CA2319076A1

CA2319076A1 - Expression of the insl4 gene in human embryonic bone tissues and applications

Info

Publication number: CA2319076A1
Application number: CA002319076A
Authority: CA
Inventors: Anne Laurent; Dominique Bellet
Original assignee: Individual
Current assignee: Institut Gustave Roussy (IGR)
Priority date: 1998-01-23
Filing date: 1999-01-22
Publication date: 1999-07-29
Also published as: EP1064380A1; FR2774095A1; FR2774095B1; WO1999037780A1; JP2002500888A

Abstract

The invention concerns the locating of the expression of the insulin-like 4 (ISNL4) gene in the human embryonic bone tissues and ligaments, detection and diagnostic methods, methods for marking and detecting said tissues expressing INSL4 gene expression products as well as methods for selecting compounds capable of modulating the activity of said cells. The invention also concerns medicines for treating pathologies related to the differentiation and/or abnormal proliferation of said tissues, particularly pathologies related to the abnormal development of the cartilage and/or an abnormal ossification of the bone being formed and/or the abnormal development of interarticular ligaments.

Description

WO 99!37780 PGT/FR99/00137 ' 1 EMBRYONNAIRES HUMAINS ET APPLICATIONS.
La présente invention concerne la localisation de l'exprc;ssion du génc insulin-like 4 (INSU dans les tissus osseux ct ligaments embryonnaires chez l'homme, des procédés de détection et de diagnostic, des méthodes de marquage et de détection de cellutes desdits tissus exprimant les produits d'expression du gène INSL4 ainsi que des méthodes de sélection de composés capables de moduler l'activité desdites cellules.
L'invention concerne également des médicaments destinés au traitement de pathologies to liées à la différenciation et/ou la prolifération anormale desdits tissus, notamment les pathologies liées au développement anormal du cartilage et/ou à une ossifccation anormale de l'os en formation et/ou au développement anotznal des ligaments interosseux.
L'insuline, 1'IGF-I, l'IGF-II (~~ Insulin like growth factors I and II ~ ou facteurs de croissance de type insuline I et II) et la relaxine appartiennent à une famille d'hormones peptidiques ayant certaines structures et fonctions en commun, notamment leur influence sur la prolifération, le développement, la différenciation et le métabolisme cellulaire (D. Le Roith, 1997).
L'insuline est bien connue comme étant une hormone endocrine pancréatique 2o régulant le métabolisme énergétique. Les facteurs de croissance de type insuline-IGF-I
sont des peptides promoteurs de croissance impliqués dans la régulation endocrine, paracrine et autocrine de la croissance cellulaire et qui sont exprimés dans de nombreux tissus. L'IGF-II a des propriétés similaires mais est exprimée en quantité
plus importante en période prénatale et est considérée comme étant un facteur de croissance foetale.
La relaxine induit un remodelage des tissus conjonctifs dans le tractus reproductif et inhibe les contractions utérines. Le gène de la relaxine est exprimé dans le corpus luteum, la decidua, le trophoblaste et la prostate (Bogie, L.V. et al., 1995).
Son r8le fonctionnel dans le cerveau où une expression très importante a été
observée, 3o reste à être élucidé.

WO 99137780 PCT/FIt99/00137 WO 99! 37780 PGT / FR99 / 00137 '1 HUMAN EMBRYONICS AND APPLICATIONS.
The present invention relates to the localization of the expression of the genc insulin-like 4 (INSU in bone tissue and embryonic ligaments in humans, of detection and diagnostic methods, marking and detection of cells of said tissues expressing the expression products of the INSL4 gene as well as methods for selecting compounds capable of modulating the activity of said compounds cells.
The invention also relates to medicaments for the treatment of pathologies to linked to the differentiation and / or the abnormal proliferation of said tissues, especially the pathologies linked to abnormal cartilage development and / or ossification abnormal bone formation and / or anotznal ligament development interosseous.
Insulin, IGF-I, IGF-II (~~ Insulin like growth factors I and II ~ or factors insulin I and II growth cells) and relaxin belong to a family peptide hormones with certain structures and functions in common, especially their influence on proliferation, development, differentiation and the cell metabolism (D. Le Roith, 1997).
Insulin is well known as a pancreatic endocrine hormone 2o regulating energy metabolism. Type growth factors insulin-IGF-I
are growth promoter peptides involved in regulation endocrine, paracrine and autocrine cell growth and which are expressed in of many fabrics. IGF-II has similar properties but is expressed in amount greater in the prenatal period and is considered to be a factor of fetal growth.
Relaxin induces remodeling of connective tissue in the tract reproductive and inhibits uterine contractions. The relaxin gene is expressed in the corpus luteum, the decidua, the trophoblast and the prostate (Bogie, LV and al., 1995).
Its functional role in the brain where a very important expression has been observed, 3o remains to be elucidated.

WO 99137780 PCT / FIt99 / 00137

2 On. a adjoint, également, à cette famille les Ley I-L (INSL3) qui sont actuellement clonés sous forme d'ADNc et dont l'activité biologique est encore à
définir. Les transcrits Ley I-L sont présents dans les cellules de Leydig et dans d'autres tissus comme par exemple le corpus luteum, le trophoblaste, les membranes foetates et le tissu mammaire (Adham, LM. ct al., 1993 ; Tashima, L.S. et al., 1995).
Différentes études ont montré l'importance évidente de ces gènes dans la régulation de la croissance du foetus et du développement des cellules souches (V.K.M. Han et al., 1996 ; D.J. Hansell et al., 1991, et L.S. Tashiman ct al., 1995).
L'IGF-I et l'IGF-II sont exprimées par la plupart des tissus foetaux et embryonnaires et régulent la croissance et la différenciation cellulaire comme facteur autocrine/paracrine. Des expériences de mutagénèse dirigée effectuées sur les gènes codant pour les facteurs de croissance IGF-I et IGF-II ont mis en évidence l'application importante des systèmes de facteurs de croissance dans le processus de croissance (J. Baker et al.; 1993 ; T.M. De Chiara et al., 1990, et J.P. Liu et al., 1993). De Chiara et al. ont démontré une relation causale entre une invalidation du gène de l'IGF-II et un phénotype de déficience de croissance qui devient apparent dès le seizième jour de l'embryon et qui persiste 'après sa naissance. Liu et al.
ont observé
que des souris mutantes IGF-I (-I ) présentaient un poids à leur naissance d'environ 60 % de leur poids normal et que certaines d'entre elles étaient mort-nées.
Cette famille peptidique présente en commun des caractères structuraux définis par la position de différentes cystéines essentielles pour la formation d'une structure tertiaire.
On a pu démontrer que tous les membres de cette famille se fixaient à des récepteurs de surface cellulaires. Ces récepteurs ont été identifiés par clonage moléculaire et caractérisés en détail pour l'insuline et les IGFs. Ils appartiennent à la superfamille des récepteurs tyrosine-kinases (RTK's) qui comprend des récepteurs de facteurs de croissance et leurs analogues oncogZnes tels que c-erbB2lneu (récepteur EGF), c-met (récepteur de facteur de croissance des hépatocytes), fms (récepteur de CSF-1) et trk (récepteur de NGF).
3o La voie de transduction du signal intracellulaire pour ces récepteurs est caractérisée par une activité tyrosine-kinase qui produit une autophosphorylation des 2 We. also added to this family the Ley IL (INSL3) who are currently cloned as cDNA and whose biological activity is still at to define. Ley IL transcripts are present in Leydig cells and in other tissues such as the corpus luteum, the trophoblast, membranes fetates and breast tissue (Adham, LM. ct al., 1993; Tashima, LS et al., 1995).
Different studies have shown the obvious importance of these genes in the regulation of fetal growth and stem cell development (VKM Han et al., 1996; DJ Hansell et al., 1991, and LS Tashiman ct al., 1995).
IGF-I and IGF-II are expressed by most fetal tissues and embryonic and regulate cell growth and differentiation as a factor autocrine / paracrine. Site-directed mutagenesis experiments performed on Genoa coding for the growth factors IGF-I and IGF-II have highlighted the important application of growth factor systems in the process of growth (J. Baker et al .; 1993; TM De Chiara et al., 1990, and JP Liu et al., 1993). De Chiara et al. have demonstrated a causal relationship between a invalidation of IGF-II gene and a growth deficiency phenotype that becomes apparent from the sixteenth day of the embryo and which persists after its birth. Liu et al.
observed that IGF-I (-I) mutant mice had birth weights about 60% of their normal weight and that some of them were stillborn.
This peptide family has in common defined structural characteristics by the position of different cysteines essential for the formation of a structure tertiary.
It has been shown that all members of this family were attached to cell surface receptors. These receptors have been identified by cloning molecular and characterized in detail for insulin and IGFs. They belong to the tyrosine kinase receptor (RTK's) superfamily which includes receptors growth factors and their oncogenic analogs such as c-erbB2lneu (receiver EGF), c-met (hepatocyte growth factor receptor), fms (receiver of CSF-1) and trk (NGF receptor).
3o The intracellular signal transduction pathway for these receptors is characterized by tyrosine kinase activity which produces a autophosphorylation of

3 résidus tyrosine sur le récepteur suivie par une chaîne d'événements correspondant à
des phosphorylations. Ceci inclut notamment l'activation de l'IRS-1 (en particulier pour l'insuline et les IGFs), P13K, Shc, GBR2, Sos, Ras, Raf et la protéine activant la mitogénèse (MAP-kinase), kinase culminant lorsque la cascade de phosphorylation s affecte différents processus cellulaires tels que la transcription.
I,es effets physiologiques pléiotropiqucs de cette cascade de signaux en général font l'objet de recherches intensives.
Les polypeptides membres de cette famille sont tous caractérisés par la présence d'un peptide signal, une chaîne B, un peptide de jonction C ou chainc C et to une chaire A.
Pour ces hormones polypeptidiques, les termes de pré-prohormone, prohormone ou hormone mature sont définis à partir de la présence ou non de certains éléments et de leur arrangement en structure tertiaire. La pré-prohormone se distingue de la prohonmone par la présence de l'élément peptide signal. La distinction entre 15 prohormone et hormone mature active est plus complexe et fonction de l'hormone considérée.
Par exemple, dans la proinsuline et la prorelaxine, les chaînes B et A sont localisées respectivement aux extrémités N- et C-terminales et sont séparées par un long peptide C de jonction qui est clivé lors de la phase de maturation qui aboutit à la 2o forme active de l'hormone.
Au contraire de l'insuline et de la relaxine, le peptide C des IGFs n'est pas clivé pendant la phase de maturation. Les formes matures des peptides IGFs contiennent, en plus des domaines A, B et C, deux peptides carboxyl terminaux (domaines D et E) qui sont clivés après expression.
2s Récemment, un nouveau gène, dénommé INSL4, de la famille des insulin-like (insulines apparentées) a été caractérisé (WO 95 34653, Chassin, D. et al., 1995). Ce gène a été cloné à partir d'une banque d'ADNc de placenta précoce et localisé
sur le chromosome 9p24.
Le gène INSL4 code pour un polypeptide de 139 acides aminés dénommé
30 ~~ EPIL ~ (peptide insulin-like de placenta précoce).

_WO 99/37780 PGT/FR99/00137 3 tyrosine residues on the receptor followed by a chain of events corresponding to phosphorylations. This notably includes the activation of IRS-1 (in particular for insulin and IGFs), P13K, Shc, GBR2, Sos, Ras, Raf and protein activating the mitogenesis (MAP-kinase), kinase culminating when the cascade of phosphorylation s affects various cellular processes such as transcription.
I, the pleiotropic physiological effects of this cascade of signals in general are the subject of intensive research.
The member polypeptides of this family are all characterized by the presence of a signal peptide, a chain B, a junction peptide C or chainc C and to a chair A.
For these polypeptide hormones, the terms pre-prohormone, prohormone or mature hormone are defined from the presence or absence of some elements and their arrangement in a tertiary structure. The pre-prohormone is distinguished of the prohonmone by the presence of the signal peptide element. The distinction Between 15 prohormone and active mature hormone is more complex and a function of the hormone considered.
For example, in proinsulin and prorelaxin, the chains B and A are located respectively at the N- and C-terminal ends and are separated by a long junction peptide C which is cleaved during the maturation phase which leads to the 2o active form of the hormone.
Unlike insulin and relaxin, peptide C of IGFs is not cleaved during the maturation phase. The mature forms of IGFs peptides contain, in addition to domains A, B and C, two terminal carboxyl peptides (domains D and E) which are cleaved after expression.
2s Recently, a new gene, called INSL4, from the insulin-like family (related insulins) has been characterized (WO 95 34653, Chassin, D. et al., 1995). This gene was cloned from a localized placenta cDNA library on the chromosome 9p24.
The INSL4 gene codes for a polypeptide of 139 amino acids called 30 ~~ EPIL ~ (insulin-like peptide from early placenta).

_WO 99/37780 PGT / FR99 / 00137

4 Pour plus de clarté dans ta présente description, on dêsignera par polypeptide EPIL, le polypeptide putatif de 139 acides aminés déduü de la séquence d'acide nucléique codante et tel que déni dans ta figure 1.
La séquence d'acides aminés déduite a montré, cn accord avec l'organisation s générale de cette famille d'hormones, certaines homologies structurales comme la présence d'un peptide signal, d'une chaîne B et A et d'un peptide C de jonction ou chaîne C, ainsi que la présence de 6 résidus cystéine, devant étre probablement impliqués dans la formation de 3 ponts Bisulfures.
Ces documents décrivent l'organisation du gène INSL4 qui est composé de 1o deux exons et d'un intron. Ces documents montrent également que les transcrits ARNm du gène INSL4 ont seulement été détectés dans les tissus placentaires et faiblement dans l'utérus (D. Chassin et at., 1995).
Le gène INSL4 qui appartient également à cette famille pourrait étre un nouveau membre de cette famille de gène qui est impliqué dans le développement 1s humain. Pour nous permettre de mieux comprendre lc r8le de ces gènes dans te développement embryonnaire et foetal, l'étude des voies d'expression de ces gènes à
différentes étapes du développement a été une approche réussie (T. Strachan et al., 1997 ; C. Ottotenghi et al., 1997, et J. Burn et al., 1995). En étudiant ta chronologie et la localisation de l'expression des gènes INSL4 et IGF II dans te développement du 2o placenta et des tissus humains d'embryons en début de gestation par la technique d'hybridation in situ, les inventeurs ont mis en évidence un niveau d'expression élevé
de transcrits d'INSL4 dans le trophoblaste humain, en particulier dans les syncytio-trophoblastes. De manière tout à fait surprenante, les inventeurs ont également mis en évidence un niveau d'expression élevé de transcrits d'INSL4 dans des tissus foetaux 2s âgés de huit semaines, mais seulement dans les ligaments interosseux et dans le périchondre.
La présente invention a donc pour objet un polypeptide EPIL 1, EPIL 2 ou EPIL 3 codé par le gène INSL4, caractérisé en ce qu'il est exprimé dans des cellules 3o foetales du tissu osseux.

Dans la présente description, le terne de polypeptide désigne également une protéine ou un peptide.
On entend désigner dans la présente invention par polypeptidc EPIL 1, un polypcptide codé par lc gène INSL4, constitué d'une seule chaire comportant Ies 4 For clarity in your present description, we will designate by polypeptide EPIL, the putative polypeptide of 139 amino acids deduced from the acid sequence coding nucleic acid and as denied in your figure 1.
The deduced amino acid sequence showed, in agreement with the organization s general of this family of hormones, certain structural homologies like the presence of a signal peptide, of a chain B and A and of a peptide C of junction or chain C, as well as the presence of 6 cysteine residues, to be probably involved in the formation of 3 Bisulfide bridges.
These documents describe the organization of the INSL4 gene which is composed of 1o two exons and an intron. These documents also show that the transcribed INSL4 gene mRNAs have only been detected in placental tissues and weakly in the uterus (D. Chassin et at., 1995).
The INSL4 gene which also belongs to this family could be a new member of this gene family that is involved in the development 1s human. To allow us to better understand the role of these genes in you embryonic and fetal development, the study of the ways of expression of these genes to different stages of development has been a successful approach (T. Strachan and al., 1997 ; C. Ottotenghi et al., 1997, and J. Burn et al., 1995). By studying your chronology and the localization of the expression of the INSL4 and IGF II genes in te development of 2o placenta and human tissues of embryos in early gestation by the technical of in situ hybridization, the inventors have highlighted a level high expression INSL4 transcripts in the human trophoblast, particularly in syncytio-trophoblasts. Surprisingly, the inventors have also set evidence of a high level of expression of INSL4 transcripts in tissues fetal 2s eight weeks of age, but only in the interosseous ligaments and in the perichondrium.
The present invention therefore relates to an EPIL 1, EPIL 2 or EPIL 3 encoded by the INSL4 gene, characterized in that it is expressed in cells 3o fetal bone tissue.

