg ctg aag aaa tcc atg act cca acc cag aac 1618 Ile Val Glu Lys Ala Gly Leu Lys Lys Ser Met Thr Pro Thr Gln Asn cgg gag aaa tgg atc tac tac tgc aat ggc cat ggt atc gat atc ctg 1666 2 5 Arg Glu Lys Trp Ile Tyr Tyr Cys Asn Gly His Gly Ile Asp Ile Leu aag ctt gta gca gcc caa gtg gga agc cag tgg aaa gat atc tat cag 1714 Lys Leu Val Ala Ala Gln Val Gly Ser GIn Trp Lys Asp Ile Tyr Gln ttt ctt tgc aat gcc agt gag agg gag gtt get get ttc tcc aat ggg 1762 Phe Leu Cys Asn Ala Ser Glu Arg Glu Val Ala Ala Phe Ser Asn Gly tac aca gcc gac cac gag cgg gcc tac gca get ctg cag cac tgg acc 1810 Tyr Thr Ala Asp His GIu Arg Ala Tyr Ala Ala Leu Gln His Trp Thr atc cgg ggc ccc gag gcc agc ctc gcc cag cta att agc gcc ctg cgc 1858 Ile Arg Gly Pro Glu Ala Ser Leu Ala Gln Leu Ile Ser Ala Leu Arg cag cac cgg aga aac gat gtt gtg gag aag att cgt ggg ctg atg gaa 1906 Gln His Arg Arg Asn Asp Val Val Glu Lys Ile Arg Gly Leu Met Glu gac acc acc cag ctg gaa act gac aaa cta get ctc ccg atg agc ccc 1954 Asp Thr Thr Gln Leu GIu Thr Asp Lys Leu Ala Leu Pro Met Ser Pro agc ccg ctt agc ccg agc ccc atc ccc agc ccc aac gcg aaa ctt gag 2002 Ser Pro Leu Ser Pro Ser Pro Ile Pro Ser Pro Asn Ala Lys Leu Glu aat tcc get ctc ctg acg gtg gag cct tcc cca cag gac aag aac aag 2050 Asn Ser Ala Leu Leu Thr Val Glu Pro Ser Pro Gln Asp Lys Asn Lys ggc ttc ttc gtg gat gag tcg gag ccc ctt ctc cgc tgt gac tct aca 2098 Gly Phe Phe Val Asp Glu Ser Glu Pro Leu Leu Arg Cys Asp Ser Thr SUBSTITUTE SHEET ( rule 26 ) ggc aca tac cgc cat gtt gac cgt gcc acc ggc cag gtg tcc agc ggc tcc tcc gcg ctg agc agg aac ggt tcc ttt att acc aaa 2146 5 Ser Ser Gly Ser Ser Ala Leu Ser Arg Asn Gly Ser Phe Ile Thr Lys gaa aag aag gac aca gtg ttg cgg cag gta cgc ctg gac ccc tgt gac 2194 Glu Lys Lys Asp Thr Val Leu Arg Gln Val Arg Leu Asp Pro Cys Asp ttg cag cct atc ttt gat gac atg ctc cac ttt cta aat cct gag gag 2242 Leu Gln Pro Ile Phe Asp Asp Met Leu His Phe Leu Asn Pro Glu Glu ctg cgg gtg att gaa gag att ccc cag get gag gac aaa cta gac cgg 2290 Leu Arg Val Ile Glu Glu Ile Pro Gln Ala Glu Asp Lys Leu Asp Arg cta ttc gaa att agc cag gcc agc 2338 att gga gtc aag gaa cag acc ctc Leu Phe Glu Ile Ser Gln Ala Ser Ile Gly Val Lys Glu Gln Thr Leu ctg gac tct gtt cct gac ctg tagaacatag 2384 tat agc cat ctt ctg Leu Asp Ser Val Pro Asp Leu Tyr Ser His Leu Leu ggatactgca ttctggaaatt,actcaatttagtggcagggtggttttttaatttccttct2444 gtgtctgatt tttgttgtttggggtgtgtgtgtgtgtttgtgtgtgtgtgtgtgtgtgtg2504 tgtgtgtgtg tttaacagaga,atatggccagtgcttgagttctttctccttctctctct.c2564 tctttttttt ttaaataactcttctgggaagttggtttataagcctttgccaggtgtaac2624 tgttgtgaaa tacccaccactaaagttttttaagttccatattttctccattttgccttc2684 ttatgtattt tcaagattattctgtgcactttaaatttactcaacttaccataaatgcag2744 tgtgactttt cccacacactggattgtgaggctcttaacttcttaaaagtataatggca.t2804 cttgtgaatc ctataagcagtctttatgtctcttaacattcacacctactttttaaaaac2864 aaatattatt act 2877 <210> 10 <211> 655 <212> PRT

<213> Unknown <400> 10 Met Gly Thr Ser Pro Ser Ser Ser Thr Ala Leu Ala Ser Cys Ser Arg Ile Ala Arg Arg Ala Thr Ala Thr Met Ile Ala Gly Ser Leu Leu Leu Leu Gly Phe Leu Ser Thr Thr Thr Ala Gln Pro Glu Gln Lys Ala Ser Asn Leu Ile Gly Thr Tyr Arg His Val Asp Arg Ala Thr Gly Gln Val SUBSTITUTE SHEET ( rule 26 ) Leu Thr CysAspLysCys ProAlaGly ThrTyrValSer GluHisCys Thr Asn ThrSerLeuArg ValCysSer SerCysProVal GlyThrPhe Thr Arg HisGluAsnGly IleGluLys CysHisAspCys SerGlnPro Cys Pro TrpProMetIle GluLysLeu ProCysAlaAla LeuThrAsp Arg Glu CysThrCysPro ProGlyMet PheGlnSerAsn AlaThrCys Ala Pro HisThrValCys ProValGly TrpGlyValArg LysLysGly Thr Glu ThrGluAspVal ArgCysLys GlnCysAlaArg GlyThrPhe Ser Asp ValProSerSer ValMetLys CysLysAlaTyr ThrAspCys Leu Ser GlnAsnLeuVal ValIleLys ProGlyThrLys GluThrAsp Asn Val CysGlyThrLeu ProSerPhe SerSerSerThr SerProSer Pro Gly ThrAlaIlePhe ProArgPro GluHisMetGlu ThrHisGlu Val Pro SerSerThrTyr ValProLys GlyMetAsnSer ThrGluSer Asn Ser SerAlaSerVal ArgProLys Va1LeuSerSer IleGlnGlu Gly Thr ValProAspAsn ThrSerSer AlaArgGlyLys GluAspVal Asn Lys ThrLeuProAsn LeuGlnVal ValAsnHisGln GlnGlyPro His His ArgHisIleLeu LysLeuLeu ProSerMetGlu AlaThrGly Gly Glu LysSerSerThr ProIleLys GlyProLysArg GlyHisPro Arg Gln AsnLeuHisLys HisPheAsp IleAsnGluHis LeuProTrp Met Ile ValLeuPheLeu LeuLeuVal LeuValValIle ValValCys Ser Ile ArgLysSerSer ArgThrLeu LysLysGlyPro ArgGlnAsp SUBSTITUTE SHEET ( rule 26 ) Pro Ser Ala Ile Val Glu Lys Ala Gly Leu Lys Lys Ser Met Thr Pro Thr Gln Asn Arg Glu Lys Trp Ile Tyr Tyr Cys Asn Gly His Gly Ile Asp Ile Leu Lys Leu Val Ala Ala Gln Val Gly Ser Gln Trp Lys Asp Ile Tyr Gln Phe Leu Cys Asn Ala Ser Glu Arg Glu Val Ala Ala Phe Ser Asn Gly Tyr Thr Ala Asp His Glu Arg A1a Tyr Ala Ala Leu Gln His Trp Thr Ile Arg Gly Pro Glu Ala Ser Leu Ala Gln Leu Ile Ser Ala Leu Arg Gln His Arg Arg Asn Asp Val Val Glu Lys Ile Arg Gly 2 5 Leu Met Glu Asp Thr Thr Gln Leu Glu Thr Asp Lys Leu Ala Leu Pro Met Ser Pro Ser Pro Leu Ser Pro Ser Pro Ile Pro Ser Pro Asn Ala Lys Leu Glu Asn Ser Ala Leu Leu Thr Val Glu Pro Ser Pro Gln Asp Lys Asn Lys Gly Phe Phe Val Asp Glu Ser Glu Pro Leu Leu Arg Cys Asp Ser Thr Ser Ser Gly Ser Ser Ala Leu Ser Arg Asn Gly Ser Phe Ile Thr Lys Glu Lys Lys Asp Thr Val Leu Arg Gln Val Arg Leu Asp Pro Cys Asp Leu Gln Pro Ile Phe Asp Asp Met Leu His Phe Leu Asn Pro Glu Glu Leu Arg Val Ile Glu Glu Ile Pro Gln Ala Glu Asp Lys Leu Asp Arg Leu Phe Glu Ile Ile Gly Val Lys Ser Gln Glu Ala Ser Gln Thr Leu Leu Asp Ser Val Tyr Ser His Leu Pro Asp Leu Leu <210> 11 <211> 1474 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism: primate <220>
SUBSTITUTE SHEET ( rule 26 ) <221> CDS
<222> (1)..(1332) <400> 11 atg ggg acc tct ccg agc agc agc acc gcc ctc gcc tcc tgc agc cgc 48 Met Gly Thr Ser Pro Ser Ser Ser Thr Ala Leu Ala Ser Cys Ser Arg atc gcc cgc cga gcc aca gcc acg atg atc gcg ggc tcc ctt ctc ctg 96 Ile Ala Arg Arg Ala Thr Ala Thr Met Ile Ala Gly Ser Leu Leu Leu ctt gga ttc ctt agc acc acc aca get cag cca gaa cag aag gcc tcg 144 Leu Gly Phe Leu Ser Thr Thr Thr Ala Gln Pro Glu Gln Lys Ala Ser 20 aat ctc att ggc aca tac cgc cat gtt gac cgt gcc acc ggc cag gtg 192 Asn Leu Ile Gly Thr Tyr Arg His Val Asp Arg Ala Thr Gly Gln Val cta acc tgt gac aag tgt cca gca gga acc tat gtc tct gag cat tgt 240 2 5 Leu Thr Cys Asp Lys Cys Pro Ala Gly Thr Tyr Val Ser Glu His Cys acc aac aca agc ctg cgc gtc tgc agc agt tgc cct gtg ggg acc ttt 288 Thr Asn Thr Ser Leu Arg Val Cys Ser Ser Cys Pro Val Gly Thr Phe acc agg cat gag aat ggc ata gag aaa tgc cat gac tgt agt cag cca 336 Thr Arg His Glu Asn Gly Ile Glu Lys Cys His Asp Cys Ser Gln Pro tgc cca tgg cca atg att gag aaa tta cct tgt get gcc ttg act gac 384 Cys Pro Trp Pro Met Ile Glu Lys Leu Pro Cys Ala Ala Leu Thr Asp 4 0 cga gaa tgc act tgc cca cct ggc atg ttc cag tct aac get acc tgt 432 Arg Glu Cys Thr Cys Pro Pro Gly Met Phe Gln Ser Asn Ala Thr Cys gcc ccc cat acg gtg tgt cct gtg ggt tgg ggt gtg cgg aag aaa ggg 480 Ala Pro His Thr Val Cys Pro Val Gly Trp Gly Val Arg Lys Lys Gly aca gag act gag gat gtg cgg tgt aag cag tgt get cgg ggt acc ttc 528 Thr Glu Thr Glu Asp Val Arg Cys Lys Gln Cys Ala Arg Gly Thr Phe tca gat gtg cct tct agt gtg atg aaa tgc aaa gca tac aca gac tgt 576 Ser Asp Val Pro Ser Ser Val Met Lys Cys Lys Ala Tyr Thr Asp Cys ctg agt cag aac ctg gtg gtg atc aag ccg ggg acc aag gag aca gac 624 Leu Ser Gln Asn Leu Val Val Ile Lys Pro Gly Thr Lys Glu Thr Asp aac gtc tgt ggc aca ctc ccg tcc ttc tcc agc tcc acc tca cct tcc 672 Asn Val Cys Gly Thr Leu Pro Ser Phe Ser Ser Ser Thr Ser Pro Ser SUBSTITUTE SHEET { rule 26 ) cct ggc aca gcc atc ttt cca cgc cct gag cac atg gaa acc cat gaa 720 Pro Gly Thr Ala Ile Phe Pro Arg Pro Glu His Met Glu Thr His Glu gtc cct tcc tcc act tat gtt ccc aaa ggc atg aac tca aca gaa tcc 768 Val Pro Ser Ser Thr Tyr Val Pro Lys Gly Met Asn Ser Thr Glu Ser aac tct tct gcc tct gtt aga cca aag gta ctg agt agc atc cag gaa 816 Asn Ser Ser Ala Ser Val Arg Pro Lys Val Leu Ser Ser Ile Gln Glu ggg aca gtc cct gac aac aca agc tca gca agg ggg aag gaa gac gtg 864 Gly Thr Val Pro Asp Asn Thr Ser Ser Ala Arg Gly Lys Glu Asp Val 2?5 280 285 aac aag acc ctc cca aac ctt cag gta gtc aac cac cag caa ggc ccc 912 Asn Lys Thr Leu Pro Asn Leu Gln Val Val Asn His Gln Gln Gly Pro cac cac aga cac atc ctg aag ctg ctg ccg tcc atg gag gcc act ggg 960 His His Arg His Ile Leu Lys Leu Leu Pro Ser Met Glu Ala Thr Gly ggc gag aag tcc agc acg ccc atc aag ggc ccc aag agg gga cat cct 1008 Gly Glu Lys Ser Ser Thr Pro Ile Lys Gly Pro Lys Arg Gly His Pro aga cag aac cta cac aag cat ttt gac atc aat gag cat ttg ccc tgg 1056 Arg Gln Asn Leu His Lys His Phe Asp Ile Asn Glu His Leu Pro Trp atg att gtg ctt ttc ctg ctg ctg gtg ctt gtg gtg att gtg gtg tgc 1104 Met Ile Val Leu Phe Leu Leu Leu Val Leu Val Val Ile Val Val Cys agt atc cgg aaa agc tcg agg act ctg aaa aag ggg ccc cgg cag gat 1152 Ser Ile Arg Lys Ser Ser Arg Thr Leu Lys Lys Gly Pro Arg Gln Asp ccc agt gcc att gtg gaa aag gca ggg ctg aag aaa tcc atg act cca 1200 Pro Ser Ala Ile Val Glu Lys Ala Gly Leu Lys Lys Ser Met Thr Pro acc cag aac cgg gag aaa tgg atc tac tac tgc aat ggc cat gga ccc 1248 Thr Gln Asn Arg Glu Lys Trp Ile Tyr Tyr Cys Asn Gly His Gly Pro cat gat gag gag tgg ggg ttg atg gag aga cat att caa gat att tat 1296 His Asp Glu Glu Trp Gly Leu Met Glu Arg His Ile Gln Asp Ile Tyr att caa aga agc aat caa gat tca gaa aga tgg ggt tgataatttt 1342 Ile Gln Arg Ser Asn Gln Asp Ser Glu Arg Trp Gly tacttcaccc tgggaggcag catagtgcag tgaaaggtat cgatatcctg aagcttgtag 1402 cagcccaagt gggaagccag tggaaagata tctatcagtt tctttgcaat gccagtgaga 1462 gggaggttgc tg 1474 SUBSTITLfTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 <210>

<21 1>

<21 2>
PRT

<21 3>
Unknown <40 0>

Met Gly ThrSerProSer SerSerThrAla LeuAlaSer CysSerArg 15 Ile Ala ArgArgAlaThr AlaThrMetIle AlaGlySer LeuLeuLeu Leu Gly PheLeuSerThr ThrThrAlaGln ProGluGln LysAlaSer Asn Leu IleGlyThrTyr ArgHisValAsp ArgAlaThr GlyGlnVal Leu Thr CysAspLysCys ProAlaGlyThr TyrValSer GluHisCys Thr Asn ThrSerLeuArg ValCysSerSer CysProVal GlyThrPhe 3 Thr Arg HisGluAsnGly IleGluLysCys HisAspCys SerGlnPro Cys Pro TrpProMetIle GluLysLeuPro CysAlaAla LeuThrAsp Arg Glu CysThrCysPro ProGlyMetPhe GlnSerAsn AlaThrCys Ala Pro HisThrValCys ProValGlyTrp GlyValArg LysLysGly Thr Glu ThrGluAspVal ArgCysLysGln CysAlaArg GlyThrPhe Ser Asp ValProSerSer ValMetLysCys LysAlaTyr ThrAspCys Leu Ser GlnAsnLeuVal ValIleLysPro GlyThrLys GluThrAsp Asn Val CysGlyThrLeu ProSerPheSer SerSerThr SerProSer Pro Gly ThrAlaIlePhe ProArgProGlu HisMetGlu ThrHisGlu Val Pro SerSerThrTyr ValProLysGly MetAsnSer ThrGluSer Asn Ser SerAlaSerVal ArgProLysVal LeuSerSer IleGlnGlu Gly Thr ValProAspAsn ThrSerSerAla ArgGlyLys GluAspVal SUBSTITUTE SHEET ( rule 26 ) Asn Lys Thr Leu Pro Asn Leu Gln Val Val Asn His Gln GIn Gly Pro His HisArgHis IleLeuLysLeu LeuProSer MetGluAla ThrGly 305 310 315 ~ 320 Gly GluLysSer SerThrProIle LysGlyPro LysArgGly HisPro Arg GlnAsnLeu HisLysHisPhe AspIleAsn GluHisLeu ProTrp Met IleValLeu PheLeuLeuLeu ValLeuVal ValIleVal ValCys 2 Ser IleArgLys SerSerArgThr LeuLysLys GlyProArg GlnAsp Pro SerAlaIle ValGluLysAla GlyLeuLys LysSerMet ThrPro Thr GlnAsnArg GluLysTrpIle TyrTyrCys AsnGlyHis GlyPro His AspGluGlu TrpGlyLeuMet GluArgHis IleGlnAsp IleTyr Ile GlnArgSer AsnGlnAspSer GluArgTrp Gly <210>

<211>

<212>
PRT

<213>
Unknown <220>

<223>
Description of Unknown Organism:
rodent <400>

Met AlaProAla AlaLeuTrpVal AlaLeuVal PheGluLeu GlnLeu Trp AlaThrGly HisThrValPro AlaGlnVal ValLeuThr ProTyr Lys ProGluPro GlyTyrGluCys GlnIleSer GlnGluTyr TyrAsp Arg LysAlaGln MetCysCysAla LysCysPro ProGlyGln TyrVal Lys HisPheCys AsnLysThrSer AspThrVal CysAlaAsp CysGlu 60 Ala SerMetTyr ThrGlnValTrp AsnGlnPhe ArgThrCys LeuSer Cys SerSerSer CysThrThrAsp GlnValGlu IleArgAla CysThr SUBSTITUTE SHEET ( rule 2fi ) Lys Gln GlnAsnArgVal CysAlaCysGlu AiaGlyArg TyrCysAla Leu Lys ThrHisSerGly SerCysArgGln CysMetArg LeuSerLys Cys Gly ProGlyPheGly ValAlaSerSer ArgAlaPro AsnGlyAsn Val Leu CysLysAlaCys AlaProGlyThr PheSerAsp ThrThrSer Ser Thr AspValCysArg ProHisArgIle CysSerIle LeuAlaIle 2 Pro Gly AsnAlaSerThr AspAlaValCys AlaProGlu SerProThr Leu Ser AlaIleProArg ThrLeuTyrVal SerGlnPro GluProThr Arg Ser Gln 3 0 <210> 14 <211> 225 <212> PRT

