CA2259041A1 - Method of treating hiv infection and related secondary infections thereof - Google Patents
Method of treating hiv infection and related secondary infections thereof Download PDFInfo
- Publication number
- CA2259041A1 CA2259041A1 CA002259041A CA2259041A CA2259041A1 CA 2259041 A1 CA2259041 A1 CA 2259041A1 CA 002259041 A CA002259041 A CA 002259041A CA 2259041 A CA2259041 A CA 2259041A CA 2259041 A1 CA2259041 A1 CA 2259041A1
- Authority
- CA
- Canada
- Prior art keywords
- defibrotide
- seq
- dose
- disease
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1793—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
- A61K31/7072—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid having two oxo groups directly attached to the pyrimidine ring, e.g. uridine, uridylic acid, thymidine, zidovudine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
- A61K31/708—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid having oxo groups directly attached to the purine ring system, e.g. guanosine, guanylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Defibrotide including its nucleic acid components and the variants thereof can be used to treat various disease conditions. Such therapeutic compounds can also be administered in combination with other nucleic acids and peptides.
Description
CA 022~9041 1998-12-22 METE~OD OF TREATING HIV ][NFE:CTION AND RELAI~D
SECONDARY INF~C'TIONS TE~EREOF
This application is a continuation-in-part of application Serial No.
08/185,416, filed January 24, 1994, which is a continuation-in-part of application Serial No. 08/002,395, filed January 13, 1993, which is a continuation-in-part of application Serial No. 07/748,277, filed August 21, 1991, and application Serial No.
07/830,886, filed February 4, 1992 which is a continuation-in-part of application Serial No. 07/815,130, filed December 27, 1991.
~;IJD OF INVENTION
The present invention relates to a rnethod of a~minictering 1) the nucleic acid components identified in defibrotide or the variants thereof, 2) the nucleic acid components identified in defibrotide or the variants thereof in combination with sequence specific oligonucleotides, 3) the nucleic acid components identified in defibrotide or the variants thereof in combiination ~vith amino acids or other protein factors, 4) oligonucleotides cont~ining ho!mologous sequences of HIV and cellular regulatory factors or the variants thereof, 5) the nucleic acid components identified in defibrotide or the variants thereof in combination ~vith 4), or 6) sequence non-specific oligonucleotide to treat various disease conditions including HIV infection and its related di.ce~es. The present invention discloses oligonucleotides and vectors which can be used as therapeutic compounds according to the invention.
The present invention also relates to a tre~tm.q.nt of drug re.~ t~nce.
BACKGl~OUN~ OF I~F INVENTION
Defibrotide is a polyanion salt of a deoxyribonucleic acid obtained from mammalian tissue. Defibrotide is a single-stranded polydeoxyribonucleotide with molecular weight of approximately 20 kDa (low molecular weight form) which may be obtained from bovine lung DNA by controlled hydrolysis. Patents related to its manufacture include U.S. Patent 3,770,720 directed to a process for extracting DNA from m~mm~ n tissue, and U.S. Patent 3,899,481 directed to a process for the controlled partial degradation of DNA extracted from animal organs.
Experimental studies have been performed to investigate the active component of defibrotide. U. S. Patent 3,770,720 discloses that the components of defibrotide include phosphorus 8.5%, Na 9.0%, N 14.0%, deoxyribose 23.2%, total bases 34.0%, guanine 9.4%, thymine 9.4~~, adenine 9.2%, cytosine 6.0%, uracil absent, Iodine, and Zinc.
Bracht et al., (Biochem. and Biophys. Res. Com., vol. 200, No.2, 1994, pp.933-937) have disclosed four aptamer sequences derived from the unfractionated defibrotide DNA precursor molecule. Tu o aptamers (5'-G'~TTGGATTG'~TTG~-3' and 5'-G~TTG'~ATCG'~TTG'~-3') were identified by thrombin chromatography. Another aptamer (5'-G'~ATGGATCGGTTGG-3') was found in the PCR product from the double-CA 022~9041 1998-12-22 stranded DNA precursor. The sequence of such aptamer was used to search the EMBL data base and was found in the bovi:ne genome and Angiotensin II-AT 1 receptor. The three aptamers were found to have inhibitory activities of thrombin induced platelet aggregation, thromboxane biosynthesis, increase in cytosolic Ca ~, and fibrin clot formation. In addition, there is a non-function aptamer (5'GGTGGTGGTTGTGGT3') whlich did not display any ofthe activities characteristic of defibrotide.
H~V infection is characterized by a progressive decline in immune system function, supp[es~ing the infected host's ability to overcome other, secondary infection. No cure has been found for HIV infection. The pathogenetic process in HIV infection is never unidimensional but, rather, ex:tremely complex and mllltif~ctorial The pathogenic progression may be only tangentially related to the direct infection of a given target cell. Death is almost inevitable, usually from an over~vhelming secondary infection andJor EIIV related neoplasm.
Current treatments for HIV infection attempt to retard the progress of the disease or relieve its symptoms. Treatment in use today include certain dideoxynucleotides such as azidothymidine (AZT or zidovudine, Burroughs Wellcome), dideoxyinosine (ddI, Bristol-Myers Squibb) or dideoxycytidine (ddC, Hoffman-LaRoche). These agents can be toxic. Their applicability is limited because of the appearance in some patients of onerous, and sometimes lethal, side effects. These side effects include myelosuppression, peripheral neuropathy, and pancreatitis. In some pa,tients, AZT has lost its effectiveness after prolonged use. While other drugs have been proposed for treatment of HIV
,.
infection, including the recent introduction of several HIV protease inhibitors, none have yet been demonstrated to be completely effective. Therefore, there remains a need in the art to develop additional therapeutic agents to treat HIV
infection. In particular, there is a need in the art to further identify the active components of defibrotide and their appli,cations in various disease conditions.
\/r~ARy OF TRF ll~VFl~TION
It is an object of the invention to provide a method useful in treating a disease condition in a patient, such as infi~ctious ~ ces, genetic (lice~.ces, degenerative ~i.ce~ces, DNA damage, neoplasia, and skin ~i.ce~ces.
To accomplish this objective, the invention provides a method of tre~tmP.nt comprising ~iminictering to a patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
Preferably, the method is practiced in a marker dependent manner, which method of treating a disease condition comprises:
(a) determining the initial state of a set of disease markers, the disease markers being observable characleristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, ~ b) a-~mini~tering to the patient a dose of a therapeutic compound comprising a nucleic acid cornponent of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following ~mini~tration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, the repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) ~dmini~tering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) .md (e) until the intensity of the repair marker in step (c) no longer increases, (g) ~ministerin& the the~ueutic compound at the highest dose level ~tt~in~d in step (f) until the intensity of the repair marker returns to the normal condition, and (h) ~rlmini~tering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of the set of disease markers no longer deviate from the normal condition.
The patient is monitored weekly for three or more weeks. If relapse occurs, as indicated by a deviation of one or more disease and/or repair markers .
from the normal level, therapy is reinitiated at the highest dose level of the prior course of therapy until norm~li7~tion is ag;ain reaehed.
In a particularly preferred embodirnent of the invention, the method of treating a disease condition comprises the steps of:
(a) determining the initial state of a set of disease markers, the disease markers being observable charaete:risties of a patient whieh deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range whieh is indicative of the normal condition, (b) ~dmini~tering to the patient a dose of a therapeutie compound comprising a nueleie aeid eomponent of defibrotide, but not ineluding defibrotide, wherein the dose of the therapeutie compound is at a level which raises a universal marker to at least five times its normal level, the universal marker being a constitutively ~yrtissed molecule whieh is transcriptionally activated by the therapeutie eompound in all disease status, and (c) eontinuing to ~m~ ter the therapeutie eompound at the dose level of step (b) until the universal marker returns to its normal level.
The invention also provides a me~hod of treating a disease condition via admini~tering a nueleie aeid component of defibrotide with a sequence speeific nueleie aeids eorresponding speeifically ~o seleeted parts of the viral genome or transcriptional factors.
The invention contemplates treating HIV infeetion in whieh HIV is not expressed and wherein the concentration of at least one immunological molecule, W O 98/48843 PCT~US98/08357 such as CD4, CD25,IL-l,IL-3,IL-4, IL--6, l~F and sIL2R,is followed. The method comprises:
(a) ~lmini~tering to the patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the effective amount is the amount which causes a universal marker to rise at least five times its normal level, the universal marker being the concentration of a constitutively expressed molecule which is transcriiptiionally activated by the therapeutic compound in all disease states, and (b) continuing to ~mini~t~r the effective amount of the therapeutic co-~-pound until the universal marker returns to its normal level.
The present invention i-lçntifies the active components of defibrotide and the variants thereof. The present invention also provides therapeutic oligonucleotides. Such the;l~peu~ic compounds can be used to treat various disease conditions.
RR FF nFA~CR~PTION OF l)RAVV~(;:~
Figure 1 is a diagram schem~ic~lly illustrating a preferred embodiment of the invention.
Figure 2iS a graph showing normal peripheral blood cells labelled with 0, 10, 20 and 40 ~g defibrotide-biotin comb,ination.
Figure 3 shows the data of Figure 18 on a linear scale.
Figure 4 is a graph showing the lymphocyte uptake of defibrotide without biotin and labelled with Cy5.18.
Figure 5 is a graph showing the monocyte uptake of defibrotide without biotin and labelled with Cy5. 18.
Figure 6 is a graph showing the granulocyte uptake of defibrotide without biotin and labelled with CyS. 18.
Figure 7 is a graph showing the percent ~ fession of HIV viral proteins remaining when blood Iymphocytes of an HIV infected individual were exposed to various doses of defibrotide with and without Con-A stimulation.
Figure 8 is a graph showing the laboratory response expressed in terms of mean linear fluorescence intensity of the peripheral blood mononuclear cells of an HIV infected individual, the cells being subjected in vitro to varying levels of defibrotide using a cell culture assay technique with and without Con-A
stimulation.
nF,T~l~,Fr~ l)FA~CR~PTION OF T~F, I~VFl~TION
The present invention provides a method for the clinical applications of therapeutic compounds including 1) the nucleic acid components identified in defibrotide or the variants thereof, 2) the nucleic acid components identified in defibrotide or the variants thereof in combination with sequence specific oligonucleotides, 3) the nucleic acid components identified in defibrotide or the variants thereof in combination with amino acids or other protein factors, 4) oligonucleotides containing homologous sequences of HlV and cellular regulatory factors or the variants thereof, 5) the nuclleic acid components identified in defibrotide or the variants thereof in combination with 4), and 6) sequence non-specific oligonucleotides .
The therapeutic compounds described in the present invention can be employed to treat various disease condition s including HIV infection and its related ~ise~es Preferably, the therapeutic compounds described in the present invention are a~mini~tered in a marker dependent manner. A "marker" is an observable characteristic of a patient which may be observed directly by a clinician or determined by diagnostic procedures. The state of an individual marker is correlatable with the status of the disease or repair processes in the patient. Dosing of the therapeutic nucleic acids according to the method of this invention is based on changes in the status of thes,e markers as taught herein.
Treatment of various disease conditions including HIV and its related disease states in accordance with the preferred method of the invention involves the admini.~tration of a therapeutic compound of the present invention at a daily dose level sufficient to increase the intensity, determined as concentration or clinical observation, of a marker of cellul;ar repair processes ("repair marker") to a plateau level (i.e., where the intensity of the marker is not changed by continued a~lmini~tration of the therapeutic compound). This daily dose level is the "maximum efficacious dose" for the particular disease and repair marker.
Administration of the therapeutic compound is continued at the same dose level until the repair marker stabilizes by returning to the normal level.
If at least one disease marker rem;ains in an abnormal state, the daily dose level of the therapeutic compound is increased. At least one other repair marker will increase in intensity, and the daily dose level is increased until the intensity of the new marker reaches a plateau level. A~lmini.s~ration of the therapeutic '~ W O 98/48843 PCT/US98/08357 -1~
compound is continued at this new maximum efficacious level until the respective repair marker stabilizes at the level and proportion ~ses~ in normal laboratory controls.
When all disease markers have rehlrned to the level of the normal state, imini~tration of the therapeutic compound is discontinued, but the levels of the disease and repair markers are monitored levery three weeks, for an additional 3 -6 months. If the levels of all markers remain at their normal state, cure has been achieved. If any marker deviates from nc,rmal at the end of any three week period, ~mini~tration of the therapeutic compound is resumed at the highest Nmaximum efficacious dose" that has been used during the immeAi~tP~ prior tre~tmçnt, and the new maximum effective dose is established by the known methodology.
The term "maximum efficacious dose" is defined herein as the daily dose rate, that will elicit, in nearly 100% of treated patients, the reversal of the respective disease markers to the uniformly normal level, and establi~hment of normal cellular markers. The maximum efficacious dose is usually ~plessed as amount of therapeutic compound admini~tered per kilogram body weight per day (DKGD). The maximum efficacious dose represents a novel concept of ~lministering a pharmaceutical agent in therapeutic medicine.
The term "maximum therapeutic doseN is defined herein as the total cumulative dose (the daily dose summed over the duration of administration) that will elicit in nearly 100% of treated patients the irreversible and complete CA 022~9041 1998-12-22 ~ 1 norm~li7~tion of the respective disease markers and resumption of normal cellular functions, i. e., the state of cure.
The term "minimum efficacious dose" is used herein to refer to the dose used in the heretofore universal practiced rnethod of administering a pharmaceutical agent. The minimum efficacious dose is the dose (daily dose or steady state level) that will elicit a particular pharmaceutical action in a certain percentage of patients, without inducing the pleiotropism of the whole repair process.
Pharmacological agents have heretofore been ~-1mini~tered at set dose levels (i.e., the "minimum efficacious dose") to treat the gross pathology and discontinued when complete or partial rem~ission of the gross pathology was achieved. Tre~tm~nt according to the prelerred method of this invention begins at the gross pathology stage which has one or more associated markers.
Norm~1i7~tion or improvement of those markers indicate that the tre~tment is beneficial. However, such a remission is not the event which causes discontinuation of therapy in accordance with this invention. Norm~1i7~tion of the markers of gross pathology indicates, rather, that a disease state corresponding to a lower level of disease activity has been reached. Markers of that stage (i.e., the lower level of disease activity) are identified and treatment is continued to normalize those markers. Complete cure is reached only if all stages of the revival process are treated.
The term "maximum tolerable dose," as used herein, is defined as the highest daily dose that can be administered without any complications, e.g., no CA 022~9041 1998-12-22 bleeding complications or thrombopathy, e tc. This in fact has been the sole and primary side effect of the high-molecular weight nucleic acid (defibrotide) utilized in the studies reported herein, i.e., the antithrombotic effect inducing bleeding complications at 300 mg/kg/day dose or above. If the maximum efficacious dose should be higher than the maximum tolerable dose, chemical modification of the nucleotide for more efficacious transmembrane transport and cellular entry would be neces~ry.
It has been determined that the therapeutic compound will not indefinitely increase tr,anscriptional activity with incre;asing doses. In this regard, transcriptional activity will shut off when the repair molecules are no longer needed, i.e., when no more "injury signal" is tr~ncmitted via stimulation of adenylate cyclase, second messengers, etc. In contrast, no matter how high the dose range in the normal individual may be, there is no induction of transcriptional activity (as indicated by, e. g., elevation in the von Willebrandt antigen (vWAg) levels). This supports the fact that no complications are seen with therapy using nucleotides which moclulate cellular repair mecl-~ni~ms for a therapeutic effect. For example, tissue plasminogen activator antigen (AgTPA) will not continue to rise indefinitely with increasing doses but will increase only in the presence of injury and at the locality of the injury, e.g., the existence of a thrombus which inevitably will be associated with the endothelial cell of the locality specific lesion. Hence no bleeding complications are to be seen secondary to systemic induction of the therapeutic compound at physiological dose ranges beyond the upper limits of the prior art thrombolytic therapy.