In the present description, the dull polypeptide also denotes a protein or peptide.
In the present invention, the expression EPIL 1 polypeptide is intended to denote a polypcptide encoded by the INSL4 gene, consisting of a single chair comprising Ies

5 régions A, B et C de séquence globale d'acides aminés choisie parmi les séquences d'acides aminés comprises entre les positions 18 et 139, extrémités incluses;
de la séquence d'acides aminés définie à la figure 1, ladite séquence globale comportant au moins la séquence d'acides aminés comprise entre les positions 24 et 139, extrémités incluses, ledit polypeptide EPIL 1 pouvant en outre comporter un peptide signal de to telle sorte que la séquence d'acides aminés du polypeptide EPIL 1 comprenant le peptide signal est la séquence comprise entre les positions 1 et 139, extrémités comprises, de la séquence d'acides aminés définie à la figure 1.
On entend désigner dans la présente invention par polypcptide EPIL 2, un polypeptide codé par le gène INSL4, constitué
t5 a) d'une chaîne A dont la séquence d'acides aminés est la séquence comprise entre les positions 115 et 139, extrémités incluses de 1a séquence d'acides aminés définie à la figure 1 ;
b) d'une chaîne B dont la séquence d'acides aminés est choisie parmi une séquence comprise entre les positions 18 et 58, extrémités incluses, de la séquence 2o d'acides aminés définie à la figure 1, ladite séquence comprenant au moins la séquence comprise entre les positions 24 et 53, extrémités incluses ;
ledit polypeptide EPIL 2 pouvant comporter en outre un peptide signal de séquence d'acides aminés choisie parmi une séquence comprise entre les positions 1 et 23, extrémités incluses, de la séquence d'acides aminés définie à la figure 1, ladite 25 séquence du peptide signal comprenant au moins la séquence comprise entre les positions 1 et 17, extrémités incluses.
On entend désigner dans la présente invention par polypeptide EPIL 3, un potypeptide codé par le gène INSL4, constitué d'une chaîne C dont la séquence d'acides aminés est choisie parmi une séquence comprise entre les positions 54 et 114, 30 extrémités incluses, de la séquence d'acides aminés définie à la figure 1, ladite G
séquence comprenant au moins la séquence comprise entre les positions 59 et 114, extrémités incluses.
On entend désigner par tissu osseux dans la présente description, les tissus composant préférentiellement les os cartilagineux longs, courts ou plats.
L'invention concerne également les polypcptides selon l'invention, caractérisés en ce que les cellules foetales du tissu osseux sont des cellules du périchondrc.
L'invention a aussi pour objet les polypeptides EPIL 1, EPIL 2 ou EPIL 3 codés par le gène INSL4, caractérisés en ce qu'ils sont exprimés dans des cellules foetales de ligaments; notamment les ligaments interosseux.
to L'invention comprend en outre les polypeptides EPIL 1, EPIL 2 ou EPIL 3 codés par le gène INSL4, caractérisés en ce qu'ils sont impliqués dans le processus de différenciation, de prolifération et/ou de régénération de cellules du tissu osseux et/ou de ligaments.
Font également partie de l' invention, les polypcptides EPIL 1, EPIL 2 ou EPIL
3 codés par le gène INSI~, caractérisés en ce qu'ils sont impliqués dans le processus de développement du cartilage et/ou d'ossification de l'os en formation.
I1 doit ëtre compris que l'invention ne concerne pas les polypeptides sous forme naturelle, c'est-à-dire qu'ils ne sont pas pris dans leur environnement naturel mais qu'ils ont pu être obtenus par purification à partir de sources naturelles, ou bien obtenus par recombinaison génétique, pouvant être glycosylés ou non, ou encore obtenus par synthèse chimique et pouvant alors comporter des acides aminés non naturels ou modifiés.
L'invention est relative à l'utilisation d'un ou de plusieurs anticorps dirigés contre un polypeptide EPIL 1, EPIL 2, EPIL 3, l'un de leurs homologues ou variants ou un de leurs fragments, pour la détection, l'identification, la localisatiôn et/ou le dosage d'un polypeptide EPIL 1, EPIL 2, EPIL 3 ou l'un de leurs homologues ou variants, dans le tissu osseux et/ou dans les ligaments.
L'invention est aussi relative à l'utilisation d'un ou de plusieurs anticorps dirigés contre un polypeptide EPIL 1, EPIL 2, EPIL 3, l'un de leurs homologues ou 3o variants, ou l'un de leurs fragments pour le diagnostic de pathologies liées à

7 _ l'expression anormale de polypeptide EPIL 1, EPIL 2 et/ou EPIL 3 dans le tissu osseux et/ou dans les ligaments.
On entendra désigner comme polypcptidcs homologues dc polypeptide EPIL 1, EPIL 2 ou EPIL 3, les polypeptides présentant, par rapport auxdits polypeptidcs EPIL
s 1, EPIL 2 ou EPIL 3, certaines modifications comme en particulier une délétion, une troncation, un allongement, une fusion chimérique, et/ou une mutation, notamment ponctuelle. Parmi les polypeptides homologues, on préfcre ceux dont la séquence d'acides aminés présente au moins 80 % , de préférence 90 % , de similitude avec les séquences d'acides aminés des polypeptides selon l'invention.
to On entendra par polypeptide variant de polypepdde EPIL 1, EPIL 2 ou EPIL
3, l'ensemble des polypeptides mutés pouvant exister naturellement, en particulier chez I'être humain, et qui correspondent notamment à des troncatures, substitutions, délétions et/ou additions d'au moins un résidu d'acide aminé. Ces polypcptides variants correspondent en particulier à une expression anormale des polypcptides 15 EPIL 1, EPIL 2 ou EPIL 3.
Par fragment de polypeptide EPIL 1, EPIL 2, EPIL 3, ou d'un de leurs homologues ou variants, on entend désigner un polypeptide de séquence d'acides aminés comportant au minimun 5 acides aminés, de préférence 10 acides aminés et 15 acides aminés consécutifs desdits polypeptides.
2o Parmi les anticorps qui pourront étre utilisés pour ladite détection, identification, localisation edou ledit dosage ou pour ledit diagnostic de pathologies, on préfère les anticorps mono ou polyclonaux ou leurs fragments, anticorps chimériques, caractérisés en ce qu'ils sont capables de reconnaître spécifiquement un polypeptide EPIL 1, EPIL 2, EPIL 3, l'un de leurs homologues ou variants, ou l'un 25 de leurs fragments.
Des anticorps polyclonaux spécifiques peuvent 8tre obtenus à partir d'un sérum d'un animal immunisé contre, par exemple - un polypeptide EPIL 1, EPIL 2, EPIL 3, l'un de leurs homologues ou variants, ou l'un de leurs fragments, notamment produit par recombinaison génétique 30 ou par synthèse peptidique, selon les modes opératoires usuels, à partir d'une 8 _ séquence d'acide nucléique codant pour lesdits polypeptides ou de séquence d'acides aminés desdits polypeptides.
Les anticorps monoclon~lux spécifiques peuvent être obtenus selon la méthode classique de culture d'hybridomes décrite par Ktihlcr et Milstcin, 1975.
Lesdits anticorps sont, par exemple, des anticorps chimériques, des anticorps humanisés, des fragments Fab ou F(ab')2. Ils peuvent également, selon l'invention, se présenter sous forme d'immunoconjugués ou d'anticorps marqués afin d'obtenir un signal détectable et/ou quantifiable.
Il est bien entendu qu'on entend par l'expression ~~ plusieurs anticorps ~~
dans la 1o présente description, au moins deux anticorps de spécificité différente, c'est-à-dire capable de reconnaître et de se lier à deux épitopes ou domaines différents desdits polypeptides. Il est d'ailleurs préféré selon l'invention d'utiliser au moins deux anticorps de spécificité différente pour les procédés, Ics méthodes et les kits de l'invention qui incluent lesdits anticorps. Dans ce cas, on pourra par exemple utiliser ts doux marquages d'anticorps différents ou deux systèmes de révélation différents.
Lesdits anticorps pourront ainsi constituer un moyen d'analyse immuno-cytochimique ou immunohistochimique de l'expression desdits polypeptides sur des coupes spécifiques de tissus osseux et/ou de ligaments, par exemple par immunofluorescence, marquage à l'or, immunoconjugués enzymatiques.
2o Ils permettent notamment de mettre en évidence et de quantifier la présence spécifique normale ou anormale desdits polypeptides dans les tissus osseux et/ou de ligaments, ce qui les rend utiles pour l'identification et la localisation de l'expression de ces polypeptides, ou pour le diagnostic de pathologies liées à la présence anormale desdits polypeptides.
2s Plus généralement, lesdits anticorps peuvent 8tre avantageusement mis en oeuvre dans toute situation oll l'expression d'un desdits polypeptides doit être observée de manière qualitative et/ou quantitative dans un échantillon biologique de tissu osseux et/ou de ligaments.
Les techniques et les réactifs spécifiques permettant la détection, 30 l'identification, la localisation et/ou le dosage des complexes antigène-anticorps que l'on pauma utiliser dans les procédés de l'invention, sont bien connus de l'homme du métier et sont, par exemple, les techniques ELISA, RIA ou d'immunofluorescence pouvant être associées, dans le cas o~ les anticorps de l'invention ne sont pas déjà
immunoconjugués ou marqués, avec les réactifs appropriés tels que des anticorps immunoconjugués, marqués ~ la fluorescéïnc ou radiomarqués capables de reconnaître spécifiquement lesdits anticorps, ainsi que les substrats chromogCnes spécifiques des enzymes conjugués et les réactifs témoins de contr8lcs positif; négatif et quantitatif.
Ainsi, l'invention comprend un procédé de détection, d'identification, de localisation et/ou de dosage spécifique d'un polypeptide EPIL 1, EPIL 2 et/ou ou un de ses fragments dans un échantillon biologique de tissu osseux et/ou de ligament, ou de diagnostic de pathologies liées à la présence anormale du ou desdits polypeptides dans le tissu osseux et/ou dans les ligaments, caractérisé en ce qu'il comprend les étapes suivantes a) mise en contact dudit échantillon biologique. avec un ou plusieurs anticorps dirigés contre le ou lesdits polypeptides ;
b) mise en évidence, identification, localisation et/ou dosage du complexe antigène-anticorps formé.
L'invention comprend également un kit ou nécessaire pour la détection, l'identification, la localisation et/ou ie dosage spécifique d'un polypeptide EPIL 1, EPIL 2 et/ou EPIL 3 ou un de ses fragments dans un échantillon biologique de tissu osseux et/ou de ligaments, ou pour le diagnostic de pathologies liées à la présence anormale du ou desdits polypeptides dans ledit échantillon biologique, caractérisé en ce .qu' il comprend les éléments suivants a) un ou plusieurs anticorps dirigés contre le ou lesdits polypeptides ;
b) le cas échéant, les réactifs pour la constitution du milieu propice à la réaction immunologique ;
c) le cas échéant, les réactifs permettant la détection, l'identification et/ou le dosage des complexes antigène-anticorps produits par la réaction immunologique.
L'invention concerne également l'utilisation d'une sonde ou amorce oligonucléotidique capable de s'hybrider spécifiquement avec une séquence d'acide 3o nucléique correspondant au gène INSL4, pour la détection, l'identification, la WO 99/37780 PGT/P'R99/00137 localisation, l'amplification, et/ou le dosage de séquence d'acide nucléique correspondant au gène INSL4 dans Ie tissu osseux et/ou dans les ligaments.
L'invention comprend également l'utilisation d'une sonde ou amorce oligonucléotidique capable de s'hybrider spéci0qucment avec une séquence d'acide s nucléique correspondant au gène INSL4, pour !e diagnostic dc pathologies liées à
l'expression anormale du gène INSL4 dans le tissu osseux et/ou dans les ligaments.
On entendra désigner par -séquence d'acide nbcléique correspondant au gène INS1,4-, la séquence nucléotidique du gène INSL4 telle que définie à 1a figure 1 ou toutes séquences nucléotidiques codant pour un polypeptide homologue ou variant de 1o polypeptide EPIL 1, EPIL 2 ou EPIL 3, leur séquence complémentaire, la séquence nucléotidique de leur ARN correspondant ainsi que leurs fragments.
Lesdites sondes oIigonucléotidiques capables de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4, pourront étre marquées ou fixées sur un support solide par liaison covalente ou non, les techniques de marquage ou de fixation de telles sondes étant bien connues de l'homme de l'art.
Une hybridation spécifique signifie que l'hybridation est réalisée dans des conditions de stringence, en particulier dans des conditions de température et de force ionique telles qu'elles permettent le maintien de l'hybridation entre deux fragments d'ADN globalement complémentaires.
2o A titre ilIustratif, des conditions de forte stringence de l'étape d'hybridation aux fins de définir les séquences nucléotidiques décrites ci-dessus, sont avantageusement les suivantes.
L'hybridation est réalisée à une température préfêrentielle de 65 °C, en présence de tampon 6 x SSC, 5 x de solution de Denhardt, 0,5 % SDS et 100.
ug/ml d'ADN de sperme de saumon.
1 x SSC correspond à 0,15 M NaCI et O,OSM de citrate de sodium et une solution de 1 x Denhardt correspond à 0,02 % Ficoll, 0,02 ~ de polyvinylpyrrolidone et 0,02 % de sérum albumine bovine.
Les étapes de lavage peuvent, par exemple, être effectuées pendant 5 à 30 min.
à 65°C, dans un tampon 2 x SSC ou 1 x SSC et à 0,1 % SDS.

.WO 99/37780 PCT/FR99/00137 tt -Les conditions d'hybridation de forte stringence décrites ci-avant pour un polynucléotide de taille définie, seront adaptées par l'homme du métier pour des oligo-nucléotides de taille plus grande ou plus petite, selon l'enseignement dc Sambrook et al., 1989.
s Les sondes ou amorces oligonuctéotidiques, et dc manière générale les séquences d'acide nucléique selon l'invention, présenteront une taille minimale de 10 bases et on préférera des fragments de 20 bases, et de préférence 30 bases.
Font également partie de l'invention, !es procédés de détection, d'identification et/ou de dosage spécifique de séquence d'acide nucléique correspondant au gène to INSL4 dans un échantillon biologique de tissu osseux et/ou tic ligament, ou de diagnostic de pathologies liées à la présence anormale de ladite séquence d'acide nucléique dans ledit échantillon biologique, caractérisés en ce qu'ils comportent les étapes suivantes a) isolement de l'ADN à partir dudit échantillon biologique à analyser, ou obtention 15 d'un ADNc à partir de l'ARN dudit échantillon biologique ;
b) amplification spécifique de ladite séquence d'acide nucléique à l'aide d'au moins une amorce capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 ;
c) analyse qualitative et/ou quantitative des produits d'amplification.
2o L' invention comprend aussi les procédés de détection, d' identification et/ou de dosage spécifique de séquence d'acide nucléique correspondant au géne INSL4 dans un échantillon biologique de tissu osseux et/ou de ligament, ou de diagnostic de pathologies liées à la présence anormale de ladite séquence d'acide nucléique dans ledit échantillon biologique, caractérisés en ce qu'ils comportent les étapes suivantes 25 a) mise en contact d'une sonde oligonucléotidique capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 avec ledit échantillon biologique, l'ADN contenu dans ledit échantillon biologique ayant, le cas échéant, préalablement été rendu accessible à l'hybridation, dans des conditions permettant l'hybridation de ladite sonde à l'ADN contenu dans ledit 3o échantillon biologique ;

b) détection, identification et/ou dosage de l'hybride formé entre ladite sonde oligonucléotidique et l'ADN dudit échantillon biologique.
L'invention est relative en outre à des procédés de détection, d'identification et/ou de dosage spécifique de séquence d'acide nucléique correspondant au gène INSL4 dans un échantillon biologique dc tissu osseux et/ou dc ligament, ou dc diagnostic de pathologies liées à 1a présence anormale de ladite séquence d'acide nucléique dans ledit échantillon biologique, caractérisés en ce qu'ils comportent les étapes suivantes a) mise en contact d'une sonde oligonucléotidique immobilisée sur un support et capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4, avec ledit échantillon biologique, l'ADN de l'échantillon, ayant, le cas échéant, été préalablement amplifié à l'aide d'au moins une amorce capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 et/ou rendu accessible à l'hybridation, dans des conditions permettant l'hybridation de ladite sonde à l'ADN dudit échantillon biologique ;
b) mise en contact de l'hybride formé entre ladite sonde oligonucléotidique immobilisée sur un support et l'ADN contenu dans ledit échantillon biologique, le cas échéant apr~,'s élimination de l'ADN dudit échantillon biologique n'ayant pas hybridé
2o avec ladite sonde, avec une sonde oligonucléotidique, notamment marquée, et capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4.
Font en outre partie de Ia présente invention, les kits ou nécessaires pour la détection, l'identification et/ou le dosage spécifique de séquence d'acide nucléique correspondant au gène INSL4 dans un échantillon biologique de tissu osseux et/ou de ligament, ou pour le diagnostic de pathologies liées à la prësence anormale de ladite séquence d'acide nucléique dans ledit échantillon biologique, caractérisés en ce qu'ils comprennent les éléments suivants a) une sonde oligonucléotidique capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 ;