<213> Unknown <220>

<223> Description of Unknown Organism:
primate <400> 14 Met Ala ValAlaVal TrpAlaAlaLeu AlaValGly LeuGluLeu Pro Trp Ala AlaHisAla LeuProAlaGln ValAlaPhe ThrProTyr Ala Ala Pro ProGlySer ThrCysArgLeu ArgGluTyr TyrAspGln Glu Thr Ala MetCysCys SerLysCysSer ProGlyGln HisAlaLys Gln Val Phe ThrLysThr SerAspThrVal CysAspSer CysGluAsp Cys Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg SUBSTITUTE SHEET ( rule 26 ) Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro Hi:~ Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala Pro Gly Ala Va:L His Leu Pro Gln Pro Val Ser Thr Arg Ser 2 0 Gln <210> 15 2 <211> 187 <212> PRT

<213> Unknown <220>

3 <223> Description 0 of Unknown Organism:
primate <400> 15 Met Asn Leu LeuCy~~CysAla LeuValPheLeu AspIleSer Ile Lys Lys Trp Thr GlnGluThrPhe ProProLysTyr LeuHisTyr Asp Thr Glu Glu Ser HisGlnLeuLeu CysAspLysCys ProProGly Thr Thr Tyr Leu Gln HisCys;ThrAla LysTrpLysThr ValCysAla Pro Lys 45 Cys Pro His TyrTyrThrAsp SerTrpHisThr SerAspGlu Cys Asp Leu Tyr Ser ProVal.CysLys GluLeuGlnTyr ValLysGln Glu Cys Cys Asn Thr HisAsr.~ArgVal CysGluCysLys GluGlyArg Tyr Arg Leu Glu Glu PheCys.LeuLys HisArgSerCys ProProGly Phe Ile Gly Val Gln AlaGlyThrPro GluArgAsnThr ValCysLys Arg Val 60 Cys Pro Gly PhePheSerAsn GluThrSerSer LysAlaPro Cys Asp 145 150 1.55 160 Arg Lys Thr AsnCysSerVal PheGlyLeuLeu LeuThrGln Lys His SUBSTITLfTE SHEET ( ruie 26 ) Gly Asn Ala Thr His Asp Asn IIe Cys Ser Gly <210> 16 <211> 636 <212> DNA

<213> Unknown <220>

<223> Description of Unknown Organism:
rodent <220>

<221> CDS

<222> (104)..(553) <400> 16 ggcacgaggg cgtttggcgc c~gaagtgcta ccaagctgcg tctggagca gaaagcgtga g 60 cagcactggc gagtagcagg a.ataaacacg tttggtgagaatggcactc aag gcc 115 MetAlaLeu Lys gtc cta cct cta cac agg acg gtg ctc ttc attctcttc cta get gcc 163 Val Leu Pro Leu His Arg- Thr Val Leu Phe IleLeuPhe Leu Ala Ala ctc cac ctg gca tgt aaa gtg agt tgc gaa acc gga gat tgc agg cag 211 Leu His Leu Ala Cys Lys Val Ser Cys Glu Thr Gly Asp Cys Arg Gln cag gaa ttc aag gat cga tct gga aac tgt gtc ctc tgc aaa cag tgc 259 Gln Glu Phe Lys Asp Arg Ser Gly Asn Cys Val Leu Cys Lys Gln Cys 40 gga cct ggc atg gag ttg tcc aag gaa tgt ggc ttc ggc tat ggg gag 307 Gly Pro Gly Met Glu Leu Ser Lys Glu Cys Gly Phe Gly Tyr Gly Glu gat gca cagtgtgtg ccctgcaggccg caccggttcaag gaagactgg 355 Asp Ala GlnCysVal ProCysArgPro HisArgPheLys GluAspTrp ggt ttc cagaagtgt aagccatgtgcg gactgtgcgctg gtgaaccgc 403 Gly Phe GlnLysCys LysProCysAla AspCysAlaLeu ValAsnArg ttt cag agggccaac tgctcacacacc agtgatgetgtc tgcggggac 451 Phe Gln ArgAlaAsn CysSerHisThr SerAspAlaVal CysGlyAsp tgc ctg ccaggattt taccggaagacc aaactggttggt tttcaagac 499 Cys Leu ProGlyPhe TyrArgLysThr LysLeuValGly PheGlnAsp atg gag tgtgtgccc tgcggagaccca cctcctccctac gaaccacac 547 Met Glu CysValPro CysGlyAspPro ProProProTyr GluProHis SUBSTITUTE SHEET ( rule 26 ) tgt gag tgatgtgcca agtggcagca gacctttaaa aaaaaaagaa aaaaaaacaa 603 5 Cys Glu acaaaaacaa aaaaaaaaaa aaaaaaaaaa aaa 636 <210> 17 <211> 150 <212> PRT

<213> Unknown <400> 17 Met Ala Lys ValLeuPro LeuHisArgThr ValLeuPhe AlaAla Leu 2 Ile Leu Leu LeuHisLeu AlaCysLysVal SerCysGlu ThrGly 0 Phe Asp Cys Gln GlnGluPhe LysAspArgSer GlyAsnCys ValLeu Arg Cys Lys Cys GlyProGly MetGluLeuSer LysGluCys GlyPhe Gln Gly Tyr Glu AspAlaGln CysValProCys ArgProHis ArgPhe Gly Lys Glu Trp GlyPhe~Gln LysCysLysPro CysAlaAsp CysAla Asp 3 Leu Val Arg PheGlnArg AlaAsnCysSer HisThrSer AspAla 5 Asn Val Cys Asp CysLeuPro GlyPheTyrArg LysThrLys LeuVal Gly Gly Phe Asp MetGluCys ValProCysGly AspProPro ProPro Gln Tyr Glu His CysGlu Pro <210> 18 <211> 474 <212> DNA

<213> Unknown <220>

<223> Description Unknown of Organism:
primate <220>

<221> CDS

<222> (78)..(473) <400> 18 cgcgctgagg tggatttgta c;cggagtccc atttgggagc aagagccatc tactcgtccg 60 ttaccggcct tcccacc atg gat tgc caa gaa aat gag tac tgg gac caa 110 SUBSTITUTE SHEET ( rule 26 ) Met .Asp Cys Gln Glu Asn Glu Tyr Trp Asp Gln 1 5 to tgg gga cgg tgt gtc acc tgc caa cgg tgt ggt cct gga cag gag cta 158 Trp Gly Arg Cys Val Thr Cys Gln Arg Cys Gly Pro Gly Gln Glu Leu tcc aag gat tgt ggt tat gga gag ggt gga gat gcc tac tgc aca gcc 206 Ser Lys Asp Cys Gly Tyr Gly Glu Gly Gly Asp Ala Tyr Cys Thr Ala tgc cct cct cgc agt aca aaa gca get ggg gcc acc aca aat gtc aga 254 Cys Pro Pro Arg Ser Th:r Lys Ala Ala Gly Ala Thr Thr Asn Val Arg gtt gcatcacct gtgctc~tca tcaatcgtgttc agaaggtc aac tgc 302 t 2 Val AlaSerPro ValLeuSer SerIleValPhe ArgArgPheAsn Cys aca gtnacctct natgetgtc tgtgggggangg tttgcccaagtt tct 350 Thr XaaThrSer XaaAlaVal CysGlyGlyXaa PheAlaGlnVal Ser aac cgaaagaca cgccat:tgg aaggetgccagg accaaggatggc atc 398 Asn ArgLysThr ArgHisTrp LysAlaAlaArg ThrLysAspGly Ile ccg tggcacaaa gncagaccc ccaacttctgan ggttncaaagtg nct 446 Pro TrpHisLys XaaArgPro ProThrSerXaa GlyXaaLysVal Xaa ttc caattggag cttaat:ggg aggcana 474 Phe GlnLeuGlu LeuAsnGly ArgXaa <210> 19 <211> 132 <212> PRT

<213> Unknown <400> 19 Met Asp Gln GluAsnGluTyr TrpAspGlnTrp GlyArgCys Val Cys Thr Cys Arg CysGlyProGly GlnGluLeuSer LysAspCys Gly Gln Tyr Gly Gly GlyAspAlaTyr CysThrAlaCys ProProArg Ser Glu Thr Lys Ala GlyAlaiThrThr AsnValArgVal AlaSerPro Val Ala Leu Ser Ile ValPheArgArg PheAsnCysThr XaaThrSer Xaa Ser Ala Val Gly GlyXaaPheAla GlnValSerAsn ArgLysThr Arg Cys SUBSTITUTE SHEET ( rule 26 ) His Trp Lys Ala Ala Arq Thr Lys Asp Gly Ile Pro Trp His Lys Xaa Arg Pro Pro Thr Ser Xaa Gly Xaa Lys Val Xaa Phe Gln Leu Glu Leu Asn Gly Arg Xaa <210> 20 <211> 546 <212> DNA

<213> Unknown <220>

<223> Description sm:
of Unknown Organi primate <220>

<221> CDS

<222> (78)..(308) <400> 20 cgcgctgagg tggatttgtacggagtccc ttgggagc atctactcgtccg60 c at aagagcc ttaccggcct tcccacc gat tgc gaaaat tactgggaccaa 110 atg caa gag 3 Met Asp Cys GluAsn TyrTrpAspGln 0 Gln Glu tgg gga cgg tgt gtc tgc caa tgtggt ggacaggagcta 158 acc cgg cct Trp Gly Arg Cys Val Cys Gln CysGly GlyGlnGluLeu Thr Arg Pro tcc aag gat tgt ggt gga gag ggagat tactgcacagcc 206 tat ggt gcc Ser Lys Asp Cys Gly Gly Glu GlyAsp TyrCysThrAla Tyr Gly Ala tgc cct cct cgc agg aaa agc tggggc cacaaatgtcag 254 tac agc cac Cys Pro Pro Arg Arg Lys Ser TrpGly HisLysCysGln Tyr Ser His agt tgc atc acc tgt gtc atc cgtgtt aaggtccaactg 302 get aat cag Ser Cys Ile Thr Cys Val Ile ArgVal LysValGlnLeu Ala Asn Gln cac agc taacctctna gtctgt t gncccaagtt ctnaccgaaa 358 tgct ggggatgtt His Ser agacacgcca tgggaaggct ggcaggacca ngaatggccn tcccgtggca gaaagccaga 418 ccccccaacn nctgnaggtt ccaatgtggc cttnccattt ggaagcttan tgggaaggca 478 gatgncaacc caaagtggcc ccttcaggga ggccaaaatt tgttggcaat gggtgnagca 538 gcntgcca SUBSTITUTE SHEET ( rule 26 ) <210> 21 <211> 77 <212> PRT

<213> Unknown <400> 21 Met Asp Cys Gln Glu Asn Glu Tyr Trp Asp Gln Trp Gly Arg Cys Val Thr Cys Gln Arg Cys Gly_ Pro Gly Gln Glu Leu Ser Lys Asp Cys Gly Tyr Gly Glu Gly Gly Asp Ala Tyr Cys Thr Ala Cys Pro Pro Arg Arg 2 0 Tyr Lys Ser Ser Trp Gly_ His His Lys Cys Gln Ser Cys Ile Thr Cys Ala Val Ile Asn Arg Val Gln Lys Val Gln Leu His Ser 65 70 ?5 <210> 22 <211> 932 <212> DNA

3 <213> Unknown <220>

<223> Description of Unknown Organism:
primate <220>

<221> CDS

<222> (78)..(770) <220>

<221> misc_feature <222> (782) <223> nucleotide may bes A, C, G, or T

<400> 22 cgcgctgagg tggatttgta c:cggagtccc atttgggagcagccatc tactcgtccg 60 aag ttaccggcct tcccacc atg gat tgc caa gaa tac gac caa 110 aat gag tgg Met Asp Cys Gln Glu Asn Glu Tyr Trp Asp Gln tgg gga cgg tgt gtc acc: tgc caa cgg ggacaggag cta 158 tgt ggt cct Trp Gly Arg Cys Val Thr Cys Gln Arg Cys GlyGlnGlu Leu Gly Pro tcc aag gat tgt ggt tai gga gag ggt gga tactgcaca gcc 206 gat gcc Ser Lys Asp Cys Gly Tyr Gly Glu Gly Gly TyrCysThr Ala Asp Ala tgc cct cct cgc agg tac aaa agc agc tgg cacaaatgt cag 254 ggc cac Cys Pro Pro Arg Arg Ty~_~ Lys Ser Ser HisLysCys Gln Trp Gly His SUBSTITI1TE SHEET ( rule 26 ) agt tgc atcacctgt gct:gtcatcaat cgtgttcagaag gtcaactgc 302 Ser Cys IleThrCys AlaValIleAsn ArgValGlnLys ValAsnCys aca get acctctaat gct:gtctgtggg gactgtttgccc aggttctac 350 Thr Ala ThrSerAsn AlaValCysGly AspCysLeuPro ArgPheTyr cga aag acacgcatt gga~ggcctgcag gaccaagagtgc atcccgtgc 398 Arg Lys ThrArgIle GlyGlyLeuGln AspGlnGluCys IleProCys acg aag cagaccccc acctctgaggtt caatgtgccttc cagttgagc 446 Thr Lys GlnThrPro ThrSerGluVal GlnCysAlaPhe GlnLeuSer tta gtg gaggcagat gcacccaca gtgccccctcaggag gccaca ctt 494 Leu Val GluAlaAsp AlaProThr ValProProGlnGlu AlaThr Leu gtt gca ctggtgagc agcctgcta gtggtgtttaccctg gccttc ctg 542 Val Ala LeuValSer SerLeuLeu ValValPheThrLeu AlaPhe Leu ggg ctc ttcttcctc tactgcaag cagttcttcaacaga cattgc cag 590 Gly Leu PhePheLeu TyrCysLys GlnPhePheAsnArg HisCys Gln cgt gga ggtttgctg cagtttgag getgataaaacagca aaggag gaa 63$

Arg Gly GlyLeuLeu GlnPheGlu AlaAspLysThrAla LysGlu Glu tct ctc ttccccgtg ccacccagc aaggagaccagtget gagtcc caa 686 Ser Leu PheProVal ProProSer LysGluThrSerAla GluSer Gln gtc tct tgggcccct ggcagcctt gcccagttgttctct ctggac tct 734 Val Ser TrpAlaPro GlySerLeu AlaGlnLeuPheSer LeuAsp Ser gtt cct ataccacaa cagcagcag gggcctgaaatgtgatgtccac 780 Val Pro IleProGln GlnGlnGln GlyProGluMet angagctaat cctatcccat cccaccagag 840 accctacaga gattgattct tggggcatat ccatttcaca tgttgtagtc 900 aggactgatc tggggagcca tggagcattt cttgcttccc gattccacat 932 tcatgggact accagacatg tt <210> 23 <211> 231 <212> PRT
<213> Unknown <400> 23 Met Asp Cys Gln Glu Asn Glu Tyr Trp Asp Gln Trp Gly Arg Cys Val SUBSTITUTE SHEET ( rule 26 ) 5 Thr Cys Gln Arg Cys Gly Pro Gly Gln Glu Leu Ser Lys Asp Cys Gly Tyr Gly Glu Gly Gly Asp Ala Tyr Cys Thr Ala Cys Pro Pro Arg Arg Tyr Lys Ser Ser Trp Gly His His Lys Cys Gln Ser Cys Ile Thr Cys Ala Val Ile Asn Arg Val Gln Lys Val Asn Cys Thr Ala Thr Ser Asn Ala Val Cys Gly Asp Cys Leu Pro Arg Phe Tyr Arg Lys Thr Arg Ile 2 0 Gly Gly Leu Gln Asp Gln Glu Cys Ile Pro Cys Thr Lys Gln Thr Pro Thr Ser Glu Val Gln Cys Ala Phe Gln Leu Ser Leu Val Glu Ala Asp Ala Pro Thr Val Pro Pro Gln Glu Ala Thr Leu Val Ala Leu Val Ser Ser Leu Leu Val Val Phe Thr Leu Ala Phe Leu Gly Leu Phe Phe Leu Tyr Cys Lys Gln Phe Phe Asn Arg His Cys Gln Arg Gly Gly Leu Leu 3 5 Gln Phe Glu Ala Asp Lys Thr Ala Lys Glu Glu Ser Leu Phe Pro Val 180 lay 19a Pro Pro Ser Lys Glu Thr Ser Ala Glu Ser Gln Val Ser Trp Ala Pro Gly Ser Leu Ala Gln Leu Phe Ser Leu Asp Ser Val Pro Ile Pro Gln Gln Gln Gln Gly Pro Glu Met <210> 24 <211> 232 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism: primate <400> 24 ttggccttag ggaccaagct tttatcatcg tcagtgggac ttaacctgtc ttaaaagtgc 60 tgcttctcct acactcgctc aagatcccga gtcagctgta ttatggcatc ctattagtca 120 ggcagcctgt gcttcaagcc cgtagttgta ttcatcccct aaaggggcca ttccgtttgt 180 atcatcacat gtcctcagtg ggtccatgtg tatatcaagg acatgatgca ga 232 SUBSTITUTE SHEET { rule 26 ) <210> 25 36 <211> 77 <212> PRT
<213> Unknown <220>
<223> Description of Unknown Organism: primate <400> 25 Leu Ala Leu Gly Thr Lys Leu Leu Ser Ser Ser Val Gly Leu Asn Leu Ser Xaa Lys Cys Cys Phe~ Ser Tyr Thr Arg Ser Arg Ser Arg Val Ser Cys Ile Met Ala Ser Tyr Xaa Ser Gly Ser Leu Cys Phe Lys Pro Val Val Val Phe Ile Pro Xaa. Arg Gly His Ser Val Cys Ile Ile Thr Cys 2 5 Pro Gln Trp Val His Val Tyr Ile Lys Asp Met Met Gln <210> 26 <211> 72 <212> PRT

<213> Unknown <220>

<223> Description Unknown of Organism:
primate <400> 26 Thr Lys Thr Glu Ser Ser GlyPro Tyr ProSerGlu Ser Arg His Cys Cys Phe Thr Tyr Thr Tyr IlePro Arg ArgIleMet Thr Lys Gln Asp Tyr Tyr Glu Thr Ser Gln SerLys Pro IleValPhe Asn Cys G1y Ile Thr Xaa Arg Gly His Ser Val Cys Thr Asn Pro Ser Asp Lys Trp Val 50 Gln Asp Tyr Ile Lys Asp Met Lys <210> 27 <211> 143 <212> PRT
<213> Unknown <220>
<223> Description of Unknown Organism: primate <400> 27 Met Lys Ile Ser Val Ala Ala Ile Pro Phe Phe Leu Leu Ile Thr Ile SUBSTITUTE SHEET ( rule 26 ) Ala LeuGlyThr LysTh:rGluSer SerSerArgGly ProTyrHis Pro Ser GluCysCys PheThrTyrThr ThrTyrLysIle ProArgGln Arg Ile MetAspTyr TyrGluThrAsn SerGlnCysSer LysProGly Il.e Val PheIleThr LysArgGlyHis SerValCysThr AsnProSer Asp Lys TrpValGln AspTyrIleLys AspMetLysGlu AsnThrLys Thr Glu SerSerSer ArgGlyProTyr HisProSerGlu CysCysPhe Thr l00 105 110 Tyr ThrThrTyr LysIleProArg GlnArgIleMet AspTyrTyr Giu Thr AsnSerGln CysSerLysPro GlyIleValPhe IleThrXaa <210> 28 <211> 93 <212> PRT

<213> Unknown <220>

<223> Description of Unknown Organism: primate <400> 28 Met Lys Ile ValAla. Ala ProPhe Phe LeuIleThr Ser Ile Leu Ile Ala Leu Gly LysThr Glu SerSer Arg ProTyrHis Thr Ser Gly Pro Ser Glu Cys PheThr Tyr ThrTyr Lys ProArgGln Cys Thr Ile Arg Ile Met Asp Tyr Tyr Glu. Thr Asn Ser Gln Cys Ser Lys Pro Gly Ile 50 Val Phe Ile Thr Lys Arg~ Gly His Ser Val Cys Thr Asn Pro Ser Asp Lys Trp Val Gln Asp Tyr Ile Lys Asp Met Lys Glu Asn <210> 29 <211> 93 <212> PRT
<213> Unknown <220>
<223> Description of Unknown Organism: primate <400> 29 SUBSTITUTE SHEET ( rule 26 ) Met Lys Ile Ser Val Ala Ala Ile Pro Phe Phe Leu Leu Ile Thr Ile Ala Leu Gly Thr Lys Thx- Glu Ser Ser Ser Arg Gly Pro Tyr His Pro Ser Glu Cys Cys Phe Thr Tyr Thr Thr Tyr Lys Ile Pro Arg Gln Arg Ile Met Asp Tyr Tyr G1u Thr Asn Ser Gln Cys Ser Lys Pro Gly Ile Val Phe Ile Thr Lys Arg Gly His Ser Val Cys Thr Asn Pro Ser Asp 65 70~ 75 80 Lys Trp Val Gln Asp Tyr Ile Lys Asp Met Lys Glu Asn 85 9p <210> 30 <211> 93 2 <212> PRT