This mech~nicm is supported by the way the cell modifies activation of the repair process. As is well known, 50~ occupation of cell surface receptors will lead to 50% increase in the baseline level of inbracellular cAMP, 100%
occupation of cell surface receptors will lead to a 100% increase in the intracellular cAMP level. This will correspond to 5 times the elevation of the baseline vWAg level. Phosphorylation of various different branscriptional factors simultaneously will lead to concurrent tissue specific turning on or off of the respective transcriptional factors, e.g., sorne molecules are turned on and some are turned off. This constitutes the pleiobropism of the nucleic acids as herein defined.
Tr~t~hle r)ic~ St~t~c Various disease conditions including HIV infection and its related dise~s characterized by injury-based alteration in the production, expression or activity of compounds whose producbion, ~ ,ression or acbivity is regulated by the cell at least in part through 1) cell surface receplors such as Adenosine A, and A2, collagen, thrombin, epinephrin and norepinephrine receptors, 2) through the protein kinase A, protein kinase C, phosphorylation, or receptor tyrosine kinase pathway, 3) through cytokine-receptor superfamily and regulatory factors encoded by oncogenes, or by 4) protein factors whose phosphorylation affects genomic translation and transcription may be breated with the therapeutic compounds of the present invention in a marker dependent manner as described herein.
W O 98/48843 PCT/~S98/08357 1~1 Treatable disease states inelude 1) iinfeetious diseases sueh as HIV
infeetion, Protozoa infeetion, Schistosima infeetion, Schistoeerea ~ Pichm~ni~
infeetion, e.g., Schistosoma japonieum in]~eetion, Trypanazoma infeetion, e.g., Trypanozoma Cruzi infeetion, fungus infeetion, e.g., Candida tropiealis and Candida Albieans, Aspergillus infeetion, ]'neumoeystis earinii infeetion, Malaria, Plasmodium vivax, gram negative bacterial infeetion, Cytomegalovirus infeetion, Hepatitis virus infeetion, human papilloma virus infeetion; 2) genetic diseases such as Duchenne's Museular Dystrophy, Down's Syndrome; 3) degenerative di.ce~es such as eneephalopathy, dementia, .Al7h~.imer's disease, Parkinson's disease, neuropathy, eardiomyopathy, aging, Kearn's Sayre syndrome, retinitis pigmentosa, ataxia, seizures, proximal musele wç~kn.osc, leber's hereditary optic neuropathy, optie neuritis, radiation damage; 4) neoplasia sueh as Iympho-proliferative diseases, Iymphomas, Kaposi's sarcoma, pancreaotic cancer, neuroblastoma, leukemia, bladder carcinoma, breast cancer, skin cancer, lung cancer, colon cancer, and 5) skin riise~es sueh as molluscum contagiosum, bacillary angiomatosis, seborrheic dermatitis, psoriasis, Reiter's syndrome, insect bite reactions, Staphylocoecal folliculitis, E~osinophilic folliculitis.
The methodology deseribed herein has universal applieation within the scope of disease states charaeterized by the absenee or inadequaey of one or more of those eell funetions whieh are normally regulated through the eellular meeh~nism~ listed above so long as the abnormalities in these eell functions are yet still reversible. The methodology is also applieable to the disease states charaeterized by acquired or genetic dismodulation, andlor transformation.
1~
Revival, institution or reinstitution of the nornnal state of those functions is, by definition, a state of cure. Revival of the normal cell functions can occur where the ~ ie~ed cell preserves the biological capacity for the physiologically predefined events of the cellular repair functions of the recovery process, if those events are pharmacologically induced by the correct use of the therapeutic nucleic acids. Complete cure is the therapeutic objective. The decisive factor in the success of this therapeutic approach is not only the pharmaceutical agent, but how it is utilized. If the biological capacily for reg~ining normalcy is there, therapeutic failure is elimin~ted. This biologically predetermined potential for cure is reproducibly and predictably obtainable, however, only by the correctly determined iatrogen~tic~lly controlled dose levels, and duration of therapy.
Incorrect dose ~lmini~tration leads to the therapeutically missed event of complete cure. Complete cure, however, is not possible if neces~ry dose levels cannot be ~ ined without complications such as bleeding or thrombopathy.
While the marker dependent dose Imethodology is universally applicable, it has been surprisingly discovered that E[V, as well as associated opportunistic secondary infections can be effectively treated with the therapeutic compounds described in the present invention.
Ther~eutic Compoun~c The therapeutic compounds conternplated in the present invention include 1) sequence non-specific oligonucleotide, 2) nucleic acid components of defibrotide, 3) variants and derivatives of 2), 4) sequence specific nucleic acid in combination with 2), 5) amino acids or protein factors in combination with 2), 6) CA 022~9041 1998-12-22 oligonucleotides containing homologous sequences of HIV sequence and other genes encoding cellular regulatory factors.
Sequence non-specific oligonucleotides of the present invention is an oligomer or a polymer of deoxyribonucleotides or derivatives thereof. The compound may be native or chemically synthesi7~d, or a fragment of a native polydeoxyribonucleotide. The compound has at least three nucleotide residues, and may have up to about 250 residues. F'referably, the nucleotide compound will have from about 15 to about 200 residues, more preferably from about 20 to about 150 residues, most preferably from about 50 to about 75 residues. The sequence of the nucleotide residues in the polymer is not critical, and may include interdisposed sense, anti-sense, nc,n-sense or missense sequences. A
therapeutic composition may contain polynucleotide molecules with varying numbers of residues within the range described above. The skilled worker will be able to select an appropliate length (degree of polymerization) based on the ability of the compound to penetrate the cell and on the ability of the compound to cause a change in the level of various repair markers in accordance with the method of this invention.
The nucleic acid compound will preferably be relatively resistant to ecto-and endonucleases. The 3' OH of the tenninal residue of the therapeutic compound according to this invention may be phosphorylated or not, and the compound will still function without the need for intracellular phosphorylation.
The therapeutic compound according to this invention is a polyanion, and the negative charge is balanced by counter ions. The counter ions may be alkali i~
metal ions or alkaline earth ions, biologic amines or other suitable counter ions which do not interfere with treatment according to the metlnod of this invention.
Preferably, at least some of the counter ions are zinc ions. The amount of zinc, however, may be increased either be directly incorporating zinc into the nucleotide compound or, alternatively, by 7,~minictering zinc, e.g., in the form of a dietary supplement, along with the tlnerapeutic nucleotide. Zinc containing compounds may be coadminictered with the nucleotide to obtain a ratio of from 2 - 20 zinc atoms per phosphate group or iodine atom.
Defibrotide may be obtained from m~mm~ n tissues as described in U.S. Patent 3,770,720 or obtained from commercial source, e.g., CRINOS
Farmacobiologica S.p.A., Villa Guardia (Como), Italy. Any means known in the art may be used to analyze the nucleic acid components of defibrotide.
Usually, HPLC can be used to separate defibrotide into its nucleotide and oligonucleotide components. For instance, in reversed-phase HPLC, defibrotide may be run on a Vydac C8 or C18 analytical HPI C column using a Rainin HPLC system. The flow rate could be set at 1 ml/min and the eluent can be monitored at 260 nm and 280 nm wavelengths. Such column run may be carried out isocratically using 0.1 TFA in water. In some runs, peaks can be collected for subsequent mass spectrometry.
It is a discovery of the present invention that all defibrotide components are eluted in approximately 8-10 peaks within 10 minutes. In order to identify the nucleotide composition of defibrotide, the mono-, di-, tri- and cyclic monophosphates of T, C, G, A, and U may be chromatographed under conditions identical to those used for defibrotide. If the retention time for a purified nucleotide is superimposeable (+ 0.1 min) on a defibrotide peak, it can be taken as evidence for the putative presence of such nucleotide in defibrotide.
Peaks collected from HPLC runs may be concentrated by vacuum evaporation and be analyzed in mass spectrometry. All mass spectra may be collected on a matrix ~c~i~ted laser desorption ionization-time of flight (MALDI-TOF) Voyager Biospectrometry Workstation (Perseptive ]3ioSystems) and run in the negative ion mode.
It is a discovery of the present invention that a simple HPLC C8 column elutes with 0.1% TFA in water provides tlhe best separation of defibrotide obtained through commercial source, i.e., Noravid (CRINOS Farmacobiologica S.p.A., Villa Guardia, Italy). Defibrotide elutes from a C8 column in approximately 10 peaks with retention timies between approximately 3 and 9 minutes. One of the peaks, i.e., peak nurnber 4 represents two 25-30 mer oligonucleotide with molecular weight of about 8171.58 and 8433.75 Dalton, respectively. Only routine experimentations are needed to sequence the two 25-30 mers.
The nucleic acid components of defibrotide include all nucleotides and/or oligonucleotides identified in defibrotide which include but are not }imited to dCTP, dATP, dGTP, dTTP, dAMP, dGMP, dCDP, dADP, ATP, AMP, CTP, CMP, UTP, cyclic TMP, cyclic UMP, c~yclic GMP, oligonucleotides containing from 6 nucleotides to less than 60 nucleolides, aptamer #1 GGTTGGATTGGTTGG (SEQ ID NO~ , aptamer #2 GGTTGGATCGGTTGG
Iq (SEQ ID NO:2), aptamer #3 GGATGGAl'CGGTTGG (SEQ ID NO:3), and aptamer #4 GGTGGTGGl~GTGGT (SEO ID NO:4), and two 25-30 mer oligonucleotides with molecular weight of about 8171.58 and 8433.75 dalton respectively and identified via HPLC anal~ysis as discussed above.
Any variant of the nucleic acid components can also be used as the therapeutic compounds in the present invention. Variants include oligonucleotides having complete or partiaLl sequence homology with the oligonucleotides of defibrotide. Variants include nucleic acid fragment comprising the oligonucleotide sequences identified in defibrotide. For example any DNA fragment containing the oligonucleotide sequence of defibrotide and additional sequences at the ends of the oligonucleotide sequence is contemplated in the present invention as a variant. Normally the number of additional nucleotides at the ends is from 1 to 100, preferably from about 5 to 50, more preferaby from about 10 to 30.
The homology level may be at least from about 505'o to about 70 %, preferably 80% to 90%, more preferably 95 % . The homologous region may be continuous or scattered through out a nucleotide fragment. For example, aptamer #l of defibrotide (5'-GGTTGGATTGGTTGG-3') has complete and partial homology to several genomes, e.g., Schizosaccharomyces, pombe GATA-binding region, and Streptococcus pneumonia Dpn I gene Aptamer #2 of defibrotide (5'GGTTGGATCGGTTGG-3') has homology to several genomes, e.g., Mycobacterium leprae cosmid B0462.
CA 022~9041 1998-12-22 Aptamer #4 of defibrotide (5'-GGTGGTG&TTGTGGT-3') has homology to various genomes, e.g., chicken liver cell adhesion molecule, human gelanin receptor mRNA, Schistosoma japonicum eggshell protein, Schistosoma japonicum ESG-1 protein mRNA, human mRNA with TGG repeat clone 83, Schistosoma japonicum ESG-2AA protein mRNA, Candida tropicalis POX9 gene, Candida Tropicalis cat gene, Schistocerca americanaL ~ntenn~pedia, chicken liver cell adhesion molecule, human papilloma virus ~:ype 20, homo sapiens mitochondrial genome, gorilla mtDNA, human mtDNA, human DNA sequence from cosmid U1 57D, T ~ishm~ni~ major cosmid clone L2759, Plasmodiun vivax Serine repeat antigen, P. clarkii mRNA, Trypanosoma cn~zi mucin-like protein, L. major mRNA
for surface antigen P2, Aspergillus aculeatus (clone PClG1), Candida Albicans DNA for MNT2 gene, E.Coli K-12 genome, Mouse amyloid beta precursor, Candida Albicans topoisomerase type, human homolog of Drosophila spilicing gene, E. Coli gcvh gene 3'end, human Do~m Syndrome region of Chromosome, E.
Coli gcv operon gene sequence, Drosophila melanogaster receptor protein and polyheamotic DNA, human Papilloma virus type 25 genomic, Drosophila melanogaster Zn finger, Pneumocystis carinii, Dystrophin associated protein of Duchenne's mllsc~ r dystrophy, ( Sequence 7 from US #5,449,616), and DNA
Polymerase (Sequence 14 from US # 5,556,772).
Variants of aptamer # 4 also inc]ude homologous sequences of HIV and aptamer #4. For example, homologous sequences may be found in gag/pol, c-vif, or env regions of HIV. Particular homologous sequences may be found on three sites on gag/pol ~V genome region The translation of the aptamer #4 region on gag site is a peptide 'PEPTA", and the pol gene fragment tr~n~l~tes the same DNA
sequence into 'TRANS. In a preferred embodiment, S-Oligo variants of aptamer #4 are 1)5 ' GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCC
CTTG3', 2) 5'ACCAGAGCCAACAGC3', 3) 5' CCTGGCCTTCCCTTG3'.
Variants of aptamer #4 also include homologous sequences of a gene encoding a cellular regulatory factor and aptamer #4. Examples of such homologous sequences are listed in Table l.
Table 1. Examples of Sequences Homologous to Aptamer #4 Cellular~Factor~Strand ~Homolog5t~Region ~Match~Percent~
human myc anti-S 2345-2449 13 86.6 TNF-Receptor anti-S 5039-5053 12 80 0 anti-S 036-9~50 12 80.0 anti-S 5574-5588 11 73 0 anti-S 5045-5059 11 73 0 S 2577-2.591 11 73 0 human TNF S 693-707 11 73.0 S 1149-1163 11 73.0 bTNFg S 6375-6389 10 66 6 S 1872-1886 10 66.6 S 1565-1579 10 66.0 bTNFfg anti-S5638-5652; 5355-5369; 10 66 6 5046-5060; 4447-4461;
4435-4449; 4224-4238;
4221-4235; 1990-2004;
1125-1139; 933-947;
930-944; 119-133.
Sl,~JTE SHEET I~RULE 26) CellularFacfo~Strand ~ Homolc~ egion ~ Mafch~ ~ Percent hsch-ras anti-S 15-:29 12 80.0 18-:~2 bt-ras S 1404- 1418 10 73.0 anti-S 978-'~92 10 66.6 975-'~89 hsch-ras anti-S 12-26 10 66.6 21-:35 human-ras-md anti-S 28- i2 10 66.6 15-:29 human-abl S 3253-3267; 3064-3078; 10 66.6 3061-3075; 3058-3072;
2918-2932; 2195-2209;
2189-2203; 1952-1966;
1059-1073.
humanbcl S 3253-3267; 3064-3078; 10 66.6 3061-3075; 3058-3072;
2918-2932; 2195-2209;
2189-2203; 1952-1966;
1050-1064.
anti-S 3451-3465; 1366-1380;
1198-1212; 120-134;
270-284.
humanfos S 5166-5180; 3358-3372 10 66.6 anti-S 6019-6033;.5561-5575;
4901-49~5; 3695-3709;
361-375; 9'3-112; 35-49.
human IL-1 S 247-261 10 66.6 anti-S 920-~34 10 66.6 SUBSTITUTE SHI_ET (RULE 26) CA 022~9041 1998-12-22 ~3 CeU~ ctar~ S~and ~ k ~ lrgy:~ n~ ~h Feroent Musnos S 3717-3731; 3685-3699; 10 66 6 (ni~ic oxide 2904 2918; 2669-2683;
synthase) 2408 2422; 2007-2021.
anti-S 2806 2820; 2572-2586;
2530 2544; 1720-1734;
1717-1731; 1237-1251;
1075-1089; 504-518.