_ WO 99/37780 PCT/Fit99/00137 b) le cas échéant, les réactifs nécessaires à la mise en oeuvre d'une réaction d'hybridation ;
c) le cas échéant, au moins une amorce capable de s'hybrider spécifiquement avec unc séquence d'acide nucléique correspondant au géne INSL4 ainsi que les réactifs nécessaires à une réaction d'amplification de l'ADN.
L'invention comprend également les kits ou nécessaires pour la détection, l'identification et/ou le dosage spécifique de séquence d'acide nucléique correspondant au gène INSL4 dans un échantillon biologique de tissu osseux et/ou de ligament, ou pour le diagnostic de pathologies liées à la présence anormale de ladite séquence 1o d'acide nucléique dans ledit échantillon biologique, caractérisés en ce qu'ils comprennent les éléments suivants a) une sonde oligonucléotidique, dite somle de capture, pouvant étre fournie préimmobilisée sur un support, et capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gtne INSL4 ;
ls b) une sonde oligonucléotidique, dite sonde de révélation, notamment marquée, et capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 ;
c) le cas échéant, au moins une amorce capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSL4 ainsi que les réactifs 2o nécessaires à une réaction d'amplification de l'ADN.
Font aussi partie de l'invention, les procédés ou kits selon l'invention pour le diagnostic de pathologies liées à la différenciation et/ou la prolifération anormale du tissu osseux et/ou des cellules de ligaments, pour le diagnostic de pathologies liées au développement anormal du cartilage et/ou à une ossification anormale de l'os en 25 formation et/ou pour le diagnostic d'ostéoporose et/ou pour le diagnostic de dysplasies. Parmi les dysplasies, on peut citer notamment les dysplasies diaphysaires comme l'hypoplasie diaphysaire ou ostéogénèse imparfaite ou encore l'hyperplasie diaphysaire ou maladie d'Engelmann.
Dans la présente invention on entend par diagnostic de pathologies liées à la 3o différenciation edou la prolifération anormale du tissu osseux et/ou des cellules de ligaments, ou pour le diagnostic de pathologies liées au développement anormal du cartilage et/ou à une ossification anormale de l'os en formation ou encore pour le diagnostic d'ostéoporose et/ou de dysplasie, non seulement le diagnostic proprement dit de la pathologie, mais aussi le diagnostic ou pronostic d'évolution de ladite pathologie, suite par exemple à un traitement thérapeutique. Ainsi, selon l'invention, lesdits procédës ou kits peuvent être utilisés pour évaluer l'efficacité d'un traitement thérapeutique de ladite pathologie.
Les techniques d'amplification spécifique ct d'analyse qualitative ct/ou quantitative de séquence nucléique que l'on pourra utiliser dans ics procédés de l'invention, sont bien connues de l'homme du métier et sont, par exemple, les lo méthodes comprenant au moins une étape d'amplification dite par PCR
(réaction en chaire par la polymérase) ou par PCR-like de la séquence cible susceptible d'étre présente à l'aide 'd'au moins une amorce oligonucléotidique de séquence nucléique telle que définie précédemment. Les produits amplifiés pourront étre traités à
l'aide d'enzyme de restriction appropriée avant de procéder à la détection ou au dosage du produit ciblé, notamment par un procédé selon l'invention.
Par PCR-like on entendra désigner toutes les méthodes mettant en oeuvre des reproductions directes ou indirectes des séquences d'acide nucléique, ou bien dans lesquelles les systèmes de marquage ont été amplifiés. Ces techniques sont bien entendu connues. En général il s'agit de l'amplification de l'ADN par une 2o polymérase ; lorsque l'échantillon d'origine est un ARN, il convient préalablement d'effectuer une transcription réverse. Il existe actuellement de très nombreux procédés permettant cette amplification, par exemple les méthodes dites NASBA ~~
Nucleic Acid Sequence Based Amplification » (Compton, 1991), TAS ~~ Transcription based Amplification System » (Guatelli et al., 1990), LCR ~~ Ligase Chair Reaction »
2s (Landegren et al. , 1988), ~~ Endo Run Amplification » (ERA), K Cycling Probe Reaction » (CPR), et SDA ~~ Strand Displacement Amplification » (Walker et al., 1992), bien connues de l'homme du métier. Sont également connues de l'homme du métier, les techniques de quantification d'acide nucléique dans lesquelles par exemple on amplifie l'acide nucléique à quantifier par une méthode type PCR et en présence 3o d'un acide nucléique standard de m8me taille, de quantité connue et capable de s'hybrider aux mêmes amorces que l'acide nucléique cible.

Les fragments amplifiés peuvent être identifiés, par exemple après une électrophorèse en gel d'agarose ou de polyacrylamide, ou après une technique chromatographique comme la filtration sur gel ou la chromatographie échangeuse d'ions. La spécificité dc l'amplification peut être contrblée par exemple par 5 hybridation moléculaire en utilisant comme sondes les sondes telles que définies ci-dessus, notamment marquées.
L'invention comprend en outre, les méthodes de marquage de cellule de tissu osseux et/ou de ligament, notamment d'origine foetales, caractérisées en ce qu'eues comprennent les étapes suivantes lo a) mise en contact d'un échantillon biologique de tissu osseux et/ou de ligament avec un ou plusieurs anticorps dirigés contre le ou les polypeptides EPIL 1, EPIL 2 ct/ou EPIL 3, lesdits anticorps pouvant être marqués ;
b) le cas échéant, marquage desdits ànticorps à l'aide dc composés marqués capable de reconnaitre lesdits anticorps.
15 Les techniques de marquage de cellules par des anticorps spécifiques de composé de ladite cellule, saut bien connues des immunocytochimistes ou des immunohistochimistes et ne seront pas développées dans la présente description.
Sont également comprises dans la présente invention les méthodes de marquage de cellule de tissu osseux et/ou de ligament, notamment d'origine foetales, 2o caractérisées en ce qu'elles comprennent les étapes suivantes à) mise en contact d'un échantillon biologique de tissu osseux etlou de ligament avec une ou plusieurs sondes oligonucléoddiques capables de s'hybrider spécifiquement avec une séquence d'acide nucléique carrespondant au gène INSL4, lesdites sondes pouvant être marquées ;
2s b} le cas échéant, marquage desdites sondes à l'aide de composés marqués capables de reconnaître lesdites sondes.
L'invention a aussi pour objet un procédé de détection de cellule anormale de tissu osseux et/ou de ligament, caractérisé cn ce qu'il met en oeuvre une méthode de marquage selon l'invention.
3o Un autre aspect de l'invention concerne des méthodes de sélection de composé
chimique ou biochimique capable de moduler la différenciation, la régénération et/ou la prolifération de cellules humaines et/ou animales de tissu osseux et/ou de ligament, caractérisées en ce qu'elles mettent en oeuvre un polypeptide EPIL I, EPIL 2, EPIL
3, un de leurs polypeptides homologues ou variant, ou un de leurs fragments, une séquence d'acide nucléique correspondant au cène INSL4, ou une cellule de tissu s osseux ou de ligament, notamment foctale. Ladite cellule pouvant être une cellule transformée par recombinaison génétique ou sélectionnée scion l'invention.
Parmi ces méthodes, on préfère les méthodes caractérisées en ce que ledit composé sélectionné est capable d'inhiber ou de favoriser la différenciation, la régénération et/ou la prolifération de cellules humaines et/ou animales de tissu osseux 1o et/ou de ligament, notamment les cellules foctales du périchondre.
Lesdits composés pourront par exemple être sélectionnés sur leur capacité à se lier à un polypeptide EPIL 1, EPIL 2, EPIL 3, à un de leurs polypeptides homologues ou variant, ou à un de leurs fragments, et à inhiber ou favoriser l'activité
desdits polypeptides dans les tissus osseux et/ou dans les ligaments, en tant que, par exemple, 15 ligands agonistes ou antagonistes d'un récepteur spécifique desdits polypeptides sur les cellules desdits tissus.
Lesdits composés pourront être également sélectionnés sur leur capacité à se lier à une séquence d'acide nucléique correspondant au gène INSL4, et à
inhiber ou favoriser l'expression du gène codant pour lesdits polypeptides en tant qu'inducteur ou 2o répresseur.
Lesdits composés pourront également étre sélectionnés sur leur capacité à
moduler sur lesdites cellules in vitro ou in vivo, l'activité biologique desdits polypeptides exprimés par lesdites cellules, comme notamment la différenciation, la prolifération ou la régénération desdites cellules.
25 Par exemple, l'invention comprend une méthode de sélection de composés capables de se lier à un polypeptide EPIL 1, EPIL 2, EPIL 3, à un de leurs polypeptides homologues ou variants, ou à un de leurs fragments, ou encore capables de se lier à une séquence d'acide nucléique correspondant au gène INSL4, et capables de moduler l'activité desdits polypeptides dans Ies tissus osseux et/ou dans les 30 ligaments, caractérisée en ce qu'elle comprend les étapes suivantes a) mise en contact dudit composé avec ledit potypeptide ou ladite séquence d'acide nucléique ;
b) détermination de la capacité dudit composé à se lier avec ledit polypeptide ou ladite séquence d'acide nucléique ;
s c) mise en évidence de la modulation de l'activité desdits polypeptides sur des cellules de tissu osseux et/ou de ligament, susceptible d'étre obtenue avec les composés sélectionnés à l'étape b).
Il sera possible, par exemple, d'utiliser des cellules de tissu osseux et/ou de ligament transformées par recombinaison génétique ou sélectionnées selon l' invention, to à l'étape b) et/ou c) de la présente méthode.
L'invention comprend également les composés chimiques ou biochimiques, susceptibles d'être sélectionnés par une méthode selon l'invention.
Les composés susceptibles d'étre sélectionnés peuvent être des composés organiques tels que des polypeptides ou hydrates de carbone ou tous autres composés 1s déjà connus, ou des composés organiques nouveaux élaborés à partir de techniques de modélisation moléculaire et obtenus par synthèse chimique ou biochimique, ces techniques étant connues de l'homme de l'art.
L'invention a en outre pour objet des composés selon l'invention â titre de médicament, de préférence choisis parmi 2o a) un polypeptide EPIL 1, EPIL 2 ou EPIL 3, un de leurs polypeptides homologues ou variants ou un de leurs fragments, pouvant être obtenu par recombinaison génétique ou par synthèse chimique ;
b) un anticorps dirigé contre un polypeptide tel que défini en a) ;
c) un composé chimique ou biochimique, caractérisé en ce qu'il est un ligand 25 d'un polypeptide tel que défini en a) ;
d) un vecteur comprenant tout ou partie d'une séquence d'acide nucléique correspondant au gène INSL4 ;
e) un vecteur tel que défini cn d), présentant à sa surface un marqueur spécifique de cellules de tissu osseux ou de ligament cible dont on cherche à
moduler 30 l'activité ;

f) une séquence d'acide nucléique sens ou antisens capable de s'hybrider spécifiquement avec une séquence d'acide nucléique correspondant au gène INSLA.
Les fragments de polypeptide EPIL I, EPIL 2 ou EPIL 3, ou de leurs polypeptides homologues ou variants, et tels que définis en a) seront de préférence caractérisés en ce qu'ils sont biologiquements actifs.
Par fragment biologiquement actif, on entendra désigner en particulier un fragment de séquence d'acides aminés de polypepdde EPIL 1, EPIL 2 ou EPIL 3, ou de leurs polypeptides homologues ou variants présentant au moins une des activités desdits polypeptides comme notamment lo - la capacité de moduler, notamment d'inhiber ou de favoriser, la différenciation, la prolifération et/ou la régénération de cellules de tissu osseux ct/ou de ligament ; et/ou - la capacité d'étre reconnu par un anticorps spécifique d'un polypcptide EPIL
1, EPIL 2 ou EPIL 3, ou d'un de leurs polypeptides homologues ou variants.
Les polypeptides EPIL 1, EPIL 2 ou EPIL 3, leurs polypeptides homologues ou variants ou leurs fragments, recombinants pourront être obtenus à partir de méthodes bien connues de l'homme de l'art à l'aide de vecteurs de clonage et/ou d'expression contenant une séquence d'acide nucléique codant pour lesdits polypeptides et de cellules hôtes transformées par lesdits vecteurs.
2o Les polypeptides recombinants obtenus peuvent aussi bien se présenter sous forme glycosylée que non glycosylée et peuvent présenter ou non la structure tertiaire naturelle.
Ces polypeptides peuvent être produits à partir des séquences d'acide nucléique codant pour lesdits polypeptides selon les techniques de production de polypeptides recombinants connues de l'homme du métier. Dans ce cas, la séquence d'acide nucléique utilisée est placée sous le contrôle de signaux permettant son expression dans un hôte cellulaire.
Un système efficace de production d'un polypeptide recombinant nécessite de disposer d'un vecteur, par exemple d'origine plasmidique ou virale, et d'une cellule 3o hôte compatible.

.WO 99/37780 PCT/FR99/00137 L'hôte cellulaire peut être choisi parmi des systèmes procaryotes, comme les bactéries, ou eucaryotes, comme par exemple les lewres, cellules d'insectes ou de mammifères comme les cellules CHO (cellules d'ovaires de hamster chinois) ou les cellules mucines ou tout autre systc',me avantagcusGment disponible. Un hôte cellulaire s préféré pour l'expression des protéines de l'invention est constitué par les cellules d'ovaire de hamster chinois CHO, et par les cellules 3A-subE d'origine placentaire humaine.
Le vecteur doit comporter un promoteur, des signaux d'initiation et de terminaison de la traduction, ainsi que des régions appropriées de régulation de 1a 1o transcription. Il doit pouvoir être maintenu de façon stable dans la cellule et peut éventuellement posséder des signaux particuliers spécifiant la sécrétion de la protéine traduite.
Ces différents signaux de contr8le sont choisis en fonction de l'hôte cellulaire utilisé. A cet effet, les séquences d'acide nucléique peuvent être insérées dans des 15 vecteurs à réplication autonome au sein de l'hôte choisi, ou des vecteurs intégratifs de l'hôte choisi.
De tels vecteurs seront préparés selon les méthodes couramment utilisées par l'homme du métier, et les clones en résultant peuvent être introduits dans un hôte approprié par , des méthodes standards, telles que par exemple la lipofection, 20 l'électroporation, le choc thermique.
Les cellules hôtes transformées par les vecteurs précédents peuvent être obtenues par l'introduction dans ces cellules d'une séquence nucléotidique insérêe dans un vecteur tel que défini ci-dessus, puis la mise en culture desdites cellules dans des conditions permettant la réplication et/ou l'expression de la séquence nucléotidique 2s transfectée.
Parmi les cellules h8tes utilisables à ces fins, on peut citer bien entendu les cellules bactériennes (Olins et Lee, 1993), mais également les cellules de lewre (Buclcholz, 1993), de même que les cellules animales, en particulier les cultures de cellules de mammifères (Edwards et Aruffo, 1993), ct notamment les cellules d'ovaire 3o de hamster chinois (CHO), des cellules humaines telles que les cellules 3A-subE

WO 99/37780 PC'T/FR99/00137 d'origine placentaire, mais également les cellules d'insectes dans lesquelles on peut utiliser des procédés mettant en oeuvre des baculovirus par exemple (Luckow, 1993).
Les procédés de purification de polypeptide recombinant ou synthétique utilisés sont connus de l'homme du métier. Le polypeptidc recombinant ou synthétique peut 5 être purifié à partir dc méthodes utilisées individuellement ou en combinaison, telles que le fractionnement, les méthodes de chromatographie, les techniques d'immuno-affinité à l'aide d'anticorps mono ou polyclonaux spécifiques.
Une variante préférée consiste à produire un polypeptidc recombinant fusionné
à une protéine ~~porteus~~~ (protéine conjuguée). L'avantage de ce système est qu'il to permet une stabilisation et une diminution de la protéolysc du produit recombinant, une augmentation de la solubilité au cours de la renaturation in vitro et/ou une simplification de la purification lorsque le partenaire de fusion possède une affinité
pour un ligand spécifique.
Les polypeptides EPIL 1, EPIL 2 ou EPIL 3, leurs polypeptides homologues 1s ou variants ou leurs fragments peuvent étre également obtenus par synthèse chimique.
Les polypeptides obtenus par synthèse chimique pourront comporter des acides aminés non naturels.
Parmi lesdits composés sélectionnés à titre de médicament, on peut citer en particulier les oligonucléotides antisens, c'est-it-dire dont la structure assure, par 2o hybridation avec la séquence cible, une inhibition de E'expression du produit cornspondant. Il faut également citer les oligonucléotides sens qui, par interaction avec des protéines impliquées dans la régulation de l'expression du gène INSL4, induiront soit une inhibition, soit une activation de cette expression.
L' invention concerne des composés selon l' invention, destinés au traitement de 2s pathologies liées à la différenciation et/ou la prolifération anormale du tissu osseux et/ou des cellules de ligaments, notamment de pathologies liées au développement anormal du cartilage et/ou à une ossification anormale de l'os en formation, en particulier destinés au traitement de L'ostéoporose ot/ou de dysplasie.
Parmi lesdites dysplasies, on préfère notamment les dysplasies diaphysaires 3o comme L'hypoplasie diaphysaire ou ostéogénèse imparfaite et l'hyperplasie diaphysaire ou maladie d'Engelmann.