<213> Unknown <220>

<223> Description of Unknown Organism:
primate <400> 30 Met Lys SerVal AlaAlaIlePro PhePheLeuLeu IleThr Ile Ile Ala Leu ThrLys ThrGluSerSer SerArgGlyPro TyrHis Pro Gly Ser Glu CysPhe ThrTyrThrThr TyrLysIlePro ArgGln Arg Cys Ile Met TyrTyr GluThrAsnSer GlnCysSerLys ProGly Ile Asp Val Phe ThrLys ArgGlyHisSer ValCysThrAsn ProSer Asp Ile Lys Trp Val Gln Asp Tyr Ile Lys Asp Met Lys Glu Asn <210> 31 <211> 1082 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism: primate <220>
<221> CDS
<222> (1)..(1080) <220>
<221> misc_feature SUBSTITUTE SHEET { rule 26 ) <222> (20) <223> nucleotide G
may be <220>

<221> misc_feature <222> (56) <223> nucleotide A, C, or T
may beg G

<220>

<221> misc_feature <222> (103) <223> nucleotide y A, C, , T
ma be G or <220>

<221> misc_feature <222> (130) <223> nucleotide C
may or be T

<220>

<221> misc_feature <222> (190}

<223> nucleotide A
may or be C

<220>

<221> misc_feature <222> (256) <223> nucleotide C r may be o G

<400> 31 atg cct ccc cca cacgcaggtaga tcttccact ctaaaggac 48 ttc ggc Met Pro Pro Pro HisAlaGlyArg SerSerThr LeuLysAsp Phe Gly acc acc cca cac caaatatttgga aggctcctg gaagatctc 96 cct tcc Thr Thr Pro His GlnIlePheGly ArgLeuLeu GluAspLeu Pro Ser caa atc gtg ccc actgcccacggc attccagac acttttgac 144 caa tct Gln Ile Val Pro ThrAlaHisGly IleProAsp ThrPheAsp Gln Ser cct tac gac gcc ctggatatccag gcagetcag agtgtccag 192 ctg atc Pro Tyr Asp Ala LeuAspIleGln AlaAlaGln SerValGln Leu Ile caa get gaa ttg gtgaagccegaa gaaetcaat ggagagaat 240 ttg cag 50 Gln Ala Glu Leu ValLysProGlu GluLeuAsn GlyGluAsn Leu Gln gcc tat tgt ctt tgtctccagagg gcgccggcc tccaagacg 288 cat ggt Ala Tyr Cys Leu CysLeuGlnArg AlaProAla SerLysThr His Gly tta act cac tct gccaaggtcctc atccttgtc ttgaagaga 336 tta acc Leu Thr His Ser AlaLysValLeu IleLeuVal LeuLysArg Leu Thr ttc tcc gtc ggc aacaagattgcc aagaatgtg caatatcct 384 gat aca Phe Ser Val Gly AsnLysIleAla LysAsnVal GlnTyrPro Asp Thr SUBSTITUTE SHEET ( rule 26 ) gag tgccttgacatg cagccatac atgtctcagag aacacagga cct 432 c 5 Glu CysLeuAspMet GlnProTyr MetSerGlnGln AsnThrGly Pro ctt gtctatgtcctc tat.getgtg ctggtccacget gggtggagt tgt 480 Leu ValTyrValLeu TyrAlaVal LeuValHisAla GlyTrpSer Cys 10 145 15(> 155 160 cac aacggacattac ttc:tcttat gtcaaagetcaa gaaggccag tgg 528 His AsnGlyHisTyr PheSerTyr ValLysAlaGln GluGlyGln Trp tat aaaatggatgat gcc:gaggtc accgcctctagc atcacttct gtc 576 Tyr LysMetAspAsp AlaGluVal ThrAlaSerSer IleThrSer Val 20 ctg agtcaacaggcc tac:gtcctc ttttacatccag aagagtgaa tgg 624 Leu SerGlnGlnAla TyrValLeu PheTyrIleGln LysSerGlu Trp gaa agacacagtgag agt.gtgtca agaggcagggaa ccaagagcc ctt 672 2 Glu ArgHisSerGlu SerValSer ArgGlyArgGlu ProArgAla Leu ggc gcagaagacaca gacaggcga gcaacgcaagga gagctcaag aga 720 Gly AlaGluAspThr AspArgArg AlaThrGlnGly GluLeuLys Arg gac cac ccc tgc ctc cag~ gcc ccc gag ttg gac gag cac ttg gtg gaa 768 Asp His Pro Cys Leu Gln. Ala Pro Glu Leu Asp Glu His Leu Val Glu aga gcc act cag gaa agc acc tta gac cac tgg aaa ttc ctt caa gag 816 Arg Ala Thr Gln Glu Ser Thr Leu Asp His Trp Lys Phe Leu Gln Glu caa aac aaa acg aag cct gag ttc aac gtc aga aaa gtc gaa ggt acc 864 Gln Asn Lys Thr Lys Pro Glu Phe Asn Val Arg Lys Val Glu Gly Thr ctg cct ccc gac gta ctt gtg att cat caa tca aaa tac aag tgt ggg 912 Leu Pro Pro Asp Val Leu Val Ile His Gln Ser Lys Tyr Lys Cys Gly atg aag aac cat cat cct gaa cag caa agc tcc ctg cta aac ctc tct 960 Met Lys Asn His His Pro Glu Gln Gln Ser Ser Leu Leu Asn Leu Ser tcg acg acc ccg aca cat cag gag tcc atg aac act ggc aca ctc get 1008 Ser Thr Thr Pro Thr His Gln Glu Ser Met Asn Thr Gly Thr Leu Ala tcc ctg cga ggg agg gcc agg aga tcc aaa ggg aag aac aaa cac agc 1056 Ser Leu Arg Gly Arg Ala Arg Arg Ser Lys Gly Lys Asn Lys His Ser aag agg get ctg ctt gtg tgc cag tg 1082 Lys Arg Ala Leu Leu Va1 Cys Gln SUBSTITUTE SHEET ( rule 26 ) <210> 32 <211> 360 <212> PRT

<213> Unknown <400> 32 Met Pro ProGly ProHisAla GlyArgSerSer ThrLeuLys Asp Phe Thr Thr ProSer HipsGlnIle PheGlyArgLeu LeuGluAsp Leu Pro Gln Ile ValSer Prc>ThrAla HisGlyIlePro AspThrPhe Asp Gln Pro Tyr AspIle AlaiLeuAsp IleGlnAlaAla GlnSerVal Gln Leu Gln Ala GluGln Leu;ValLys ProGluGluLeu AsnGlyGlu Asn Leu 65 7C 75 g0 Ala Tyr His Cys Gly Leu. Cys Leu Gln Arg Ala Pro Ala Ser Lys Thr Leu Thr Leu His Thr Ser Ala Lys Val Leu Ile Leu Val Leu Lys Arg Phe Ser Asp Val Thr Gly Asn Lys Ile Ala Lys Asn Val Gln Tyr Pro Glu Cys Leu Asp Met Gln Pro Tyr Met Ser Gln Gln Asn Thr Gly Pro Leu Val Tyr Val Leu Tyr Ala Val Leu Val His Ala Gly Trp Ser Cys His Asn Gly His Tyr Phe Ser Tyr Val Lys Ala Gln Glu Gly Gln Trp Tyr Lys Met Asp Asp Ala Glu Val Thr Ala Ser Ser Ile Thr Ser Val Leu Ser Gln Gln Ala Tyr Val Leu Phe Tyr Ile Gln Lys Ser Glu Trp Glu Arg His Sex Glu Ser Val Ser Arg Gly Arg Glu Pro Arg Ala Leu Gly Ala Glu Asp Thr Asp Arg Arg Ala Thr Gln Gly Glu Leu Lys Arg Asp His Pro Cys Leu Gln Ala Pro Glu Leu Asp Glu His Leu Val Glu Arg Ala Thr Gln Glu Ser Thr Leu Asp His Trp Lys Phe Leu Gln Glu Gln Asn Lys Thr Lys Pro Glu Phe Asn Val Arg Lys Val Glu Gly Thr SUBSTITUTE SHEET ( rule 26 ) Leu Pro Pro Asp Val Leu Val Ile His Gln Ser Lys Tyr Lys Cys Gly Met Lys Asn His His Pro Glu Gln Gln Ser Ser Leu Leu Asn Leu Ser Ser Thr Thr Pro Thr His Gln Glu Ser Met Asn Thr Gly Thr Leu Ala Ser Leu Arg Gly Arg Ala Arg Arg Ser Lys Gly Lys Asn Lys His Ser Lys Arg Ala Leu Leu Val Cys Gln <210> 33 <211> 1683 <212> DNA

<213> Unknown <220>

<223> Description of Unl~cnown Organism:
primate <220>

<221> CDS

3 <222> (1)..(1590) <400> 33 atg gag gactcactctac ttgggaggt gagtggcag ttcaaccac 48 gac Met Glu AspSerLeuTyr LeuGlyGly GluTrpGln PheAsnHis Asp ttt tca ctcacatcttct cggccagat gcagetttt getgaaatc 96 aaa Phe Ser LeuThrSerSer ArgProAsp AlaAlaPhe AlaGluIle Lys cag cgg tctctccctgag aagtcacca ctctcatct gaggcccgt 144 act Gln Arg SerLeuProGlu LysSerPro LeuSerSer GluAlaArg Thr gtc gac tgtgatgatttg getcctgtg gcaagacag cttgeteec 192 ctc Val Asp CysAspAspLeu AlaProVal AlaArgGln LeuAlaPro Leu agg gag cttectctgagt agcaggaga cetgetgcg gtggggget 240 aag 50 Arg Glu LeuProLeuSer SerArgArg ProAlaAla ValGlyAla Lys 65 70 75 8p ggg ctc eag aat atg gga aat acc tgc tac gag aac get tcc ctg cag 288 Gly Leu Gln Asn Met Gly Asn Thr Cys Tyr Glu Asn Ala Ser Leu Gln tgc ctg aca tac aca ccg ccc ctt gcc aac tac atg ctg tcc cgg gag 336 Cys Leu Thr Tyr Thr Pro Pro Leu Ala Asn Tyr Met Leu Ser Arg Glu cac tct caa aca tgt cag cgt ccc aag tgc tgc atg ctc tgt act atg 384 His Ser Gln Thr Cys Gln Arg Pro Lys Cys Cys Met Leu Cys Thr Met SUBSTITUTE SHEET ( ruie 26 ) caa get cacatcaca tgggccctccac agtcctggt catgtcatc cag 432 Gln Ala HisIleThr TrpAlaLeuHis SerProGly HisValIle Gln ccc tca caggcattg gct.getggcttc catagaggc aagcaggaa gat 480 Pro Ser GlnAlaLeu Ala.AlaGlyPhe HisArgGly LysGlnGlu Asp gcc cat gaatttctc atgttcactgtg gatgccatg aaaaaggca tgc 528 Ala His GluPheLeu MetPheThrVal AspAlaMet LysLysAla Cys ctt ccc ggccacaag caggtagatcat cactctaag gacaccacc ctc 576 Leu Pro GlyHisLys GlnValAspHis HisSerLys AspThrThr Leu 2 atc cac caaatattt ggaggctgctgg agatctcaa atcaagtgt ctc 624 Ile His GlnIlePhe GlyGlyCysTrp ArgSerGln IleLysCys Leu cac tgc cacgggatt ccagacactttt gacccttac ctggacatc gcc 672 2 His Cys HisGlyIle ProAspThrPhe AspProTyr LeuAspIle Ala ctg gat atccaggca getcagagtgtc aagcaaget ttggaacag ttg 720 Leu Asp IleGlnAla AlaGlnSerVal LysGlnAla LeuGluGln Leu gtg aag cccgaagaa ctcaatggagag aatgcctat cattgtggt ctt 768 Val Lys ProGluGlu LeuAsnGlyGlu AsnAlaTyr HisCysGly Leu tgt ctc cagagggcg ccggcctccaag acgttaact ttacacact tct 816 Cys Leu GlnArgAla ProAlaSerLys ThrLeuThr LeuHisThr Ser 40 gcc aag gtcctcatc cttgtmttgaag agattctcc gatgtcaca ggc 864 Ala Lys ValLeuIle LeuXaaLeuLys ArgPheSer AspValThr Gly aac aaa cttgccaag aatgtgcaatat cctgagtgc cttgacatg cag 912 45 Asn Lys LeuAlaLys AsnValGlnTyr ProGluCys LeuAspMet Gln cca tac atgtctcag cagaacacagga cctcttgtc tatgtcctc tat 960 Pro Tyr MetSerGln GlnAsnThrGly ProLeuVal TyrValLeu Tyr get gtg ctggtccac getgggtggagt tgtcacaac ggacattac ttc 1008 Ala Val LeuValHis AlaGlyTrpSer CysHisAsn GlyHisTyr Phe tct tat gtcaaaget caagaaggccag tggtataaa atggatgat gcc 1056 Ser Tyr ValLysAla GlnGluGlyGln TrpTyrLys MetAspAsp Ala 60 gag gtc accgcctct agcatcacttct gtcctgagt caacaggcc tac 1104 Glu Val ThrAlaSer SerIleThrSer ValLeuSer GlnGlnAla Tyr SUBSTITUTE SHEET ( rule 26 ) gtc ctcttttac atccagaag agtgaatgggaa agacacagt gagagt 1152 Val LeuPheTyr IleGlnLys SerGluTrpGlu ArgHisSer GluSer gtg tcaagaggc agggaacca agagcccttggc gcagaagac acagac 1200 Val SerArgGly ArgGluPro ArgAlaLeuGly AlaGluAsp ThrAsp agg cgagcaacg caaggagag ctcaagagagac cacccctgc ctccag 1248 Arg ArgAlaThr GlnGlyGlu LeuLysArgAsp HisProCys LeuGln gcc cccgagttg gacgagcac ttggtggaaaga gccactcag gaaagc 1296 Ala ProGluLeu AspGluHis LeuValGluArg AlaThrGln GluSer 2 acc ttagaccac tggaaattc cttcaagagcaa aacaaaacg aagcct 1344 Thr LeuAspHis TrpLysPhe LeuGlnGluGln AsnLysThr LysPro gag ttcaac gtcagaaaagtc gaaggtacc ctgcctcccgac gtactt 1392 2 Glu PheAsn ValArgLysVal GluGlyThr LeuProProAsp ValLeu gtg attcat caatcaaaatac aagtgtggg atgaagaaccat catcct 1440 Val IleHis GlnSerLysTyr LysCysGly MetLysAsnHis HisPra gaa cagcaa agctccctgcta aacctctct tcgacgaccccg acacat 1488 Glu GlnGln SerSerLeuLeu AsnLeuSer SerThrThrPro ThrHis cag gagtcc atgaacactggc acactcget tccctgcgaggg agggcc 1536 Gln GluSer MetAsnThrGly ThrLeuAla SerLeuArgGly ArgAla 40 agg agatcc aaagggaagaac aaacacagc aagagggetctg cttgtg 1584 Arg ArgSer LysGlyLysAsn LysHisSer LysArgAlaLeu LeuVal tgc cagtgatctcagt aggggtgcac acacacacgc 1640 ggaagtaccg acccacacgt 45 Cys Gln acacacacag acacacacat aactacaccc agaagcgcgc tga 1683 <210> 34 <211> 530 <212> PRT
<213> Unknown <400> 34 Met Glu Asp Asp Ser Leu Tyr Leu Gly Gly Glu Trp Gln Phe Asn His Phe Ser Lys Leu Thr Ser Ser Arg Pro Asp Ala Ala Phe Ala Glu Ile Gln Arg Thr Ser Leu Pro Glu Lys Ser Pro Leu Ser Ser Glu Ala Arg SUBSTITUTE SHEET ( rule 26 ) Val Asp Leu Cys Asp Asp Leu Ala Pro Val Ala Arg Gln Leu Ala Pro Arg Glu Lys Leu Pro Leu Ser Ser Arg Arg Pro Ala Ala Val Gly Ala 10 Gly Leu Gln Asn Met GlSr Asn Thr Cys Tyr Glu Asn Ala Ser Leu G1n Cys Leu Thr Tyr Thr Pro Pro Leu Ala Asn Tyr Met Leu Ser Arg Glu His Ser Gln Thr Cys Gln Arg Pro Lys Cys Cys Met Leu Cys Thr Met Gln Ala His Ile Thr Trp Ala Leu His Ser Pro Gly His Val Ile Gln Pro Ser Gln Ala Leu Ala. Ala Gly Phe His Arg Gly Lys Gln Glu Asp 145 150' 155 160 Ala His Glu Phe Leu Met Phe Thr Val Asp Ala Met Lys Lys Ala Cys Leu Pro Gly His Lys Gln. Val Asp His His Ser Lys Asp Thr Thr Leu Ile His Gln Ile Phe Gly Gly Cys Trp Arg Ser Gln Ile Lys Cys Leu His Cys His Gly Ile Pro Asp Thr Phe Asp Pro Tyr Leu Asp Ile Ala Leu Asp Ile Gln Ala Ala Gln Ser Val Lys Gln Ala Leu Glu Gln Leu Val Lys Pro Glu Glu Leu Asn Gly Glu Asn Ala Tyr His Cys Gly Leu Cys Leu Gln Arg Ala Pro Ala Ser Lys Thr Leu Thr Leu His Thr Ser Ala Lys Val Leu Ile Leu Xaa Leu Lys Arg Phe Ser Asp Val Thr Gly Asn Lys Leu Ala Lys Asn Val Gln Tyr Pro Glu Cys Leu Asp Met Gln Pro Tyr Met Ser Gln Gln Asn Thr Gly Pro Leu Val Tyr Val Leu Tyr Ala Val Leu Val His Ala Gly Trp Ser Cys His Asn Gly His Tyr Phe Ser Tyr Val Lys Ala Gln Glu Gly Gln Trp Tyr Lys Met Asp Asp Ala Glu Val Thr Ala Ser Ser Ile Thr Ser Val Leu Ser Gln Gln Ala Tyr SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 Val Leu PheTyrIle GlnLysSer GluTrpGluArg HisSerGlu Ser Val Ser ArgGlyArg GluProArg AlaLeuGlyAla GluAspThr Asp Arg Arg AlaThrGln GlyGluLeu LysArgAspHis ProCysLeu Gln Ala Pro GluLeuAsp GluHisLeu ValGluArgAla ThrGlnGlu Ser Thr Leu AspHisTrp Ly=~PheLeu GlnGluGlnAsn LysThrLys Pro Glu Phe AsnValArg Lye:ValGlu GlyThrLeuPro ProAspVal Leu Val Ile HisGlnSer Lys~TyrLys CysGlyMetLys AsnHisHis Pro Glu Gln GlnSerSer Leu.LeuAsn LeuSerSerThr ThrProThr His Gln Glu SerMetAsn ThrGlyThr LeuAlaSerLeu ArgGlyArg Ala Arg Arg SerLysGly LysAsnLys HisSerLysArg AlaLeuLeu Val Cys Gln <210> 35 <211> 735 <212> DNA

<213> Unknown <220>

<223> Description Unknown Organism:
of primate <220>

<221> CDS

<222> (1)..(735) <220>

<221> misc_feature <222> (197) <223> nucleotide be A or C
may <220>

<221> misc_feature <222> (590) <223> nucleotide be A, C, G, or T
may <220>

<221> misc_feature <222> (664) <223> nucleotide be A, C, G, or T
may SUBSTITC~TE SHEET ( rule 2C ) <220>