Variants of aptamer #4 also include homologous sequences of mitochondrial DNA and al)~alller #4. Aptamer #4 has 100 % homology to NADH Dehydrogenase Subunit 6 at target site of 13741; homology of 86.6% to tRNA glu. at target site of 14101; homology of 80 % to NADH Dehydrogenase subunit 4 at target site 10249;
homology of 80 % to 16 S rRNA at target site of 1924; homology of 73 3% to D-loop at target site of 16470; homology of 73.3% to NADH Dehydrogenase Subunit 5 at target site of 14227; homology of 73.3% to NAD Hydrogenase Subunit 6 at target site of 13819; homology of 73.3 % to NADH Dehydrogenase of Subunit 6 at target site of 13744; homolo~y of 73 3 % to NADDhydrogenase Subunit 5 at target sites of 13467 and 117~53; homology of 73 3 % of NAD
Dehydrogenase of Subunit 6 at target site 10246; homology of 73.3 % to cytochrome oxidase Subunit 3 at target site of 8820; homology of 73.3% to cytochrome oxidase subunit 6 at target site 8327; homology of 73.3% to ATPase subunit 8 at target site 7810; homology of 73 3 % to tRNA-lys at target site of 7752; homology of 73.3 % to cytochrome c oxidase subunit lat target sites 5961, 5478; homology of 73.3 % to NAD Dehydrogenase Subunit 2 at target sites of 4871, 4733, 45594145; homology of 73 3 % to NADH Dehydrogenase Subunit 1 at CA 022~9041 1998-12-22 ' ' W O 98/48843 PCT~US98/08357 target sites of 2922, 2919; and homology of 73.3 % to 16S rRNA at target sites of 1936, 163S
Derivatives of the nucleic acid components are contemplated in the present invention. Derivatives include the nucleic acid components conjugated with poly(L-lysine) or modified by, for example, the addition of amino acids such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals and ions including zinc, m~ng~nese and iodine, by the addition of 5'-polyalkyl moieties, cholesterol, vitamin E, 1-2-di-0-hexadecyl-3-glyceryl and other lipophilic moieties and/or modified by the replacement of phosphodiester bonds with phosphothiotate bonds, and/or modified nucleotide sequences of the prototype nucleic acid, defibrotide.
Derivatives of the nucleic acid cornponents of defibrotide also include modified nucleic acid components. Any ~modification method known in the art may also be employed to modify the nucleic acid components of defibrotide. For example, addition of RNA monomer, i.e., adenosine on the 3' end of a DNA
oligonucleotide by using an RNA-3 ' solidl support with (di)phosphorodimite chemistry; insertion of ~-lçn~ne, deoxyadenosine, or dA adnine base in a oligonucleotide; insertion of 5' monophosphate, e.g., S'-P-A-C-G-T or 3' monophosphate, e.g., A-C-G-T-P-3' at any selected spot on an oligo using (di)phosphoramidite chemistry; addition of any nucleotide on the end of tri-phosphates, e.g. N-P-P-P-A-C-G-T; production of di-nucleotides, e.g., N-S'-P-P-P-P-S'-N; conjugate NTP to any oligonucleotide, e.g., N-S'-P-P-P-P-S';
CA 022~9041 1998-12-22 ' r WO 98/48843 PCT~US98/08357 coupling of cyelic nueleotides, e.g., use of APPPPA-synthase to make A-5'-P-P-P-P-5'A; membrane support modifications including addition of eholesterol to any position of an oligonueleotide with (di)phosphorodimite ehemistry; addition of peptides via carboxy-dT to any pOSitiOII on an oligonucleotide (carboxy-dT can be coupled directly to a molecule containing a primary amino group using peptide chemistry or via the intermediate N-hydroxysuceinimide (NHS) ester);
attaching molecules to any site on an oligonucleotide using amino linkers and linker-spacers via NHS ester chemistry; linking oligonucleotides together, e.g., 5'-5' or 3'-3' with (di)phosphorodite chemistry; thiolated, methylayed, or in the form of propyne oligonucleotides antisense oligonucleotides produced via (di)phosphorodite chemistry; multiple syrnmetric (same sequence) or asymmetric (different sequence) braced oligonucleotides with targeted virus and subtargeted cellular elements via (di)phosphorodite.
Oligonucleotides containing a homologous sequence of HIV and a gene encoding a cellular regulatory factor are also contemplated in the present invention. The sequence homology between HIV and other cellular regulatory factors may be at least 40%, preferably at least from 60% to 70%, and more preferably from 80% to 90%. The lengt~h of the homology region may be from 3 nucleotides to 100 nucleotides, preferably from 6 to 60 nucleotides. The cellular regulatory factors include transcription factors, oncogene products, and any factors involved in the signal transduction pat]hway, e.g., TNF receptor, RIP, IL-2 receptor, IL-1 analog, TNF-a, c-myc, c-abl, c-fos, c-ras, dystrophin, surface glycoprotein proteins of L-CAM and eathedrin, and B-myb. Table 6 lists a few examples of sueh oligonueleotides.
Table 6. Examples of Oligonueleotides Oligonucleotide Homology Region in HIV Cellular Regulatory Faetor CAGCTGCACCTGCCAAGC gag/pol 968-984 human TNF reeeptor ATAAAATATACCATATACA gag 2315-2331 human RIP protein kinas~
(HSU50062) TCATAAAATATACTATATTCA gag 2312-2331 mouse TNF reeeptor (mmu 25995) ATATTAAAGAAeGeTGmAeAAT vif 4847-4876 IL-2 receptor ACTTGG
ATGCA~l~ GAAGAGAA env 7485-7502 TNF receptor (eell death protein HSU25994) AATTAAGGcATAAGAAAAcTAAGA env 6118-6150 IL-1 analog AATATGCAC
CCTCAAGGACTCAGCTTT 5'untr~n.~1~t~d region pos. TNF-a promoter CAATAATAAAAGGGGAAA gag 186-203 e-myc AGTGCAACCGGCAGGAGGTGA 5' untr~n~l~ted ~egion pos. c-abl GeeAceAGeeeeTeeeeAGAeTeT pol 1522-1547 B-myb, c-myc ~AGGTGGAGGCAACAG
protooncogene Defibrotide or the nucleic acid components of defibrotide and variants thereof may be ~t~mini~tered in combination with 1) sequence specific nucleic acids, 2) amino acids, 3) protein factors, 4) sequence specific nucleic acids and sequence non-specific nucleic acids, 5) sequence specific nucleic acids and sequence specific peptides including but are not limited to peptides encoded by oligonucleotides of defibrotides and the vilnants thereof, 6) sequence specific nucleic acids and sequence non-specific peptides.
The sequence specific nucleic acids include but are not limited to anti-protease sequences, retroviral promoter s~quences, TAR s-equences, HIV mutants of TAR decoy RNA, mutants TAR decoy RNA, negative mutants of the viral REV transactivator, synthetic promoters ~vith the con~sen~us sequence for binding of the transcription factor Spl and the TA~TA box, mutants of TATA box, TAT
mutants wherein the mutations involving ~he seven cysteine residues, sense, anti-sense, mi~sçn~e derivative of CIS acting negative elements (CRS) present in the integrase gene and REV mutants, transdominant suppressors of REV (mutations involving amino acid 78 and 79), NEF~DNA sequences and its mutants with or without U3 region sequence of the 3'LTR, POL reverse transcriptase gene mutants, POL viral integrase gene and its mutants, POL viral protease gene mutants, HIV-I LTR enhancer (-137 to -17) mutants, HIV LI~R promoters starting at -78, HIV LTR sequences encoding a arginine fork from aa27 to aa38, HIV-I LTR s,ense sequences of the negative regulatory element (-340 to -185), HIV-1 LTR consensus sequences for binding of transcription factors of AP1/COUP, NFAT-1, USF, TCF-~ -KB, TCF-la, TBP, and inhibitors of the con~.ns~ls sequence, LTR NFkB mutants (-104 to -80), LTR Spl (GC box) binding site and TATA box mutants, LTR GAG gene sequence mutants, LTR
mutants (~54 to +180), LTR genomic re.peats at +80, LTR regions responsive for cellular transcription factors between and to the left of U3 to -454 extending to -7, 3' LTR and its variants, 5' LTR and its variants, LTR variants, inhibitors of UBP-1 or LBP-l binding sequence (-5 to +82), ENV, GAG, POL gene sequences placed 3' of the REV mutant codon, short sequence mutants (15-60 mer), and host DNA sequences of preferred targets for proviral integration.
Amino acids ~mini~tered in combination with the nucleic acid components and the variants thereof include these involved in signal transduction pathways and phosphorylations. They include but are not limited to threonine, serine, tyrosine, and proline.
Protein factors ~mini.ctered in combination with the nucleic acid components and the variants thereof include DNA polymerase, protease inhibitor, and reverse transcriptase inhibitor.
In ad~litic)n, N-containing ring compounds, e.g., pyrimidine, purine, adenylic, and guanosine can also be ~m.ini.ct~o.red in combination with the nucleic acid compounds and the variants thereof in the present invention.
The homologous sequences of HIV and a gene encoding a cellular regulatory factor may also be administered in combination with homologous sequences of nucleic acid components of defibrotide and the variants thereof, . . ~
espe,cially the homologous sequences of aptamer #4 and a gene encoding a cellular regulatory factor.
The nucleic acid compounds of the present invention can be ~-~mini~tered directly or via a vector. Any vector capable of replicating in vivo can be used to carry the nucleic acid compounds. Preferably, the vectors employed are suitable for gene delivery. Expression/replication vectors are readily available in the art, e.g., pCI, pCI-neo.
It is a discovery of the present in~ention that mitochondrial genome, especially origin of ~eplication, e.g., from a human can be used to construct replication/e~ ession vectors. Preferably, 5' end of mitochondrial 12S RNA
con~ining sequences from about nucleotide 72 to 1025 and mitochondrial DNA
containing sequences from nucleotide 1 to 72 can be used.
In replication/~A~lt;ssion vectors, the oligonucleotides of the present invention can be flanked by some buffer sequences. In a plefell~d embodiment, pCI-neo vector can be cut by Bgl2 and BamH1, and eIF-4E initiation factor gene may be inserted. The sequence of eIF-4E gene specifically relevent to such vector is GGCCAGGCATGGTAAGTCATACCTATAATCCCAGCACTGTGGGAGGCC
AAGGAAGGGGGATCCCTTGAGCTC'AAGAGTTTAAGACCGAGATCGAT
(upstream of Alu) and AAAGAGTTTAAGACCAGCTTGGGC'AACACAGTCAGACTTCATCTCTAT
AAATAATTTAAAAATTAGCCAAGCATGGTGGCGTGGTACCCTTGTGGG
TTCCAGGCTTATTTGGGAGGTTGAGGTAAAGGAATTCTCTTGGACGCCC
AGGTAGTCAAGGTTGCAGTGAGCCATAATCAAACCACTGCACTCCAGC
ATGGCAACAGAGCAAGACCCCATCTCAAATATAT (downstream of Alu).
Subsequently, the oligonucleotides of the present invention can be inserted into the eIF-4E gene, preferably at the Alu site of eIF-4E gene.
In replication/expression vectors, the oligonucleotides of the present invention can be driven by a promoter, especially a TAR promoter, a HIV LTR
promoter, or a promoter of DNA polymerase. Alternatively, the oligonucleotides of the present invention can be co-expressed or co-replicated with a gene encoding DNA polymerase. Tat protein may be added to enhance vector replication.
The mitochondrial vectors discussed above can also be used to supply oligonucleotides with wild-type mitochondrial sequences. HIV patients are likely to have mutations in mitochondrial DNA, e.g, cytochrome-oxidase (COX) gene, NADH subunits, origin of replication, D-loop, t-RNA lysine, tRNA glu, and ATPase subunits. It is routine to screen these genes for mutations. Upon finding of mutations in mitochondrial DNA, oligonucleotides containing the colre~l)onding wild-type mitochondrial DNA sequences can be a~lmini~tered to treat the disease conditions associated with such genetic alterations.
It is also a discovery of the present invention that a drug resistance can be treated via ~dmini~tçring the nucleic acid components of defibrotide and the variants thereof in combination with the drug, e.g., a prote~se inhibitor.
~rker-nrivPn Ther~y The c!~imPd method involves the use of a "marker dependent dose ~essment" methodology for determining~ the therapeutically most efficacious use of the respective pharmaceutical agents. The use of incremental marker stratification reflects the concept that "mcLximum efficacious dose" is redefined through the different stages of treatment, each time ad3usted to the respective specific marker most representative of the respective pathogenictclinical picture of the disease state. Tre~tment at respec~ively higher doses corresponding to the progressively lower disease activity levels are continued until a state of total cure is reached.
Intrinsic to the claimed method is the total elimin~tion of empirically 2ccesced doses or constant therapy doses, arrived at by the universal pharmaceutical principal of "minimum eiFficacious dose" for a class of drugs, which, until the present time, has been the standard for the definition of the "effective therapeutic dose." The respective doses thereof are defined to elicit a response colrcs~nding to different disea.se i~unctions of the treated cell and revival of the respective disease parameters, in a stratified fashion.
The method of treating various ~ ces provided by this invention uses specific clinical and laboratory markers ~o assess dosages to be ~flmini.~tPred.
The markers vary from gross clinical observations of pathology to the progressively subclinical vet valid detection of certain laboratory levels associated with a particular disease. The preferred markers are the clinical _ . .
CA 022~9041 1998-12-22 W O 98/48843 PCT~US98/08357 ~3 absent genomes, under-regulatedtsuppressed genomes), and/or over-expressed, not appropliately shut off transcriptions of genomes (e.g. activated repair molecules, second rnes~engers and molecules of signal transduction pathways).
Disease l,.alkers are observable characteristics of the organism whose status in a disease state differs from the status in the normal (non-disease) state.
Such characteristics and their association with their respective disease states are well known to the skilled practitioner. In the practice of the method of this invention, it is contemplated that the practitioner will monitor the status of multiple disease markers relat~d to the di,sease being treated, either simultaneously or sequentially. The disease markers include both clinical markers, which are observed directly by clinician, and laboratory markers, which represent qll~ntit~tive values determined by support staff. These characteristics include, but are not limited to, the concentration of compounds whose production or expression is affected by injury-based alteration of cell surface receptors such as Adenosine A, and A2, collagen, thrombin, epinephrin and norepinephrine receptors, of protein kinase A or protein kinase C pathways, or of protein factors whose phosphorylation affects genomic lranslation and transcription, or hybridization of genomic enhancers/ inhibitors infusion or excess enhancers, infusion of excess genomes to deplete viral/cellular transactivation transcription factors, etc. where the concentration in Ihe disease state differs from the concentration in the normal state. Disea~se markers for HIV related disease states include odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptococcal diarrhea, Karnofsky performance score, waste syndrome.