L'invention a enfin pour objet des composés selon l'invention, destinés au traitement de pathologies impliquant à la régénération de tissu osseux et/ou de ligament, en particulier au traitement visant ~ réparer des lésions du tissu osseux et/ou de ligaments suite à un choc traumatique.
Les composés de l'invention en tant que principes actifs de médicament, seront préférentiellement sous forme soluble, associés à un véhicule pharmaceutiquement acceptable.
De préférence, ces composés seront administrés par voie systémique, en particulier par voie intraveineuse, par voie intramusculaire, intradermique ou par voie orale.
Leurs modes d'administration, posologies et formes galéniques optimaux peuvent être déterminés selon les critères généralement pris en compte dans l'établissement d'un traitement adapté à un patient comme par exemple l'~ge ou le poids corporel du parlent, la gravité de son état général, la tolérance au traitement et les effets secondaires constatés, etc.
On peut également pallier de façon générale la carence ou la surexpression de polypeptides selon l'invention par une thérapie dite ~~de remplacement~~
permettant l'amplification ou la diminution des activités desdits polypeptides.
La thérapie de remplacement pourra ëtre effectuée par thérapie génique, c'est-2o à-dire en introduisant les séquences d'acide nucléique selon l'invention et/ou les gènes correspondants avec les éléments qui permettent leur expression in vivo, dans le cas od l'un des gènes est insuffisamment exprimé par exemple, ou bien lorsqu'il est exprimé sous une forme anormale.
Les principes de la thérapie génique sont connus. On peut utiliser des vecteurs viraux, par exemple sur la base des adénovirus (Perricaudet et al., 1992), des AAV, Adenovirus Associated Virus (Carter, 1993), des rétrovirus (Temin, 1986), des poxvirus ou des virus herpès (Epstein et al., 1992). La plupart du temps ces virus sont utilisés sous forme défective et, de façon générale, avec ou sans intégration dans le génome cellulaire. Il est également possible de prévoir des vecteurs non viraux, c'est-3o à-dire synthétiques, qui miment des séquences virales ou bien qui sont constitués par WO 99137780 PCT/FR99/0013'i de l'ADN ou de l'ARN nu selon la tectuûque développée notamment par ta société
VICAL.
Dans la plupart des cas, il faudra prévoir des éléments tic ciblage assurant une expression spécifique de façon ~ pouvoir limiter les zones d'expression des s golypeptides. Il est méme intéressant, dans certains cas, d'avoir des vecteurs d'expression transitoire ou au moins d'expression contr0lée que l'on pourra bloquer lorsque cela sera nécessaire.
Les composés selon l'invention utilisables à titre de médicament offrent une nouvelle approche pour le traitement de maladies liées à la différenciation ou à la lo prolifération non régulëe de cellules ou tissus osseux et/ou de ligaments ou à l'absence ou à l'insuffisance de certaines cellules de tissus osseux et/ou de ligaments, suite par exemple à un traumatisme.
D'autres caractéristiques ct avantages de l'invention apparaissent dans la suite de la description avec les exemptes et les figures dont les légendes sont représentées ts ci-aprts.
Légende des Figures Figure 1 : Séquence d'acide nucléique de l'ADNc du gène INSL4 et séquence d'acides aminés du potypeptide EPIL codé par cette séquence.
Figures 2A, 2B, 2C, 2D, 2E, 2F : Comparaison de la distribution de l'ARNm 2o d'INSL4 et d'IGF-II dans le placenta humain âgé de 14 semaines ;
- observation sur fond clair (figure 2A) et sur fond noir (figure 2B} d'une même coupe de tissu hybridée avec une sonde INSLA antisens ;
- agrandissement de la coupe précédente observée sur fond clair (figure 2C) ;
- observation sur fond clair (figure 2D} et sur fond noir (figure 2E) d'une même 2s coupe de tissu hybridée avec une sonde IGF-II antisens ;
- agrandissement de la coupe précédente observée sur fond clair (figure 2F) ;
s : syncytiotrophoblaste ; c : cytotrophoblaste ; m : mésenchyme ;
la barre d'échelle représente 29s ~,m pour figures 2A, 2B, 2D et 2E, et représente 15 ~cm pour figures 2C et 2D.
3o Figures 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H : Distribution cellulaire de l'AIZNm d'IGF-II dans des embryons humains âgés de~ 25 jours (figures 3A et 3B), 30 jours (figures 3C, 3D, 3E et 3F) ou 45 jours (figures 3G et 3H) obtenue par hybridation in situ à l'aide d'une sonde oligonucléotidique marquée au "S:
Microphotographies sur fond clair (panel de gauche) et sur fond noir (panel de droite) d'une mëme coupe de tissu - coupe axiale (figures 3A et 3B) au niveau du ~rhombencéphaie~ ; nt : tube ncurat ;
ov : vésicule otique ;
- coupe abdominale longitudinale (figures 3C et 3D) ; nt : tube neural ; m mésonéphron ;
- coupe sagitale au niveau des arcs branchiaux (ba) (figures 3E et 3F) ;
to - coupe longitudinale du corps vertébral (vb) (figures 3G et 3H) ;
la barre d'échelle représente 295 ~m pour figures 3A, 3B, 3C et 3D, et représente 150 ~cm pour tous les autres panels.
Figures 4A, AB, 4C, 4D, 4E et 4F : Hybridation in situ effectuée avec une sonde oligonucléotidique d'INSL4 sur un foetus humain âgé de 8 semaines.
t5 Microphotographies sur fond clair (panel de gauche) et fond noir (panel de droite) d'une même coupe de tissu - coupe de la partie distale du fémur dans l'articulation développée de la hanche (figures 4A et 4B) au niveau du ~~rhombencéphale~ ; f : fémur; 1 : ligament ;
- coupe longitudinale du rachis (figures 4C et 4D) ;
20 l'ARNm d'INSL4 est localisé dans les disques inter-vertébraux, dans les ligaments intervertébraux ; vb :corps vertébral ; 1 : ligament ;
- coupe transversale de c8te (Figure 4E et 4F) ; pc : périchondre ; r : c8te ;
la barre d'échelle représente 295 ~m pour figures 4A, 4B, 4C et 4D, et représente 150 ~m pour figures 4E et 4F.
EXEMPLES
Matériels et méthodes A) Sujets expérimentaux 3o Des embryons morphologiquement normaux âgés de trois à huit semaines (après owlation) ont été obtenus après avortement légal par la mifepristone (RU 486) à l'HBpital Broussais à Paris. Une complète indépendance a été respectée entre la direction médicale de l'h8pital et le groupe de recherche. Le consentement maternel n'a jamais été demandé avant que l'avortement ait été décidé et réalisé. Lc consentement a été obtenu aprCS explication de l'objectif de recherche et seulement s après que l'avortement médical ait été effectué. Cette procédure est approuvée par le Comité Ethique de l'H6pital des Enfants Malades de Neckcr (Paris). Les embryons ont été séparés du trophoblaste par dissection sous microscope. Lc stade de développement de chacun des embryons a été estimé en utilisant ia classification de Carnegie établie par O'Rahilly (R. O'Rahilly et al., 1987 et 1994). Les embryons lo microdisséqués ont été congelés et conservés à - 80°C. Des cryocoupes (I2 p,m) ont été montés sur des lames prétraitées (lames Probon Plus, Microm France). Les coupes ont été fixées pendant 30 minutes dans une solution de para-formaldéhyde en tampon phosphate 0,1 M (pH 7,4), rincées une fois en PBS (tampon phosphate salin) et brièvement dans de l'eau, puis déshydratées avec une série de solution d'éthanol à
ts différentes concentrations (50 %, 75 %, 95 96). Les coupes ont été ensuite séchées à
l'air ct conservées à - 80°C afin de préserver l'ARNm.
B) Sonde d' hybridation Des sondes oligonucléotidiques de 60-mer ont été synthétisées et purifeées 20 (DNAgency, Malvern, PA). Elles ont été marquées en 3' avec [a"S]dATP (NEN, Boston, MA) en utilisant une désoxyribonucléotidyle terminale transférase (Gibco BRL, Grand Island, N~ à une activité spécifique d'environ 7 x 10°
cpm/mg. Les sondes oligonucléotidiques ont été purifiées sur colonnes Biospin (Bio-Rad Laboratories, Hercules, CA) avant utilisation. La séquence de la sonde INSL4 2s antisens est la suivante (SEQ ID N° 2) 5'-CTGGGGTGGTGGTGAATGTCTTCTCAGGCATGGGGCAATATGACAGCAA
GTGTTTTCCAA-3', localisée sur l'exon 1. La séquence de la sonde IGF-û antisens est la suivante (SEQ ID N° 3) 5'-AGCCAATCGATTTTGTACATGTTTGAAGATGCTGCTGTGCTTCCTCAGCC
30 CGATGG AGGG-3', localisée sur l'exon 7 dans la région codante commune des ARNm de fIGF-II. Des sondes sens ont été utilisées comme témoin.

C) Hybridation in situ Le protocoie expérimental (M. Abitbot et al., 1993, et M. Gerard et al., 1995) inclut une étape d'hybridation utilisant une solution contenant 50 R6 de formamide, 4 x SSC (solution standard dc citrate salin), 1 x solution de Denhardt, 0,25 mg/ml s d'ARNt de levure, 0,25 mg/ml de sperme de hareng, 0,25 mg/ml dc poly-A, 10 3~ dc sulfate dextran, 100 mM de dithiothreitol (DTT) et une sonde marquée [ "S)dATP
d'activité spécifque de 6 x lOb cpm/ml. 100 ~cl de la solution d'hybridation a été
déposée sur chacune des coupes. Puis les sections ont été recouvertes avec un parafilm et incubées dans une chambre humide à 43°C pendant 20 heures. Après hybridation, ~o les lames ont été lavées deux fois dans 1 x SSC contenant 10 mM DTT pendant minutes à 55°, et deux fois dans une solution de 0,5 x SSC contenant 10 mM DTT
~ pendant 15 minutes à température ambiante. Les coupes ont été ensuite plongées dans l'eau, déshydratées avec une série de solutions d'éthanol de différentes concentrations puis exposées pendant une semaine sur des films à rayon X Amersham Hyperfilm 15 Betamax et dans une émulsion photographique Kodak NTB2 (Eastmman Kodak, Rochester, NY) pendant un à deux mois à 4°C. Les coupes ont ensuite été
développées et marquées avec du bleu toluidine. Les résultats sont analysés par microscopie à contraste de phase.
2o Exemple 1 : Hybridation in situ de membranes nlacentaj,~ et foetale~
Afin de démontrer la spécificité des sondes oligonucléotidiques, une analyse par Northern blot a été réalisée avec 12 p,g d' ARN total issus de tissus de trophoblaste. Les transcrits d'INSL4 ont été détectés à une taille de 0,7 kilobase (kb) avec à la fois les sondes oligonucléotidiques et une sonde d'ADNc, en accord avec la 25 taille du transcrit d'INSL4 publié par Chassie et al. (1995). Pour le gène IGF-II un transcrit majeur de 6,0 kilobases et d'autres transcrits de 2 à 5 kilobases ont été
détectés, confirmant les résultats de Han et al. (1988), qui a identifié des transcrits multiples d'IGF-II avec des tailles estimées de 1,8, 2,0, 2,8, 3,0, 4,0, 4,8 et 6,2 kb, le dernier étant le plus abondant. Ces résultats montrent la spécificité des oligomers 3o d'INSL4 et d'IGF-II qui ont été choisis respectivement pour les ARNm d'INS1,4 et d'IGF-II humains. L'hybridation in situ effectuée avec des oligonucléotides sens d'INSL.4 et d'IGF-II génère seulement des grains diffus correspondant au bruit de fond, démontrant ainsi la spécificité de l'hybridation positive obtenue avec des oligonucléotides antisens.
Un niveau faible d'expression du géne INSL4 a été détecté à partir de placenta s précoce âgé de 25 jours et un niveau abondant d'ARNm d'INSL4 a été identifié
à
partir de placenta âgé de 14 semaines. Le gène INSL4 est exprimé dans les syncytiotrophoblastes et de manière moins abondante dans les cytotrophoblastcs. Lcs cellules de la partie centrale du mésoderme villeux et les cellules de cordon ombilical expriment encore plus faiblement le gène INSL4 (figures 2A, 2B et 2C). Aucun signal lo n'a été détecté ni dans l'amnion ni dans le sac vitellin (résultats non représentés).
L'ARNm d'IGF II a été exprimé en quantité abondante dans les colonnes de trophoblastes intermédiaires et dans le stroma villeux à 20 jours et 14 semaines de dévelop~ment, mais n'est pas détectable dans les coupes de syncytiotrophoblastes (figures 2D, 2r~et 2F). Dans les membranes foetales (20 jours), d'abondantes quantités 1s d'ARNm d'IGF II ont été identifiées dans les cellules damnions et les collules externes du sac vitellin (résultats non représentés). Ces résultats sont résumés dans le tableau I ci-après.

TABLEAU I : Distribution de t'ARNm d'INSL4 et d'IGF II dans le placenta et les membranes foetales humains Type de Cellules ARNm d'INSL4 ARNm d'IGF-II

Pl t aen a + + + + Ng, Syncytiotrophoblastes Cytotrophoblastes + + + +

Stroma villeux + + + +

Trophoblastes Intermdiaires + + + + +

membranes faetales Cellules de + Nd Cordon ombilical Amnion Ng. + + + +

Sac vitellin ~ Ng. ~ + + + +

s Légende du Tableau 1 Nd : non déterminé ; Nég. : signal d'hybridation négatif ; + : signal d'hybridation faible ; + + : signal d'hybridation modéré ; + + + : signal d'hybridation fort ;
+ + + + : signal d'hybridation très fort ; ies signaux sont observés après 6 semaines d'exposition.
Le gène INSL4 est exprimé de manière plus importante dans Ies syncytiotrophoblastes que dans les cytotrophoblastes. Ces résultats sont confirmés par la technique RT-PCR (amplification par réaction en chaîne à la polymérase en utilisant la transcriptase inverse) effectuée sur l'ARN total de cellules de syncytiotrophoblaste ts et de cytotrophoblaste (D. Bellet et al., 1997). L'ARNm d'IGF ll est, de manière significative, plus abondante que l'ARNm d'INSL4 dans les coupes adjacentes testées avec la sonde oligonucléotidique d'INSL4. L'expression du gène IGF II dans le placenta d'embryon humain âgé de 25 à 40 jours et de 14 semaines est localisée dans les cellules de la parle centrale du mésoderme villeux et dans les cellules de cytotrophoblaste intermédiaire ou villeux. Les transcrits d'IGF II ne sont pas détectés dans la couche syncytiotrophoblastique pour les étapes de développement étudiées.
Des observations similaires ont été reportées par exemple par V.K.M. Han (V.K.M.
Han et al., 1996). Ainsi, il est probable que ces deux g~nes jouent un r8le différent dans le développement du trophoblaste.
Exemple 2 : Hybridation in situ de tissus embrvon_~A~rec Aucune sonde oligonucléotidiquc marquée d'INSL4 n'a été détectée dans les tissus embryonnaires âgés de 20 ou 30 jours, suggérant que le gène INSL4 n'est pas lo exprimé à cette étape précoce ou que le niveau de transcrit est trop faible pour étre détecté par hybridation in situ. Par opposition, le gène IGF ll a été
fortement exprimé
à cette étape embryonnaire précoce. L'expression du gène IGF ll a été mise en évidence dans plusieurs tissus dérivés du mésoderme et de l'endoderme (figures 3A à
3H), résultats concordants avec ceux précédemment décrits (V.K.M. Han et al., ls 1987a et 1987b, J.E. Lee et al., 1990). Le site majeur de l'expression de l'IGF II est localisé dans le foie pour toutes les étapes étudiées.
Les coupes de tissus foetaux âgés de 8 semaines ont été également hybridés en utilisant les sondes oligo-nucléotidiques d'INSL4. De manière surprenante, l'ARNm d'INSL4 montre une distribution spatiale spécifique. En effet, 1a majorité des transcrits 2o d'INS1.4 sont localisés dans le périchondre des quatre membres, des c8tes et des vertèbres. De plus, l'ARNm d'INSL4 est trés abondant dans les ligaments interosseux (figures 4A à 4F). Par opposition, aucun marquage n'a été détecté dans le foie, les poumons, le coeur, le thymus, l'estomac, le muscle ou les intestins à ce stade de développement. Le tableau û ci-après résume les résultats en accord avec les types de 25 cellules identifiées dans les coupes de tissus foetaux testés.