<221> misc_feature <222> (665) <223> nucleotide A, C, or T
may beg G, <220>

1 <221> misc_feature <222> (666) <223> nucleotide A, C, or T
may be G, <220>

<221> misc_feature <222> (708) <223> nucleotide A, C, or T
may bea G, <220>

<221> misc_feature <222> (715) <223> nucleotide A, C, or T
may beg G, <400> 35 atg get gtg cca agt atcgtc aaacgcaggcta ctaccttgg tce 48 tggr Met Ala Val Pro Ser IleVal LysArgArgLeu LeuProTrp Ser Trp atc aaa ttt ttg gag atctca gatcacggcgtg aagtgctcc gtg 96 ggt 3 Ile Lys Phe Leu Glu IleSer AspHisGlyVal LysCysSer Val 0 Gly tgc aag agc gtc tcg acctac gacccctacttg gacgtcgcg ctg 144 gac Cys Lys Ser Val Ser ThrTyr AspProTyrLeu AspValAla Leu Asp gag atc cgg caa get geg aat att gtg cgt get ctg gaa ctt ttt gtg 192 Glu Ile Arg Gln Ala Ala Asn Ile Val Arg Ala Leu Glu Leu Phe Va.l aaa gea gat gtc ctg agt gga gag aat gcc tac atg tgt get aaa tgc 240 Lys Ala Asp Val Leu Ser Gly Glu Asn Ala Tyr Met Cys Ala Lys Cys 45 aag aag aag gtt cca gcc agc aag cgc ttc acc atc cac aga aca tcc 288 Lys Lys Lys Val Pro Ala Ser Lys Arg Phe Thr Ile His Arg Thr Ser aac gtc tta acc ctt tcc ctc aag cgc ttt gcc aac ttc agc ggg ggg 336 50 Asn Val Leu Thr Leu Ser Leu Lys Arg Phe Ala Asn Phe Ser Gly Gly aag atc acc aag gat gta ggc tat ccg gaa ttc ctc aac ata cgt ccg 384 Lys Ile Thr Lys Asp Val Gly Tyr Pro Glu Phe Leu Asn Ile Arg Pro tat atg tcc cag aat aat ggt gat cet gtc atg tat gga cte tat get 432 Tyr Met Ser Gln Asn Asn Gly Asp Pro Val Met Tyr Gly Leu Tyr Ala gtc ctg gtg cac tcg ggc tac agc tgc cat gcc ggg cac tat tac tgc 480 Val Leu Val His Ser Gly Tyr Ser Cys His Ala Gly His Tyr Tyr Cys SUBSTITLfTE SHEET ( rule 26 ) WO 00/01817 PC'f/US99/12366 tac gtg aaggcaagcaat ggacagtggtac cagatgaat gattccttg 528 Tyr Val LysAlaSerAsn GlyGlnTrpTyr GlnMetAsn AspSerLeu gtc cca ttccagcaacgt ccaagttggttt ctgaaacca gcaggccta 576 Val Pro PheGlnGlnArg ProSerTrpPhe LeuLysPro AlaGlyLeu agt ggc ttgttctcatcg gcgaatttccag getctcaag aaaaattcc 624 Ser Gly LeuPheSerSer AlaAsnPheGln AlaLeuLys LysAsnSer cga agg gcctccattttc caggaacaggtt cct.tcctcc ccttcccgg 672 Arg Arg AlaSerIlePhe GlnGluGlnVal ProSerSer ProSerArg gcg gcc cgaattgtgaat tccagattcatt cccagcagg aacctcggc 720 Ala Ala ArgIleValAsn SerArgPheIle ProSerArg AsnLeuGly aat ggg gattatttt 2 Asn Gly AspTyrPhe <210> 36 3 <211> 245 <212> PRT

<213> Unknown <400> 36 35 Met Ala ProSerTrpIle ValLysArg ArgLeuLeu ProTrpSer Val Ile Lys LeuGluGlyIle SerAspHis GlyValLys CysSerVal Phe Cys Lys ValSerAspThr TyrAspPro TyrLeuAsp ValAlaLeu Ser Glu Ile GlnAlaAlaAsn IleValArg AlaLeuGlu LeuPheVal Arg Lys Ala ValLeuSerGly GluAsnAla TyrMetCys AlaLysCys Asp 50 Lys Lys ValProAlaSer LysArgPhe ThrIleHis ArgThrSer Lys Asn Val ThrLeuSerLeu LysArgPhe AlaAsnPhe SerGlyGly Leu Lys Ile LysAspValGly TyrProGlu PheLeuAsn IleArgPro Thr Tyr Met GlnAsnAsnGly AspProVal MetTyrGly LeuTyrAla Ser Val Leu HisSerGlyTyr SerCysHis AlaGlyHis TyrTyrCys Val SUBSTITUTE SHEET ( rule 2b ) Tyr Val Ala SerAsnGly GlnTrpTyrGln MetAsnAspSer Leu Lys Val Pro Gln GlnArgPro SerTrpPheLeu LysProAlaGly Leu Phe Ser Gly Phe SerSerAla AsnPheGlnAla LeuLysLysAsn Ser Leu Arg Arg Ser IlePheGln GluGlnValPro SerSerProSer Arg Ala Ala Ala Ile ValAsnSer ArgPheIlePro SerArgAsnLeu Gly Arg Asn Gly Tyr Phe Asp <210> 37 <211> 2244 2 <212> DNA

<213> Unknown <220>

<223> Description of Unknown Organism:
primate <220>

<221> CDS

<222> (1)..{2244) <400> 37 atg cag gcc tgcctgraat ggctgtgccaag ttggatcgtcaa acg aaa 48 Met Gln Ala CysLeu.Asn GlyCysAlaLys LeuAspArgGln Thr Lys cag get acc ttggtccat caaatttttgga gggtatctcaga tca act 96 Gln Ala Thr LeuValHis GlnIlePheGly GlyTyrLeuArg Ser Thr cgc gtg aagtgctcc gtgtgcaag agcgtctcggac acctacgac ccc 144 Arg Val LysCysSer ValCysLys SerValSerAsp ThrTyrAsp Pro tac ttg gacgtcgcg ctg~gagatc cggcaagetgcg aatattgtg cgt 192 Tyr Leu AspValAla Leu.GluIle ArgGlnAlaAla AsnIleVal Arg get ctg gaacttttt gtgaaagca gatgtcctgagt ggagagaat gcc 240 Ala Leu GluLeuPhe ValLysAla AspValLeuSer GlyGluAsn Ala tac atg tgtgetaaa tgcaagaag aaggttccagcc agcaagcgc ttc 288 Tyr Met CysAlaLys CysLysLys LysValProAla SerLysArg Phe acc atc cac aga aca tcc aac gtc tta acc ctt tcc ctc aag cgc ttt 336 Thr Ile His Arg Thr Ser Asn Val Leu Thr Leu Ser Leu Lys Arg Phe gcc aac ttc agc ggg ggg aag atc acc aag gat gta ggc tat ccg gaa 384 SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/1Z366 Ala Asn Phe Ser Gly Gly Lys Ile Thr Lys Asp Val Gly Tyr Pro Glu ttc ctc aac ata cgt ccc~ tat atg tcc cag aat aat ggt gat cct gtc 432 Phe Leu Asn Ile Arg Pro Tyr Met Ser Gln Asn Asn Gly Asp Pro Val atg tat gga ctc tat gct: gtc ctg gtg cac tcg ggc tac agc tgc cat 480 Met Tyr Gly Leu Tyr Ala Val Leu Val His Ser Gly Tyr Ser Cys His gcc ggg cac tat tac tgc tac gtg aag gca agc aat gga cag tgg tac 528 Ala Gly His Tyr Tyr Cys Tyr Val Lys Ala Ser Asn Gly Gln Trp Tyr cag atg aat gat tcc ttg gtc cat tcc agc aac gtc aag gtg gtt ctg 576 2 0 Gln Met Asn Asp Ser Leu. Val His Ser Ser Asn Val Lys Val Val Leu aac cag cag gcc tac gtg ctg ttc tat ctg cga att cca ggc tct aag 624 Asn Gln Gln Ala Tyr Val Leu Phe Tyr Leu Arg Ile Pro Gly Ser Lys aaa agt ccc gag ggc ctc atc tcc agg aca ggc tcc tcc tcc ctt ccc 672 Lys Ser Pro Glu Gly Leu Ile Ser Arg Thr Gly Ser Ser Ser Leu Pro ggc cgc ccg agt gtg att cca gat cac tcc aag aag aac atc ggc aat 720 Gly Arg Pro Ser Val Ile Pro Asp His Ser Lys Lys Asn Ile Gly Asn ggg att att tcc tcc cca ctg act gga aag cga caa gac tct ggg acg 768 Gly Ile Ile Ser Ser Pro Leu Thr Gly Lys Arg Gln Asp Ser Gly Thr atg aag aag ccg cac acc act gaa gag att ggt gtg ccc ata tcc agg 816 Met Lys Lys Pro His Thr Thr Glu Glu Ile Gly Val Pro Ile Ser Arg aat ggc tcc acc ctg ggc ctg aag tcc cag aac ggc tgc att cct cca 864 Asn Gly Ser Thr Leu Gly Leu Lys Ser Gln Asn Gly Cys Ile Pro Pro aag ctg ccc tcg ggg tcc cct tcc ccc aaa ctc tcc cag aca ccc aca 9I2 Lys Leu Pro Ser Gly Ser Pro Ser Pro Lys Leu Ser Gln Thr Pro Thr cac atg cca acc atc cta gac gac cct gga aag aag gtg aag aag cca 960 His Met Pro Thr Ile Leu Asp Asp Pro Gly Lys Lys Val Lys Lys Pro get cct cca cag cac ttt tcc ccc aga act get cag ggg ctg cct ggg 1008 Ala Pro Pro Gln His Phe Ser Pro Arg Thr Ala Gln Gly Leu Pro Gly acc agc aac tcg aat agc agc aga tct ggg agc caa agg cag ggc tcc 1056 Thr Ser Asn Ser Asn Ser Ser Arg Ser Gly Ser Gln Arg Gln Gly Ser tgg gac agc agg gat gtt gtc ctc tct acc tca cct aag ctc ctg get 1104 SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/IZ366 Trp Asp Ser Arg Asp Val. Val Leu Ser Thr Ser Pro Lys Leu Leu Ala aca gcc act gcc aac ggc~ cat ggg ctg aag ggg aac gac gag agc get 1152 Thr Ala Thr Ala Asn Gly His Gly Leu Lys Gly Asn Asp Glu Ser Ala ggc ctc gac agg agg ggc tcc agc agc tcc agc cca gag cac tcg gcc 1200 Gly Leu Asp Arg Arg Gly Ser Ser Ser Ser Ser Pro Glu His Ser Ala agc agc gac tcc acc aag- gcc ccc cag acc ccc agg agt gga gcg gcc 1248 Ser Ser Asp Ser Thr Lys Ala Pro Gln Thr Pro Arg Ser Gly Ala Ala cat ctc tgc gat tct cag gaa acg aac tgt tcc acc get ggc cac tcc 1296 His Leu Cys Asp Ser Gln Glu Thr Asn Cys Ser Thr Ala Gly His Ser aaa acg ccg cca agt gga gca gat tct aag acg gtg aag ctg aag tcc 1344 Lys Thr Pro Pro Ser Gly Ala Asp Ser Lys Thr Val Lys Leu Lys Ser cct gtc ctg agc aac acc acc act gag cct gca agc acc atg tct cct 1392 Pro Val Leu Ser Asn Thr Thr Thr Glu Pro Ala Ser Thr Met Ser Pro cca cca gcc aaa aaa ctg gcc ctt tct gcc aag aag gcc agc acc ctg 1440 Pro Pro Ala Lys Lys Leu Ala Leu Ser Ala Lys Lys Ala Ser Thr Leu tgg agg gcg acc ggc aat gac ctc cgt cca cct ccc ccc tca cca tcc 1488 Trp Arg Ala Thr Gly Asn Asp Leu Arg Pro Pro Pro Pro Ser Pro Ser tcc gac ctc acc cac ccc atg aaa acc tct cac ccc gtc gtt gcc tcc 1536 Ser Asp Leu Thr His Pro Met Lys Thr Ser His Pro Val Val Ala Ser act tgg ccc gtc cat aga gcc agg get gtg tca cct get ccc caa tca 1584 Thr Trp Pro Val His Arg Ala Arg Ala Val Ser Pro Ala Pro Gln Ser tcc agc cgc ctg caa ccc ccc ttc agc ccc cac ccc aca ttg ctg tcc 1632 Ser Ser Arg Leu Gln Pro Pro Phe Ser Pro His Pro Thr Leu Leu Ser agt acc ccc aag ccc cca ggg acg tca gaa cca cgg agc tgc tcc tcc 1680 Ser Thr Pro Lys Pro Pro Gly Thr Ser Glu Pro Arg Ser Cys Ser Ser atc tcg acg gcg ctg cct cag gtc aac gag gac ctt gtg tct ctt cca 1728 Ile Ser Thr Ala Leu Pro Gln Val Asn Glu Asp Leu Val Ser Leu Pro cac cag ttg cca gag gcc agt gag ccc ccc cag agc ccc tct gag aag 1776 His Gln Leu Pro Glu Ala Ser Glu Pro Pro Gln Ser Pro Ser Glu Lys SUBSTITUTE SHEET ( rule 26 ) agg aaaaagacc tttgtggga gagccgcagagg ctgggctca gagacg 1824 Arg LysLysThr PheVa:1Gly GluProGlnArg LeuGlySer GluThr cgc ctcccacag cacatcagg gaggccactgcg getccccac gggaag 1872 Arg LeuProGln HisIleArg GluAlaThrAla AlaProHis GlyLys agg aagaggaag aagaagaag cgcccggaggac ca getgcc agcgcc 1920 a Arg LysArgLys LysLysLys ArgProGluAsp ThrAlaAla SerAla ctg caggagggg cagacacag agacagcctggg agccccatg tacagg 1968 Leu GlnGluGly GlnThrGln ArgGlnProGly SerProMet TyrArg 2 agg gagggccag gcacac~ctg cccgetgtcaga cggag gaa gatggc 2016 0 c Arg GluGlyGln AlaGlnLeu ProAlaValArg ArgGlnGlu AspGly aca cagccacag gtgaat:ggc cagcaggtggga tgtgttacg gacggc 2064 Thr GlnProGln ValAsnGly GlnGlnValGly CysValThr AspGly cac cacgcgagc agcagcyaag cggaggaggaaa ggagcaaa ggtctt 2112 g His HisAlaSer SerArqLys ArgArgArgLys GlyAlaGlu GlyLeu ggt gaagaaggc ggcctgcac caggacccactt cggcacagc tgctct 2160 Gly GluGluGly GlyLeuHis GlnAspProLeu ArgHisSer CysSer ccc atgggtgat ggtgat:cca gaggccatggaa gagtctcca aggaaa 2208 Pro MetGlyAsp GlyAspPro GluAlaMetGlu GluSerPro ArgLys aag aaaaaaaaa aaaaactcg agggggggcccg gta 2244 Lys LysLysLys LysAsnSer ArgGlyGlyPro Val <210> 38 <211> 748 <212> PRT
<213> Unknown <400> 38 Met Gln Lys Ala Cys Leu. Asn Gly Cys Ala Lys Leu Asp Arg Gln Thr Gln Ala Thr Thr Leu Val His Gln Ile Phe Gly Gly Tyr Leu Arg Ser Arg Val Lys Cys Ser Val Cys Lys Ser Val Ser Asp Thr Tyr Asp Pro Tyr Leu Asp Val Ala Leu. Glu Ile Arg Gln Ala Ala Asn Ile Val Arg Ala Leu Glu Leu Phe Val Lys Ala Asp Val Leu Ser Gly Glu Asn Ala SUBSTITUTE SHEET ( ruie 26 ) Tyr Met Cys Ala Lys Cys Lys Lys Lys Val Pro Ala Ser Lys Arg Phe Thr Ile HisArgThr SerAsnValLeu ThrLeuSerLeu LysArgPhe Ala Asn PheSerGly GlyLysIleThr LysAspValGly TyrProGlu Phe Leu AsnIleArg ProTyrMetSer GlnAsnAsnGly AspProVal Met Tyr GlyLeuTyr AlaValLeuVal HisSerGlyTyr SerCysHis 2 Ala Gly HisTyrTyr CysTyrValLys AlaSerAsnGly GlnTrpTyr Gln Met AsnAspSer LeuValHisSer SerAsnValLys ValValLeu Asn Gln GlnAlaTyr ValLeuPheTyr LeuArgIlePro GlySerLys Lys Ser ProGluGly LeuIleSerArg ThrGlySerSer SerLeuPro Gly Arg ProSerVal IleProAspHis SerLysLysAsn IleGlyAsn Gly Ile IleSerSer ProLeuThrGly LysArgGlnAsp SerGlyThr Met Lys LysProHis ThrThrGluGlu IleGlyValPro IleSerArg Asn Gly SerThrLeu GlyLeuLysSer GlnAsnGlyCys IleProPro Lys Leu ProSerGly SerProSerPro LysLeuSerGln ThrProThr His Met ProThrIle LeuAspAspPro GlyLysLysVal LysLysPro Ala Pro ProGlnHis PheSerProArg ThrAlaGlnGly LeuProGly Thr Ser AsnSerAsn SerSerArgSer GlySerGlnArg GlnGlySer Trp Asp SerArgAsp ValValLeuSer ThrSerProLys LeuLeuAla Thr Ala ThrAlaAsn GlyHisGlyLeu LysGlyAsnAsp GluSerAla Gly Leu AspArgArg GlySerSerSer SerSerProGlu HisSerAla SUBSTITUTE SHEET ( rule 26 ) Ser Ser Asp Ser Thr Lys; Ala Pro Gln Thr Pro Arg Ser Gly Ala Ala His Leu Cys Asp Ser Gln Glu Thr Asn Cys Ser Thr Ala Gly His Ser Lys Thr Pro Pro Ser Gly Ala Asp Ser Lys Thr Val Lys Leu Lys Ser Pro Val Leu Ser Asn Thr Thr Thr Glu Pro Ala Ser Thr Met Ser Pro Pro Pro Ala Lys Lys Leu. Ala Leu Ser Ala Lys Lys Ala Ser Thr Leu 465 470 475 4g0 Trp Arg Ala Thr Gly Asn Asp Leu Arg Pro Pro Pro Pro Ser Pro Ser Ser Asp Leu Thr His Pro Met Lys Thr Ser His Pro Val Val Ala Ser Thr Trp Pro Val His Arg Ala Arg Ala Val Ser Pro Ala Pro Gln Ser Ser Ser Arg Leu Gln Pro Pro Phe Ser Pro His Pro Thr Leu Leu Ser Ser Thr Pro Lys Pro Pro Gly Thr Ser Glu Pro Arg Ser Cys Ser Ser 3 5 Ile Ser Thr Ala Leu Pro Gln Val Asn Glu Asp Leu Val Ser Leu Pro His Gln Leu Pro Glu Ala Ser Glu Pro Pro Gln Ser Pro Ser Glu Lys Arg Lys Lys Thr Phe Val Gly Glu Pro Gln Arg Leu Gly Ser Glu Thr Arg Leu Pro Gln His Ile Arg Glu Ala Thr Ala Ala Pro His Gly Lys Arg Lys Arg Lys Lys Lys Lys Arg Pro Glu Asp Thr Ala Ala Ser Ala Leu Gln Glu Gly Gln Thr Gln Arg Gln Pro Gly Ser Pro Met Tyr Arg Arg Glu Gly Gln Ala Gln Leu Pro Ala Val Arg Arg Gln Glu Asp Gly Thr Gln Pro Gln Val Asn Gly Gln Gln Val Gly Cys Val Thr Asp Gly His His Ala Ser Ser Arg Lys Arg Arg Arg Lys Gly Ala Glu Gly Leu Gly Glu Glu Gly Gly Leu His Gln Asp Pro Leu Arg His Ser Cys Ser SUBSTITUTE SHEET ( rule 26 ) Pro Met Gly Asp Gly Asp Pro Glu Ala Met Glu Glu Ser Pro Arg Lys Lys Lys Lys Lys Lys Asn Ser Arg Gly Gly Pro Val IO
<210>