SECONDARY INF~C'TIONS TE~EREOF
This application is a continuation-in-part of application Serial No.
08/185,416, filed January 24, 1994, which is a continuation-in-part of application Serial No. 08/002,395, filed January 13, 1993, which is a continuation-in-part of application Serial No. 07/748,277, filed August 21, 1991, and application Serial No.
07/830,886, filed February 4, 1992 which is a continuation-in-part of application Serial No. 07/815,130, filed December 27, 1991.
~;IJD OF INVENTION
The present invention relates to a rnethod of a~minictering 1) the nucleic acid components identified in defibrotide or the variants thereof, 2) the nucleic acid components identified in defibrotide or the variants thereof in combination with sequence specific oligonucleotides, 3) the nucleic acid components identified in defibrotide or the variants thereof in combiination ~vith amino acids or other protein factors, 4) oligonucleotides cont~ining ho!mologous sequences of HIV and cellular regulatory factors or the variants thereof, 5) the nucleic acid components identified in defibrotide or the variants thereof in combination ~vith 4), or 6) sequence non-specific oligonucleotide to treat various disease conditions including HIV infection and its related di.ce~es. The present invention discloses oligonucleotides and vectors which can be used as therapeutic compounds according to the invention.
The present invention also relates to a tre~tm.q.nt of drug re.~ t~nce.
BACKGl~OUN~ OF I~F INVENTION
Defibrotide is a polyanion salt of a deoxyribonucleic acid obtained from mammalian tissue. Defibrotide is a single-stranded polydeoxyribonucleotide with molecular weight of approximately 20 kDa (low molecular weight form) which may be obtained from bovine lung DNA by controlled hydrolysis. Patents related to its manufacture include U.S. Patent 3,770,720 directed to a process for extracting DNA from m~mm~ n tissue, and U.S. Patent 3,899,481 directed to a process for the controlled partial degradation of DNA extracted from animal organs.
Experimental studies have been performed to investigate the active component of defibrotide. U. S. Patent 3,770,720 discloses that the components of defibrotide include phosphorus 8.5%, Na 9.0%, N 14.0%, deoxyribose 23.2%, total bases 34.0%, guanine 9.4%, thymine 9.4~~, adenine 9.2%, cytosine 6.0%, uracil absent, Iodine, and Zinc.
Bracht et al., (Biochem. and Biophys. Res. Com., vol. 200, No.2, 1994, pp.933-937) have disclosed four aptamer sequences derived from the unfractionated defibrotide DNA precursor molecule. Tu o aptamers (5'-G'~TTGGATTG'~TTG~-3' and 5'-G~TTG'~ATCG'~TTG'~-3') were identified by thrombin chromatography. Another aptamer (5'-G'~ATGGATCGGTTGG-3') was found in the PCR product from the double-CA 022~9041 1998-12-22 stranded DNA precursor. The sequence of such aptamer was used to search the EMBL data base and was found in the bovi:ne genome and Angiotensin II-AT 1 receptor. The three aptamers were found to have inhibitory activities of thrombin induced platelet aggregation, thromboxane biosynthesis, increase in cytosolic Ca ~, and fibrin clot formation. In addition, there is a non-function aptamer (5'GGTGGTGGTTGTGGT3') whlich did not display any ofthe activities characteristic of defibrotide.
H~V infection is characterized by a progressive decline in immune system function, supp[es~ing the infected host's ability to overcome other, secondary infection. No cure has been found for HIV infection. The pathogenetic process in HIV infection is never unidimensional but, rather, ex:tremely complex and mllltif~ctorial The pathogenic progression may be only tangentially related to the direct infection of a given target cell. Death is almost inevitable, usually from an over~vhelming secondary infection andJor EIIV related neoplasm.
Current treatments for HIV infection attempt to retard the progress of the disease or relieve its symptoms. Treatment in use today include certain dideoxynucleotides such as azidothymidine (AZT or zidovudine, Burroughs Wellcome), dideoxyinosine (ddI, Bristol-Myers Squibb) or dideoxycytidine (ddC, Hoffman-LaRoche). These agents can be toxic. Their applicability is limited because of the appearance in some patients of onerous, and sometimes lethal, side effects. These side effects include myelosuppression, peripheral neuropathy, and pancreatitis. In some pa,tients, AZT has lost its effectiveness after prolonged use. While other drugs have been proposed for treatment of HIV
,.
infection, including the recent introduction of several HIV protease inhibitors, none have yet been demonstrated to be completely effective. Therefore, there remains a need in the art to develop additional therapeutic agents to treat HIV
infection. In particular, there is a need in the art to further identify the active components of defibrotide and their appli,cations in various disease conditions.
\/r~ARy OF TRF ll~VFl~TION
It is an object of the invention to provide a method useful in treating a disease condition in a patient, such as infi~ctious ~ ces, genetic (lice~.ces, degenerative ~i.ce~ces, DNA damage, neoplasia, and skin ~i.ce~ces.
To accomplish this objective, the invention provides a method of tre~tmP.nt comprising ~iminictering to a patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
Preferably, the method is practiced in a marker dependent manner, which method of treating a disease condition comprises:
(a) determining the initial state of a set of disease markers, the disease markers being observable characleristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, ~ b) a-~mini~tering to the patient a dose of a therapeutic compound comprising a nucleic acid cornponent of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following ~mini~tration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, the repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) ~dmini~tering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) .md (e) until the intensity of the repair marker in step (c) no longer increases, (g) ~ministerin& the the~ueutic compound at the highest dose level ~tt~in~d in step (f) until the intensity of the repair marker returns to the normal condition, and (h) ~rlmini~tering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of the set of disease markers no longer deviate from the normal condition.
The patient is monitored weekly for three or more weeks. If relapse occurs, as indicated by a deviation of one or more disease and/or repair markers .
from the normal level, therapy is reinitiated at the highest dose level of the prior course of therapy until norm~li7~tion is ag;ain reaehed.
In a particularly preferred embodirnent of the invention, the method of treating a disease condition comprises the steps of:
(a) determining the initial state of a set of disease markers, the disease markers being observable charaete:risties of a patient whieh deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range whieh is indicative of the normal condition, (b) ~dmini~tering to the patient a dose of a therapeutie compound comprising a nueleie aeid eomponent of defibrotide, but not ineluding defibrotide, wherein the dose of the therapeutie compound is at a level which raises a universal marker to at least five times its normal level, the universal marker being a constitutively ~yrtissed molecule whieh is transcriptionally activated by the therapeutie eompound in all disease status, and (c) eontinuing to ~m~ ter the therapeutie eompound at the dose level of step (b) until the universal marker returns to its normal level.
The invention also provides a me~hod of treating a disease condition via admini~tering a nueleie aeid component of defibrotide with a sequence speeific nueleie aeids eorresponding speeifically ~o seleeted parts of the viral genome or transcriptional factors.
The invention contemplates treating HIV infeetion in whieh HIV is not expressed and wherein the concentration of at least one immunological molecule, W O 98/48843 PCT~US98/08357 such as CD4, CD25,IL-l,IL-3,IL-4, IL--6, l~F and sIL2R,is followed. The method comprises:
(a) ~lmini~tering to the patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the effective amount is the amount which causes a universal marker to rise at least five times its normal level, the universal marker being the concentration of a constitutively expressed molecule which is transcriiptiionally activated by the therapeutic compound in all disease states, and (b) continuing to ~mini~t~r the effective amount of the therapeutic co-~-pound until the universal marker returns to its normal level.
The present invention i-lçntifies the active components of defibrotide and the variants thereof. The present invention also provides therapeutic oligonucleotides. Such the;l~peu~ic compounds can be used to treat various disease conditions.
RR FF nFA~CR~PTION OF l)RAVV~(;:~
Figure 1 is a diagram schem~ic~lly illustrating a preferred embodiment of the invention.
Figure 2iS a graph showing normal peripheral blood cells labelled with 0, 10, 20 and 40 ~g defibrotide-biotin comb,ination.
Figure 3 shows the data of Figure 18 on a linear scale.
Figure 4 is a graph showing the lymphocyte uptake of defibrotide without biotin and labelled with Cy5.18.
Figure 5 is a graph showing the monocyte uptake of defibrotide without biotin and labelled with Cy5. 18.
Figure 6 is a graph showing the granulocyte uptake of defibrotide without biotin and labelled with CyS. 18.
Figure 7 is a graph showing the percent ~ fession of HIV viral proteins remaining when blood Iymphocytes of an HIV infected individual were exposed to various doses of defibrotide with and without Con-A stimulation.
Figure 8 is a graph showing the laboratory response expressed in terms of mean linear fluorescence intensity of the peripheral blood mononuclear cells of an HIV infected individual, the cells being subjected in vitro to varying levels of defibrotide using a cell culture assay technique with and without Con-A
stimulation.
nF,T~l~,Fr~ l)FA~CR~PTION OF T~F, I~VFl~TION
The present invention provides a method for the clinical applications of therapeutic compounds including 1) the nucleic acid components identified in defibrotide or the variants thereof, 2) the nucleic acid components identified in defibrotide or the variants thereof in combination with sequence specific oligonucleotides, 3) the nucleic acid components identified in defibrotide or the variants thereof in combination with amino acids or other protein factors, 4) oligonucleotides containing homologous sequences of HlV and cellular regulatory factors or the variants thereof, 5) the nuclleic acid components identified in defibrotide or the variants thereof in combination with 4), and 6) sequence non-specific oligonucleotides .
The therapeutic compounds described in the present invention can be employed to treat various disease condition s including HIV infection and its related ~ise~es Preferably, the therapeutic compounds described in the present invention are a~mini~tered in a marker dependent manner. A "marker" is an observable characteristic of a patient which may be observed directly by a clinician or determined by diagnostic procedures. The state of an individual marker is correlatable with the status of the disease or repair processes in the patient. Dosing of the therapeutic nucleic acids according to the method of this invention is based on changes in the status of thes,e markers as taught herein.
Treatment of various disease conditions including HIV and its related disease states in accordance with the preferred method of the invention involves the admini.~tration of a therapeutic compound of the present invention at a daily dose level sufficient to increase the intensity, determined as concentration or clinical observation, of a marker of cellul;ar repair processes ("repair marker") to a plateau level (i.e., where the intensity of the marker is not changed by continued a~lmini~tration of the therapeutic compound). This daily dose level is the "maximum efficacious dose" for the particular disease and repair marker.
Administration of the therapeutic compound is continued at the same dose level until the repair marker stabilizes by returning to the normal level.
If at least one disease marker rem;ains in an abnormal state, the daily dose level of the therapeutic compound is increased. At least one other repair marker will increase in intensity, and the daily dose level is increased until the intensity of the new marker reaches a plateau level. A~lmini.s~ration of the therapeutic '~ W O 98/48843 PCT/US98/08357 -1~
compound is continued at this new maximum efficacious level until the respective repair marker stabilizes at the level and proportion ~ses~ in normal laboratory controls.
When all disease markers have rehlrned to the level of the normal state, imini~tration of the therapeutic compound is discontinued, but the levels of the disease and repair markers are monitored levery three weeks, for an additional 3 -6 months. If the levels of all markers remain at their normal state, cure has been achieved. If any marker deviates from nc,rmal at the end of any three week period, ~mini~tration of the therapeutic compound is resumed at the highest Nmaximum efficacious dose" that has been used during the immeAi~tP~ prior tre~tmçnt, and the new maximum effective dose is established by the known methodology.
The term "maximum efficacious dose" is defined herein as the daily dose rate, that will elicit, in nearly 100% of treated patients, the reversal of the respective disease markers to the uniformly normal level, and establi~hment of normal cellular markers. The maximum efficacious dose is usually ~plessed as amount of therapeutic compound admini~tered per kilogram body weight per day (DKGD). The maximum efficacious dose represents a novel concept of ~lministering a pharmaceutical agent in therapeutic medicine.
The term "maximum therapeutic doseN is defined herein as the total cumulative dose (the daily dose summed over the duration of administration) that will elicit in nearly 100% of treated patients the irreversible and complete CA 022~9041 1998-12-22 ~ 1 norm~li7~tion of the respective disease markers and resumption of normal cellular functions, i. e., the state of cure.
The term "minimum efficacious dose" is used herein to refer to the dose used in the heretofore universal practiced rnethod of administering a pharmaceutical agent. The minimum efficacious dose is the dose (daily dose or steady state level) that will elicit a particular pharmaceutical action in a certain percentage of patients, without inducing the pleiotropism of the whole repair process.
Pharmacological agents have heretofore been ~-1mini~tered at set dose levels (i.e., the "minimum efficacious dose") to treat the gross pathology and discontinued when complete or partial rem~ission of the gross pathology was achieved. Tre~tm~nt according to the prelerred method of this invention begins at the gross pathology stage which has one or more associated markers.
Norm~1i7~tion or improvement of those markers indicate that the tre~tment is beneficial. However, such a remission is not the event which causes discontinuation of therapy in accordance with this invention. Norm~1i7~tion of the markers of gross pathology indicates, rather, that a disease state corresponding to a lower level of disease activity has been reached. Markers of that stage (i.e., the lower level of disease activity) are identified and treatment is continued to normalize those markers. Complete cure is reached only if all stages of the revival process are treated.
The term "maximum tolerable dose," as used herein, is defined as the highest daily dose that can be administered without any complications, e.g., no CA 022~9041 1998-12-22 bleeding complications or thrombopathy, e tc. This in fact has been the sole and primary side effect of the high-molecular weight nucleic acid (defibrotide) utilized in the studies reported herein, i.e., the antithrombotic effect inducing bleeding complications at 300 mg/kg/day dose or above. If the maximum efficacious dose should be higher than the maximum tolerable dose, chemical modification of the nucleotide for more efficacious transmembrane transport and cellular entry would be neces~ry.
It has been determined that the therapeutic compound will not indefinitely increase tr,anscriptional activity with incre;asing doses. In this regard, transcriptional activity will shut off when the repair molecules are no longer needed, i.e., when no more "injury signal" is tr~ncmitted via stimulation of adenylate cyclase, second messengers, etc. In contrast, no matter how high the dose range in the normal individual may be, there is no induction of transcriptional activity (as indicated by, e. g., elevation in the von Willebrandt antigen (vWAg) levels). This supports the fact that no complications are seen with therapy using nucleotides which moclulate cellular repair mecl-~ni~ms for a therapeutic effect. For example, tissue plasminogen activator antigen (AgTPA) will not continue to rise indefinitely with increasing doses but will increase only in the presence of injury and at the locality of the injury, e.g., the existence of a thrombus which inevitably will be associated with the endothelial cell of the locality specific lesion. Hence no bleeding complications are to be seen secondary to systemic induction of the therapeutic compound at physiological dose ranges beyond the upper limits of the prior art thrombolytic therapy.
This mech~nicm is supported by the way the cell modifies activation of the repair process. As is well known, 50~ occupation of cell surface receptors will lead to 50% increase in the baseline level of inbracellular cAMP, 100%
occupation of cell surface receptors will lead to a 100% increase in the intracellular cAMP level. This will correspond to 5 times the elevation of the baseline vWAg level. Phosphorylation of various different branscriptional factors simultaneously will lead to concurrent tissue specific turning on or off of the respective transcriptional factors, e.g., sorne molecules are turned on and some are turned off. This constitutes the pleiobropism of the nucleic acids as herein defined.