WO 99137780 PC'T/FR99/00137 -TABLEAU II . Distribution de I'ARNm d'INSL4 et d'IGF II dans les tisssus embryonnaires (âgés de 25, 30 et 45 jours pour l'IGF II et de 8 semaines pour l'INSU
Tissus Embryonnaires ARNm d'INSL4 AItIYm d'IGF-ll Mninges Ng. + +

Prominence mandibulaire Ng. ++

Arcs branchiaux Ng. + +

Thymus Ng. Nd Arcs aortiques Ng. +

Cacur Ng. +

Moelle osseuse Ng. Nd Poumon Ng, .+.

Foie Ng. + + +

Estomac Ng. Nd Pancras Ng. Nd Intestins Ng. Nd Glandes surrnales Ng. + +

Mtanphros , Ng. + +

Sclrotome Ng, +

Prichondre + + + +

Ligaments + + Nd Muscles squelettiques Ng. + +

Epiderme Ng. Ng.

Légende du Tableau II
Nd : non déterminé ; Nég. : signal d'hybridation négatif ; + : signal d'hybridation faible ; + + : signal d' hybridation modéré ; + + + : signal d' hybridation fort ;
+ + + + : signal d'hybridation trZs fort ; les signaux sont observés après 6 semaines lo d'exposition.

Les coupes de tissus embryonnaires hybridés avec les mêmes sondes oligonucléotidiques d'INSL4 et d'IGF ll montrent qu'au contraire des transcrits d'IGF
II, qui sont localisés dans la plupart des tissus embryonnaires (V.R.K. Han et al., 1987a et 1987b ; J.E. Lec et al., 1990), lc gène INSL4 est exprimé seulement dans 5 quelques-uns de ces tissus. En effet, dans les coupes de tissu d'embryon humain âgé
de 8 semaines, les transcrits d'INSL4 ne sont localisés que dans les cellules du périchondre et des ligaments. A cc stade de développement, la chondrification est commencée pour tous les os des membres inférieurs.
Il est remarquable que le gène INSL4 soit un membre de la superfamille des 10 gènes apparentés à l'insuline et que d'autres membres de cette famille codent pour des polypeptides régulateurs à la fois de la croissance et du développement dans de nombreux tissus. En particulier, les facteurs de croissance apparentés à
l'insuline (IGFs) jouent un r8le important dans la régulation de la formation des os (B.
Bhaumic et al., 1993 ; R. Malpe et al., 1997, et S. Mohan et al., 1991). Dans ce contexte, 1s l'expression spécifique du gène INSl,4 au cours du développement embryonnaire chez l'homme, à la fois sur le plan chronologique et sur le plan de sa distribution tissulaire hautement restrictive dans l'embryon, suggère fortement que ce gène est très certainement impliqué dans différents stades de développement de l'os en formation et des ligaments.

Bibliog_ra_phie ~ Abitbol M., et al., 1993, Nucleus basalis magnocellularis and hippocampus are the major sites of FMR-1 expression during humas embryonic development, a preliminary report. C R Acad. Sci. Paris 318 : 57-66.
~ Adham, LM. et al., (1993), J. Biol. Chem. 268 : 26668-26672.
~ Haker J., et al. 1993, Role of insulin-litre growth factors in embryonic and postnatal growth. Cell. 75 : 73-82.
~ Bellet D., et al., 1997, Identification of pro-EPIL and EPIL peptides translated from insulin-litre 4 (INSL-4) mRNA in humas placenta. 1. Clin. Endocrinol to Metab.82:3169-3172.
~ Bhaumic B., 1993, Insulin-litre growth factor (IGF) binding proteins and insulin-like growth factor secretion by cultured chondrocyte cells . identification, characteri-zation and ontogeny during cell differentiation. Regularoty Peptides 48 113-122.
~ Bogie, L.V. et al., {1995), J. Clin. Endocrinol. Metab. 80 : 130-137.
~ Buckholz, R.G., (1993), Curr. Op. Biotechnology 4 : 538-542.
~ Burn J., et al., 1995, Humas embryo use in dcvelopmental research. Nature Genet. 11 : 3-6.
~ Carter, B.J., (1993), Curr. Op. Biotechnology 3 : 533-539.
~ Chassin D., et al., 1995, Cloning of a new member of the insulin gene superfamily (INSL4) expressed in humas placenta. Genomics 29 : 465-470.
~ Compton, J. et al., (1991), Nature, 350 : 91-92.
~ De Chiara 'TM., et al., 1990, A growth-deficiency phenotype in heterozygous mice carrying an insulin-litre growth factor û gene disrupted by targeting.
Nature 2s 345:78-80.
~ Edwards, C.P. et al., (1993), Curr. Op. Biotechnology 4 : 558-563.
~ Epstein, A., (1992), Médecine/Sciences 8 : 902-911.
~ Gérard M., et al., 1995, Pax-Genes expression during humas embryonic development, a preliminary report. Compte Rendu Acad. Sci. Paris 318 : 57-66.
~ Guatelli J.C. et al., (1990), Proc. Natl. Acad. Sci., USA, 87 : 1874-1878.

WO 99/37780 PCT/FR99/00137~

~ Han VKM, et al., 1987a, Identification of somatomedin/insulin-litre growth factor immunoreactive tells in the human fetus. Pediatrics Research 22 : 245-249.
~ Han VKM, et at., 1987b, Cellular localization of sommatomedin (insulin-litre growth factor) messenger RNA in the human fetus. Science 236 : 193-197.
s ~ Han VKM, et al., 1988, Expression of sommatomcdin (Insulin-litre growth factor) messengcr ribonucleic acids in the human fetus : identification, characterization, and tissue distribution. J. Clin. Endocrinol. Metab. 66 : 422-429.
~ Han VKM, et al., 1996, The expression of insulin-litre growth factors (IGF) and IGF-binding protein (IGFBP) genes in the human placenta at the feto-maternai 1o interface. J. Clin. Endocrinol Metab. 81 : 2680-2693.
~ Hansell DJ, et al., 1991, Expression of the human relaxin H1 Bene in the dccidua, trophoblast, and prostate. J. Clin. Endocrinol. Metab. 72 : 899-904.
~ Kbhler et Milstein, (1975), Nature 256, 495-497.
~ Landegren, U. et al., (1988), Science 241 : 1077-1080.
ts ~ Lee JE, et al., 1990, Pattern of the insulin-litre growth factor II gent expression during early moule embryogenesis. Development 110 : 151-159.
~ Le Roith D., 1997, Insulin-litre growth factors. N. Engl. J. Med. 336 : 633-640.
~ Liu 7P, et al., 1993, Mice carrying pull mutations of the genes encoding insulin-Iike growth factor I (Igf I and type 1 IGF receptor (Igflr). Cell. 75 : 59-72.
20 ~ Malpe R., 1997, Insulin-litre growth factor (IGF)-I, -û, IGF binding proteins (IGFBP~3, -4, and -5 levels in the conditioned media of normal human boue tells are skeletal site-dependant. J. Bone Minerai Res. 12 : 423-430.
~ Mohan S., et al., 1991, Bone growth factors. Clin. Orthop. Rel. Res. 263 :
30-48.
~ Olins, P.O., and Lee, (1993), Curr. Op. Biotechnology 4 : 520-525.
25 ~ 0'Rahilly R., et al., 1987, Developmental stages in human embryos including a revision of Streeter's 'Horizons', and a survey of the Carnegie collection.
Canergie Institution of Washington, publication N° 637:
~ O'Rahilly R., et al., 1994, The Embryonic Human Brain, An Atlas of Developmental Stages. Wiley-Liss, Inc., New York.

~ Ottolenghi C., et al., 1997, Genetic homology and divergence between mouse and humans : specific and gencral implications. TIG in press.
~ Perricaudet, M. et al. ,(1992), La Recherche 23 : 471-473.
~ Sambrook, J., et al., 1989, In Molecular Cloning : A Laboratory Manual. Cold s Spring Harbor, NY : Cold Spring Harbor Laboratory Press.
~ Strachan T., et al., 1997, A new dimension for the human genome project towards comprehensive expression maps. Nature Genet. 16 : 126-132.
~ Tashima LS, et al., 1995, The human leydig insulin-like (hLEY I-L) Bene is expressed in the corpus luteum and trophoblast. J. Clin. Endocrinol Metab. 80 l0 707-710.
~ Walker, G.T. et al., (1992), Nucleic Acids Res. 20 : 1691-1696.

LISTE DE SÉQUENCES
(1) INFORMATIONS GÉNÉRALES:
(i) DÉPOSANT:
(A) NOM: INSTITUT GUSTAVE-ROUSSY
(B) RUE: 39 RUE CAMILLE DESMOULINS
(C) VILLE: VILLEJUIF
( E ) PAYS : FRANCE
(F) CODE POSTAL: 94800 (ü ) TITRE DE L' INVENTION: NOUVELLE PROTÉINE DÉNOMMÉE EPIL/PLACENTIN, PROCÉDÉ DE PRÉPARATION DE CETTE PROTÉINE ET COMPOSITION
PHARMACEUTIQUE LA CONTENANT, ADN CODANT POUR LADITE
PROTÉINE
(iii) NOMBRE DE SÉQUENCES: 3 (iv) FORME DÉCHIFFRABLE PAR ORDINATEUR:
(A) TYPE DE SUPPORT: Floppy disk (8) ORDINATEUR: IBM PC compatible (C) SYSTEME D' EXPLOITATION: PC-DOS/MS-DOS
(D) LOGICIEL: PatentIn Release #1.0, Version #1.30 (OEB) (2) INFORMATIONS POUR LA SEQ ID NO: 1:
(i) CARACTÉRISTIQUES DE LA SÉQUENCE:
(A) LONGUEUR: 618 paires de bases (B) TYPE: nuclbotide (C) NOMBRE DE BRINS: simple (D) CONFIGURATION: linéaire (ü ) TYPE DE MOLÉCULE: ADNc (ix) CARACTÉRISTIQUE:
(A) NOM/CLE: CDS
(B) EMPLACEMENT:107..523 (xi) DESCRIPTION DE LA SÉQUENCE: SEQ ID NO: l:

Met Ala Ser Leu Phe Arg Ser Tyr Leu Pro Ala Ile Trp Leu Leu Leu Ser Gln Leu WO 99/3778b PCf/FR99/00137 Leu Glu Ser Leu AlaGlu Leu Gly Gly Arg Phe Arg Ala Arg Cys Pro AAA TCA GAG ACA

Gly His Leu Leu TyrCys ProMetPro Lys Phe Thr Lys Ser Glu Thr ACC TGG CGT AAA

Thr Pro Gly Gly LeuLeu GluSerGly Pro Glu Met Thr Trp Arg Lys TCA AAC TTA ACG

Val Thr Ser Asn LysAsp GlyGlnAla Gly Thr Ser Ser Asn Leu Thr TTC TTG AAA CTG

Glu Ile Pro Asn SerPro GluLeuLys Pro Ser Glu Phe Leu Lys Leu CAG AAG CGC AAG

Gly Pro Ser Leu LysIle IleLeuSer Lys Arg Ser Gln Lys Arg Lys CGT GAT GTA TGT

Gly His Arg Phe ProPhe CysCysGlu Ile Asp Asp Arg Asp Val Cys ACT TTA ATCAT GGACATCTCA

Gly Ser Val Lys CysThr Thr Leu TATGTATTCT CCCAATTAAA
CAATGACAAA T

(2) INFORMATIONS POUR LA SEQ ID N0: 2:
(i) CARACTÉRISTIQUES DE LA SÉQUENCE:
(A) LONGUEUR: 60 paires de bases (B) TYPE: nucléotide (C) NOMBRE DE BRINS: simple (D) CONFIGURATION: linéaire (ü ) TYPE DE MOLÉCULE: ADNc (ix) CARACTÉRISTIQUE:
(A) NOM/CLE: sonde INSL4 antisens (xi) DESCRIPTION DE LA SÉQUENCE: SEQ ID NO: 2:

(2) INFORMATIONS POUR LA SEQ ID NO: 3:
(i) CARACTÉRISTIQUES DE LA SÉQUENCE:
(A) LONGUEUR: 60 paires de bases (8) TYPE: nucléotide (C) NOMBRE DE BRINS: simple (D) CONFIGURATION: linéaire (ü ) TYPE DE MOLÉCULE: ADNc (ix) CARACTÉRISTIQUE:
(A) NOM/CLE: sonde IGF-II antisens (xi) DESCRIPTION DE LA SÉQUENCE: SEQ ID NO: 3: 5 regions A, B and C of global amino acid sequence chosen from the sequences amino acids between positions 18 and 139, ends included;
of the amino acid sequence defined in FIG. 1, said global sequence comprising at minus the amino acid sequence between positions 24 and 139, ends included, said EPIL 1 polypeptide possibly further comprising a peptide signal from to such that the amino acid sequence of the EPIL 1 polypeptide including the signal peptide is the sequence between positions 1 and 139, ends included, of the amino acid sequence defined in Figure 1.
In the present invention is meant to designate by polypcptide EPIL 2, a polypeptide encoded by the INSL4 gene, consisting t5 a) of a chain A whose amino acid sequence is the sequence included between positions 115 and 139, inclusive ends of the acid sequence amines defined in Figure 1;
b) a chain B whose amino acid sequence is chosen from a sequence between positions 18 and 58, ends included, of the sequence 2o of amino acids defined in FIG. 1, said sequence comprising at least the sequence between positions 24 and 53, ends included;
said EPIL 2 polypeptide can also comprise a signal peptide amino acid sequence chosen from a sequence between positions 1 and 23, ends included, of the amino acid sequence defined in FIG. 1, said 25 signal peptide sequence comprising at least the sequence between the positions 1 and 17, ends included.
In the present invention, the expression EPIL 3 polypeptide is intended to denote a potypeptide encoded by the INSL4 gene, consisting of a C chain whose sequence of amino acids is chosen from a sequence between positions 54 and 114, 30 ends included, of the amino acid sequence defined in FIG. 1, said G
sequence comprising at least the sequence between positions 59 and 114, ends included.
The term “bone tissue” is intended to denote, in the present description, the tissues preferentially making up long, short or flat cartilaginous bones.
The invention also relates to the polypcptides according to the invention, characterized in that the fetal cells of the bone tissue are cells of the perichondrc.
The subject of the invention is also the EPIL 1, EPIL 2 or EPIL 3 polypeptides.
encoded by the INSL4 gene, characterized in that they are expressed in cells ligament fetuses; especially the interosseous ligaments.
to The invention further comprises the EPIL 1, EPIL 2 or EPIL 3 polypeptides encoded by the INSL4 gene, characterized in that they are involved in the process of differentiation, proliferation and / or regeneration of tissue cells bony and / or ligaments.
Also forming part of the invention, the polypcptides EPIL 1, EPIL 2 or EPIL
3 encoded by the INSI ~ gene, characterized in that they are involved in the process of cartilage development and / or ossification of the bone in formation.
It should be understood that the invention does not relate to the polypeptides under natural form, that is, they are not caught in their environment natural but that they could have been obtained by purification from sources natural, or obtained by genetic recombination, which may or may not be glycosylated, or else obtained by chemical synthesis and which can then contain non-amino acids natural or modified.
The invention relates to the use of one or more antibodies directed against an EPIL 1, EPIL 2, EPIL 3 polypeptide, one of their counterparts or variants or one of their fragments, for detection, identification, localization and / or the assay of an EPIL 1, EPIL 2, EPIL 3 polypeptide or one of their counterparts or variants, in bone tissue and / or in ligaments.
The invention also relates to the use of one or more antibodies raised against an EPIL 1, EPIL 2, EPIL 3 polypeptide, one of their counterparts or 3o variants, or one of their fragments for the diagnosis of pathologies linked to 7 _ abnormal expression of EPIL 1, EPIL 2 and / or EPIL 3 polypeptide in tissue bone and / or ligaments.
We will hear designate as polypptides homologs of the EPIL 1 polypeptide, EPIL 2 or EPIL 3, the polypeptides having, with respect to said EPIL polypeptides s 1, EPIL 2 or EPIL 3, certain modifications such as in particular a deletion, a truncation, elongation, chimeric fusion, and / or mutation, especially punctual. Among the homologous polypeptides, those of which the sequence amino acids with at least 80%, preferably 90%, similarity with the amino acid sequences of the polypeptides according to the invention.
to The term polypeptide variant of polypepdde EPIL 1, EPIL 2 or EPIL
3, all of the mutated polypeptides possibly existing naturally, in particular in humans, and which correspond in particular to truncations, substitutions, deletions and / or additions of at least one amino acid residue. These polypcptides variants correspond in particular to an abnormal expression of polypcptides 15 EPIL 1, EPIL 2 or EPIL 3.
By fragment of polypeptide EPIL 1, EPIL 2, EPIL 3, or one of their homologs or variants, it is intended to denote an acid sequence polypeptide amino acids comprising at least 5 amino acids, preferably 10 amino acids and 15 consecutive amino acids of said polypeptides.
2. Among the antibodies which could be used for said detection, identification, location or said dosage or for said diagnosis of pathologies, mono or polyclonal antibodies or their fragments, antibodies are preferred chimerical, characterized in that they are able to recognize specifically a EPIL 1, EPIL 2, EPIL 3 polypeptide, one of their homologs or variants, or Mon 25 of their fragments.
Specific polyclonal antibodies can be obtained from a serum of an animal immunized against, for example - an EPIL 1, EPIL 2, EPIL 3 polypeptide, one of their counterparts or variants, or one of their fragments, in particular produced by recombination genetic Or by peptide synthesis, according to the usual procedures, from of a 8 _ nucleic acid sequence encoding said polypeptides or sequence acids amines of said polypeptides.
Monoclon ~ lux specific antibodies can be obtained by the method classic hybridoma culture described by Ktihlcr and Milstcin, 1975.
Said antibodies are, for example, chimeric antibodies, antibodies humanized, Fab or F (ab ') fragments 2. They can also, depending on the invention present in the form of immunoconjugates or labeled antibodies in order to obtain a detectable and / or quantifiable signal.
It is understood that the expression ~~ means several antibodies ~~
in the 1o present description, at least two antibodies of different specificity, that is to say able to recognize and bind to two different epitopes or domains said polypeptides. It is moreover preferred according to the invention to use at least of them antibodies of different specificity for the processes, the methods and the kits the invention which include said antibodies. In this case, for example, use ts soft different antibody labeling or two revelation systems different.
Said antibodies can thus constitute a means of immunoassay cytochemical or immunohistochemical expression of said polypeptides on of specific sections of bone tissue and / or ligaments, for example by immunofluorescence, gold labeling, enzyme immunoconjugates.
2o They allow in particular to highlight and quantify the presence normal or abnormal specific of said polypeptides in bone tissue and / or ligaments, making them useful for identifying and localizing the expression of these polypeptides, or for the diagnosis of pathologies linked to the presence abnormal of said polypeptides.
2s More generally, said antibodies can advantageously be work in any situation where the expression of one of said polypeptides must to be observed qualitatively and / or quantitatively in a sample organic from bone and / or ligament tissue.
Techniques and specific reagents for detection, Identification, localization and / or assay of antigen-antibody that the pauma used in the methods of the invention are well known from the man of trade and are, for example, ELISA, RIA or immunofluorescence techniques can be combined, in the case where the antibodies of the invention are not not already immunoconjugated or labeled, with appropriate reagents such as antibody immunoconjugated, labeled ~ fluorescein or radiolabelled capable of recognize specifically said antibodies, as well as chromogenic substrates specific of conjugated enzymes and positive control control reagents; negative and quantitative.
Thus, the invention includes a method for detecting, identifying, localization and / or specific assay of an EPIL 1, EPIL 2 and / or polypeptide or a fragment thereof in a biological sample of bone tissue and / or ligament, or diagnosis of pathologies linked to the abnormal presence of or said polypeptides in bone tissue and / or in ligaments, characterized in that he includes the following steps a) bringing said biological sample into contact. with one or more directed antibodies against the said polypeptide (s);
b) highlighting, identification, location and / or determination of the complex antigen-antibody formed.
The invention also includes a kit or kit for detection, identification, localization and / or specific dosage of a polypeptide EPIL 1, EPIL 2 and / or EPIL 3 or a fragment thereof in a biological sample of tissue bone and / or ligaments, or for the diagnosis of pathologies linked to presence abnormal said polypeptide (s) in said biological sample, characterized in that it includes the following a) one or more antibodies directed against said polypeptide (s);
b) where appropriate, the reagents for constituting the medium suitable for reaction immunological;
c) where appropriate, reagents for detection, identification and / or the dosage antigen-antibody complexes produced by the immunological reaction.
The invention also relates to the use of a probe or primer oligonucleotide capable of specifically hybridizing with a sequence acid 3o nucleic acid corresponding to the INSL4 gene, for detection, identification, the WO 99/37780 PGT / P'R99 / 00137 localization, amplification, and / or assay of nucleic acid sequence corresponding to the INSL4 gene in bone tissue and / or in ligaments.
The invention also includes the use of a probe or primer oligonucleotide capable of hybridizing specifically with a sequence acid s nucleic acid corresponding to the INSL4 gene, for the diagnosis of pathologies linked to abnormal expression of the INSL4 gene in bone tissue and / or in ligaments.
We will mean by -nucleic acid sequence corresponding to the gene INS1,4-, the nucleotide sequence of the INSL4 gene as defined in FIG.
1 or all nucleotide sequences encoding a homologous polypeptide or varying from 1o EPIL 1, EPIL 2 or EPIL 3 polypeptide, their complementary sequence, the sequence nucleotide of their corresponding RNA as well as their fragments.
Said oligonucleotide probes capable of hybridizing specifically with a nucleic acid sequence corresponding to the INSL4 gene, may be marked or fixed on a solid support by covalent bond or not, the techniques of labeling or attachment of such probes being well known to those skilled in the art art.
Specific hybridization means that hybridization is carried out in stringency conditions, in particular in temperature conditions and by force ionic as they allow the maintenance of hybridization between two fragments of globally complementary DNA.
2o As an illustration, conditions of high stringency of the step hybridization for the purpose of defining the nucleotide sequences described above, are advantageously the following.
Hybridization is carried out at a preferential temperature of 65 ° C, in presence of buffer 6 x SSC, 5 x Denhardt's solution, 0.5% SDS and 100.
ug / ml of salmon sperm DNA.
1 x SSC corresponds to 0.15 M NaCI and O, OSM sodium citrate and one 1 x Denhardt solution corresponds to 0.02% Ficoll, 0.02 ~
polyvinylpyrrolidone and 0.02% bovine serum albumin.
The washing steps can, for example, be carried out for 5 to 30 min.
at 65 ° C, in 2 x SSC or 1 x SSC buffer and 0.1% SDS.

.WO 99/37780 PCT / FR99 / 00137 tt -The high stringency hybridization conditions described above for a polynucleotide of defined size, will be adapted by those skilled in the art to oligo-larger or smaller nucleotides, depending on teaching dc Sambrook and al., 1989.
s The oligonucleotide probes or primers, and in general the nucleic acid sequences according to the invention will have a size minimum of 10 bases and fragments of 20 bases, and preferably 30 bases, will be preferred.
Also part of the invention are the detection methods, identification and / or specific nucleic acid sequence assay corresponding to the gene to INSL4 in a biological sample of bone tissue and / or tic ligament, or of diagnosis of pathologies linked to the abnormal presence of said sequence acid nucleic acid in said biological sample, characterized in that they include the following steps a) isolation of the DNA from said biological sample to be analyzed, or obtaining CDNA from the RNA of said biological sample;
b) specific amplification of said nucleic acid sequence using at least less a primer capable of specifically hybridizing with an acid sequence nucleic corresponding to the INSL4 gene;
c) qualitative and / or quantitative analysis of the amplification products.
2o The invention also includes the methods of detection, of identification and / or specific nucleic acid sequence assay corresponding to the INSL4 gene in one biological sample of bone tissue and / or ligament, or diagnostic of pathologies linked to the abnormal presence of said nucleic acid sequence in said biological sample, characterized in that they comprise the steps following A) contacting an oligonucleotide probe capable of hybridizing specifically with a nucleic acid sequence corresponding to the INSL4 gene with said biological sample, the DNA contained in said sample biological having, where applicable, previously made available for hybridization, in conditions allowing the hybridization of said probe to the DNA contained in said 3o biological sample;

b) detection, identification and / or assay of the hybrid formed between said probe oligonucleotide and the DNA of said biological sample.
The invention also relates to detection methods, identification and / or specific nucleic acid sequence assay corresponding to the gene INSL4 in a biological sample of bone tissue and / or ligament, or diagnosis of pathologies linked to the abnormal presence of said sequence acid nucleic acid in said biological sample, characterized in that they include the following steps a) contacting an oligonucleotide probe immobilized on a support and capable of specifically hybridizing with a nucleic acid sequence corresponding to the INSL4 gene, with said biological sample, the DNA of the sample, having, if necessary, been previously amplified using minus one primer capable of specifically hybridizing with an acid sequence nucleic corresponding to the INSL4 gene and / or made accessible to hybridization, in conditions allowing the hybridization of said probe to the DNA of said sample biological ;
b) bringing the hybrid formed into contact with said oligonucleotide probe immobilized on a support and the DNA contained in said biological sample, the case possibly after ~, 's elimination of DNA from said biological sample not having hybrid 2o with said probe, with an oligonucleotide probe, in particular labeled, and able to specifically hybridize with a corresponding nucleic acid sequence at INSL4 gene.
In addition, part of the present invention, the kits or necessary for the detection, identification and / or specific acid sequence assay nucleic corresponding to the INSL4 gene in a biological sample of bone tissue and / or ligament, or for the diagnosis of pathologies linked to the abnormal presence of said nucleic acid sequence in said biological sample, characterized by what they include the following a) an oligonucleotide probe capable of hybridizing specifically with a nucleic acid sequence corresponding to the INSL4 gene;

_ WO 99/37780 PCT / Fit99 / 00137 b) where appropriate, the reagents necessary for carrying out a reaction hybridization;
c) if necessary, at least one primer capable of specifically hybridizing with unc nucleic acid sequence corresponding to the INSL4 gene and the reagents necessary for a DNA amplification reaction.
The invention also includes the kits or kits for detection, identification and / or specific nucleic acid sequence assay corresponding INSL4 gene in a biological sample of bone tissue and / or ligament, or for the diagnosis of pathologies linked to the abnormal presence of said sequence 1o of nucleic acid in said biological sample, characterized in that that they include the following a) an oligonucleotide probe, known as capture somle, which can be supplied pre-immobilized on a support, and capable of hybridizing specifically with a nucleic acid sequence corresponding to the INSL4 gene;
ls b) an oligonucleotide probe, called a revelation probe, in particular marked, and capable of specifically hybridizing with a nucleic acid sequence corresponding to the INSL4 gene;
c) if necessary, at least one primer capable of specifically hybridizing with a nucleic acid sequence corresponding to the INSL4 gene as well as the reagents 2o necessary for a DNA amplification reaction.
Also forming part of the invention are the methods or kits according to the invention for the diagnosis of pathologies linked to differentiation and / or proliferation abnormal bone tissue and / or ligament cells, for the diagnosis of pathologies related to abnormal cartilage development and / or abnormal ossification of the bone in 25 training and / or for the diagnosis of osteoporosis and / or for the diagnosis of dysplasias. Among the dysplasias, mention may in particular be made of dysplasias diaphyseal such as diaphyseal hypoplasia or imperfect osteogenesis or hyperplasia diaphyseal or Engelmann's disease.
In the present invention, the term “diagnosis of pathologies linked to the 3o differentiation or the abnormal proliferation of bone tissue and / or cells of ligaments, or for the diagnosis of pathologies linked to abnormal development of cartilage and / or abnormal ossification of the developing bone or for the diagnosis of osteoporosis and / or dysplasia, not only the diagnosis cleanly said of the pathology, but also the diagnosis or prognosis of evolution of said pathology, following for example a therapeutic treatment. So according to the invention, said procedures or kits can be used to assess the effectiveness of a treatment therapeutic of said pathology.
Specific amplification techniques and qualitative analysis ct / or nucleic acid sequence that can be used in these processes of the invention are well known to those skilled in the art and are, for example, lo methods comprising at least one amplification step called PCR
(reaction in by polymerase) or by PCR-like of the target sequence likely to be present using at least one oligonucleotide primer of sequence nucleic as defined above. Amplified products can be processed at ugly appropriate restriction enzyme prior to detection or dosage of targeted product, in particular by a method according to the invention.
By PCR-like we mean to designate all the methods implementing direct or indirect reproductions of nucleic acid sequences, or in which the marking systems have been amplified. These techniques are well heard known. In general it is the amplification of DNA by a 2o polymerase; when the original sample is an RNA, previously perform reverse transcription. There are currently many processes allowing this amplification, for example the so-called NASBA methods ~~
Nucleic Acid Sequence Based Amplification ”(Compton, 1991), TAS ~~ Transcription based Amplification System "(Guatelli et al., 1990), LCR ~~ Ligase Chair Reaction"
2s (Landegren et al., 1988), ~~ Endo Run Amplification "(ERA), K Cycling Probe Reaction "(CPR), and SDA ~~ Strand Displacement Amplification" (Walker and al., 1992), well known to those skilled in the art. Are also known to those skilled in the art profession, nucleic acid quantification techniques in which by example the nucleic acid to be quantified is amplified by a PCR type method and presence 3o of a standard nucleic acid of the same size, of known quantity and capable of hybridize to the same primers as the target nucleic acid.

The amplified fragments can be identified, for example after a agarose or polyacrylamide gel electrophoresis, or after a technique chromatography such as gel filtration or exchange chromatography ions. The specificity of the amplification can be controlled for example by 5 molecular hybridization using as probes probes such as defined above above, notably marked.
The invention further includes methods for labeling tissue cells.
bone and / or ligament, in particular of fetal origin, characterized in that that ues include the following steps lo a) contacting a biological sample of bone tissue and / or ligament with one or more antibodies directed against the polypeptide (s) EPIL 1, EPIL 2 ct / or EPIL 3, said antibodies being capable of being labeled;
b) where appropriate, labeling of said antibodies using labeled compounds able to recognize said antibodies.
15 Techniques for labeling cells with antibodies specific for composed of said cell, a jump well known to immunocytochemists or immunohistochemists and will not be discussed here description.
Also included in the present invention are the marking methods.
bone tissue and / or ligament cell, in particular of fetal origin, 2o characterized in that they comprise the following stages a) contacting a biological sample of bone tissue and / or ligament with one or more oligonucleodic probes capable of hybridizing specifically with a nucleic acid sequence corresponding to the INSL4 gene, said probes can be marked;
2s b} where appropriate, labeling of said probes using labeled compounds able to recognize said probes.
The invention also relates to a method for detecting an abnormal cell bone and / or ligament tissue, characterized by the fact that it implements a method of marking according to the invention.
Another aspect of the invention relates to methods for selecting compound chemical or biochemical capable of modulating differentiation, regeneration and or proliferation of human and / or animal cells of bone tissue and / or ligament, characterized in that they use an EPIL I, EPIL 2 polypeptide, EPIL
3, one of their homologous or variant polypeptides, or one of their fragments, a nucleic acid sequence corresponding to the INSL4 supper, or a cell of tissue s bone or ligament, especially fetal. Said cell possibly being a cell transformed by genetic recombination or selected according to the invention.
Among these methods, methods characterized in that the said are preferred.
selected compound is capable of inhibiting or promoting differentiation, the regeneration and / or proliferation of human and / or animal cells of bone tissue 1o and / or ligament, in particular the fetal cells of the perichondrium.
Said compounds can for example be selected on their ability to link to an EPIL 1, EPIL 2, EPIL 3 polypeptide, to one of their polypeptides counterparts or variant, or to a fragment thereof, and to inhibit or promote activity said polypeptides in bone tissue and / or in ligaments, as, by example, 15 agonist or antagonist ligands of a specific receptor for said receptors polypeptides on them cells of said tissues.
Said compounds may also be selected on their ability to link to a nucleic acid sequence corresponding to the INSL4 gene, and to inhibit or promote the expression of the gene encoding said polypeptides as that inductor or 2o repressor.
Said compounds may also be selected on their ability to modulate biological cells in vitro or in vivo said polypeptides expressed by said cells, such as in particular the differentiation, the proliferation or regeneration of said cells.
For example, the invention includes a method of selecting compounds capable of binding to an EPIL 1, EPIL 2, EPIL 3 polypeptide, to one of their homologous or variant polypeptides, or to a fragment thereof, or capable to bind to a nucleic acid sequence corresponding to the INSL4 gene, and capable modulate the activity of said polypeptides in bone tissue and / or in the 30 ligaments, characterized in that it comprises the following stages a) bringing said compound into contact with said potypeptide or said sequence nucleic acid;
b) determining the capacity of said compound to bind with said polypeptide or said nucleic acid sequence;
sc) demonstration of the modulation of the activity of said polypeptides on of bone and / or ligament cells, which can be obtained with the compounds selected in step b).
It will be possible, for example, to use bone tissue cells and / or of ligaments transformed by genetic recombination or selected according to invention, to in step b) and / or c) of this method.
The invention also includes chemical or biochemical compounds, likely to be selected by a method according to the invention.
The compounds which can be selected can be compounds organic such as polypeptides or carbohydrates or any other compounds 1s already known, or new organic compounds made from techniques of molecular modeling and obtained by chemical or biochemical synthesis, these techniques being known to those skilled in the art.
A subject of the invention is also compounds according to the invention by way of drug, preferably chosen from 2o a) an EPIL 1, EPIL 2 or EPIL 3 polypeptide, one of their polypeptides homologs or variants or a fragment thereof, obtainable by genetic recombination or by chemical synthesis;
b) an antibody directed against a polypeptide as defined in a);
c) a chemical or biochemical compound, characterized in that it is a ligand A polypeptide as defined in a);
d) a vector comprising all or part of a nucleic acid sequence corresponding to the INSL4 gene;
e) a vector as defined cn d), having a marker on its surface specific to target bone tissue or ligament cells that we are looking to modulate 30 activity;