<211>

<212>
PRT

<213>
Unknown <220>

<223>
Description of Unknown Organism:
primate <400>

20 Met Val ValAlaLeuSer PheProGlu AlaAspProAla LeuSerSer Pro Asp AlaProGluLeu HisGlnAsp GluAlaGlnVal ValGluGlu Leu Thr ValAsnGlyLys HisSerLeu SerTrpGluSer ProGlnGly Pro Gly CysGlyLeuGln AsnThrGly AsnSerCysTyr LeuAsnAla Ala Leu GlnCysLeuThr HisThrPro ProLeuAlaAsp TyrMetLeu 3 Ser Gln GluHisSerGln ThrCysCys SerProGluGly CysLysLeu Cys Ala MetGluAlaLeu ValThrGln SerLeuLeuHis SerHisSer Gly Asp ValMetLysPro SerHisIle LeuThrSerAla PheHisLys His Gln GlnGluAspAla HisGluPhe LeuMetPheThr LeuGluThr Met His GluSerCysLeu GlnValHis ArgGlnSerLys ProThrSer 50 Glu Asp SerSerProIle HisAspIle PheGlyGlyTrp TrpArgSer Gln Ile LysCysLeuLeu CysGlnGly ThrSerAspThr TyrAspArg Phe Leu AspIleProLeu AspIleSer SerAlaGlnSer ValLysGln Ala Leu TrpAspThrGlu LysSerGlu GluLeuCysGly AspAsnAla Tyr Tyr CysGlyLysCys ArgGlnLys MetProAlaSer LysThrLeu SUBSTITUTE SHEET ( rule 26 ) His Val HisIleAlaPro LysValLeuMet ValValLeu AsnArgPhe Ser Ala PheThrGlyAsn LysLeuAspArg LysValSer TyrProGlu Phe Leu AspLeuLysPro TyrLeuSerGlu ProThrGly GlyProLeu Pro Tyr AlaLeuTyrAla ValLeuValHis AspGlyAla ThrSerHis Ser Gly HisTyrPheCys CysValLysAla GlyHisGly LysTrpTyr Lys Met AspAspThrLys ValThrArgCys AspValThr SerValLeu Asn Glu AsnAlaTyrVal LeuPheTyrVal GlnGlnAla AsnLeuLys Gln Val SerIleAspMet ProGluGlyArg IleAsnGlu ValLeuAsp Pro Glu TyrGlnLeuLys LysSerArgArg LysLysHis LysLysLys Ser Pro PheThrGluAsp LeuGlyGluPro CysGluAsn ArgAspLys Arg Ala IleLysGluThr SerLeuGlyLys GlyLysVal LeuGlnGlu Val Asn HisLysLysAla GlyGlnLysHis GlyAsnThr LysLeuMet Pro Gln LysGlnAsnHis GlnLysAlaGly GlnAsnLeu ArgAsnThr Glu Val GluLeuAspLeu ProAlaAspAla IleValIle HisGlnPro Arg Ser ThrAlaAsnTrp GlyArgAspSer ProAspLys GluAsnGln Pro Leu HisAsnAlaAsp ArgLeuLeuThr SerGlnGly ProValAsn Thr Trp GlnLeuCysArg GlnGluGlyArg ArgArgSer LysLysGly Gln Asn LysAsnLysGln GlyGlnArgLeu LeuLeuVal Cys <210> 40 <211> 545 <212> PRT
<213> Unknown <220>
SUBSTITUTE SHEET ( ruie 26 ) <223> Description of Unknown Organism: primate <400> 40 Met Val Val Ser Leu Ser Phe Pro Glu Ala Asp Pro Ala Leu Ser Ser Pro Gly Ala Gln Gln Leu His Gln Asp Glu Ala Gln Val Val Val Glu Leu Thr Ala Asn Asp Lys~ Pro Ser Leu Ser Trp Glu Cys Pro Gln Gly Pro Gly CysGlyLeu GlnAsnThr GlyAsnSerCys TyrLeuAsn Ala Ala Leu GlnCysLeu ThrHisThr ProProLeuAla AspTyrMet Leu Ser Gln GluTyrSer Gln.ThrCys CysSerProGlu GlyCysLys Met Cys Ala MetGluAla HisValThr GlnSerLeuLeu HisSerHis Ser Gly Asp ValMetLys ProSerGln IleLeuThrSer AlaPheHis Lys His Gln GlnGluAsp AlaHisGlu PheLeuMetPhe ThrLeuGlu Thr Met His GluSerCys LeuGlnVal HisArgGlnSer GluProThr Ser Glu Asp SerSerPro IleHisAsp IlePheGlyGly LeuTrpArg Ser Gln Ile LysCysLeu HisCysGln GlyThrSerAsp ThrTyrAsp Arg Phe Leu AspValPro LeuAspIle SerSerAlaGln SerValAsn Gln Ala Leu TrpAspThr GluLysSer GluGluLeuArg GlyGluAsn Ala Tyr Tyr CysGlyArg CysArgGln LysMetProAla SerLysThr Leu His Ile HisSerAla ProLysVal LeuLeuLeuVal LeuLysArg Phe Ser Ala PheMetGly Asn.LysLeu AspArgLysVal SerTyrPro Glu Phe Leu AspLeuLys ProTyrLeu SerGlnProThr GlyGlyPro Leu Pro Tyr AlaLeuTyr AlaValLeu ValHisGluGly AlaThrCys His SUBSTITUTE SHEET ( rule 26 ) Ser Gly His Tyr Phe Ser Tyr Val Lys Ala Arg His Gly Ala Trp Tyr Lys MetAspAspThr Lys;ValThr SerCysAspVal ThrSerVal Leu Asn GluAsnAlaTyr Val.LeuPhe TyrValGlnGln ThrAspLeu Lys Gln ValSerIleAsp MeC.ProGlu GlyArgValHis GluValLeu Asp Pro GluTyrGlnLeu Lys~LysSer ArgArgLysLys HisLysLys Lys Ser ProCysThrGlu AspAlaGly GluProCysLys AsnArgGlu Lys Arg AlaThrLysGlu ThrSerLeu GlyGluGlyLys ValXaaGln Glu 2 Lys AsnHisLysLys Ala.GlyGln LysHisGluAsn ThrLysLeu Val Pro GlnGluGlnAsn HisGlnLys LeuGlyGlnLys HisArgIle Asn Glu IleLeuProGln GluGlnAsn HisGlnLysAla GlyGlnSer Leu Arg AsnThrGluGly GluLeuAsp LeuProAlaAsp AlaIleVal Ile His LeuLeuArgSer ThrGluAsn TrpGlyArgAsp AlaProAsp Lys 40 Glu AsnGlnProTrp HisAsnAla AspArgLeuLeu ThrSerGln Asp Pro ValAsnThrGly Gln.LeuCys ArgGlnGluGly ArgArgArg Ser Lys LysGlyLysAsn LysAsnLys GlnGlyGlnArg LeuLeuLeu Val Cys <210> 41 <211> 890 5 5 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism: primate <220>
<221> CDS
<222> (15)..(500) SUBSTITLJ~TE SHEET ( rule 26 ) <220>

<221> misc_feature <222> (53) <223> nucleotide may A or be C

<220>

<221> misc_feature <222> (123) <223> nucleotide may C or be G

<220>

<221> misc_feature <222> (124) <223> nucleotide may G or be T

<220>

<221> misc_feature <222> (125) <223> nucleotide may C or be T

<220>

<221> misc_feature <222> (525) <223> nucleotide may A, C, or T
be G, <220>

<221> misc_feature <222> (547) <223> nucleotide may A, C, or T
be G, <220>

3 <221> misc_feature <222> (835) <223> nucleotide may A, C, or T
be G, <400> 41 ggcacgagcc cacc atg ggt acagccactctc ttcctctggact 50 aag ttc Met Lys Gly ThrAlaThrLeu PheLeuTrpThr Phe ctc att ttt ccc agc agt ggcggcggtggg aaagcctggccc 98 tgc gga Leu Ile Phe Pro Ser Ser GlyGlyGlyGly LysAiaTrpPro Cys Gly aca cac gtg gtc tgt gac cgcttggaagtg ctctaccagagt 146 agc agc Thr His Val Val Cys Asp ArgLeuGluVal LeuTyrGlnSer Ser Ser tgc gat cca tta caa ttt ttttctgttgaa aagtgttccaag 194 gat ggc Cys Asp Pro Leu Gln Phe PheSerValGlu LysCysSerLys Asp Gly caa tta aaa tca aat aac agatttggaatt attctgagagag 242 atc att Gln Leu Lys Ser Asn Asn ArgPheGlyIle IleLeuArgGlu Ile Ile 60 gac atc aaa gag ctt ctt ctagetctcatg tctcaaggctca 290 ttt gac Asp Ile Lys Glu Leu Leu LeuAlaLeuMet SerGlnGlySer Phe Asp SUBSTITUTE SHEET ( rule 26 ) tct gtt ttgaatttc tcctateccate tgtgaggcgget ctgcccaag 338 5 Ser Val LeuAsnPhe SerTyrProIle CysGluAlaAla LeuProLys ttt tct ttetgtgga agaaggaaagga gagcagatttac tatgetggg 386 Phe Ser PheCysGly ArgArgLysGly GluGlnIleTyr TyrAlaGly cct gtc aataatcct gaatttactatt cctcagggagaa taccaggtt 434 Pro Val AsnAsnPro GluPheThrIle ProGlnGlyGlu TyrGlnVal ttg ctg gaactgtac actgaaaaacgg tccaccgtggcc tgtgccaat 482 Leu Leu GluLeuTyr ThrGluLysArg SerThrValAla CysAlaAsn 20 get act atcatgtgc tcctgactgtggg 530 cctgttagca aaaactcaca Ala Thr IleMetCys Ser gccagctgca tctcgtcggg aaccttccaa gctcctctga ctgaacctac tgtgggagga 590 gaagcagctg atgacagaga g,aggctctac aaagaagcgc ccccaaagag tgcagctgct 650 aattttagtc ccaggaccag acatccccag actccacaga tgtaatgaag tccccgaatg 710 tatctgtttc taaggagcct cttggcagtc cttaagcagt cttgagggtc catccttttt 770 ctctaattgg tcgcctccca ccagactcac ctgcttttca actttttagg agtgcttcct 830 cacacgttac caataataaa gaaagctggc caccaaaaaa aaaaaaaaaa aaaaaaaaaa 890 <210> 42 <211> 162 <212> PRT
<213> Unknown <400> 42 Met Lys Gly Phe Thr Ala Thr Leu Phe Leu Trp Thr Leu Ile Phe Pro Ser Cys Ser Gly Gly Gly Gly Gly Lys Ala Trp Pro Thr His Val Val Cys Ser Asp Ser Arg Leu Glu Val Leu Tyr Gln Ser Cys Asp Pro Leu Gln Asp Phe Gly Phe Ser Val Glu Lys Cys Ser Lys Gln Leu Lys Ser Asn Ile Asn Ile Arg Phe Gly Ile Ile Leu Arg Glu Asp Ile Lys Glu Leu Phe Leu Asp Leu Ala Leu Met Ser Gln Gly Ser Ser Val Leu Asn Phe Ser Tyr Pro Ile Cys Glu Ala Ala Leu Pro Lys Phe Ser Phe Cys SUBSTITUTE SHEET ( rule 26 ) Gly Arg Arg Lys Gly Glu Gln Ile Tyr Tyr Ala Gly Pro Val Asn Asn Pro Glu Phe Thr Ile Pro Gln Glu Tyr Val Leu Leu Glu Gly Gln Leu Tyr Thr Glu Lys Arg Ser Thr Ala Cys Asn Ala Thr Ile Val Ala Met Cys Ser <210> 43 <211> 486 <212> DNA

<213> Unknown <220>

<223> Description of Unknown Organism: primate <220>

<221> CDS

<222> (1)..(132) <400> 43 ccc ctg ttt tct tcc ata ttt gaa get aag cag tat tgg 48 act cag gtc Pro Leu Phe Ser Ser Ile Phe Glu Ala Lys Gln Tyr Trp Thr Gln Val tgc aac tca tcc gat gca agt tca tac tac tgt gat aaa 96 att acc atg 3 Cys Asn Ser Ser Asp Ala Ser Ser Tyr Tyr Cys Asp Lys 5 Ile Thr Met caa tac cca att tca att aat aac ccc ata gaattgaaag 142 gtt tgt Gln Tyr Pro Ile Ser Ile Asn Asn Pro Ile Val Cys gatccaaagg attattgcac attttctacattccaaggagagatttaaag caattatatt202 tcaatctcta tataactgtc aacaccatgaatcttccaaagcgcaaagaa gttatttgcc:262 gaggatctga tgacgattac tctttttgcagagctctgaagggagagact gtgaatacaa322 caatatcatt ctccttcaag ggaataaaattttctaagggaaaatacaaa tgtgttgttg382 aagctatttc tgggagccca gaagaaatgctcttttgcttggagtttgtc atcctacacc442 aacctaattc aaattagaat aaattgagtatttaaaaaaaaaaa 486 <210> 44 <211> 44 <212> PRT
<213> Unknown <400> 44 Pro Leu Phe Ser Ser Ile Phe Thr Glu Ala Gln Lys Gln Tyr Trp Val SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'TNS99/12366 Cys Asn Ser Ser Asp Ala Ser Ile Ser Tyr Thr Tyr Cys Asp Lys Met Gln Tyr Pro Ile Ser Ile: Asn Val Asn Pro Cys Ile <210>

<211> 83 <212>
DNA

<213>
Unknown <220>

<223> te Description of Unknown Organism:
prima <220>

<221>
CDS

<222> (480) (1)..

<400>

atg ttc ccattt ctgtttttttccacc ctgttttct tccatattt act 48 2 Met Phe ProPhe LeuPhePheSerThr LeuPheSer SerIlePhe Thr gaa get cagaag cagtattgggtctgc aactcatcc gatgcaagt att 96 Glu Ala GlnLys GlnTyrTrpValCys AsnSerSer AspAlaSer Ile tca tac acctac tgtgataaaatgcaa tacccaatt tcaattaat gtt 144 Ser Tyr ThrTyr CysAspLysMetGln TyrProIle SerIleAsn Val aac ccc tgtata gaattgaaaggatcc aaaggatta ttgcacatt ttc 192 Asn Pro CysIle GluLeuLysGlySer LysGlyLeu LeuHisIle Phe tac att ccaagg agagatttaaagcaa ttatatttc aatctctat ata 240 Tyr Ile ProArg ArgAspLeuLysGln LeuTyrPhe AsnLeuTyr Ile act gtc aacacc atgaatcttccaaag cgcaaagaa gttatttgc cga 288 Thr Val AsnThr MetAsnLeuProLys ArgLysGlu ValIleCys Arg gga tct gatgac gattactctttttgc agagetctg aagggagag act 336 Gly Ser AspAsp AspTyrSerPheCys ArgAlaLeu LysGlyGlu Thr loo 105 llo gtg aat acaaca atatcattctccttc aagggaata aaattttct aag 384 Val Asn ThrThr IleSerPheSerPhe LysGlyIle LysPheSer Lys gga aaa tacaaa tgtgttgttgaaget atttetggg agcccagaa gaa 432 Gly Lys TyrLys CysValValGluAla IleSerGly SerProGlu Glu atg ctc ttttgc ttggagtttgtcatc ctacaccaa cctaattca aat 480 Met Leu PheCys LeuGluPheValIle LeuHisGln ProAsnSer Asn tag 483 SUBSTITI:fTE SHEET ( rule 26 ) <210> 46 <211> 160 <212> PRT
< 213 > Unknown <400> 46 Met Phe Pro Phe Leu Phe Phe Ser Thr Leu Phe Ser Ser Ile Phe Thr Glu Ala Gln Lys Gln Tyr Trp Val Cys Asn Ser Ser Asp Ala Ser Ile Ser Tyr TyrCys AspLysMetGln TyrPro IleSerIleAsn Val Thr Asn Pro IleGlu LeuLysGlySer LysGly LeuLeuHisIle Phe Cys Tyr Ile ArgArg AspLeuLysGln LeuTyr PheAsnLeuTyr Ile Pro Thr Val ThrMet AsnLeuProLys ArgLys GluValIleCys Arg Asn Gly Ser AspAsp TyrSerPheCys ArgAla LeuLysGlyGlu Thr Asp loo los 110 Val Asn ThrIle SerPheSerPhe LysGly IleLysPheSer Lys Thr Gly Lys LysCys ValValGluAla IleSer GlySerProGlu Glu Tyr Met Leu CysLeu GluPheValIle LeuHis GlnProAsnSer Asn Phe <210> 47 <211> 498 <212> DNA

<213> Unknown <220>

<223> Description of Unknown Organism:
rodent <220>

<221> CDS

<222> (53)..(394) <400> 47 gtcgagtccg agatattaaa tc atggtcttcc atg tggcgagttt ttg aaagtatcgg 58 Met Leu cca ttt ctcttt tcg~acgctgctt tctccc atattgactgaa tct 106 att Pro Phe LeuPhe SerThrLeuLeu SerPro IleLeuThrGlu Ser Ile gag aag cagtgg ttctgcaactcc tccgat gcaattatttcc tac 154 caa SUBSTiTIITE SHEET ( rule 26 ) Glu Lys Gln Gln Trp Phe Cys Asn Ser Ser Asp Ala Ile Ile Ser Tyr agt tattgtgat cacttcraaattc cctatttca attagttctgaa ccc 202 Ser TyrCysAsp HisLeuLysPhe ProIleSer IleSerSerGlu Pro tgc ataagactg agggga~accaat ggatttgtg catgttgagttc att 250 Cys IleArgLeu ArgGlyThrAsn GlyPheVal HisValGluPhe Ile cca agaggaaac ttaaaatattta tatttcaac ctattcatcagt gtc 298 Pro ArgGlyAsn LeuLye;TyrLeu TyrPheAsn LeuPheIleSer Val aac tccatagag ttgcccraagcgt aaggaagtt ctgtgccatgga cat 346 2 Asn SerIleGlu LeuProLysArg LysGluVal LeuCysHisGly His gat gat gac tat tct ttt. tgc aga get ctg aaa gga gga tat get att 394 Asp Asp Asp Tyr Ser Phe Cys Arg Ala Leu Lys Gly Gly Tyr Ala I1e loo l05 llo tagaaaatat gagactgtga a.tacatcaat accattctct ttcgagggaa tactatttcc 454 taagggccat tacagatgtg ttgcagaagc tattgctggg Bata 498 <210> 48 <211> 114 <212> PRT

3 <213> Unknown <400> 48 Met Leu PheIle LeuPheSer ThrLeuLeuSer ProIleLeu Thr Pro Glu Ser LysGln GlnTrpPhe CysAsnSerSer AspAlaIle Ile Glu Ser Tyr TyrCys AspHisLeu LysPheProIle SerIleSer Ser Ser Glu Pro IleArg LeuArgGly ThrAsnGlyPhe ValHisVal Glu Cys 50 Phe Ile ArgGly AsnLeuLys TyrLeuTyrPhe AsnLeuPhe Ile Pro Ser Val SerIle GluLeuPro LysArgLysGlu ValLeuCys His Asn Gly His AspAsp TyrSerPhe CysArgAlaLeu LysGlyGly Tyr Asp Ala Ile <210> 49 <211> 141 SUBSTITL1TE SHEET ( rule 26 ) <212>
PRT

5 <213>
Unknown <220>

<223>
Description of Unknown Organism:
primate 10 <400>

Met Leu ProPheIle LeuPheSerThr LeuLeuSerPro IleLeu Thr Glu Ser GluLysGln GlnTrpPheCys AsnSerSerAsp AlaIle Ile Ser Tyr SerTyrCys AspHisLeuLys PheProIleSer IleSer Ser 20 Glu Pro CysIleArg LeuArgGlyThr AsnGlyPheVal HisVal Glu Phe Ile ProArgGly AsnLeuLysTyr LeuTyrPheAsn LeuPhe Ile Ser Val AsnSerIle GluLeuProLys ArgLysGluVal LeuCys His Gly His AspAspAsp TyrSerPheCys ArgAlaLeuLys GlyGlu Thr Val Asn ThrSerIle ProPheSerPhe GluGlyIleLeu PhePro Lys 35 Gly His TyrArgCys ValAlaGluAla IleAlaGlyAsp <210> 50 40 <211> 162 <212> PRT