Tr~t~hle r)ic~ St~t~c Various disease conditions including HIV infection and its related dise~s characterized by injury-based alteration in the production, expression or activity of compounds whose producbion, ~ ,ression or acbivity is regulated by the cell at least in part through 1) cell surface receplors such as Adenosine A, and A2, collagen, thrombin, epinephrin and norepinephrine receptors, 2) through the protein kinase A, protein kinase C, phosphorylation, or receptor tyrosine kinase pathway, 3) through cytokine-receptor superfamily and regulatory factors encoded by oncogenes, or by 4) protein factors whose phosphorylation affects genomic translation and transcription may be breated with the therapeutic compounds of the present invention in a marker dependent manner as described herein.
W O 98/48843 PCT/~S98/08357 1~1 Treatable disease states inelude 1) iinfeetious diseases sueh as HIV
infeetion, Protozoa infeetion, Schistosima infeetion, Schistoeerea ~ Pichm~ni~
infeetion, e.g., Schistosoma japonieum in]~eetion, Trypanazoma infeetion, e.g., Trypanozoma Cruzi infeetion, fungus infeetion, e.g., Candida tropiealis and Candida Albieans, Aspergillus infeetion, ]'neumoeystis earinii infeetion, Malaria, Plasmodium vivax, gram negative bacterial infeetion, Cytomegalovirus infeetion, Hepatitis virus infeetion, human papilloma virus infeetion; 2) genetic diseases such as Duchenne's Museular Dystrophy, Down's Syndrome; 3) degenerative di.ce~es such as eneephalopathy, dementia, .Al7h~.imer's disease, Parkinson's disease, neuropathy, eardiomyopathy, aging, Kearn's Sayre syndrome, retinitis pigmentosa, ataxia, seizures, proximal musele wç~kn.osc, leber's hereditary optic neuropathy, optie neuritis, radiation damage; 4) neoplasia sueh as Iympho-proliferative diseases, Iymphomas, Kaposi's sarcoma, pancreaotic cancer, neuroblastoma, leukemia, bladder carcinoma, breast cancer, skin cancer, lung cancer, colon cancer, and 5) skin riise~es sueh as molluscum contagiosum, bacillary angiomatosis, seborrheic dermatitis, psoriasis, Reiter's syndrome, insect bite reactions, Staphylocoecal folliculitis, E~osinophilic folliculitis.
The methodology deseribed herein has universal applieation within the scope of disease states charaeterized by the absenee or inadequaey of one or more of those eell funetions whieh are normally regulated through the eellular meeh~nism~ listed above so long as the abnormalities in these eell functions are yet still reversible. The methodology is also applieable to the disease states charaeterized by acquired or genetic dismodulation, andlor transformation.
1~
Revival, institution or reinstitution of the nornnal state of those functions is, by definition, a state of cure. Revival of the normal cell functions can occur where the ~ ie~ed cell preserves the biological capacity for the physiologically predefined events of the cellular repair functions of the recovery process, if those events are pharmacologically induced by the correct use of the therapeutic nucleic acids. Complete cure is the therapeutic objective. The decisive factor in the success of this therapeutic approach is not only the pharmaceutical agent, but how it is utilized. If the biological capacily for reg~ining normalcy is there, therapeutic failure is elimin~ted. This biologically predetermined potential for cure is reproducibly and predictably obtainable, however, only by the correctly determined iatrogen~tic~lly controlled dose levels, and duration of therapy.
Incorrect dose ~lmini~tration leads to the therapeutically missed event of complete cure. Complete cure, however, is not possible if neces~ry dose levels cannot be ~ ined without complications such as bleeding or thrombopathy.
While the marker dependent dose Imethodology is universally applicable, it has been surprisingly discovered that E[V, as well as associated opportunistic secondary infections can be effectively treated with the therapeutic compounds described in the present invention.
Ther~eutic Compoun~c The therapeutic compounds conternplated in the present invention include 1) sequence non-specific oligonucleotide, 2) nucleic acid components of defibrotide, 3) variants and derivatives of 2), 4) sequence specific nucleic acid in combination with 2), 5) amino acids or protein factors in combination with 2), 6) CA 022~9041 1998-12-22 oligonucleotides containing homologous sequences of HIV sequence and other genes encoding cellular regulatory factors.
Sequence non-specific oligonucleotides of the present invention is an oligomer or a polymer of deoxyribonucleotides or derivatives thereof. The compound may be native or chemically synthesi7~d, or a fragment of a native polydeoxyribonucleotide. The compound has at least three nucleotide residues, and may have up to about 250 residues. F'referably, the nucleotide compound will have from about 15 to about 200 residues, more preferably from about 20 to about 150 residues, most preferably from about 50 to about 75 residues. The sequence of the nucleotide residues in the polymer is not critical, and may include interdisposed sense, anti-sense, nc,n-sense or missense sequences. A
therapeutic composition may contain polynucleotide molecules with varying numbers of residues within the range described above. The skilled worker will be able to select an appropliate length (degree of polymerization) based on the ability of the compound to penetrate the cell and on the ability of the compound to cause a change in the level of various repair markers in accordance with the method of this invention.
The nucleic acid compound will preferably be relatively resistant to ecto-and endonucleases. The 3' OH of the tenninal residue of the therapeutic compound according to this invention may be phosphorylated or not, and the compound will still function without the need for intracellular phosphorylation.
The therapeutic compound according to this invention is a polyanion, and the negative charge is balanced by counter ions. The counter ions may be alkali i~
metal ions or alkaline earth ions, biologic amines or other suitable counter ions which do not interfere with treatment according to the metlnod of this invention.
Preferably, at least some of the counter ions are zinc ions. The amount of zinc, however, may be increased either be directly incorporating zinc into the nucleotide compound or, alternatively, by 7,~minictering zinc, e.g., in the form of a dietary supplement, along with the tlnerapeutic nucleotide. Zinc containing compounds may be coadminictered with the nucleotide to obtain a ratio of from 2 - 20 zinc atoms per phosphate group or iodine atom.
Defibrotide may be obtained from m~mm~ n tissues as described in U.S. Patent 3,770,720 or obtained from commercial source, e.g., CRINOS
Farmacobiologica S.p.A., Villa Guardia (Como), Italy. Any means known in the art may be used to analyze the nucleic acid components of defibrotide.
Usually, HPLC can be used to separate defibrotide into its nucleotide and oligonucleotide components. For instance, in reversed-phase HPLC, defibrotide may be run on a Vydac C8 or C18 analytical HPI C column using a Rainin HPLC system. The flow rate could be set at 1 ml/min and the eluent can be monitored at 260 nm and 280 nm wavelengths. Such column run may be carried out isocratically using 0.1 TFA in water. In some runs, peaks can be collected for subsequent mass spectrometry.
It is a discovery of the present invention that all defibrotide components are eluted in approximately 8-10 peaks within 10 minutes. In order to identify the nucleotide composition of defibrotide, the mono-, di-, tri- and cyclic monophosphates of T, C, G, A, and U may be chromatographed under conditions identical to those used for defibrotide. If the retention time for a purified nucleotide is superimposeable (+ 0.1 min) on a defibrotide peak, it can be taken as evidence for the putative presence of such nucleotide in defibrotide.
Peaks collected from HPLC runs may be concentrated by vacuum evaporation and be analyzed in mass spectrometry. All mass spectra may be collected on a matrix ~c~i~ted laser desorption ionization-time of flight (MALDI-TOF) Voyager Biospectrometry Workstation (Perseptive ]3ioSystems) and run in the negative ion mode.
It is a discovery of the present invention that a simple HPLC C8 column elutes with 0.1% TFA in water provides tlhe best separation of defibrotide obtained through commercial source, i.e., Noravid (CRINOS Farmacobiologica S.p.A., Villa Guardia, Italy). Defibrotide elutes from a C8 column in approximately 10 peaks with retention timies between approximately 3 and 9 minutes. One of the peaks, i.e., peak nurnber 4 represents two 25-30 mer oligonucleotide with molecular weight of about 8171.58 and 8433.75 Dalton, respectively. Only routine experimentations are needed to sequence the two 25-30 mers.
The nucleic acid components of defibrotide include all nucleotides and/or oligonucleotides identified in defibrotide which include but are not }imited to dCTP, dATP, dGTP, dTTP, dAMP, dGMP, dCDP, dADP, ATP, AMP, CTP, CMP, UTP, cyclic TMP, cyclic UMP, c~yclic GMP, oligonucleotides containing from 6 nucleotides to less than 60 nucleolides, aptamer #1 GGTTGGATTGGTTGG (SEQ ID NO~ , aptamer #2 GGTTGGATCGGTTGG
Iq (SEQ ID NO:2), aptamer #3 GGATGGAl'CGGTTGG (SEQ ID NO:3), and aptamer #4 GGTGGTGGl~GTGGT (SEO ID NO:4), and two 25-30 mer oligonucleotides with molecular weight of about 8171.58 and 8433.75 dalton respectively and identified via HPLC anal~ysis as discussed above.
Any variant of the nucleic acid components can also be used as the therapeutic compounds in the present invention. Variants include oligonucleotides having complete or partiaLl sequence homology with the oligonucleotides of defibrotide. Variants include nucleic acid fragment comprising the oligonucleotide sequences identified in defibrotide. For example any DNA fragment containing the oligonucleotide sequence of defibrotide and additional sequences at the ends of the oligonucleotide sequence is contemplated in the present invention as a variant. Normally the number of additional nucleotides at the ends is from 1 to 100, preferably from about 5 to 50, more preferaby from about 10 to 30.
The homology level may be at least from about 505'o to about 70 %, preferably 80% to 90%, more preferably 95 % . The homologous region may be continuous or scattered through out a nucleotide fragment. For example, aptamer #l of defibrotide (5'-GGTTGGATTGGTTGG-3') has complete and partial homology to several genomes, e.g., Schizosaccharomyces, pombe GATA-binding region, and Streptococcus pneumonia Dpn I gene Aptamer #2 of defibrotide (5'GGTTGGATCGGTTGG-3') has homology to several genomes, e.g., Mycobacterium leprae cosmid B0462.
CA 022~9041 1998-12-22 Aptamer #4 of defibrotide (5'-GGTGGTG&TTGTGGT-3') has homology to various genomes, e.g., chicken liver cell adhesion molecule, human gelanin receptor mRNA, Schistosoma japonicum eggshell protein, Schistosoma japonicum ESG-1 protein mRNA, human mRNA with TGG repeat clone 83, Schistosoma japonicum ESG-2AA protein mRNA, Candida tropicalis POX9 gene, Candida Tropicalis cat gene, Schistocerca americanaL ~ntenn~pedia, chicken liver cell adhesion molecule, human papilloma virus ~:ype 20, homo sapiens mitochondrial genome, gorilla mtDNA, human mtDNA, human DNA sequence from cosmid U1 57D, T ~ishm~ni~ major cosmid clone L2759, Plasmodiun vivax Serine repeat antigen, P. clarkii mRNA, Trypanosoma cn~zi mucin-like protein, L. major mRNA
for surface antigen P2, Aspergillus aculeatus (clone PClG1), Candida Albicans DNA for MNT2 gene, E.Coli K-12 genome, Mouse amyloid beta precursor, Candida Albicans topoisomerase type, human homolog of Drosophila spilicing gene, E. Coli gcvh gene 3'end, human Do~m Syndrome region of Chromosome, E.
Coli gcv operon gene sequence, Drosophila melanogaster receptor protein and polyheamotic DNA, human Papilloma virus type 25 genomic, Drosophila melanogaster Zn finger, Pneumocystis carinii, Dystrophin associated protein of Duchenne's mllsc~ r dystrophy, ( Sequence 7 from US #5,449,616), and DNA
Polymerase (Sequence 14 from US # 5,556,772).
Variants of aptamer # 4 also inc]ude homologous sequences of HIV and aptamer #4. For example, homologous sequences may be found in gag/pol, c-vif, or env regions of HIV. Particular homologous sequences may be found on three sites on gag/pol ~V genome region The translation of the aptamer #4 region on gag site is a peptide 'PEPTA", and the pol gene fragment tr~n~l~tes the same DNA
sequence into 'TRANS. In a preferred embodiment, S-Oligo variants of aptamer #4 are 1)5 ' GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCC
CTTG3', 2) 5'ACCAGAGCCAACAGC3', 3) 5' CCTGGCCTTCCCTTG3'.
Variants of aptamer #4 also include homologous sequences of a gene encoding a cellular regulatory factor and aptamer #4. Examples of such homologous sequences are listed in Table l.
Table 1. Examples of Sequences Homologous to Aptamer #4 Cellular~Factor~Strand ~Homolog5t~Region ~Match~Percent~
human myc anti-S 2345-2449 13 86.6 TNF-Receptor anti-S 5039-5053 12 80 0 anti-S 036-9~50 12 80.0 anti-S 5574-5588 11 73 0 anti-S 5045-5059 11 73 0 S 2577-2.591 11 73 0 human TNF S 693-707 11 73.0 S 1149-1163 11 73.0 bTNFg S 6375-6389 10 66 6 S 1872-1886 10 66.6 S 1565-1579 10 66.0 bTNFfg anti-S5638-5652; 5355-5369; 10 66 6 5046-5060; 4447-4461;
4435-4449; 4224-4238;
4221-4235; 1990-2004;
1125-1139; 933-947;
930-944; 119-133.
Sl,~JTE SHEET I~RULE 26) CellularFacfo~Strand ~ Homolc~ egion ~ Mafch~ ~ Percent hsch-ras anti-S 15-:29 12 80.0 18-:~2 bt-ras S 1404- 1418 10 73.0 anti-S 978-'~92 10 66.6 975-'~89 hsch-ras anti-S 12-26 10 66.6 21-:35 human-ras-md anti-S 28- i2 10 66.6 15-:29 human-abl S 3253-3267; 3064-3078; 10 66.6 3061-3075; 3058-3072;
2918-2932; 2195-2209;
2189-2203; 1952-1966;
1059-1073.
humanbcl S 3253-3267; 3064-3078; 10 66.6 3061-3075; 3058-3072;
2918-2932; 2195-2209;
2189-2203; 1952-1966;
1050-1064.
anti-S 3451-3465; 1366-1380;
1198-1212; 120-134;
270-284.
humanfos S 5166-5180; 3358-3372 10 66.6 anti-S 6019-6033;.5561-5575;
4901-49~5; 3695-3709;
361-375; 9'3-112; 35-49.
human IL-1 S 247-261 10 66.6 anti-S 920-~34 10 66.6 SUBSTITUTE SHI_ET (RULE 26) CA 022~9041 1998-12-22 ~3 CeU~ ctar~ S~and ~ k ~ lrgy:~ n~ ~h Feroent Musnos S 3717-3731; 3685-3699; 10 66 6 (ni~ic oxide 2904 2918; 2669-2683;
synthase) 2408 2422; 2007-2021.
anti-S 2806 2820; 2572-2586;
2530 2544; 1720-1734;
1717-1731; 1237-1251;
1075-1089; 504-518.