f) a sense or antisense nucleic acid sequence capable of hybridizing specifically with a nucleic acid sequence corresponding to the gene INSLA.
Fragments of the EPIL I, EPIL 2 or EPIL 3 polypeptide, or their homologous or variant polypeptides, and as defined in a) will be of preference characterized in that they are biologically active.
By biologically active fragment is meant in particular a amino acid sequence fragment of polypepdde EPIL 1, EPIL 2 or EPIL 3, or of their homologous or variant polypeptides exhibiting at least one of the activities said polypeptides such as in particular lo - the ability to modulate, in particular to inhibit or promote, differentiation, proliferation and / or regeneration of tissue cells bony ct / or ligament; and or - the ability to be recognized by an antibody specific for an EPIL polypcptide 1, EPIL 2 or EPIL 3, or one of their homologous or variant polypeptides.
The EPIL 1, EPIL 2 or EPIL 3 polypeptides, their homologous polypeptides or variants or their fragments, which are recombinant, may be obtained from methods well known to those skilled in the art using cloning vectors and or of expression containing a nucleic acid sequence coding for said polypeptides and host cells transformed by said vectors.
2o The recombinant polypeptides obtained may equally well be present under glycosylated form than non-glycosylated and may or may not have the structure tertiary natural.
These polypeptides can be produced from acid sequences nucleic coding for said polypeptides according to the techniques for producing polypeptides recombinants known to those skilled in the art. In this case, the acid sequence nucleic acid used is placed under the control of signals allowing its expression in a cell host.
An efficient system for producing a recombinant polypeptide requires have a vector, for example of plasmid or viral origin, and a cell 3o compatible host.

.WO 99/37780 PCT / FR99 / 00137 The cell host can be chosen from prokaryotic systems, such as bacteria, or eukaryotes, such as for example lewres, insect cells or of mammals like CHO cells (Chinese hamster ovary cells) or the mucin cells or any other system, advantageously available to me. A host cellular s preferred for the expression of the proteins of the invention consists of the cells of CHO Chinese hamster ovary, and by the original 3A-subE cells placental human.
The vector must include a promoter, initiation and translation termination, as well as appropriate regulatory regions from 1a 1o transcription. It must be able to be maintained stably in the cell and can possibly possess particular signals specifying the secretion of the protein translated.
These different control signals are chosen according to the host cellular used. For this purpose, the nucleic acid sequences can be inserted in 15 autonomously replicating vectors within the chosen host, or vectors integrative of the chosen host.
Such vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into a host suitable by standard methods, such as for example lipofection, 20 electroporation, thermal shock.
Host cells transformed by the above vectors can be obtained by the introduction into these cells of a nucleotide sequence inserted in a vector as defined above, then the cultivation of said cells in conditions allowing replication and / or expression of the sequence nucleotide 2s transfected.
Among the host cells which can be used for these purposes, mention may of course be made the bacterial cells (Olins and Lee, 1993), but also the cells of lewre (Buclcholz, 1993), as well as animal cells, in particular cultures of mammalian cells (Edwards and Aruffo, 1993), especially cells ovary 3o of Chinese hamster (CHO), human cells such as 3A cells subE

WO 99/37780 PC'T / FR99 / 00137 of placental origin, but also the insect cells in which we can use methods using baculoviruses for example (Luckow, 1993).
Methods for purifying recombinant or synthetic polypeptides used are known to those skilled in the art. The recombinant or synthetic polypeptide can 5 be purified using methods used individually or in combination such that fractionation, chromatography methods, techniques immuno-affinity using specific mono or polyclonal antibodies.
A preferred variant is to produce a fused recombinant polypeptide to a protein ~~ porteus ~~~ (conjugated protein). The advantage of this system is that he to allows stabilization and reduction of the proteolysc of the product recombinant, increased solubility during in vitro renaturation and / or a simplification of the purification when the fusion partner has a affinity for a specific ligand.
The EPIL 1, EPIL 2 or EPIL 3 polypeptides, their homologous polypeptides 1s or variants or their fragments can also be obtained by synthesis chemical.
The polypeptides obtained by chemical synthesis may contain acids unnatural amines.
Among said compounds selected as medicaments, mention may be made of particularly antisense oligonucleotides, that is to say the structure of which Insured by 2o hybridization with the target sequence, an inhibition of the expression of product corresponding. Mention should also be made of sense oligonucleotides which, for interaction with proteins involved in regulating gene expression INSL4, will induce either an inhibition or an activation of this expression.
The invention relates to compounds according to the invention for the treatment of 2s pathologies linked to the differentiation and / or the abnormal proliferation of bone tissue and / or ligament cells, in particular from pathologies linked to development abnormal cartilage and / or abnormal ossification of the developing bone, in particular intended for the treatment of osteoporosis and / or dysplasia.
Among said dysplasias, diaphyseal dysplasias are particularly preferred.
3o as Diaphyseal hypoplasia or imperfect osteogenesis and hyperplasia diaphyseal or Engelmann's disease.

The invention finally relates to compounds according to the invention, intended for treatment of pathologies involving the regeneration of bone tissue and / or of ligament, especially for treatment to repair tissue damage bony and / or ligaments following traumatic shock.
The compounds of the invention as active drug ingredients will be preferably in soluble form, associated with a vehicle pharmaceutically acceptable.
Preferably, these compounds will be administered systemically, in particularly intravenously, intramuscularly, intradermally or by way oral.
Their optimal modes of administration, dosages and dosage forms can be determined according to the criteria generally taken into account in the establishment of a treatment adapted to a patient such as for example the ~ age or the speak body weight, severity of general condition, tolerance to treatment and side effects found, etc.
We can also generally compensate for the deficiency or overexpression of polypeptides according to the invention by a therapy called ~~ replacement ~~
allowing amplification or reduction of the activities of said polypeptides.
Replacement therapy may be performed by gene therapy, that is, 2o, by introducing the nucleic acid sequences according to the invention and / or genes corresponding with the elements which allow their expression in vivo, in the case od one of the genes is insufficiently expressed, for example, or when it East expressed in an abnormal form.
The principles of gene therapy are known. We can use vectors viral, for example on the basis of adenoviruses (Perricaudet et al., 1992), AAV, Adenovirus Associated Virus (Carter, 1993), retroviruses (Temin, 1986), poxvirus or herpes virus (Epstein et al., 1992). Most of the time these viruses are used in defective form and, in general, with or without integration in the cell genome. It is also possible to provide non-vector vectors.
that is viral 3o ie synthetic, which mimic viral sequences or which are made up of WO 99137780 PCT / FR99 / 0013'i naked DNA or RNA according to the tectuûque developed in particular by your company VICAL.
In most cases, it will be necessary to plan for tic targeting elements ensuring a specific expression so as to be able to limit the expression s golypeptides. It is even interesting, in some cases, to have vectors transient expression or at least controlled expression that we can block when necessary.
The compounds according to the invention which can be used as medicaments offer a new approach for the treatment of differentiation-related diseases or to the lo unregulated proliferation of bone cells or tissues and / or ligaments or the absence or the insufficiency of certain cells of bone tissue and / or ligaments, continued by example to trauma.
Other characteristics and advantages of the invention appear in the after of the description with the exempt and the figures whose legends are represented ts below.
Legend of Figures Figure 1: INSL4 gene cDNA nucleic acid sequence and sequence of amino acids of the EPIL polypeptide encoded by this sequence.
Figures 2A, 2B, 2C, 2D, 2E, 2F: Comparison of the distribution of mRNA
2o of INSL4 and IGF-II in the 14-week-old human placenta;
- observation on a light background (Figure 2A) and on a black background (Figure 2B} of even tissue section hybridized with an INSLA antisense probe;
- enlargement of the previous section observed on a light background (Figure 2C);
- observation on a light background (Figure 2D} and on a black background (Figure 2E) of a even 2s section of tissue hybridized with an IGF-II antisense probe;
- enlargement of the previous section observed on a light background (Figure 2F);
s: syncytiotrophoblast; c: cytotrophoblast; m: mesenchyme;
the scale bar represents 29s ~, m for FIGS. 2A, 2B, 2D and 2E, and represented 15 ~ cm for figures 2C and 2D.
3o Figures 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H: Cellular distribution of AIZNm IGF-II in human embryos ~ 25 days old (Figures 3A and 3B), 30 days (Figures 3C, 3D, 3E and 3F) or 45 days (Figures 3G and 3H) obtained by hybridization in situ using an "S-labeled oligonucleotide probe:
Light micrographs on a light background (left panel) and on a black background (panel of right) of the same cut of fabric - axial section (Figures 3A and 3B) at the ~ rhombencephaly ~; nt: tube ncurat;
ov: otic vesicle;
- longitudinal abdominal section (Figures 3C and 3D); nt: neural tube; m mesonephron;
- sagital section at the level of the gill arches (ba) (Figures 3E and 3F);
to - longitudinal section of the vertebral body (vb) (Figures 3G and 3H);
the scale bar represents 295 ~ m for FIGS. 3A, 3B, 3C and 3D, and represented 150 ~ cm for all other panels.
Figures 4A, AB, 4C, 4D, 4E and 4F: In situ hybridization performed with a INSL4 oligonucleotide probe on an 8 week old human fetus.
t5 Microphotographs on a light background (left panel) and black background (panel of right) of the same fabric cut - cut of the distal part of the femur in the developed articulation of the hip (Figures 4A and 4B) at the ~~ rhombencephalon ~; f: femur; 1: ligament;
- longitudinal section of the spine (Figures 4C and 4D);
20 INSL4 mRNA is localized in the inter-vertebral discs, in the ligaments intervertebral; vb: vertebral body; 1: ligament;
- cross section of c8te (Figure 4E and 4F); pc: perichondrium; r: c8te;
the scale bar represents 295 ~ m for FIGS. 4A, 4B, 4C and 4D, and represented 150 ~ m for Figures 4E and 4F.
EXAMPLES
Materials and methods A) Experimental subjects 3o Morphologically normal embryos three to eight weeks old (after owlation) were obtained after legal abortion by mifepristone (RU 486) at the Broussais Hospital in Paris. Complete independence was respected between the medical directorate of the hospital and the research group. The consent maternal was never requested before the abortion was decided and performed. Lc consent was obtained after explanation of the research objective and only s after medical abortion has been performed. This procedure is approved by Ethics Committee of the Hospital for Sick Children in Neckcr (Paris). The embryos were separated from the trophoblast by dissection under a microscope. The stadium development of each of the embryos was estimated using ia classification of Carnegie established by O'Rahilly (R. O'Rahilly et al., 1987 and 1994). The embryos lo microdissected were frozen and stored at -80 ° C. Of cryocuts (I2 p, m) have were mounted on pretreated blades (Probon Plus blades, Microm France). The cuts were fixed for 30 minutes in a para-formaldehyde solution in buffer 0.1 M phosphate (pH 7.4), rinsed once in PBS (phosphate buffered saline) and briefly in water, then dehydrated with a series of solution ethanol to ts different concentrations (50%, 75%, 95 96). The cuts were then dried to the air is kept at - 80 ° C in order to preserve the mRNA.
B) Hybridization probe 60-mer oligonucleotide probes were synthesized and purified 20 (DNAgency, Malvern, PA). They were marked in 3 'with [a "S] dATP (NEN, Boston, MA) using a terminal deoxyribonucleotidyl transferase (Gibco BRL, Grand Island, N ~ with a specific activity of approximately 7 x 10 °
cpm / mg. The oligonucleotide probes were purified on Biospin columns (Bio-Rad Laboratories, Hercules, CA) before use. The INSL4 probe sequence 2s antisense is as follows (SEQ ID N ° 2) 5'-CTGGGGTGGTGGTGAATGTCTTCTCAGGCATGGGGCAATATGACAGCAA
GTGTTTTCCAA-3 ', located on exon 1. The sequence of the IGF-û antisense probe is as follows (SEQ ID N ° 3) 5'-AGCCAATCGATTTTGTACATGTTTGAAGATGCTGCTGTGCTTCCTCAGCC
30 CGATGG AGGG-3 ', located on exon 7 in the common coding region of FIGF-II mRNA. Sense probes were used as a control.

C) In situ hybridization The experimental protocol (M. Abitbot et al., 1993, and M. Gerard et al., 1995) includes a hybridization step using a solution containing 50 R6 of formamide, 4 x SSC (standard saline citrate solution), 1 x Denhardt solution, 0.25 mg / ml s yeast tRNA, 0.25 mg / ml herring sperm, 0.25 mg / ml dc poly-A, 10 3 ~ dc dextran sulfate, 100 mM dithiothreitol (DTT) and a probe labeled ["S) dATP
specific activity of 6 x 10b cpm / ml. 100 ~ cl of hybridization solution a summer deposited on each of the sections. Then the sections were covered with a parafilm and incubated in a humid chamber at 43 ° C for 20 hours. After hybridization, ~ o the slides were washed twice in 1 x SSC containing 10 mM DTT for minutes at 55 °, and twice in a solution of 0.5 x SSC containing 10 mM DTT
~ for 15 minutes at room temperature. The cuts were then immersed in water, dehydrated with a series of ethanol solutions of different concentrations then exposed for a week on X-ray films Amersham Hyperfilm 15 Betamax and in a Kodak NTB2 photographic emulsion (Eastmman Kodak, Rochester, NY) for one to two months at 4 ° C. The cuts have then been developed and labeled with toluidine blue. The results are analyzed through phase contrast microscopy.
2o Example 1: In situ hybridization of nlacentaj, ~ and fetal membranes ~
In order to demonstrate the specificity of oligonucleotide probes, an analysis by Northern blot was carried out with 12 p, g of total RNA from tissue of trophoblast. INSL4 transcripts were detected at a size of 0.7 kilobase (kb) with both the oligonucleotide probes and a cDNA probe, in agreement with the 25 size of the INSL4 transcript published by Chassie et al. (1995). For the gene IGF-II a major transcript of 6.0 kilobases and other transcripts of 2 to 5 kilobases have been detected, confirming the results of Han et al. (1988), who identified transcribed multiples of IGF-II with estimated sizes of 1.8, 2.0, 2.8, 3.0, 4.0, 4.8 and 6.2 kb, the latter being the most abundant. These results show the specificity of oligomers 3o of INSL4 and IGF-II which were chosen respectively for the mRNAs INS1.4 and of human IGF-II. In situ hybridization performed with oligonucleotides meaning INSL.4 and IGF-II generate only diffuse grains corresponding to noise of background, thus demonstrating the specificity of the positive hybridization obtained with of antisense oligonucleotides.
A low level of expression of the INSL4 gene was detected from the placenta s early 25 days old and an abundant level of INSL4 mRNA was identified at from 14 week old placenta. The INSL4 gene is expressed in syncytiotrophoblasts and less abundantly in cytotrophoblasts. Lcs cells of the central part of the villous mesoderm and cord cells umbilical express the INSL4 gene even more weakly (FIGS. 2A, 2B and 2C). No signal lo was detected neither in the amnion nor in the yolk sac (results not represented).
IGF II mRNA was abundantly expressed in the columns of trophoblasts intermediate and in the villous stroma at 20 days and 14 weeks of development, but is not detectable in sections of syncytiotrophoblasts (Figures 2D, 2r ~ and 2F). Abundant in fetal membranes (20 days) quantities 1s of IGF II mRNA were identified in damnion cells and collules external of the yolk sac (results not shown). These results are summaries in the Table I below.