<213> Unknown <220>

45 <223> Description Unknown of Organism:
rodent <400> 50 Met Asn ValAla AlaAlaLeuLeu ValTrp IleLeuThrSer Pro Gly Ser Ser AspHis GlySerGluAsn GlyTrp ProLysHisThr Ala Ser Cys Asn GlyGly LeuGluValVal TyrGln SerCysAspPro Leu Ser Gln Asp GlyLeu SerIleAspGln CysSer LysGlnIleGln Ser Phe 60 Asn Leu IleArg PheGlyIleIle LeuArg GlnAspIleArg Lys Asn Leu Phe AspIle ThrLeuMetAla LysGly SerSerIleLeu Asn Leu SUBSTITUTE SHEET ( ruie 2fi ) Tyr Ser Tyr Pro Leu Cys Glu Glu Asp Gln Pro Lys Phe Ser Phe Cys Gly Arg Arg Lys Gly Glu Gln Ile Tyr Tyr Ala Gly Pro Val Asn Asn Pro Gly Leu Asp Val Pro Gln Gly Glu Tyr Gln Leu Leu Leu Glu Leu Tyr Asn Glu Asn Arg Ala Thr Val Ala Cys Ala Asn Ala Thr Val Thr Ser Ser <210> 51 <211> 1158 <212> DNA

<213> Unknown <220>

<223> Description f sm:
o Unknown avian Organi <220>

<221> CDS

<222> (11)..(490) <400> 51 cggtgcaacc acattg aatgttctcget ctcgtctta gtcctg 49 atg aag Met Lys Leu Leu LeuVal ValLeu Thr Asn Ala Leu Val ctt tgc aatgccagcaca gagtggcctaca cacacagtc tgcaag 97 atc Leu Cys AsnAlaSerThr GluTrpProThr HisThrVal CysLys Ile gag gaa ttggagatatat tacaaaagctgt gatccccag caagac 145 aac Glu Glu LeuGluIleTyr TyrLysSerCys AspProGln GlnAsp Asn ttt get agcattgaccgt tgttcagatgtc acaacccac accttt 193 ttc Phe Ala SerIleAspArg CysSerAspVal ThrThrHis ThrPhe Phe SO gac atc getgcaatggtc ctaagacaaagc atcaaggaa ctgtat 241 aga Asp Ile AlaAlaMetVal LeuArgGlnSer IleLysGlu LeuTyr Arg gcc aag gatctgatcata aatgggaagact gtcttaagc tactca 289 gtt Ala Lys AspLeuIleIle AsnGlyLysThr ValLeuSer TyrSer Val gag aca tgtggaccaggc ctttctaagcta attttctgt ggaaag 337 ctc Glu Thr CysGlyProGly LeuSerLysLeu IlePheCys GlyLys Leu aag aaa gaacatctctac tatgagggacca atcacactg ggaatc 385 gga Lys Lys GluHisLeuTyr TyrGluGlyPro IleThrLeu GlyIle Gly SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'TNS99/12366 aaa gaa atc cca cag cga gat tac act atc aca gca agg ctg act aac 433 Lys Glu Ile Pro Gln Arg Asp Tyr Thr Ile Thr Ala Arg Leu Thr Asn gaa gat cgc gcc act gtt get tgt get gat ttt acc gtg aaa aat tat 481 Glu Asp Arg Ala Thr Val Ala Cys Ala Asp Phe Thr Val Lys Asn Tyr tta gat tat taagcaaaac aacgcactcg gtccgactcc cttaaaacta 530 Leu Asp Tyr cagattccta aaactattca agcccagtga gctgcttgca tgcttcagtg attctgaagg 590 aaagatctcc cgcacggtgg ttctgatgct gttcctcttc gtaattcaac ttttttggag 650 aagtcactag gccctaccct ctagtggtaa ttttatctcc aaatgcactc tgtagcccac 710 ttttcgcttt taatatatac a~gctgcaaat agaaagtatt tgataccaac attctcatct 770 caggatgaaa atagtacaaa gcagaagagg cgagagccaa aacagatttt tgcagtaagc 830 tatggaggta tccatttcta acacaagcta aagaagattg tcatatgtat tatgcagtta 890 tagcactcaa cattttcagt ttttcacaag gcctgtttgg agcctccatt ggtataaatt 950 ttgttgtaac cacagaacaa agaccaaata ggatgaacat ggctccatgt tcagtcactc 1010 tattcatatc atttaagttt tcatgattct tcttgtatat ttttttttat tctttaatgt 1070 ttacagtgat gtgagaatcc ttttgtttaa gctacatgct gttcccgctt gtcaataaat 1130 ctgcaagaaa aaaaaaaaaa aaaaaaaa 1158 <210> 52 <211> 160 <212> PRT
<213> Unknown <400> 52 Met Lys Thr Leu Asn Val Leu Ala Leu Val Leu Val Leu Leu Cys Ile Asn Ala Ser Thr Glu Trp Pro Thr His Thr Val Cys Lys Glu Glu Asn Leu Glu Ile Tyr Tyr Lys Ser Cys Asp Pro Gln Gln Asp Phe Ala Phe Ser Ile Asp Arg Cys Ser Asp Val Thr Thr His Thr Phe Asp Ile Arg Ala Ala Met Val Leu Arg Gln Ser Ile Lys Glu Leu Tyr Ala Lys Val Asp Leu Ile Ile Asn Gly Lys Thr Val Leu Ser Tyr Ser Glu Thr Leu SUBSTITUTE SHEET ( ruie 2b ) Cys Gly Pro Gly Leu Ser Lys Leu Ile Phe Cys Gly Lys Lys Lys Gly Glu His Leu Tyr Tyr Glu Gly Pro Ile Thr Leu Gly Ile Lys Glu Ile Pro Gln Arg Asp Tyr Thr Ile Thr Ala Arg Leu Thr Asn Glu Asp Arg Ala Thr Val Ala Cys Ala Asp Phe Thr Val Lys Asn Tyr Leu Asp Tyr <210> 53 <211> 2684 <212> DNA

2 < 213 > Unkno~nrn <220>

<223> Description of Unls:nown Organism: primate <220>

<221> CDS

<222> (45)..(1256) <400> 53 3 gaattcggca cgagggcgag gagaatg agacga 56 0 gtattataca cctgaaagaa tca Met ArgArg Ser agt agc cgt tta getaag cag cag ccc cccagc acggaa 104 caa cag cag 3 Ser Ser Arg Leu AlaLys Gln Gln Pro ProSer ThrGlu 5 Gln Gln Gln tcc ccc caa gaa cagata atc cag gcc aagagg actacc 152 gcc aag aaa Ser Pro Gln Glu GlnIle Ile Gln Ala LysArg ThrThr Ala Lys Lys cag gat gtc aaa aaa aga aga gag gag gtc acc aag aaa cat cag tat 200 Gln Asp Val Lys Lys Arg Arg Glu Glu Val Thr Lys Lys His Gln Tyr gaa att agg aat tgt tgg cca cct gta tta tct ggg ggg atc agt cct 248 Glu Ile Arg Asn Cys Trp Pro Pro Val Leu Ser Gly Gly Ile Ser Pro 50 tgc att atc att gaa aca cct cac aaa gaa ata gga aca agt gat ttc 296 Cys Ile Ile Ile Glu Thr Pro His Lys Glu Ile Gly Thr Ser Asp Phe tcc aga ttt aca aat tac aga ttt aaa aat ctt ttt att aat cct tca 344 55 Ser Arg Phe Thr Asn Tyr Arg Phe Lys Asn Leu Phe Ile Asn Pro Ser cct ttg cct gat tta agc tgg gga tgt tca aaa gaa gtc tgg cta aac 392 Pro Leu Pro Asp Leu Ser Trp Gly Cys Ser Lys Glu Val Trp Leu Asn atg tta aaa aag gag agc aga tat gtt cat gac aaa cat ttt gaa gtt 440 Met Leu Lys Lys Glu Ser Arg Tyr Val His Asp Lys His Phe Glu Val SUBSTITUTE SHEET ( rule 26 ) ctg cat tct gac ttg gaa cca cag atg agg tcc ata ctt cta gac tgg 488 Leu His Ser Asp Leu Glu Pro Gln Met Arg Ser Ile Leu Leu Asp Trp ctt tta gag gta tgt gaa gta tac aca ctt cat agg gaa aca ttt tat 536 Leu Leu Glu Val Cys Glu Val Tyr Thr Leu His Arg Glu Thr Phe Tyr ctt gca caa gac ttt ttt gat aga ttt atg ttg aca caa aag gat ata 584 Leu Ala Gln Asp Phe Phe Asp Arg Phe Met Leu Thr Gln Lys Asp Ile aat aaa aat atg ctt caa ctc att gga att acc tca tta ttc att get 632 Asn Lys Asn Met Leu Gln Leu Ile Gly Ile Thr Ser Leu Phe Ile Ala tcc aaa ctt gag gaa atc tat get cct aaa ctc caa gag ttt get tac 680 Ser Lys Leu Glu Glu Ile Tyr Ala Pro Lys Leu Gln Glu Phe Ala Tyr gtc act gat ggt get tgc agt gaa gaa gat atc tta agg atg gaa ctc 728 Val Thr Asp Gly Ala Cys Ser Glu Glu Asp Ile Leu Arg Met Glu Leu att ata tta aag get tta aaa tgg gaa ctt tgt cct gta aca atc atc 776 Ile Ile Leu Lys Ala Leu Lys Trp Glu Leu Cys Pro Val Thr IIe Ile tcc tgg cta aat ctc ttt ctc caa gtt gat get ctt aaa gat get cct 824 Ser Trp Leu Asn Leu Phe Leu Gln Val Asp Ala Leu Lys Asp Ala Pro aaa gtt ctt cta cct cag tat tct cag gaa aca ttc att caa ata get 872 Lys Val Leu Leu Pro Gln Tyr Ser Gln Glu Thr Phe Ile Gln Ile Ala cag ctt tta gat ctg tgt att cta gcc att gat tca tta gag ttc cag 920 Gln Leu Leu Asp Leu Cys Ile Leu Ala Ile Asp Ser Leu GIu Phe Gln tac aga ata ctg act get get gcc ttg tgc cat ttt acc tcc att gaa 968 Tyr Arg Ile Leu Thr Ala Ala Ala Leu Cys His Phe Thr Ser Ile Glu gtg gtt aag aaa gcc tca ggt ttg gag tgg gac agt att tca gaa tgt 1016 Val Val Lys Lys Ala Ser Gly Leu Glu Trp Asp Ser Ile Ser Glu Cys gta gat tgg atg gta cct ttt gtc aat gta gta aaa agt act agt cca 1064 Val Asp Trp Met Val Pro Phe Val Asn Val Val Lys Ser Thr Ser Pro gtg aag ctg aag act ttt aag aag att cct atg gaa gac aga cat aat 1112 Val Lys Leu Lys Thr Phe Lys Lys Ile Pro Met Glu Asp Arg His Asn atc cag aca cat aca aac tat ttg get atg ctg gag gaa gta aat tac 1160 Ile Gln Thr His Thr Asn Tyr Leu Ala Met Leu Glu Glu Val Asn Tyr SUBSTITUTE SHEET ( rule 26 ) ata aac acc ttc aga aaa. ggg gga cag ttg tca cca gtg tgc aat gga 2208 5 Ile Asn Thr Phe Arg Lys Gly Gly Gln Leu Ser Pro Val Cys Asn Gly ggc att atg aca cca ccg aag agc act gaa aaa cca cca gga aaa cac 1256 Gly Ile Met Thr Pro Pro Lys Ser Thr Glu Lys Pro Pro Gly Lys His taaagaagat aactaagcaa acaagttgga attcaccaag attgggtaga actggtatca 1316 ctgaactact aaagttttac agaaagtagt gctgtgattg attgccctag ccaattcaca 1376 agttacactg ccattctgat tttaaaactt acaattggca ctaaagaata catttaatta 1436 tttcctatgt tagctgttaa agaaacagca ggacttgttt acaaagatgt cttcattccc 1496 2 0 aaggttactg gatagaagcc aaccacagtc tataccatag caatgttttt cctttaatcc 1556 agtgttactg tgtttatctt gataaactag gaattttgtc actggagttt tggactggat 1616 aagtgctacc ttaaagggta tactaagtga tacagtactt tgaatctagt tgttagattc 1676 tcaaaattcc tacactcttg actagtgcaa tttggttctt gaaaattaaa tttaaacttg 1736 tttacaaagg tttagttttg taataaggtg actaatttat ctatagctgc tatagcaagc 1796 3 0 tattataaaa cttgaatttc tacaaatggt gaaatttaat gttttttaaa ctagtttatt 1856 tgccttgcca taacacattt tttaactaat aaggcttaga tgaacatggt gttcaacctg 1916 tgctctaaac agtgggagta ccaaagaaat tataaacaag ataaatgctg tggctcctt:c 1976 ctaactgggg ctttcttgac atgtaggttg cttggtaata acctttttgt atatcacaat 2036 ttgggtgaaa aacttaagta ccctttcaaa ctatttatat gaggaagtca ctttactact 2096 ctaagatatc cctaaggaat tttttttttt aatttagtgt gactaaggct ttatttatgt 2156 ttgtgaaact gttaaggtcc tttctaaatt cctccattgt gagataagga cagtgtcaaa 2216 gtgataaagc ttaacacttg acctaaactt ctattttctt aaggaagaag agtattaaat 2276 atatactgac tcctagaaat ctatttatta aaaaaagaca tgaaaacttg ctgtacatag 2336 gctagctatt tctaaatatt ttaaattagc ttttctaaaa aaaaaatcca gcctcataaa 2396 gtagattaga aaactagatt gctagtttat tttgttatca gatatgtgaa tctcttctcc 2456 ctttgaagaa actatacatt tattgttacg gtatgaagtc ttctgtatag tttgttttta 2516 aactaatatt tgtttcagta ttttgtctga aaagaaaaca ccactaattg tgtacatatg 2576 tattatataa acttaacctt ttaatactgt ttatttttag cccatgttta aaaaataaaa 2636 gttaaaaaaa tttaactgct aaaaaaaaaa aaaaaaaagt gcggccgc 2684 <210> 54 <211> 404 <212> PRT
SUBSTITL1TE SHEET ( rule 26 ) <213> Unknown <400> 54 Met Ser Arg Arg Ser Ser Arg Leu Gln Ala Lys Gln Gln Pro Gln Pro Ser Gln Thr Glu Ser Pro Gln Glu Ala Gln Ile Ile Gln Ala Lys Lys Arg Lys Thr Thr Gln Asp Val Lys Lys Arg Arg Glu Glu Val Thr Lys Lys His Gln Tyr Glu Ile Arg Asn Cys Trp Pro Pro Val Leu Ser Gly Gly Ile Ser Pro Cys Ile Ile Ile Glu Thr Pro His Lys Glu Ile Gly Thr Ser Asp Phe Ser Arg Phe Thr Asn Tyr Arg Phe Lys Asn Leu Phe 2 5 Ile Asn Pro Ser Pro Leu Pro Asp Leu Ser Trp Gly Cys Ser Lys Glu Val Trp Leu Asn Met Leu Lys Lys Glu Ser Arg Tyr Val His Asp Lys His Phe Glu Val Leu His Ser Asp Leu Glu Pro Gln Met Arg Ser Ile Leu Leu Asp Trp Leu Leu Glu Val Cys Glu Val Tyr Thr Leu His Arg Glu Thr Phe Tyr Leu Ala Gln Asp Phe Phe Asp Arg Phe Met Leu Thr Gln Lys Asp Ile Asn Lys Asn Met Leu Gln Leu Ile Gly Ile Thr Ser Leu Phe Ile Ala Ser Lys Leu Glu Glu Ile Tyr Ala Pro Lys Leu Gln Glu Phe Ala Tyr Val Thr Asp Gly Ala Cys Ser Glu Glu Asp Ile Leu Arg Met Glu Leu Ile Ile Leu Lys Ala Leu Lys Trp Glu Leu Cys Pro Val Thr Ile Ile Ser Trp Leu Asn Leu Phe Leu Gln Val Asp Ala Leu Lys Asp Ala Pro Lys Val Leu Leu Pro Gln Tyr Ser Gln Glu Thr Phe Ile Gln Ile Ala Gln Leu. Leu Asp Leu Cys Ile Leu Ala Ile Asp Ser Leu Glu Phe Gln Tyr Arg~ Ile Leu Thr Ala Ala Ala Leu Cys His Phe SUBSTITL1TE SHEET ( rule 26 ) WO 00/01817 PC1'NS99/12366 Thr Ser Ile Glu Val Va:L Lys Lys Ala Ser Gly Leu Glu Trp Asp Ser Ile SerGlu CysValAspTrp MetValPro PheValAsnVal ValLys Ser ThrSer ProValLysLeu LysThrPhe LysLysIlePro MetGlu Asp ArgHis AsnIleGlnThr HisThrAsn TyrLeuAlaMet LeuGlu Glu ValAsn TyrIleAsnThr PheArgLys GlyGlyGlnLeu SerPro Val CysAsn GlyGlyIlexMet ThrProPro LysSerThrGlu LysPro Pro GlyLys His <210> 55 <211> 1764 <212> DNA

<213> Unknown <220>

<223> Description of Unknown Organism:
primate <220>

<221> CDS

<222> (26)..(1210) <400> 55 ccgggatgcg atgaaggag gacggcggcgcg gagttc 52 aaggagcggg acacc MetLysGlu AspGlyGlyAla GluPhe tcg get tccaggaagagg aaggcaaac gtgaccgttttt ttgcag 100 cgc Ser Ala SerArgLysArg LysAlaAsn ValThrValPhe LeuGln Arg 10 1!i 20 25 gat cca gaagaaat<1gcc aaaatcgac aggacggcgagg gaccag 148 gat Asp Pro GluGluMetAla LysIleAsp ArgThrAlaArg AspGln Asp tgt ggg cagccttgggac aataatgca gtctgtgcagac ccctgc 196 agc Cys Gly GlnProTrpAsp AsnAsnAla ValCysAlaAsp ProCys Ser tcc ctg cccacacctgac aaagaagat gatgaccgggtt taccca 244 atc Ser Leu ProThrProAsp LysGluAsp AspAspArgVal TyrPro Ile aac tca tgcaagcctcgg attattgca ccatccagaggc tccccg 292 acg 60 Asn Ser CysLysProArg IleIleAla ProSerArgGly SerPro Thr ctg cct ctgagctgggca aatagagag gaagtctggaaa atcatg 340 gta SUBSTITUTE SHEET ( rule 2b ) Leu Pro Val Leu Ser Tr;p Ala Asn Arg Glu Glu Val Trp Lys Ile Met tta aac aag gaa aag ac,a tac tta agg gat cag cac ttt ctt gag caa 388 Leu Asn Lys Glu Lys Thr Tyr Leu Arg Asp Gln His Phe Leu Glu Gln cac cct ctt ctg cag cc,a aaa atg cga gca att ctt ctg gat tgg tta 436 His Pro Leu Leu Gln Pro Lys Met Arg Ala Ile Leu Leu Asp Trp Leu atg gag gtg tgt gaa gtc tat aaa ctt cac agg gag acc ttt tac ttg 484 Met Glu Val Cys Glu Val Tyr Lys Leu His Arg Glu Thr Phe Tyr Leu gca caa gat ttc ttt gac cgg tat atg gcg aca caa gaa aat gtt gta 532 2 0 Ala Gln Asp Phe Phe Asp Arg Tyr Met Ala Thr Gln Glu Asn Val Val aaa act ctt tta cag ctt att ggg att tca tct tta ttt att gca gcc 580 Lys Thr Leu Leu Gln Leu Ile Gly Ile Ser Ser Leu Phe Ile Ala Ala aaa ctt gag gaa atc tat cct cca aag ttg cac cag ttt gcg tat gtg 628 Lys Leu Glu Glu Ile Ty:r Pro Pro Lys Leu His Gln Phe Ala Tyr Val.