Variants of aptamer #4 also include homologous sequences of mitochondrial DNA and al)~alller #4. Aptamer #4 has 100 % homology to NADH Dehydrogenase Subunit 6 at target site of 13741; homology of 86.6% to tRNA glu. at target site of 14101; homology of 80 % to NADH Dehydrogenase subunit 4 at target site 10249;
homology of 80 % to 16 S rRNA at target site of 1924; homology of 73 3% to D-loop at target site of 16470; homology of 73.3% to NADH Dehydrogenase Subunit 5 at target site of 14227; homology of 73.3% to NAD Hydrogenase Subunit 6 at target site of 13819; homology of 73.3 % to NADH Dehydrogenase of Subunit 6 at target site of 13744; homolo~y of 73 3 % to NADDhydrogenase Subunit 5 at target sites of 13467 and 117~53; homology of 73 3 % of NAD
Dehydrogenase of Subunit 6 at target site 10246; homology of 73.3 % to cytochrome oxidase Subunit 3 at target site of 8820; homology of 73.3% to cytochrome oxidase subunit 6 at target site 8327; homology of 73.3% to ATPase subunit 8 at target site 7810; homology of 73 3 % to tRNA-lys at target site of 7752; homology of 73.3 % to cytochrome c oxidase subunit lat target sites 5961, 5478; homology of 73.3 % to NAD Dehydrogenase Subunit 2 at target sites of 4871, 4733, 45594145; homology of 73 3 % to NADH Dehydrogenase Subunit 1 at CA 022~9041 1998-12-22 ' ' W O 98/48843 PCT~US98/08357 target sites of 2922, 2919; and homology of 73.3 % to 16S rRNA at target sites of 1936, 163S
Derivatives of the nucleic acid components are contemplated in the present invention. Derivatives include the nucleic acid components conjugated with poly(L-lysine) or modified by, for example, the addition of amino acids such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals and ions including zinc, m~ng~nese and iodine, by the addition of 5'-polyalkyl moieties, cholesterol, vitamin E, 1-2-di-0-hexadecyl-3-glyceryl and other lipophilic moieties and/or modified by the replacement of phosphodiester bonds with phosphothiotate bonds, and/or modified nucleotide sequences of the prototype nucleic acid, defibrotide.
Derivatives of the nucleic acid cornponents of defibrotide also include modified nucleic acid components. Any ~modification method known in the art may also be employed to modify the nucleic acid components of defibrotide. For example, addition of RNA monomer, i.e., adenosine on the 3' end of a DNA
oligonucleotide by using an RNA-3 ' solidl support with (di)phosphorodimite chemistry; insertion of ~-lçn~ne, deoxyadenosine, or dA adnine base in a oligonucleotide; insertion of 5' monophosphate, e.g., S'-P-A-C-G-T or 3' monophosphate, e.g., A-C-G-T-P-3' at any selected spot on an oligo using (di)phosphoramidite chemistry; addition of any nucleotide on the end of tri-phosphates, e.g. N-P-P-P-A-C-G-T; production of di-nucleotides, e.g., N-S'-P-P-P-P-S'-N; conjugate NTP to any oligonucleotide, e.g., N-S'-P-P-P-P-S';
CA 022~9041 1998-12-22 ' r WO 98/48843 PCT~US98/08357 coupling of cyelic nueleotides, e.g., use of APPPPA-synthase to make A-5'-P-P-P-P-5'A; membrane support modifications including addition of eholesterol to any position of an oligonueleotide with (di)phosphorodimite ehemistry; addition of peptides via carboxy-dT to any pOSitiOII on an oligonucleotide (carboxy-dT can be coupled directly to a molecule containing a primary amino group using peptide chemistry or via the intermediate N-hydroxysuceinimide (NHS) ester);
attaching molecules to any site on an oligonucleotide using amino linkers and linker-spacers via NHS ester chemistry; linking oligonucleotides together, e.g., 5'-5' or 3'-3' with (di)phosphorodite chemistry; thiolated, methylayed, or in the form of propyne oligonucleotides antisense oligonucleotides produced via (di)phosphorodite chemistry; multiple syrnmetric (same sequence) or asymmetric (different sequence) braced oligonucleotides with targeted virus and subtargeted cellular elements via (di)phosphorodite.
Oligonucleotides containing a homologous sequence of HIV and a gene encoding a cellular regulatory factor are also contemplated in the present invention. The sequence homology between HIV and other cellular regulatory factors may be at least 40%, preferably at least from 60% to 70%, and more preferably from 80% to 90%. The lengt~h of the homology region may be from 3 nucleotides to 100 nucleotides, preferably from 6 to 60 nucleotides. The cellular regulatory factors include transcription factors, oncogene products, and any factors involved in the signal transduction pat]hway, e.g., TNF receptor, RIP, IL-2 receptor, IL-1 analog, TNF-a, c-myc, c-abl, c-fos, c-ras, dystrophin, surface glycoprotein proteins of L-CAM and eathedrin, and B-myb. Table 6 lists a few examples of sueh oligonueleotides.
Table 6. Examples of Oligonueleotides Oligonucleotide Homology Region in HIV Cellular Regulatory Faetor CAGCTGCACCTGCCAAGC gag/pol 968-984 human TNF reeeptor ATAAAATATACCATATACA gag 2315-2331 human RIP protein kinas~
(HSU50062) TCATAAAATATACTATATTCA gag 2312-2331 mouse TNF reeeptor (mmu 25995) ATATTAAAGAAeGeTGmAeAAT vif 4847-4876 IL-2 receptor ACTTGG
ATGCA~l~ GAAGAGAA env 7485-7502 TNF receptor (eell death protein HSU25994) AATTAAGGcATAAGAAAAcTAAGA env 6118-6150 IL-1 analog AATATGCAC
CCTCAAGGACTCAGCTTT 5'untr~n.~1~t~d region pos. TNF-a promoter CAATAATAAAAGGGGAAA gag 186-203 e-myc AGTGCAACCGGCAGGAGGTGA 5' untr~n~l~ted ~egion pos. c-abl GeeAceAGeeeeTeeeeAGAeTeT pol 1522-1547 B-myb, c-myc ~AGGTGGAGGCAACAG
protooncogene Defibrotide or the nucleic acid components of defibrotide and variants thereof may be ~t~mini~tered in combination with 1) sequence specific nucleic acids, 2) amino acids, 3) protein factors, 4) sequence specific nucleic acids and sequence non-specific nucleic acids, 5) sequence specific nucleic acids and sequence specific peptides including but are not limited to peptides encoded by oligonucleotides of defibrotides and the vilnants thereof, 6) sequence specific nucleic acids and sequence non-specific peptides.
The sequence specific nucleic acids include but are not limited to anti-protease sequences, retroviral promoter s~quences, TAR s-equences, HIV mutants of TAR decoy RNA, mutants TAR decoy RNA, negative mutants of the viral REV transactivator, synthetic promoters ~vith the con~sen~us sequence for binding of the transcription factor Spl and the TA~TA box, mutants of TATA box, TAT
mutants wherein the mutations involving ~he seven cysteine residues, sense, anti-sense, mi~sçn~e derivative of CIS acting negative elements (CRS) present in the integrase gene and REV mutants, transdominant suppressors of REV (mutations involving amino acid 78 and 79), NEF~DNA sequences and its mutants with or without U3 region sequence of the 3'LTR, POL reverse transcriptase gene mutants, POL viral integrase gene and its mutants, POL viral protease gene mutants, HIV-I LTR enhancer (-137 to -17) mutants, HIV LI~R promoters starting at -78, HIV LTR sequences encoding a arginine fork from aa27 to aa38, HIV-I LTR s,ense sequences of the negative regulatory element (-340 to -185), HIV-1 LTR consensus sequences for binding of transcription factors of AP1/COUP, NFAT-1, USF, TCF-~ -KB, TCF-la, TBP, and inhibitors of the con~.ns~ls sequence, LTR NFkB mutants (-104 to -80), LTR Spl (GC box) binding site and TATA box mutants, LTR GAG gene sequence mutants, LTR
mutants (~54 to +180), LTR genomic re.peats at +80, LTR regions responsive for cellular transcription factors between and to the left of U3 to -454 extending to -7, 3' LTR and its variants, 5' LTR and its variants, LTR variants, inhibitors of UBP-1 or LBP-l binding sequence (-5 to +82), ENV, GAG, POL gene sequences placed 3' of the REV mutant codon, short sequence mutants (15-60 mer), and host DNA sequences of preferred targets for proviral integration.
Amino acids ~mini~tered in combination with the nucleic acid components and the variants thereof include these involved in signal transduction pathways and phosphorylations. They include but are not limited to threonine, serine, tyrosine, and proline.
Protein factors ~mini.ctered in combination with the nucleic acid components and the variants thereof include DNA polymerase, protease inhibitor, and reverse transcriptase inhibitor.
In ad~litic)n, N-containing ring compounds, e.g., pyrimidine, purine, adenylic, and guanosine can also be ~m.ini.ct~o.red in combination with the nucleic acid compounds and the variants thereof in the present invention.
The homologous sequences of HIV and a gene encoding a cellular regulatory factor may also be administered in combination with homologous sequences of nucleic acid components of defibrotide and the variants thereof, . . ~
espe,cially the homologous sequences of aptamer #4 and a gene encoding a cellular regulatory factor.
The nucleic acid compounds of the present invention can be ~-~mini~tered directly or via a vector. Any vector capable of replicating in vivo can be used to carry the nucleic acid compounds. Preferably, the vectors employed are suitable for gene delivery. Expression/replication vectors are readily available in the art, e.g., pCI, pCI-neo.
It is a discovery of the present in~ention that mitochondrial genome, especially origin of ~eplication, e.g., from a human can be used to construct replication/e~ ession vectors. Preferably, 5' end of mitochondrial 12S RNA
con~ining sequences from about nucleotide 72 to 1025 and mitochondrial DNA
containing sequences from nucleotide 1 to 72 can be used.
In replication/~A~lt;ssion vectors, the oligonucleotides of the present invention can be flanked by some buffer sequences. In a plefell~d embodiment, pCI-neo vector can be cut by Bgl2 and BamH1, and eIF-4E initiation factor gene may be inserted. The sequence of eIF-4E gene specifically relevent to such vector is GGCCAGGCATGGTAAGTCATACCTATAATCCCAGCACTGTGGGAGGCC
AAGGAAGGGGGATCCCTTGAGCTC'AAGAGTTTAAGACCGAGATCGAT
(upstream of Alu) and AAAGAGTTTAAGACCAGCTTGGGC'AACACAGTCAGACTTCATCTCTAT
AAATAATTTAAAAATTAGCCAAGCATGGTGGCGTGGTACCCTTGTGGG
TTCCAGGCTTATTTGGGAGGTTGAGGTAAAGGAATTCTCTTGGACGCCC
AGGTAGTCAAGGTTGCAGTGAGCCATAATCAAACCACTGCACTCCAGC
ATGGCAACAGAGCAAGACCCCATCTCAAATATAT (downstream of Alu).
Subsequently, the oligonucleotides of the present invention can be inserted into the eIF-4E gene, preferably at the Alu site of eIF-4E gene.
In replication/expression vectors, the oligonucleotides of the present invention can be driven by a promoter, especially a TAR promoter, a HIV LTR
promoter, or a promoter of DNA polymerase. Alternatively, the oligonucleotides of the present invention can be co-expressed or co-replicated with a gene encoding DNA polymerase. Tat protein may be added to enhance vector replication.
The mitochondrial vectors discussed above can also be used to supply oligonucleotides with wild-type mitochondrial sequences. HIV patients are likely to have mutations in mitochondrial DNA, e.g, cytochrome-oxidase (COX) gene, NADH subunits, origin of replication, D-loop, t-RNA lysine, tRNA glu, and ATPase subunits. It is routine to screen these genes for mutations. Upon finding of mutations in mitochondrial DNA, oligonucleotides containing the colre~l)onding wild-type mitochondrial DNA sequences can be a~lmini~tered to treat the disease conditions associated with such genetic alterations.
It is also a discovery of the present invention that a drug resistance can be treated via ~dmini~tçring the nucleic acid components of defibrotide and the variants thereof in combination with the drug, e.g., a prote~se inhibitor.
~rker-nrivPn Ther~y The c!~imPd method involves the use of a "marker dependent dose ~essment" methodology for determining~ the therapeutically most efficacious use of the respective pharmaceutical agents. The use of incremental marker stratification reflects the concept that "mcLximum efficacious dose" is redefined through the different stages of treatment, each time ad3usted to the respective specific marker most representative of the respective pathogenictclinical picture of the disease state. Tre~tment at respec~ively higher doses corresponding to the progressively lower disease activity levels are continued until a state of total cure is reached.
Intrinsic to the claimed method is the total elimin~tion of empirically 2ccesced doses or constant therapy doses, arrived at by the universal pharmaceutical principal of "minimum eiFficacious dose" for a class of drugs, which, until the present time, has been the standard for the definition of the "effective therapeutic dose." The respective doses thereof are defined to elicit a response colrcs~nding to different disea.se i~unctions of the treated cell and revival of the respective disease parameters, in a stratified fashion.
The method of treating various ~ ces provided by this invention uses specific clinical and laboratory markers ~o assess dosages to be ~flmini.~tPred.
The markers vary from gross clinical observations of pathology to the progressively subclinical vet valid detection of certain laboratory levels associated with a particular disease. The preferred markers are the clinical _ . .
CA 022~9041 1998-12-22 W O 98/48843 PCT~US98/08357 ~3 absent genomes, under-regulatedtsuppressed genomes), and/or over-expressed, not appropliately shut off transcriptions of genomes (e.g. activated repair molecules, second rnes~engers and molecules of signal transduction pathways).
Disease l,.alkers are observable characteristics of the organism whose status in a disease state differs from the status in the normal (non-disease) state.
Such characteristics and their association with their respective disease states are well known to the skilled practitioner. In the practice of the method of this invention, it is contemplated that the practitioner will monitor the status of multiple disease markers relat~d to the di,sease being treated, either simultaneously or sequentially. The disease markers include both clinical markers, which are observed directly by clinician, and laboratory markers, which represent qll~ntit~tive values determined by support staff. These characteristics include, but are not limited to, the concentration of compounds whose production or expression is affected by injury-based alteration of cell surface receptors such as Adenosine A, and A2, collagen, thrombin, epinephrin and norepinephrine receptors, of protein kinase A or protein kinase C pathways, or of protein factors whose phosphorylation affects genomic lranslation and transcription, or hybridization of genomic enhancers/ inhibitors infusion or excess enhancers, infusion of excess genomes to deplete viral/cellular transactivation transcription factors, etc. where the concentration in Ihe disease state differs from the concentration in the normal state. Disea~se markers for HIV related disease states include odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptococcal diarrhea, Karnofsky performance score, waste syndrome.
3~t The normal state concentration of these markers will be known to the ski}led practitioner, and usually replesents a range of concentration valiues determined by measurement of the concentration of the compound in a large number of individuals who are not in a diisease state, by the respective laboratory.
Repair markers are compounds that participate in the regulatory pathways which include protein kinase A or protein kinase C. Adenylate cyclase is known to be activated by G-proteins (see Ross, 1992, Curren~ Biology, 2(10):517-519, the disclosure of which is incorporated herein by reference) with eventual production of cAMP and cAMP-dependent activation of protein kinase A, leading to phosphorylation of the respective transcription factors, until 100% of the cell membrane receptors are taken up by the ligands. For defibrotide these receptors are ~-adrenergic receptors, collagen receptors, adenosine Al/A2 receptors, ADP receptors, thrombin receptors, collagen receptors, etc). A
parallel pathway operates through actival~ion of protein kinase C, in response to intracellular calcium ion level, inositol triphosphate and diacylglycerol, responsive to ligand binding to another siet of receptors and similarly controlling transcription/tran~l~ti- n of respective proteins. These pathways, and their intermediate compounds are well known to those skilled in the art. However, their use in assessment of therapeutic dosage have not, heretofore, been known in the art.