TABLE I: Distribution of INSL4 and IGF II mRNA in the placenta and human fetal membranes Cell Type INSL4 mRNA IGF-II mRNA

Pl t so a + + + + Ng, Syncytiotrophoblasts Cytotrophoblasts + + + +

Villous stroma + + + +

Trophoblasts Intermediate + + + + +

fetal membranes + Nd cells Umbilical cord Amnion Ng. + + + +

Yolk bag ~ Ng. ~ + + + +

s Legend to Table 1 Nd: not determined; Neg. : negative hybridization signal; +: signal hybridization low ; + +: moderate hybridization signal; + + +: strong hybridization signal ;
+ + + +: very strong hybridization signal; the signals are observed after 6 weeks of exposure.
The INSL4 gene is expressed more prominently in Ies syncytiotrophoblasts than in cytotrophoblasts. These results are confirmed by RT-PCR technique (amplification by polymerase chain reaction in using reverse transcriptase) performed on total RNA from syncytiotrophoblast ts and cytotrophoblast (D. Bellet et al., 1997). IGF ll mRNA is, from way significant, more abundant than INSL4 mRNA in adjacent sections tested with the INSL4 oligonucleotide probe. The expression of the IGF II gene in the human embryo placenta 25 to 40 days and 14 weeks old is localized in the central talking cells of the villous mesoderm and in the cells of intermediate or villous cytotrophoblast. IGF II transcripts are not detected in the syncytiotrophoblastic layer for the stages of development studied.
Similar observations have been reported for example by VKM Han (VKM
Han et al., 1996). Thus, it is likely that these two genes play a role different in the development of the trophoblast.
Example 2 In situ hybridization of embrvon_ ~ A ~ rec tissues No INSL4-labeled oligonucleotide probe was detected in the embryonic tissue 20 or 30 days old, suggesting that the INSL4 gene is not not lo expressed at this early stage or that the level of transcript is too low to be detected by in situ hybridization. In contrast, the IGF ll gene has been strongly expressed at this early embryonic stage. The expression of the IGF ll gene has been brought into evidence in several tissues derived from the mesoderm and endoderm (figures 3A to 3H), results consistent with those previously described (VKM Han et al., ls 1987a and 1987b, JE Lee et al., 1990). The major site for the expression of IGF II is localized in the liver for all stages studied.
The 8-week-old fetal tissue sections were also hybridized in using INSL4 oligonucleotide probes. In a surprising way, mRNA
of INSL4 shows a specific spatial distribution. In fact, the majority of transcribed 2o of INS1.4 are located in the perichondrium of the four limbs, ribs and vertebrae. In addition, INSL4 mRNA is very abundant in ligaments interosseous (Figures 4A to 4F). In contrast, no markings were detected in the liver, lungs, heart, thymus, stomach, muscle or intestines at this stage of development. The table û below summarizes the results in accordance with the types of 25 cells identified in the fetal tissue sections tested.

WO 99137780 PC'T / FR99 / 00137 -TABLE II. Distribution of INSL4 and IGF II mRNA in tissues embryonic (25, 30 and 45 days old for IGF II and 8 weeks old for INSU
Embryonic tissues mRNA of INSL4 AItIYm of IGF-ll Mninges Ng. + +

Mandibular prominence Ng. ++

Ng gill arches. + +

Thymus Ng. Nd Ng aortic arches. +

Cacur Ng. +

Bone marrow Ng. Nd Lung Ng,. +.

Liver Ng. + + +

Ng stomach. Nd Pancras Ng. Nd Intestines Ng. Nd Ng adrenal glands. + +

Mtanphros, Ng. + +

Sclrotome Ng, +

Prichonde + + + +

Ligaments + + Nd Skeletal muscles Ng. + +

Ng epidermis. Ng.

Legend of Table II
Nd: not determined; Neg. : negative hybridization signal; +: signal hybridization low ; + +: moderate hybridization signal; + + +: hybridization signal strong;
+ + + +: very strong hybridization signal; signals are observed after 6 weeks exposure lo.

Embryonic tissue sections hybridized with the same probes INSL4 and IGF ll oligonucleotides show that, on the contrary, IGF transcripts II, which are located in most embryonic tissues (VRK Han and al., 1987a and 1987b; JE Lec et al., 1990), the INSL4 gene is expressed only in 5 some of these tissues. Indeed, in embryo tissue sections aged human by 8 weeks, INSL4 transcripts are localized only in cells of perichondrium and ligaments. At this stage of development, chondrification East started for all the bones of the lower limbs.
It is remarkable that the INSL4 gene is a member of the superfamily of 10 genes related to insulin and that other members of this family code for regulatory polypeptides for both growth and development in of many fabrics. In particular, growth factors related to insulin (IGFs) play an important role in regulating bone formation (B.
Bhaumic et al., 1993; R. Malpe et al., 1997, and S. Mohan et al., 1991). In this context, 1s the specific expression of the INS1 gene, 4 during development embryonic at man, both chronologically and in terms of its distribution tissue highly restrictive in the embryo, strongly suggests that this gene is very certainly involved in different stages of bone development in training and ligaments.

Bibliography ~ Abitbol M., et al., 1993, Nucleus basalis magnocellularis and hippocampus are the major sites of FMR-1 expression during humas embryonic development, a preliminary report. CR Acad. Sci. Paris 318: 57-66.
~ Adham, LM. et al., (1993), J. Biol. Chem. 268: 26668-26672.
~ Haker J., et al. 1993, Role of insulin-liter growth factors in embryonic and postnatal growth. Cell. 75: 73-82.
~ Bellet D., et al., 1997, Identification of pro-EPIL and EPIL peptides translated from insulin-liter 4 (INSL-4) mRNA in humas placenta. 1. Clin. Endocrinol to Metab. 82: 3169-3172.
~ Bhaumic B., 1993, Insulin-liter growth factor (IGF) binding proteins and insulin-like growth factor secretion by cultured chondrocyte cells. identification, characteri-zation and ontogeny during cell differentiation. Regularoty Peptides 48 113-122.
~ Bogie, LV et al., (1995), J. Clin. Endocrinol. Metab. 80: 130-137.
~ Buckholz, RG, (1993), Curr. Op. Biotechnology 4: 538-542.
~ Burn J., et al., 1995, Humas embryo use in dcvelopmental research. Nature Broom. 11: 3-6.
~ Carter, BJ, (1993), Curr. Op. Biotechnology 3: 533-539.
~ Chassin D., et al., 1995, Cloning of a new member of the insulin gene superfamily (INSL4) expressed in humas placenta. Genomics 29: 465-470.
~ Compton, J. et al., (1991), Nature, 350: 91-92.
~ De Chiara 'TM., Et al., 1990, A growth-deficiency phenotype in heterozygous mice carrying an insulin-liter growth factor û gene disrupted by targeting.
Nature 2s 345: 78-80.
~ Edwards, CP et al., (1993), Curr. Op. Biotechnology 4: 558-563.
~ Epstein, A., (1992), Medicine / Science 8: 902-911.
~ Gérard M., et al., 1995, Pax-Genes expression during humas embryonic development, a preliminary report. Acad. Sci. Paris 318: 57-66.
~ Guatelli JC et al., (1990), Proc. Natl. Acad. Sci., USA, 87: 1874-1878.

WO 99/37780 PCT / FR99 / 00137 ~

~ Han VKM, et al., 1987a, Identification of somatomedin / insulin-liter growth factor immunoreactive tells in the human fetus. Pediatrics Research 22: 245-249.
~ Han VKM, et at., 1987b, Cellular localization of sommatomedin (insulin-liter growth factor) messenger RNA in the human fetus. Science 236: 193-197.
s ~ Han VKM, et al., 1988, Expression of sommatomcdin (Insulin-liter growth factor) messengcr ribonucleic acids in the human fetus: identification, characterization, and tissue distribution. J. Clin. Endocrinol. Metab. 66: 422-429.
~ Han VKM, et al., 1996, The expression of insulin-liter growth factors (IGF) and IGF-binding protein (IGFBP) genes in the human placenta at the feto-maternai 1o interface. J. Clin. Endocrinol Metab. 81: 2680-2693.
~ Hansell DJ, et al., 1991, Expression of the human relaxin H1 Bene in the dccidua, trophoblast, and prostate. J. Clin. Endocrinol. Metab. 72: 899-904.
~ Kbhler and Milstein, (1975), Nature 256, 495-497.
~ Landegren, U. et al., (1988), Science 241: 1077-1080.
ts ~ Lee JE, et al., 1990, Pattern of the insulin-liter growth factor II gent expression during early mold embryogenesis. Development 110: 151-159.
~ Le Roith D., 1997, Insulin-liter growth factors. N. Engl. J. Med. 336: 633-640.
~ Liu 7P, et al., 1993, Mice carrying pull mutations of the genes encoding insulin-Iike growth factor I (Igf I and type 1 IGF receptor (Igflr). Cell. 75: 59-72.
20 ~ Malpe R., 1997, Insulin-liter growth factor (IGF) -I, -û, IGF binding proteins (IGFBP ~ 3, -4, and -5 levels in the conditioned media of normal human mud tells are skeletal site-dependent. J. Bone Ore Res. 12: 423-430.
~ Mohan S., et al., 1991, Bone growth factors. Clin. Orthop. Rel. Res. 263:
30-48.
~ Olins, PO, and Lee, (1993), Curr. Op. Biotechnology 4: 520-525.
25 ~ 0'Rahilly R., et al., 1987, Developmental stages in human embryos including a revision of Streeter's 'Horizons', and a survey of the Carnegie collection.
Canergie Institution of Washington, publication No. 637:
~ O'Rahilly R., et al., 1994, The Embryonic Human Brain, An Atlas of Developmental Stages. Wiley-Liss, Inc., New York.

~ Ottolenghi C., et al., 1997, Genetic homology and divergence between mouse and humans: specific and gencral implications. TIG in press.
~ Perricaudet, M. et al. , (1992), La Recherche 23: 471-473.
~ Sambrook, J., et al., 1989, In Molecular Cloning: A Laboratory Manual. Cold s Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
~ Strachan T., et al., 1997, A new dimension for the human genome project towards comprehensive expression maps. Nature Genet. 16: 126-132.
~ Tashima LS, et al., 1995, The human leydig insulin-like (hLEY IL) Bene is expressed in the corpus luteum and trophoblast. J. Clin. Endocrinol Metab. 80 l0 707-710.
~ Walker, GT et al., (1992), Nucleic Acids Res. 20: 1691-1696.

SEQUENCE LIST
(1) GENERAL INFORMATION:
(i) DEPOSITOR:
(A) NAME: GUSTAVE-ROUSSY INSTITUTE
(B) STREET: 39 CAMILLE DESMOULINS STREET
(C) CITY: VILLEJUIF
(E) COUNTRY: FRANCE
(F) POSTAL CODE: 94800 (ü) TITLE OF THE INVENTION: NEW PROTEIN CALLED EPIL / PLACENTIN, PROCESS FOR THE PREPARATION OF THIS PROTEIN AND COMPOSITION
PHARMACEUTICAL CONTAINING THE SAME, DNA ENCODING THE SAME
PROTEIN
(iii) NUMBER OF SEQUENCES: 3 (iv) COMPUTER-DETACHABLE FORM:
(A) TYPE OF SUPPORT: Floppy disk (8) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) SOFTWARE: PatentIn Release # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 618 base pairs (B) TYPE: nuclbotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ü) TYPE OF MOLECULE: cDNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 107..523 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l:

Met Ala Ser Leu Phe Arg Ser Tyr Leu Pro Ala Ile Trp Leu Leu Leu Ser Gln Leu WO 99 / 3778b PCf / FR99 / 00137 Leu Glu Ser Leu AlaGlu Leu Gly Gly Arg Phe Arg Ala Arg Cys Pro AAA TCA GAG ACA

Gly His Leu Leu TyrCys ProMetPro Lys Phe Thr Lys Ser Glu Thr ACC TGG CGT AAA

Thr Pro Gly Gly LeuLeu GluSerGly Pro Glu Met Thr Trp Arg Lys TCA AAC TTA ACG

Val Thr Ser Asn LysAsp GlyGlnAla Gly Thr Ser Ser Asn Leu Thr TTC TTG AAA CTG

Glu Ile Pro Asn SerPro GluLeuLys Pro Ser Glu Phe Leu Lys Leu CAG AAG CGC AAG

Gly Pro Ser Leu LysIle IleLeuSer Lys Arg Ser Gln Lys Arg Lys CGT GAT GTA TGT

Gly His Arg Phe ProPhe CysCysGlu Ile Asp Asp Arg Asp Val Cys ACT TTA ATCAT GGACATCTCA

Gly Ser Val Lys CysThr Thr leu TATGTATTCT CCCAATTAAA
CAATGACAAA T

(2) INFORMATION FOR SEQ ID N0: 2:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 60 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ü) TYPE OF MOLECULE: cDNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: INSL4 antisense probe (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:

(2) INFORMATION FOR SEQ ID NO: 3:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 60 base pairs (8) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ü) TYPE OF MOLECULE: cDNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: IGF-II antisense probe (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3:

Claims

34

1. Use of the INSL4 sequence for the preparation of a composition intended for the treatment of pathologies linked to regeneration, or to the differentiation and/or abnormal proliferation of bone tissue and/or cells of ligaments.

2. Use according to claim 1, for the treatment and/or the prevention of osteoporosis or dysplasia.

3. Use according to claim 1, for the repair of lesions of the bone tissue and/or ligaments following a traumatic shock.

4. Use according to one of claims 1 to 3, characterized in that said composition comprises a compound chosen from the following compounds:
a) a nucleic acid sequence comprising a fragment of at least 10 nucleotides of the sequence of the INSL4 gene or the antisense sequence of this fragment:
b) a polypeptide, or one of its fragments of at least 5 amino acids, encoded over there INSL4 gene sequence; and c) an antibody capable of recognizing a polypeptide, or a fragment thereof of at least 5 amino acids, encoded by the INSL4 gene sequence.

5. Use of the INSL4 gene sequence in a diagnostic method pathologies linked to the differentiation and/or abnormal proliferation of tissue bone and/or ligament cells.

6. Use according to claim 5, in a method for diagnosing pathologies related to abnormal cartilage development and/or ossification abnormal bone formation.

7. Use according to claim 5, in a method for diagnosing osteoporosis and/or dysplasia.

8. Use according to one of claims 5 to 7, characterized in that said method uses a fragment of at least 10 nucleotides of the sequence of INSL4 gene as probe or primer.

9, Use according to one of claims 5 to 7, characterized in that said method uses an antibody capable of recognizing a polypeptiae, or a of its fragments of at least 5 amino acids, encoded by the sequence of the gene

10. Kit or necessary for 1c diagnosis of pathologies linked to the differentiation and/or abnormal proliferation of bone tissue and/or cells of ligaments.characterized in that it comprises at least one compound chosen from them following compounds a) a nucleic acid sequence comprising a fragment of at least 10 nucleotides of the sequence of the INSL4 gene or the sequence complementary to this fragment; and b) an antibody capable of recognizing a polypeptide, or a fragment thereof of at least 5 amino acids, encoded by the INSL4 gene sequence.

11 Kit is necessary according to claim 10, in a method of diagnosis of pathologies related to abnormal cartilage development and/or a abnormal ossification of the forming bone.

12. Kit or kit according to claim 10, in a method of diagnosis of osteoporosis and/or dysplasia.

13. Method for selecting a compound capable of modulating differentiation and/or proliferation of bone tissue and/or ligament cells, characterized in that that said method uses a compound chosen from the compounds following.
a) a nucleic acid sequence comprising a fragment of at least 10 nucleotides of the INSL4 gene sequence or the sequence complementary to this fragment;
b) a transformed cell comprising a nucleic sequence comprising a fragment of at least 10 nucleotides of the INSL4 sequence, and c) a polypeptide, or one of its fragments of at least 5 amino acids, encoded by the INSL4 gene sequence.