aca gat gga get tgt tc~a gga gat gaa att ctc acc atg gaa tta atg 676 Thr Asp Gly Ala Cys Se:r Gly Asp Glu Ile Leu Thr Met Glu Leu Met.

att atg aag gcc ctt aag tgg cgt tta agt ccc ctg act att gtg tcc 724 Ile Met Lys Ala Leu Lys Trp Arg Leu Ser Pro Leu Thr Ile Val Ser tgg ctg aat gta tac atg cag gtt gca tat cta aat gac tta cat gaa 772 4 0 Trp Leu Asn Val Tyr Met Gln Val Ala Tyr Leu Asn Asp Leu His Glu gtg cta ctg ccg cag tat ccc cag caa atc ttt ata cag att gca gag 820 Val Leu Leu Pro Gln Tyr Pro Gln Gln Ile Phe Ile Gln Ile Ala Glu ctg ttg gat ctc tgt gtc ctg gat gtt gac tgc ctt gaa ttt cct tat 868 Leu Leu Asp Leu Cys Val Leu Asp Val Asp Cys Leu Glu Phe Pro Tyr ggt ata ctt get get tcg gcc ttg tat cat ttc tcg tca tct gaa ttg 916 Gly Ile Leu Ala Ala Ser Ala Leu Tyr His Phe Ser Ser Ser Glu Leu atg caa aag gtt tca ggg tat cag tgg tgc gac ata gag aac tgt gtc 964 Met Gln Lys Val Ser Gly Tyr Gln Trp Cys Asp Ile Glu Asn Cys Val aag tgg atg gtt cca ttt gcc atg gtt ata agg gag acg ggg agc tca 1012 Lys Trp Met Val Pro Phe Ala Met Val Ile Arg Glu Thr Gly Ser Ser aaa ctg aag cac ttc agg ggc gtc get gat gaa gat gca cac aac ata 1060 SUBSTITLfTE SHEET ( rule 26 ) WO 00/01817 PCTNS99/123bb Lys Leu Lys His Phe Arg Gly Val Ala Asp Glu Asp Ala His Asn Ile cag acc cac aga gac agc ttg gat ttg ctg gac aaa gcc cga gca aag 1108 Gln Thr His Arg Asp Ser Leu Asp Leu Leu Asp Lys Ala Arg Ala Lys aaa gcc atg ttg tct gaa. caa aat agg get tct cct ctc ccc agt ggg 1156 Lys Ala Met Leu Ser Glu. Gln Asn Arg Ala Ser Pro Leu Pro Ser Gly ctc ctc acc ccg cca cag~ agc ggt aag aag cag agc agc ggg ccg gaa 1204 Leu Leu Thr Pro Pro Gln. Ser Gly Lys Lys Gln Ser Ser Gly Pro Glu atg gcg tgaccacccc atccttctcc accaaagaca gttgcgccgc tgctccacgt 1260 Met Ala tctcttctgt ctgttgcagc g~gaggcgtgc gtttgctttt acagatatct gaatggaaga 1320 gtgtttcttc cacaacagaa g~tatttctgt ggatggcatc aaacagggca aagtgttttt 1380 tattgaatgc ttataggttt t.ttttaaata agtgggtcaa gtacaccagc cacctccaga 1440 caccagtgcg tgctcccgat g~ctgctatgg aaggtgctac ttgacctaag ggactcccac 1500 aacaacaaaa gcttgaagct grtggaggcgc acggtggcgt ggctctcctc gcaggtgttc 1560 tgggctccgt tgtaccaagt ggagcaggtg gttgcgggca agcgttgtgc agagcccata 1620 gccagctggg cagggggctg ccctctccac attatcagtt gacagtgtac aatgcctttg 1680 atgaactgtt ttgtaagtgc t.gctatatct atccattttt taataaagct aatactgttt 1740 ctttagagca cactggcggg t.cgt 1764 <210> 56 <211> 395 <212> PRT
<213> Unknown <400> 56 Met Lys Glu Asp Gly Gly Ala Glu Phe Ser Ala Arg Ser Arg Lys Arg Lys Ala Asn Val Thr Val. Phe Leu Gln Asp Pro Asp Glu Glu Met Ala Lys Ile Asp Arg Thr Ala Arg Asp Gln Cys Gly Ser Gln Pro Trp Asp Asn Asn Ala Val Cys Ala Asp Pro Cys Ser Leu Ile Pro Thr Pro Asp Lys Glu Asp Asp Asp Arg Val Tyr Pro Asn Ser Thr Cys Lys Pro Arg Ile Ile Ala Pro Ser Arcfi Gly Ser Pro Leu Pro Val Leu Ser Trp Ala SUBSTITUTE SHEET ( rule 26 ) WO 00/01817 PC'T/US99/12366 Asn GluGlu ValTrp~Lys IleMetLeuAsn LysGluLys ThrTyr Arg Leu ArgAspGln HisPhe~Leu GluGlnHisPro LeuLeuGln ProLys 10 Met ArgAlaIle LeuLeu.Asp TrpLeuMetGlu ValCysGlu ValTyr Lys LeuHisArg GluThrPhe TyrLeuAlaGln AspPhePhe AspArg Tyr MetAlaThr GlnGlu.Asn ValValLysThr LeuLeuGln LeuIle Gly IleSerSer LeuPhe~Ile AlaAlaLysLeu GluGluIle TyrPro Pro LysLeuHis GlnPhe:Ala TyrValThrAsp GlyAlaCys SerGly 25 Asp GluIleLeu ThrMet.Glu LeuMetIleMet LysAlaLeu LysTrp Arg LeuSerPro LeuThrIle ValSerTrpLeu AsnValTyr MetGln Val AlaTyrLeu AsnAspLeu HisGluValLeu LeuProGln TyrPro Gln GlnIlePhe IleGlnIle AlaGluLeuLeu AspLeuCys ValLeu Asp ValAspCys LeuGluPhe ProTyrGlyIle LeuAlaAla SerAla 4 Leu TyrHisPhe SerSerSer GluLeuMetGln LysValSer GlyTyr Gln TrpCysAsp IleGluAsn CysValLysTrp MetValPro PheAla Met ValIleArg GluThrGly SerSerLysLeu LysHisPhe ArgGly Val AlaAspGlu AspAlaHis AsnIleGlnThr HisArgAsp SerLeu Asp LeuLeuAsp LysAlaArg AlaLysLysAla MetLeuSer GluGln 55 Asn ArgAlaSer ProLeuPro SerGlyLeuLeu ThrProPro GlnSer Gly LysLysGln SerSerGly ProGluMetAla SUBSTITL1TE SHEET ( rule 26 )

Claims (84)

WHAT IS CLAIMED IS:

1. An isolated or recombinant antigenic polypeptide comprising:
a) a plurality of distinct segments, wherein each said segment has identity to at least 12 contiguous amino acids from the mature SEQ ID NO: 2; or b) at least 17 contiguous amino acids from the mature SEQ ID
NO: 2.

2. The polypeptide of Claim 1, wherein said plurality of segments includes a) one of at least 19 contiguous amino acids; or b) two of at least 15 contiguous amino acids.

3. The polypeptide of Claim 1, wherein said polypeptide:
a) comprises the manure SEQ ID NO: 2;
b) binds with specificity to a polyclonal antibody which specifically binds to SEQ ID NO: 2; or c) said polypeptide:
i) is a natural allelic variant of SEQ ID NO: 2;
ii) is at least 30 amino acids in length;
iii) exhibits at least two non-overlapping epitopes specific for SEQ ID NO: 2;
iv) is a synthetic polypeptide;
v) is attached to a solid substrate; or vi) is a 5-fold or less conservative substitution from SEQ ID NO: 2.

4. A fusion protein comprising first and second portions, said first portion comprising a polypeptide of Claim 1 and said second portion comprising a detectable marker.

5. A pharmaceutical composition comprising a sterile polypeptide of Claim 1 in a pharmaceutically acceptable carrier.

6. An isolated or recombinant polynucleotide encoding a polypeptide of Claim 1.

7. The polynucleotide of Claim 6, which:
a) comprises the mature polypeptide coding portion of SEQ ID
NO: 1; or b) encodes the mature SEQ ID NO: 2.

8. The polynucleotide of Claim 6, wherein said polynucleotide is:
a) a PCR product;
b) a hybridization probe;
c) a mutagenesis primer; or d) made by chemical synthesis.

9. The polynucleotide of Claim 6, which is:
a) detectably labeled;
b) a deoxyribonucleic acid; or c) double stranded.

10. An expression vector comprising a polynucleotide of Claim 6.

11. The vector of Claim 10, wherein said polypeptide specifically binds polyclonal antibodies generated against an immunogen of mature SEQ ID NO: 2.

12. The vector of Claim 10, which a) selectively hybridizes under stringent hybridization conditions to a target polynucleotide sequence having at least 60 contiguous nucleotides from SEQ ID NO: 1;
b) encodes a polypeptide having at least 50 contiguous amino acid residues from mature SEQ ID NO: 2; or c) is suitable for transfection into a prokaryote or eukaryote host cell.

13. The vector of Claim 12, wherein said host cell is:
a) a mammalian cell;
b) a bacterial cell;

c) an insect cell;
d) a prokaryote;
e) a eukaryote; or f) a COS cell.

14. A method of making a polypeptide comprising expressing said vector of Claim 13 in said host cell.

15. An isolated or recombinant polynucleotide which hybridizes to the coding portion of SEQ ID NO: 1 under stringent hybridization and wash conditions of at least 50° C, a salt concentration of less than 400 mM, and 50% formamide.

16. An expression vector comprising the polynucleotide of Claim 15.

17. The vector of Claim 16 which hybridizes to the coding portion of SEQ ID NO: 1 wider stringent hybridization and wash conditions of at least 60° C, a salt concentration of less than 200 mM, and 50% formamide.

18. The vector of Claim 25, which encodes a polypeptide which specifically binds an antibody generated against a mature SEQ ID NO: 2.

19. The polynucleotide of Claim 15 which hybridizes to SEQ
ID NO: 1, wherein said polynucleotide is:
a) a PCR product;
b) a hybridization probe;
c) a mutagenesis primer; or d) made by chemical synthesis.

20. A method of modulating the physiology or development of a cell, comprising contacting said cell with an agonist or antagonist of a polypeptide of Claim 1.

21. A method of detecting the presence of a complementary polynucleotide in a sample, comprising contacting a polynucleotide of Claim 6 that selectively hybridizes with said complementary polynucleotide in said sample to form a detectable duplex; thereby indicating the presence of said polynucleotide in said sample.

22. A method for identifying a compound that binds to a polypeptide of Claim 1, comprising:
a) incubating components comprising said compound and said polypeptide under conditions sufficient to allow the components to interact; and b) measuring the binding of the compound to said polypeptide.

23. An isolated or recombinant polynucleotide encoding an antigenic polypeptide comprising:
a) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 6;
b) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 8;
c) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 10;
d) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 12;
e) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 17;
f) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 19;
g) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 21; or h) at least 17 contiguous amino acids from the mature polypeptide from SEQ ID NO: 23.

24. The polynucleotide of Claim 23, encoding all of the polypeptide of:
a) signal processed SEQ ID NO: 6;
b) signal processed SEQ ID NO: 8;
c) signal processed SEQ ID NO: 10;

d) signal processed SEQ ID NO: 12;
e) signal processed SEQ ID NO: 17;
f) SEQ ID NO: 19;
g) SEQ ID NO: 21; or h) SEQ ID NO: 23.

25. The polynucleotide of Claim 23, which hybridizes at 55°
C, less than 500 mM salt, and 50% formamide to the:
a) mature protein coding portion of SEQ ID NO: 5;
b) signal processed coding portion of SEQ ID NO: 7;
c) signal processed coding portion of SEQ ID NO: 9;
d) signal processed coding portion of SEQ ID NO: 11;
e) mature protein coding portion of SEQ ID NO: 16;
f) polypeptide coding portion of SEQ ID NO: 18;
g) polypeptide coding portion of SEQ ID NO: 20; or h) polypeptide coding portion of SEQ ID NO: 22.

26. The polynucleotide of Claim 25, comprising at least 35 contiguous nucleotides of:
a) mature protein coding portion of SEQ ID NO: 5;
b) signal processed coding portion of SEQ ID NO: 7;
c) signal processed coding portion of SEQ ID NO: 9;
d) signal processed coding portion of SEQ ID NO: 11;
e) mature protein coding portion of SEQ ID NO: 16;
f) polypeptide coding portion of SEQ ID NO: 18;
g) polypeptide coding portion of SEQ ID NO: 20; or h) polypeptide coding portion of SEQ ID NO: 22.

27. An expression vector comprising the polynucleotide of Claim 23.

28. A host cell containing the expression vector of Claim 27, including a eukaryotic cell.

29. A method of making an antigenic polypeptide comprising expressing a recombinant polynucleotide of Claim 23.

30. A method for detecting a polynucleotide of Claim 23, comprising contacting said polynucleotide with a probe that hybridizes, under stringent conditions, to at least 25 contiguous nucleotides of the:
a) mature protein coding portion of SEQ ID NO: 5;
b) signal processed coding portion of SEQ ID NO: 7;
c) signal processed coding portion of SEQ ID NO: 9;
d) signal processed coding portion of SEQ ID NO: 11;
e) mature protein coding portion of SEQ ID NO: 16;
f) polypeptide coding portion of SEQ ID NO: 18;
g) polypeptide coding portion of SEQ ID NO: 20; or h) polypeptide coding portion of SEQ ID NO: 22;
to form a duplex, wherein detection of said duplex indicates the presence of said polynucleotide.

31. A kit for the detection of a polynucleotide of Claim 23, comprising a compartment containing a probe that hybridizes, under stringent hybridization conditions, to at least 17 contiguous nucleotides of a polynucleotide of Claim b1 to form a duplex.

32. The kit of Claim 31, wherein said probe is detectably labeled.

33. A binding compound comprising an antibody binding site which specifically binds to a polypeptide comprising at least 17 contiguous amino acids from:
a) signal processed SEQ ID NO: 6;
b) signal processed SEQ ID NO: 8;
c) signal processed SEQ ID NO: 10;
d) signal processed SEQ ID NO: 12;
e) signal processed SEQ ID NO: 17;
f) SEQ ID NO: 19;
g) SEQ ID NO : 21; o:r h) SEQ ID NO: 23.

34. The binding compound of Claim 33, wherein:
a) said antibody binding site is:

1) selectively immunoreactive with the:
a) signal processed SEQ ID NO: 6;
b) signal processed SEQ ID NO: 8;
c) signal processed SEQ ID NO: 10;
d) signal processed SEQ ID NO: 12;
e) signal processed SEQ ID NO: 17;
f) SEQ ID NO: 19;
g) SEQ ID NO: 21; or h) SEQ ID NO: 23;
2) raised against a purified or recombinantly produced human HDTEA84 protein;
3) raised against a purified or recombinantly produced human HSLJD37R protein; or 4) in a monoclonal antibody, Fab, or F(ab)2; or b) said binding compound is:
1) an antibody molecule;
2) a polyclonal antiserum;
3) detectably labeled;
4) sterile; or 5) in a buffered composition.

35. A method using the binding compound of Claim 33, comprising contacting said binding compound with a biological sample comprising an antigen, thereby forming a binding compound:antigen complex.

36. The method of Claim 35, wherein said biological sample is from a human, and wherein said binding compound is an antibody.

37. A detection kit comprising said binding compound of Claim 34, and:
a) instructional material for the use of said binding compound for said detection; or b) a compartment providing segregation of said binding compound.

38. A substantially pure or isolated antigenic polypeptide, which binds to said binding composition of Claim 33, and further comprises at least 17 contiguous amino acids from:
a) signal processed SEQ ID NO: 6;
b) signal processed SEQ ID NO: 8;
c) signal processed SEQ ID NO: 10;
d) signal processed SEQ ID NO: 12;
e) signal processed SEQ ID NO: 17;
f) SEQ ID NO: 19;
g) SEQ ID NO: 21; or h) SEQ ID NO: 23.

39. The polypeptide of Claim 38, which:
a) comprises at least a fragment of at least 25 contiguous amino acid residues from a primate HDTEA84 protein;
b) comprises at least a fragment of at least 25 contiguous amino acid residues from a primate HSLJD37R protein;
c) comprises at least a fragment of at least 25 contiguous amino acid residues from a rodent or primate RANKL
protein;
d) is a soluble polypeptide;
e) is detectably labeled;
f) is in a sterile composition;
g) is in a buffered composition;
h) binds to an sialic acid residue;
i) is recombinantly produced, or j) has a naturally occurring polypeptide sequence.

40. The polypeptide of Claim 39, which comprises at least 17 contiguous amino acids from the:
a) signal processed SEQ ID NO: 6;
b) signal processed SEQ ID NO: 8;
c) signal processed SEQ ID NO: 10;
d) signal processed SEQ ID NO: 12;
e) signal processed SEQ ID NO: 17;
f) SEQ ID NO: 19;
g) SEQ ID NO: 21; or h) SEQ ID NO: 23.

41. A method of modulating a precursor cell physiology or function comprising a step of contacting said cell with:
a) a binding compound which binds to said polypeptide of Claim 38;
b) an HDTEA84 polypeptide;
c) an HSLJD37R polypeptide; or d) a RANKL polypeptide.

42. The method of Claim 41, wherein said contacting is in combination with a TNF family ligand, or an antagonist of said TNF
family ligand.

43. A composition of matter selected from:
a) a substantially pure or recombinant HCC5 polypeptide exhibiting identity over a length of at least 12 amino acids to SEQ ID NO: 25;
b) an isolated natural sequence HCC5 of mature SEQ ID NO:
25;
c) a fusion protein comprising HCC5 sequence;
d) a substantially pure or recombinant Dub11 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID NO: 32 or 34;
e) an isolated natural sequence Dub11 of mature SEQ ID NO:
32 or 34;
f) a fusion protein comprising Dub11 sequence;
g) a substantially pure or recombinant Dub12 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID NO: 36 or 38;
h) an isolated natural sequence Dub12 of mature SEQ ID NO:
36 or 38;
i) a fusion protein comprising Dub12 sequence;
j) a substantially pure or recombinant MD-1 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID NO: 42;
k) an isolated natural sequence MD-1 of mature SEQ ID NO:
42;

l) a fusion protein comprising primate MD-1 sequence;
m) a substantially pure or recombinant MD-2 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID NO: 44 or 46;
n) an isolated natural sequence MD-2 of mature SEQ ID NO: 44 or 46;
o) a fusion protein. comprising primate MD-2 sequence;
p) a substantially pure or recombinant MD-2 polypeptide exhibiting identity over a length of at least about 12 amino acids to SEQ ID NO: 48 or 49;
q) an isolated natural sequence MD-2 of mature SEQ ID NO:
48; or r) a fusion protein comprising murine MD-2 sequence.

44. The composition of Claim 43, which is a substantially pure or isolated:
a) a HCC5 polypeptide, wherein said length is at least 17 amino acids;
b) a Dub11 polypeptide, wherein said length is at least 17 amino acids;
c) a Dub12 polypeptide, wherein said length is at least 17 amino acids;
d) a primate MD-1 polypeptide, wherein said length is at least 17 amino acids;
e) a primate MD-2 polypeptide, wherein said length is at least 17 amino acids; or f) a rodent MD-2 polypeptide, wherein said length is at least 17 amino acids.

45. The composition of Claim 44, which is a substantially pure or isolated:
a) a HCC5 polypeptide, wherein said length is at least 21 amino acids;
b) a Dub11 polypeptide, wherein said length is at least 21 amino acids;
c) a Dub12 polypeptide, wherein said length is at least 21 amino acids;

d) a primate MD-1 polypeptide, wherein said length is at least 21 amino acids;
e) a primate MD-2 polypeptide, wherein said length is at least 21 amino acids; and f) a rodent MD-2 polypeptide, wherein said length is at least 21 amino acids.