In particular, "repair markers" are molecules in the pathways of the respective cellular repair processes defined by the type of injury. Repair markers are transcribed or shut off genes, second mçssçngers and/or molecules of the signal transduction pathways that may be increased, decreased, or absent in response to cellular injury. As discussed herein, the term "repair marker" may refer to the compound or its concentration or the measurement value of an assay associated with the concentration of the compound. Examples of suitable repair markers include but are not limited to cAMP, cGMP, IL-1, IL-2, TNF-a, IL-6, cGMP/cAMP ratio, total lymphocyte count, T lymphocyte count, CD4 count, CD8 count, cAMP dependent protein kinase A enzyme, adenylate cyclase, G-protein, phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol, intracell~ r calcium level, intracellular calcium ion level, c-myc, ras, c-fos, cjun, NK-kB, EIAI, AP-l, COUP, TCF-1~, TATA, TAT elem~nt, oxygen radical, CREB, CREM, Platelet ]Derived Growth Factor (PDGF), Colony Stimul~tin~r Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor (IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src Homology 3 domain (SH3), serine/threonine kinase, Mitogen Activated Protein Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and Activators of Transcription (STATs), JAJ 1, JAK2, Tumor Necrosis Factor -Receptor I signal Transducer TRADD, c:hemokines of Rantes, and MIP-Alpha, and MIP-Beta.
The level of a repair marker may deviate from the level present in the cell during normal function, and when it does so deviate, cellular repair processes are activated. This deviation may be positive or negative, depending on the disease state and the precise state of cellular repair currently in progress. As discussed herein, the "intensity" of the repair marker will refer to the degree of deviation from the level during normal cellular function, without regard to whether the deviation is positive or negative. The use of repair markers in establishing dose and duration of therapy is a novel mode of ~mini.ct~ring a pharm~eutical agent.
As defined herein, a "universal marker" is a constitutively expressed molecule transcriptionally activated by the respective nucleic acid universally in all disease states for which the nucleic acid is specific. "Universal markers" are specific for each nucleic acid employed. While the universal marker is the only molecule that is not injury specific and has no therapeutic value, it is expressive of the event and duration of the ongoing repair process. Transcriptional activation gets shut off with the establi~hmt.nt of the state of cure. As such, the universal marker does not get modulated unless there is a disease state and the respective nucleic acid has therapeutic specificity. The universal marker carries a direct quantitative relationship to the ~aily per kilo~gram body weight dose (DKGD) of the nucleic acid employed. A universal marker defined for the prototype nucleic acid (defibrotide) is vWAg. Other "housekeeping genes"
related to particular nucleic acids can be selected as per the target cell involved from the respective "house~ping genes."
Clinical and clinical laboratory markers may be determined through blood tests, urine tests, clinical observation or identification of blood clots by any of several conventional techniques, as well as the more novel techniques of determining genomic transcriptional and translational activity by DNA finger printing, PCR and the like. To evaluate the markers, the laboratory analyses W O 98t48843 PCT/US98/08357 ''3~) measure levels of certain proteins, lymphokines, enzymes and relevant molecules. Clinical markers include blood pressure, visible tissue damage, signs of infl~mm~tion, ecchymoses, and the like. Clinical markers vary from one disease to another. Moreover, like HIV, many ~ es progress through several clinical stages during the process of recovery. The clinical markers of one stage of a disease are frequently different from the clinical markers in other stages of the disease, befitting different stages of the pathogenic picture.
The detection of markers relevant to the particular disease, stage of that disease, and as baseline for dose escalation, must first be identified. Any observable characteristic generally accepted by the skilled practitioner as being associated with a specific disease state may be employed as a clinical marker.
See, e.g., Hamson's P~lNClPLES OF l VTERNAL MEDICINE, 10th Edition, Petersdorf et al. Eds., McGraw Hill. The skilled artisan would readily recognize those markers indicative of a pathological state.
One critical marker is chosen at each respective stage of the repair process and the maximum efficacious dose for that marker established.
Admini~tration of that dose induces correction of other stage-specific markers not neces~rily identified or aimed at during therapy (i.e., "stage specific pleiotropism"). Following norm~li7~tion of the first chosen marker, a second marker which continues to deviate from ~he normal condition is chosen. The dose that normalizes the second marker (i.e., the higher dose) is likely to further improve the first marker incrementally.
CA 022~9041 1998-12-22 3~'~
Initial ~dmini.ctration of the selected dosage is followed by incrementally increasing dosages until the "maximum efficacious dose" is reached. A panel of laboratory assays to determine the state of the markers (e.g., absence, increase, decrease) is repeated every 3 to 7 days during therapy. These results together with the clinical markers of disease would indicate whether the defibrotide, or other nucleic acid derivative, is adequate in dose and duration to cause improvement in the pertinent marker or markers while simultaneously being totally safe to administer. Therapy is continued with esc~l~ting doses over sufficient time to assure complete norm~li7~tion (i.e., the clinical laboratory assays, when compared to the reference r~mge, are indicative of the norrnal condition) of the pertinent markers. When norm~li7~tion is reached, therapy is stopped.
Although therapy is discontinued, the patient is tested weekly for the current state of the pertinent disease marker. If relapse occurs, therapy is reinitiated at the highest dose level of the prior course of therapy until norm~li7~tion is again reached. While optional, it is advisable to continue esc~l~ting the dose level to potentially rea.ch a shorter duration of therapy.
The highest tolerable dose per day which is complication free (e.g., no bleeding, thrombopathy) is preferred since treatment periods are usually shorter at higher dose levels. Therapy cycles are repeated until there is complete and irreversible normalization of the pertinenl~ markers at which point the patient is cured. A marker is considered to be irreversibly norm~li7~ if it remains normal for three months without therapy.
CA 022~9041 1998-12-22 WO 98/48843 PCTA~S98/08357 There is a certain dose level which will ultimately give plateau levels on a particular marker, and irrespective of how long the dose range is continued, the level of the molecule will not go higher unless the dose (or cellular uptake of the respective nucleotide) is increased. This ;agrees with accepted biochemical knowledge, i.e., the more the number of receptors receiving signals, the more cAMP is produced and, as a consequence, the higher the transcriptional activity pertaining to vWAg is.
Minimum effective dosing is therefore counterproductive and markers have to be used to assess the maximum efficacious dose. Application of the higher dose will promptly lead to higher levels in a shorter time (high m-efficiency score). This is confirmed from the cellular uptake curves.
Once a plateau is reached with the maximum efficacious dose, the m-efficiency score can thereafter be used along with the maximum highest levels of the last day to assess how long therapy should be continued to complete the repair process, i. e., when the maximum efficacious dose is continued when m-efficiency score is less than 1.0, the nucleotide no longer exerts any further therapeutic effect. This observation leads to the statistical definition of "maximum therapeutic dose," i.e., the time slot of the total ~dminictered dose beyond which further repair of the selected marker would not take place at that particular dose level.
If another disease marker were selected, the maximum efficacious dose and maximum therapeutic dose would be redefined for that second stage marker.
One skilled in the art, based on the information presented herein, would be able to detect and determine finer disease/repair markers so as not to miss complete cure. Any abnormality in any marker should prompt reinitiation of therapy, even if no visible disease markers are observed, since many of the markers of the subclinical stage will be biochemical molecules, e.g., an interleukin.
Tr~tment in Accor~nce wi'h the ~nv~r-tion A prefelled embodiment of the treatment method according to this invention is diagramed in Figure 1. An initial laboratory test panel (box 1) is first run which would consist of the respec:tive set of "disease markers" and the universal panel of "repair markers" con~i~ting of signal transduction/second messe~ger panel molecules. Additionally oertain laboratory assays are used to assure that the dosages are safe for the patient being treated. For defibrotide these may include prothrombin time, activated partial prothromboplastin time, thrombin time, reptilase time, bleeding tinne, platelet function assays and coagulation factors (see baseline coagulation panel). "Disease markers" are utilized to in~lic~te the overall therapeutic efficacy of the doses. These markers may be identified through blood tests, urine tests, clinical observation or identification of blood clots by any of several conventional techniques, or by the more refined techniques such as DNA fingerprinting and PCR. To evaluate the "disease markers" the laboratory analyses measure levels of certain proteins, lymphokines, enzymes and relevant molecules. Clinical markers may include CA 022~9041 1998-12-22 ~ll blood pressure, visible tissue damage, SigllS of inflammation, ecchymoses, and the like.
An initial bolus of defibrotide (box 2) or its nucleic acid components is given intravenously over 15 to 30 minutes. Immediately thereafter the patient is given the daily dose of 40 - 400 mg/kg by continuous infusion. Preferably, the initial dose is a bolus (25 - 50 mg/kg) followed by 24-hour dose which is increased in 50 mg/kglday increments every 1 - 3 days. The starting base-line dose may be from 40 - 400 mglkglday depending upon physician preference and the respective disease state treated. Lower initial doses are preferred for those therapeutic compounds which enter the cell nucleus more readily and are thus effective at lower doses. The bolus and cliaily dose for chemical derivatives of the nucleic acids may be calculated as a proportion of the defibrotide dose based on the relative cell-entry rate. It is preferred to ~ministçr this dose intravenously using two IV bags of 50 m]l DSW, each bag infused over 12 hours.
If for any reason the infusion is interrupted, the rate of infusion would be thereafter adjusted so that the patient will have received the calculated 12 hour dosage at the completion of the specified time period. This 24 hour dose range can also be administered in 2 - 4 bolus injections or per oral ~dminictration.
Defibrotide or other selected nucleic acid derivative may be adminictçred parenterally, orally or locally by application to the skin. Parenteral a~1mini~ration is in the form of continuous intravenous infusion or intravenous bolus injection. Intravenous infusion ma,y be accomplished by gravity feed, pump delivery or other clinicaLlly accepted methods. Oral ~lmini~tration may include the use of vials, capsules, tablets or powders for any method of enteric admini ~tration.
To permit clinically practicable ~mini~tration of defibrotide in the amount ne~es~ry, materials for delivery of the agent optionally comprise 2 x 50 ml D5W IV bags each containing one-hali of the calculated total 24 hour dose in milligrams of defibrotide, each bag infused over 12 hours for the IV-continuous infusion at the maximum tolerable doses. Alternatively, the total 24-hour dose can be ~mini~tered by bolus injection every 8 - 12 hours. The initial bolus injection and the subsequent outpatient bolus maintenance infusions are given, for example, in 3 x 25 ml D5W bags, each bolus to be infused over fifteen to thirty minutes. The oral dosage outpatient m~inten~nce therapy in milligrams given daily (divided into 3 - 6 doses by mlouth) would be the multiples of 2X the maximum tolerable IV dose.
The same dose is given for three clays and the laboratory test panel is repeated (box 3). A full coagulation prof;le and tests for markers should be run before and after any dose escalation. These tests results are compared with the initial test data to determine if any of the markers (which may include laboratory data or clinical observation for the diseas~ being treated) have changed. A
change is expected to occur in at least one marker within 3 - 21 days, indicating that defibrotide is having an effect. After each test the dose of defibrotide is increased by 50 mg/kg/day, dose for chemical derivatives being proportional to the cell entry rate for the respective nucleic acid, and continued at that dose for three days before retesting. This pattern of esc~l~ting the dose and repeating the 'l3 laboratory panels is repeated (boxes 4 ancl 5) until the patient's "maximum tolerable dose" (MTD) is reached or unti]. the diseaselrepair markers have pl~e~ued or completely norm~li7ed.
If three consecutive values for a se~lected marker are about the same, a plateau has been reached. This procedurl is followed for a minimum of 21 days (box 6). Disease/repair markers are chec ked and coagulation profiles are run on weekly intervals to monitor response. If no response is observed, i.e., no change in the level of any marker (box 7), therapy is discontinued (box 8), and treatment is determined to have failed. If, after 21 days (box 6), no plateau is reached, but improvement in the disease markers has occurred (box 14), the dose may be doubled or the M'rD may be given (box 15).
If the .,lalkel~ are normal (box 9), therapy is discontinued (box 10).
Tests continue to be repeated weekly for up to three months, noting any change in markers that would indicate relapse. '[f no relapse has occurred and no new markers have appeared after three monthls (box 11), therapy is discontinued (box 12) and the patient is considered cured. Should an old marker reappear or a new marker appear (box 13), the last previous dose is doubled, and therapy is resumed at that dose level. If doubling of the dose would exceed the MTD, the MTD would be ~mini~t~red.
Seleclion of M~rk~rs The correct identification of mar'kers are based on the identification of the pathways of disease pathogenesis and th,e respective repair processes and pathways. The mech~ni~m of efficacy of the therapeutic nucleic acid simulate or CA 022~9041 1998-12-22 '\'-1 are superimposed on the cellular pathways of the respective repair process they induce. For example, using defibrotide as the clinical agent, one would (1) identify the known signal transduction sysltems and second messengers of the repair process, (2) define the most probable nucleic acid-induced repair markersof the known cellular repair pathway, and (3) define markers of the disease process related to disease pathogenesis.
Many disease processes are pathogenically based on overactive body defense mech~ni~ms. As such, a compound whose intracellular concentration can be a repair marker in one disease stat~ can be a disease marker in another disease state. In such a case, the marker would usually be under-regulated by defibrotide instead of induced. Similarly, a marker of normal cellular function, if deficient, may be a disease marker. For example, the paralysis of cellular function of CD4 cells by the HIV retrovirus is secondary to the co.l-plumise of normal cellular markers of transduction pathways and second messengers.
G-proteins instrumental in the activation of adenylyl cyclase are likely to be deficient in their active form with a low dose threshold level. In this case, the deficiency of the normal cellular marker of G-proteins would be a disease marker. Since defibrotide affects the adenylate cyclase pathway (increased cAMP by defibrotide), defibrotide would restore the second messenger of cAMP, which therefore would be a repair marker.
The maximum therapeutic dose in turn would again follow the guidelines described above for vWAg, since this universal marker will get elevated with modulatiûn of any phase of repair process such as, for example, receptor up-~C;~
regulation, signal transduction or induction of translation and/or transcription, shutting off of transcription/translation which in turn may happen by activation of CREM, which is the inhibitor transcription factor of CREB, i.e., the latter is cAMP dependent initiator of the transcription factor of the CRE which in turn is the portion of the DNA enhancer sequence responsive to cAMP and cAMP
associated transcription factors, such as c myc products, c-fos products, ATP
Activation Factor, Serum Responsive Element (SRE), API transcription factor (ATF), HIV-Long Terminal Repeat (LTR ), leucine zipper transcription factors of c-foslc jun. (ATF, SRE, AP1 sites in c-Jos promoter/enhancer all respond to cAMP without the requirement of SRE. Protein Kinase A activates endogenous CREB activity and will enhance viral transactivation).
The prototype high molecular weight defibrotide, native defibrotide, low molecular weight native defibrotide, and chemical defibrotide derivatives regulate genes which are regulated by cAMP. These genes include vasoactive intestinal peptide (VI-P), somatostatin, human chorionic gonadotropin, phosphoenolpyruvate carboxylkinase, tyrosine hydroxylase, fibronectin, prolactin, ornithine decarboxylase, interleukin-6 gene, c-fos oncogene, haptoglobin, hemopexin, C-reactive protein (CRP), as well as other cellular genes which are regulated by cAMP responsive element (CRE), transcriptional factors interacting with CREB (which is 43 kd protein that interacts with CRE
via leucine zipper, such as c-myc products, c-fos products, ATP (Activating Protein), SRE (serum responsive element), API Protein kinase A will activate endogenous CREB activity and will also enhance viral transactivation.