46. The composition of matter of Claim 43, wherein said:
a) HCC5 polypeptide:
i) is from a primate, including a human;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 25;
iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of HCC5;
v) has a length at least about 30 amino acids;
vi) exhibits at least two non-overlapping epitopes which are specific for a primate HCC5;
vii) exhibits a sequence identity over a length of at least 35 amino acids to a HCC5;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence;
b) Dub11 polypeptide:
i) is from a primate, including a human;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 32 or 34;
iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of Dub11;
v) has a length at least about 30 amino acids;

vi) exhibits at least two non-overlapping epitopes which are specific for a primate Dub11;
vii) exhibits a sequence identity over a length of at least about 35 amino acids to a Dub11;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence;
c) Dub12 polypeptide:
i) is from a primate, including a human;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 36 or 38;
iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of Dub12;
v) has a length at least about 30 amino acids;
vi) exhibits at least two non-overlapping epitopes which are specific for a primate Dub12;
vii) exhibits a sequence identity over a length of at least about 35 amino acids to a Dub12;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence;
d) primate MD-1 polypeptide:
i) is from a human;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 42;

iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of primate MD-1;
v) has a length at least about 30 amino acids;
vi) exhibits at least two non-overlapping epitopes which are specific for a primate MD-1;
vii) exhibits a sequence identity over a length of at least about 35 amino acids to a primate MD-1;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence;
e) primate MD-2 polypeptide:.
i) is from a human;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 44 or 46;
iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of primate MD-2;
v) has a length at least about 30 amino acids;
vi) exhibits at least two non-overlapping epitopes which are specific for a primate MD-2;
vii) exhibits a sequence identity over a length of at least about 35 amino acids to a primate MD-2;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence; or f) rodent MD-2 polypeptide i) is from a mouse;
ii) comprises at least one polypeptide segment of SEQ
ID NO: 48 or 49;
iii) exhibits a plurality of portions exhibiting said identity;
iv) is a natural allelic variant of rodent MD-2;
v) has a length at least about 30 amino acids;
vi) exhibits at least two non-overlapping epitopes which are specific for a rodent MD-2;
vii) exhibits a sequence identity over a length of at least about 35 amino acids to a rodent MD-2;
viii) is glycosylated;
ix) is a synthetic polypeptide;
x) is attached to a solid substrate;
xi) is conjugated to another chemical moiety;
xii) is a 5-fold or less substitution from natural sequence; or xiii) is a deletion or insertion variant from a natural sequence.

47. A composition comprising a sterile polypeptide of Claim 43, wherein said polypeptide is:
a) HCC5 polypeptide,;
b) Dub11 polypeptide:;
c) Dub12 polypeptide;
d) MD-1 polypeptide;; or e) MD-2 polypeptide.

48. A composition of Claim 43 comprising:
a) said FCC5 polypeptide and:
1) a carrier, wherein said carrier is:
a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration;
2) another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4; or 3) an antibody antagonist for a chemokine, including one selected from the group of HCC1, HCC2 , HCC3 , and HCC4;
b) said Dub11 polypeptide and a carrier, wherein said carrier is a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration;
c) said Dub12 polypeptide and a carrier, wherein said carrier is:
a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration;
d) said MD-1 polypeptide and a carrier, wherein said carrier is:
a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration;
e) said MD-2 polypeptide and a carrier, wherein said carrier is:
a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration.

49. The fusion protein of Claim 43 comprising:
a) mature protein sequence of Table 7;
b) mature protein sequence of Table 9;
b) mature protein sequence of Table 11;
c) a detection or purification tag, including a FLAG, His6, or Ig sequence; or d) sequence of another chemokine protein with said protein in a).

50. A kit comprising a polypeptide of Claim 43, and:
a) a compartment comprising said polypeptide; and/or b) instructions for use or disposal of reagents in said kit.

51. A binding compound comprising an antigen binding portion from an antibody, which specifically binds to a natural:
a) HCC5 polypeptide of Claim 43, wherein said antibody:
i) is raised against a peptide sequence of a mature polypeptide sequence of Table 7;
ii) is raised against a mature HCC5;
iii) is raised to a purified HCC5;
iv) is immunoselected;
v) is a polyclonal antibody;
vi) binds to a denatured HCC5; or vii) exhibits a Kd to antigen of at least 30 µM;
b) Dub11 polypeptide of Claim 43, wherein said antibody:
i) is raised against a peptide sequence of a mature polypeptide sequence of Table 9;
ii) is raised against a mature Dub11;
iii) is raised to a purified Dub11;
iv) is immunoselected;
v) is a polyclonal antibody;
vi) binds to a denatured Dub11; or vii) exhibits a Kd to antigen of at least 30 µM;
c) Dub12 polypeptide of Claim 43, wherein said antibody:
i) is raised against a peptide sequence of a mature polypeptide sequence of Table 9;
ii) is raised against a mature Dub12;
iii) is raised to a purified Dub12;
iv) is immunoselected;
v) is a polyclonal antibody;
vi) binds to a denatured Dub12; or vii) exhibits a Kd to antigen of at least 30 µM;
d) a primate MD-1 polypeptide of Claim 43, wherein said antibody:

i) is raised against a peptide sequence of a mature polypeptide sequence of Table 11;
ii) is raised against a mature MD-1;
iii) is raised to a purified MD-1;
iv) is immunoselected;
v) is a polyclonal antibody;
vi} binds to a denatured MD-1; or vii) exhibits a Kd to antigen of at least 30 µM;
e) a primate MD-2 polypeptide of Claim 43, wherein said antibody:
i) is raised against a peptide sequence of a mature polypeptide sequence of Table 11;
ii) is raised against a mature MD-2;
iii} is raised to a purified MD-2;
iv) is immunoselected;
v) is a polyclonal antibody;
vi) binds to a denatured MD-2; or vii) exhibits a Kd to antigen of at least 30 µM; or f) a rodent MD-2 polypeptide of Claim 43, wherein said antibody:
i) is raised against a peptide sequence of a mature polypeptide sequence of Table 11;
ii) is raised against a mature rodent MD-2;
iii) is raised to a purified rodent MD-2;
iv) is immunoselected;
v) is a polyclonal antibody;
vi) binds to a denatured rodent MD-2; or vii) exhibits a Kd to antigen of at least 30 µM.

52. The binding composition of Claim 51, wherein:
a) said polypeptide is from a primate or rodent;
b) said binding compound is an Fv, Fab, or Fab2 fragment;
c) said binding compound is conjugated to another chemical moiety;
d) is attached to a solid substrate, including a bead or plastic membrane;

e) is in a sterile composition; or f) is detectably labeled, including a radioactive or fluorescent label.

53. A kit comprising said binding compound of Claim 51., and:
a) a compartment comprising said binding compound;
b) a compartment comprising purified antigen; and/or c) instructions for use or disposal of reagents in said kit.

54. A method of producing an antigen: antibody complex, comprising contacting an antibody of Claim 51 and:
a) a primate HCC5 polypeptide;
b) a primate Dub11 polypeptide;
c) a primate Dub12 polypeptide;
d) a primate MD-1 polypeptide;
e) a primate MD-2 polypeptide; or f) a rodent MD-2 polypeptide;
thereby allowing said complex to form.

55. A composition comprising said binding compound of Claim 51 and:
1) a carrier, wherein said carrier is:
a) an aqueous compound, including water, saline, and/or buffer; and/or b) formulated for oral, rectal, nasal, topical, or parenteral administration; or 2) an antibody antagonist for another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4.

56. An isolated or recombinant nucleic acid encoding a polypeptide or fusion protein of Claim 43, wherein:
A) said HCC5 .
a) polypeptide is from a primate, including a human; or b) nucleic acid:
i) encodes an antigenic HCC5 peptide sequence of Table 7;

ii) encodes a plurality of antigenic peptide sequences of Table 7;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said HCC5 segment;
iv) is a hybridization probe for a gene encoding said HCC5 polypeptide; or v) further encodes another chemokine, including one selected from the group of HCC1, HCC2, HCC3, and HCC4;
B) said Dub11:
a) polypeptide is from a primate, including a human; or b) nucleic acid:
i) encodes an antigenic Dub11 peptide sequence of Table 9;
ii) encodes a plurality of antigenic peptide sequences of Table 9;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said Dub11 segment; or iv) is a hybridization probe for a gene encoding said Dub11 polypeptide;
C) said Dub12:
a) polypeptide is from a primate, including a human; or b) nucleic acid:
i) encodes an antigenic Dub12 peptide sequence of Table 9;
ii) encodes a plurality of antigenic peptide sequences of Table 9;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said Dub12 segment;
iv) is a hybridization probe for a gene encoding said Dub12 polypeptide;
D) said primate MD-1:
a) polypeptide is from a primate, including a human; or b) nucleic acid:
i) encodes an antigenic MD-1 peptide sequence of Table 11;

ii) encodes a plurality of antigenic peptide sequences of Table 11;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said MD-1 segment;
iv) is a hybridization probe for a gene encoding said Dub11 polypeptide;
E ) said primate MD-2:
a) polypeptide is from a human; or b) nucleic acid:
i) encodes an antigenic MD-2 peptide sequence of Table 11;
ii) encodes a plurality of antigenic peptide sequences of Table 11;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said MD-2 segment;
iv) is a hybridization probe for a gene encoding said primate MD-2 polypeptide; or F) said rodent MD-2:
a) polypeptide is from a mouse; or b) nucleic acid:
i) encodes an antigenic MD-2 peptide sequence of Table 11;
ii) encodes a plurality of antigenic peptide sequences of Table 11;
iii) exhibits identity over at least 25 nucleotides to a natural cDNA encoding said MD-2 segment; or iv) is a hybridization probe for a gene encoding said rodent MD-2 polypeptide.

57. The nucleic acid of Claim 56, which:
a) is an expression vector;
b) further comprise an origin of replication;
c) is from a natural source;
d) comprises a detectable label;
e) comprises synthetic nucleotide sequence;
f) is less than 6 kb, preferably less than 3 kb;
g) is from a primate, including a human;

h) comprises a natural full length coding sequence; or i) is a PCR primer, PCR product, or mutagenesis primer.

58. A cell or tissue comprising a recombinant nucleic acid of Claim 56, including wherein said cell is:
a) a prokaryotic cell;
b) a eukaryotic cell;
c) a bacterial cell;
d) a yeast cell;
e) an insect cell;
f) a mammalian cell;
g) a mouse cell;
h) a primate cell; or i) a human cell.

59. A kit comprising said nucleic acid of Claim 56, and:
a) a compartment comprising said nucleic acid;
b) a compartment comprising a nucleic acid encoding another chemokine, including HCC1, HCC2, HCC3, and HCC4; or c) instructions for use or disposal of reagents in said kit.

60. A nucleic acid which:
a) hybridizes under wash conditions of 45°C and less than 2M salt to the polypeptide coding portion of SEQ ID NO:
24;
b) hybridizes underwash conditions of 45°C and less than 2M salt to the polypeptide coding portions of SEQ ID NO:
31 or 33;
c) hybridizes underwash conditions of 45°C and less than 2M salt to the coding portions of SEQ ID NO: 35 or 37;
d) hybridizes underwash conditions of 45°C and less than 2M salt to the coding portion of SEQ ID NO: 41;
e) hybridizes underwash conditions of 45° C and less than 2M salt to the coding portion of SEQ ID NO: 43 or 45. or f) hybridizes underwash conditions of 45° C and less than 2M salt to the coding portion of SEQ ID NO: 47.

61. The nucleic acid of Claim 57, wherein:
a) said wash conditions are at 55° C and/or 500 mM salt; or b) said wash conditions are at 65° C and/or 150 mM salt.

62. A method of modulating physiology or development of a cell or tissue culture cells comprising exposing said cell to an agonist or antagonist of HCC5, primate MD-1, primate MD-2, or rodent MD-2.

63. A method of detecting specific binding to a compound, comprising:
a) contacting said compound to a composition selected from the group of:
i) an antigen binding site which specifically binds to a HCC5 chemokine;
ii) an antigen binding site which specifically binds to Dub11;
iii) an antigen binding site which specifically binds to Dub12;
iv) an antigen binding site which specifically binds to primate MD-1;
v) an antigen binding site which specifically binds to primate MD-2 ;
vi) an antigen binding site which specifically binds to rodent MD-2 ;
vii) an expression vector encoding a HCC5 chemokine or fragment thereof;
viii) an expression vector encoding a Dub11 or fragment thereof;
ix) an expression vector encoding a Dub12 or fragment thereof ;
x) an expression vector encoding a primate MD-1 or fragment thereof;
xi) an expression vector encoding a primate MD-2 or fragment thereof;
xii) an expression vector encoding a rodent MD-2 or fragment thereof;

xiii) a substantially pure protein which is specifically recognized by said antigen binding site of (i);
xiv) a substantially pure protein which is specifically recognized by said antigen binding site of (ii);
xiv) a substantially pure protein which is specifically recognized by said antigen binding site of (iii);
xiv) a substantially pure protein which is specifically recognized by said antigen binding site of (iv);
xiv) a substantially pure protein which is specifically recognized by said antigen binding site of (v);
xiv) a substantially pure protein which is specifically recognized by said antigen binding site of (vi);
ix) a substantially pure HCC5 chemokine or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of HCC5 chemokine sequence;
x) a substantially pure Dub11 or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of Dub11 sequence;
xi) a substantially pure Dub12 or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of Dub11 sequence;
xi) a substantially pure primate MD-1 or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of primate MD-1 sequence;
xi) a substantially pure primate MD-2 or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of primate MD-2 sequence;
xi) a substantially pure rodent MD-2 or peptide thereof of Claim 43, or a fusion protein comprising a 30 amino acid sequence portion of rodent MD-2 sequence; and b) detecting binding of said compound to said composition.

64. An isolated or recombinant polynucleotide which:

a) encodes at least 17 contiguous amino acid residues of SEQ
ID NO: 54;
b) encodes at least two distinct segments of at least 10 contiguous amino acid residues of SEQ ID NO 54; or c) comprises one or more segments at least 21 contiguous nucleotides of SEQ ID NO: 53.

65. A method of making:
a) a polypeptide comprising expressing an expression vector of Claim 64, thereby producing said polypeptide;
b) a duplex nucleic acid comprising contacting a polynucleotide of Claim 64 with a complementary nucleic acid, thereby resulting in production of said duplex nucleic acid;
c) a synthetic polynucleotide of Claim 64, comprising chemically polymerizing nucleotides to produce said polynucleotide; or d) a polynucleotide of Claim 64 comprising using a PCR
method.

66. An isolated or recombinant antigenic polypeptide comprising at least:
a) one segment comprising at least 17 contiguous amino acids from SEQ ID NO: 54; or b) at least two distinct segments of at least 11 contiguous amino acids from SEQ ID NO: 54.

67. The antigenic polypeptide of Claim 66, comprising at least one segment comprising at least 17 contiguous amino acids from SEQ ID NO: 54.

68. The polypeptide of Claim 66, which exhibits at least two non-overlapping epitopes which are selective for primate protein of SEQ ID NO: 54.

69. The polypeptide of Claim 66, wherein said polypeptide:
a) is a 5-fold or less substitution from a natural sequence;
or b) is a deletion or insertion variant from a natural sequence.

70. A kit comprising said polypeptide of Claim 66, and instructions for the use or disposal of said polypeptide or other reagents of said kit.

71. The antigenic polypeptide of Claim 66, comprising at least two distinct segments of at least 11 contiguous amino acids from SEQ ID NO: 54.

72. The polypeptide of Claim 71:
a) which comprises at least one sequence from (SEQ ID NO:
54) KESRYVHD (residues 120-127), DKHFEVLH (residues 127-134), HSDLEPQM (residues 134-141), QKDINKNM (residues 177-184), YAPKLQEF (residues 203-210), SEEDILRM
(residues 219-226), LRMELIIL (residues 224-231), ELCPVTII (residues 237-244), and LFLQVDAL (residues 249-256);
and/or b) wherein said segments of at least 11 contiguous amino acids comprise one said segment with at least 14 contiguous amino acids from SEQ ID NO: 54.

73. The polypeptide of Claim 71, which exhibits at least two non-overlapping epitopes which are selective for primate protein of SEQ ID NO: 54.

74. The polypeptide of Claim 71, wherein said polypeptide:
a) comprises a mature sequence of SEQ ID NO: 2;
b) binds with selectivity to an antibody generated against an immunogen of SEQ ID NO: 54;
c) comprises a plurality of polypeptide segments of 17 contiguous amino acids of SEQ ID NO: 54; or d) is a natural allelic variant of SEQ ID NO: 54.

75. The polypeptide of Claim 71, wherein said polypeptide:
a) is in a sterile composition;

b) has a length at least 30 amino acids;
c) is not glycosylated;
d) is denatured;
e) is a synthetic polypeptide;
f) is attached to a solid substrate; or g) is a fusion protein with a detection or purification tag, including a FLAG, His6, or Ig sequence.

76. The polypeptide of Claim 71, wherein said polypeptide:
a) is a 5-fold or less substitution from a natural sequence;
or b) is a deletion or insertion variant from a natural sequence.

77. A kit comprising said polypeptide of Claim 71, and instructions for the use or disposal of said polypeptide or other reagents of said kit.

78. A method using said polypeptide of Claim 71:
a) to label said polypeptide, comprising labeling said polypeptide with a radioactive label;
b) to separate said polypeptide from another polypeptide in a mixture, comprising running said mixture on a chromatography matrix, thereby separating said polypeptides;
c) to identify a compound that binds selectively to said polypeptide, comprising incubating said compound with said polypeptide under appropriate conditions; thereby causing said component to bind to said polypeptide; or d) to conjugate said polypeptide to a matrix, comprising derivatizing said polypeptide with a reactive reagent, and conjugating said polypeptide to said matrix; or e) inducing an antibody response to said polypeptide, comprising introducing said polypeptide as an antigen to an immune system, thereby inducing said response.

79. A binding compound comprising an antigen binding portion from an antibody which binds with selectivity to a polypeptide of Claim 66.

80. A method of evaluating the selectivity of binding of a compound to cyclin E2, comprising contacting said compound to a recombinant cyclin E2 polypeptide and at least one other cyclin;
and comparing binding of said compound to said cyclins.

81. The polypeptide of Claim 67:
a) which comprises at least one sequence from (SEQ ID NO:
54) KESRYVHD (residues 120-127), DKHFEVLH (residues 127-134), HSDLEPQM (residues 134-141), QKDINKNM (residues 177-184), YAPKLQEF (residues 203-210), SEEDILRM
(residues 219-226), LRMELIIL (residues 224-231), ELCPVTII (residues 237-244}, and LFLQVDAL (residues 249-256);
and/or b) wherein said segment comprising at least 17 contiguous amino acids exhibits at least 23 contiguous amino acids from SEQ ID NO: 54.

82. The polypeptide of Claim 67, wherein said polypeptide:
a) comprises a mature sequence of SEQ ID NO: 54;
b) binds with selectivity to an antibody generated against an immunogen of SEQ ID NO: 54;
c) comprises a plurality of polypeptide segments comprising at least 17 contiguous amino acids of SEQ ID NO: 54; or d) is a natural allelic variant of SEQ ID NO: 54.

83. The polypeptide of Claim 67, wherein said polypeptide:
a) is in a sterile composition;
b) has a length at least 30 amino acids;
c) is not glycosylated;
d) is denatured;
e) is a synthetic polypeptide;
f) is attached to a solid substrate; or g) is a fusion protein with a detection or purification tag, including a FLP,G, His6, or Ig sequence.

84. A method using said polypeptide of Claim 67:
a) to label said polypeptide, comprising labeling said polypeptide with a radioactive label;
b) to separate said polypeptide from another polypeptide in a mixture, comprising running said mixture on a chromatography matrix, thereby separating said polypeptides;
c) to identify a compound that binds selectively to said polypeptide, comprising incubating said compound with said polypeptide under appropriate conditions; thereby causing said component to bind to said polypeptide;
d) to conjugate said polypeptide to a matrix, comprising derivatizing said polypeptide with a reactive reagent, and conjugating said polypeptide to said matrix; or e) inducing an antilbody response to said polypeptide, comprising introducing said polypeptide as an antigen to an immune system, thereby inducing said response.