CA 022~9041 1998-12-22 CRE/CREB related transcription of genes including HIV Long Terminal Repeat (LTR) will be positively induced with high cAMP levels.
The selected nucleic acid, e.g., defibrotide, will affect only injury-dependent parameters in each individual patient. As such, no uniform action will be observable in all patients. For the nucleotide transcriptionally-activated parameters, analysis is made for the highest values in each dose range. For the nucleotide transcriptionally shut-off parameters, analysis is made for the lowest value in each dose range.
Ther~py R~c~A on Univers~ rk~rs Several markers have now been sblown to reflect transcriptional genomic activity by nucleotides which increase cAMP, adenylate cyclase via the interaction of G-proteins, and phosphorylate tramscriptional factors via protein kinase A. Such markers include von Willebrandt antigen (vWAg), tissue plasminogen activator antigen (AgTPA) alnd ~2-microglobulin. While vWAg, AgTPA and ~2-microglobulin are representative markers, any moleeules which are initiated by nucleotides, or derivatives such as defibrotide, to induee transeriptional aetivity are ineluded.
It has been diseovered that vWAg may be employed as a universal marker to guide the ~e~m~nt of the duration of therapy, i.e., the most therapeutic dose, as well as the most effieacious daily dose. The inventors have discovered that vWAg is transeriptionally activated by defibrotide irrespective of the type of injury. Analysis of patient data has led to the unexpected finding that with the onset of cure, vWAg levels deeline. The production of vWAg will be activated CA 022~9041 1998-12-22 by defibrotide only for the duration of the injury and the repair process. In this regard, defibrotide will not effect vWAg levels in healthy individuals or following the establishment of cure, i.e., vWAg level will decline to baseline regardless of ongoing therapy. Concurrent analysis of vWAg with various "disease markers" correlated with changes in the disease marker levels. In other words, it has been discovered that therapy dependent absolute changes in disease markers (decline or increase) correlate with peak vWAg levels. The norm~li7~tion of disease markers, in turn, correlates with decline in vWAg levels.
vWAg is classified according to this invention as being a universal dose marker. vWAg can be utilized as the universal marker for all nucleotides that induce activation of cAMP and protein kinase A enzymes. vWAg is a plasma glycoprotein having a molecular weight of approximately 200,000 which is constitutively secreted by the endothelial cell. It is important in hemostasis as a prothrombotic factor (factor VIII/vWAg ]protein) and as an inducer of adherence of platelets to the exposed subendotheliurn. In every disease state, vWAg levels go up with increasing defibrotide dose levels when the dose is adequate to stimulate vascular endothelial function.
In accordance with the invention, an increase in the vWAg level corresponds to the induction of transcriptional activity of this gene by the nucleic acid. Elevation of vWAg is representative of the ongoing repair process. The decline in the level and eventual normali:zation of vWAg during therapy is representative of the cure process. Plateau in the level of vWAg correlates with ~1~
the application of the maximum efficacious dose. Without exception, the elevation in the level of vWAg is concurrent with modulation of the disease marker and activation of the repair marker. Here the maximum efficacious dose is determined along with vWAg, so as to normalize the levels of these molecules between 65 - 150%, and eliminatt the intracellular oxygen radicals (measured by chemilumin~scence, normal state being negative). For the prototype drug, defibrotide, the maximum efficacy in inducing transcriptional activation of vWAg occurs at doses of 40 DKGD and above, ideally within the DKGD range of 40 - 400. The universal marker vWAg dose levels are representative dose levels by the prototype's transcriptional/translational modulatory effects. Fitting the definition of universal marker, vWAg does not contribute to the expected correction of bleeding time but acts as a fiunctionally dormant molecule.
Another option is to empirically repeat therapy after three weeks following cessation of therapy on the above principles. In this regard, the half life of the nucleic acid appears to be about three weeks, based on the observation that universal marker vWAg requires 2 - 3 weeks to come down to baseline levels with cessation of tlnerapy. If the universal marker vWAg is elevated during therapy with the previous maximum efficacious dose, there is still a lesion to treat, irrespective of the fact that there are no known or visible clinical, and/or documented biochemical repair or disease markers.
Therapy, in accordance with the invention, is geared to continue until vWAg is norm~li7ed while on established~ maximum effective dose. Thereafter therapy is discontinued and the same cyc]es are repeated until the maximum efficacious dose therapeutically initiated no longer induces any elevation in vWAg, as would be observed in a normal healthy individual.
St~ti~tin~l An~lysi~
A statistical model has been used to assess the dose and duration of therapy with the ultimate objective of irreversible cure. For each molecular marker, calculations are presented, based on analysis of the data from all the patients for the "first day value," the "last day value," the "highest value" or "lowest value" (i.e., for transcriptionally activated molecular markers and for transcriptionally inhibited molecular markers, respectively), the "m-efficiency score," and the "time required to reach the optimal effect of the nucleotide" at the dose ranges employed. The "first day value" at a particular dose is the "last day value" of the preceding dose range. The "minimum of increasing values"
has been found to be the best parameter to follow for transcriptionally turned on molecules while the "maximum of the lowest values" has been found to be the best parameter to follow for transcriptionally turned off molecules.
The best parameter to follow the dose related induction of transcriptional activity is the "minimum values of the increasing levels" obtained on the first day of the initiation of each dose range. "Highest or increasing levels" represent the increase in level of a molecule whose production (transcription) is turned on with increasing dose levels. Choosing the minimum increase in the level in the transcribed genome among all patients treated in any dose range enables the prediction of the worst performance with that dose of the therapeutic compound.
This enables the treatment of the worst pPrformer, which allows turning on the CA 022~9041 1998-12-22 genomic transcriptional activity in the greatest number of patients within each respective dose range. Increase in the marker, as shown by "minimum highest value" represents that the repair process is ongoing, that is, repair molecules are being produced and transcriptional activity is ongoing.
The quantitative relationship between vWAg level and daily dose of the therapeutic compound is best visualized when the minimum value of the increasing vWAg levels in the population are analyzed (i. e., the worst performance levels in any one patient at any one dose range, "worst performance" implying that increasing the dose will incrementally continue to elevate the vWAg, which is biologically interpreted as me~ning that there are more repair events to go through).
Minimum increasing value is the plarameter to use to confirm the event of ongoing cellular repair. Maximum increa.sing value is the statistical parameter to use to follow the completion of the repair event. Maximum therapeutic dose is the dose at which vWAg on continued therapy will decline to a normal level.
The "maximum values of the lowest levels" obtained among all patient data on the last days of treatment at each dose range are similarly used to analyze how increasing dose raLnges affect the transcriptional activities involving the "turned on" molecules. The levels will show progressive declines, i.e., the progressive turning off of the repair process with the onset of cure, in spite of the higher doses.
Once maximum stimulation takes place (as assessed by the use of first day minimum highest levels), the cell gets turned off. By the use of the maximum ~\
lowest levels of the last day, therapy is continued at that particular dose level until these levels return to the baseline levels on therapy, i.e., until tlnere is no more ongoing transcriptional activity, i.e., the repair process is completed.
The m-efficiency value is the ratio of the respective elevated level over the time taken for elevation to occur. The higher the dose, the higher the value of the numerator and the higher the m-eff;ciency level. Alternatively, the shorter the time (denominator), the higher is the m-efficiency value.
Method of TrP~tin~ H~V-Infect~ Patient~ with nefihrotiAe or Itc Nucleic Acid Compon~nt~
Defibrotide or its nucleic acid connponents modulate cell functions at the nuclear genomic level through one or more pathways by modulation of the cell' s genetic material, i.e., DNA itself or translation or transcription of the genetic information. Defibrotide or its nucleic acid components-induced cellular modulation restores the normal functions of the cell such as the production of normal proteins needed by the cell and, in the case of HIV, the correction of the effects of the abnormal, viral encoded genetic material by inhibiting its further production at the expense of the normal, virus-free genetic material. In the course of the multiphase treatment, defibrotide or its nucleic acid components is ~ministered at dosages much greater than previously described in the literature for other disease states. The dosages and durations of the phases of therapy are adjusted according to the results of laboratory studies performed on the patient's infected cells. Preferably, in treating HIV, an initial bolus dose of 100 mg/kg in 50 ml DSW is infused over a period of 30 - 60 minutes followed by 200 5~
mglkg/day infused in 250 - 500 ml DSW over a period of 3 - 24 hours. From day 2, dose is esc~l~te~ to maximum tolerable dose, maximum efficacious dose and maximum therapeutic dose levels. In this way, the HIV virus may be inactivated and its proliferation arrested. Therefore, the progress of the disease may be arrested or ameliorated.
ReMuse HIV virus adversely affects the genetic material and function of the cells, defibrotide or its nucleic acid components can effectively treat HIV
infection as long as the carrier CD4+ cell and/or the monocyte harboring the virus preserves the physiological ability to revive itself. Therapeutic success with defibrotide, however, is strictly dependent upon the ~sessment of the correct treatment doses for the respective disease states. Moreover, since the optimum function of the normal cell, by defmition, would not be compatible with any complications, defibrotide or its nucleic acid compDnents at any defined maximum efficacious dose, specific for any patient and disease state would be complication-free .
Sarin etal. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85:7448-7451), aswell as Leonetti et al. (Bioconjugate Chem., 1990, 1:149-153), have shown that anti-sense oligonucleotides are potent inhibitors of HIV-l replication in cell culture.
The methylphosphonate linked oligonucleotides were found to be superior in this effect over the phosphodiester linked oligonucleotides, apparently as a result of their resistance to nucleases. This property was deemed to be the factor in the superiority, since oligonucleotides less than 20 bases in length proved to be ineffective inhibitors.
CA 022~9041 1998-12-22 - W O 98/48843 PCT/~S98/08357 ~3 Efficacy of defibrotide or its nucleiic acid components may have several concurrently active mech~nicmc. Defibrolide or its nucleic acid eomponents may provide anti-sense neutralization of the viral proteins. Defibrotide's mechanism of efficacy may be at the nuclear level by modulation of genetic functions via other pathways as well. Defibrotide's actiions may be more apparent during viral phases which involve translation and/or transcription of the DNA message, so as to revive the normal function of the cell at the expense of the disease-specifie molecules. This action may be analogous to anti-viral effects of Ampligen (a micm~tched double stranded RNA-molecule). However, whereas Ampligen exhibits immunostimulating effects, agents such as defibrotide are both immunostimulants and immunosuppressants. Defibrotide or its nucleic acid components may modulate viral penetration into the cell via its known action of inhibiting intracellular ealcium mobilization. Also, defibrotide or its nucleic aeid components may direetly inhibit viral enzyme reverse transeriptase via inducing ATP production analogous to ddI (dedeoxyinosine), by virtue of its known action of inducing high energy metabolites (ATP, ADP, NADPtNADPH), possibly via modulation of Complex-I respiratory moleeule. Defibrotide or its nucleie acid components may inhibit protein kinase C, analogous to Hypericin. Defibrotide may also decrease Tissue Necrosis Factor (INF), a cytokine known to promote HIV activation, by its known effect on increasing cAMP levels at the correct defibrotide dose level similar to Pentoxyf;lline.
Whatever the mechanism, zinc is known to have an inhibitory effect upon nucleases acting on phosphodiester linkages, as well as an enhancing effect on CA 022~9041 1998-12-22 base pairing. U.S. Patent 3,770,720, teaches that in the production of defibrotide, zinc should be removed from the molecule. However, in the treatment of AIDS, it is preferred that zinc be present. Moreover, it is preferred that iodine should also be present. In the defibrotide used in the Examples iodine was present in an approximate ratio of one zinc atom per iodine atom and a two to one ratio of zinc + iodine to nucleotide base.
As can be seen from comparing thie cellular uptake data shown in Figures 2 and 3 with the data shown in Figures 4, 5 and 6, a greater level of defibrotide enters the lymphocytes when biotin is present. Horn et al. (Planl Physiol, 1990, ~:1492-1496) has observed that biotinylated molecules enter the cell via the folate endocytic pathway. The data of Figures 2 - 6 read in conjunction with the above-cited Horn reference, indicate that defibrotide with biotin may also use the folate endocytic pathway.
Defibrotide may jointly and/or selectively modulate one or several pathways. This modulation will be, only to the apl)ropliate degree thus surpassing all of the other anti-HIV agents in its lack of side effects, yet presence of proven efficacy. Defibrotide will achieve this result only when the dose levels are tailored to the patient, stage of disease activity and/or reigning stage of viral activity.
The method of treating the HIV-infected patient begins with a panel of laboratory studies which include the quantitative evaluation of the activated peripheral blood mononuclear cell subsets, circulating viral proteins, cytokinases and soluble cell-surface receptors. There are no patient inclusion or exclusion ~ 5 criteria for therapy. Patients in any or all of the four clinical stages of HIV-infection including history of exposure (i.e., HIV+, Pre-ARC, ARC, and AIDS) are candidates for therapy. The initial adtninictration of a selected dosage of defibrotide is followed by incrementally increasing the dosage of defibrotide until a maximum tolerable dose is reached. The laboratory panel is repeated weekly during this therapy. These results together with the clinical markers of diseasewould indicate whether the defibrotide is e fficacious and whether defibrotide should be continued to be given alone or with other therapeutic agents.
The details of treatment and the dose ranges fitting the various stages of the HIV disease will be expressed by retrospective analysis of respective laboratory and clinical markers. Additionally, dosage levels and frequencies as well as the use of other anti-HIV medication will also depend upon the individual patient or stage of disease and/or other concurrent medical conditions.
Before the initiation of therapy and weekly thereafter blood is drawn from the patient and subjected to a panel of tests which preferably include activated peripheral blood mononuclear cell subsets by two~olor flow cytometry, lymphokines and soluble cell surface receptors by ELISA, and HIV-viral proteins by Western blot analysis. The peripheral blood mononuclear cell subset analysis will usually include either CD4+, CD~+, CV19+, CD25+, CD56+, and HLA-DR alone, combined with one another, or combined with the quantification of monocytes. The Western blot protein tests include gp-24, gp-17, gp-120 and gp-160. The ELISA test measures TNF, sIL2R, sILl and soluble CD8. Every third W O 98/48843 PCT/~S98/083~7 ~' week, it is p~c;Çelled that cell cultures for ]HIV antibody neutralization, PCR and reverse transcriptase determinations be made.
H~V-I Gene Therapy in Accor~nce with l:he Tnv~ontion Gene delivery thus far has been a method by which foreign genetic material is introduced into a suitable target cell usually via viral vectors. Such strategy generally consisted of an ex vivo ;md an in vivo phase. In the ~x vivo phase the foreign gene is inserted into target cells derived from the recipient.
The engineered cells containing the newly inserted gene are expanded ex vivo. In the in vivo phase, the expanded engineered cells are transplanted into the recipient.
This modulatory therapy is the first of its kind which manages therapy from cell surface signaling to genomic modulation utilizing the oral and/or intravenous ~Iminictration of nucleotides, without utili7ing retrovirus, adenovirus or other gene viral vectors traditionally employed in gene therapy. Gene therapy has not, heretofore, been utilized without cellular transfection with viral vectors, and never before by oral or intravenous administration of nucleotides to humans.
Gene therapy has not, heretofore, been tried without the interaction of viral vectors, i. e., by the ~-lmini.ctration of nucleic acid-based pharmaceutical agents orally and/or by intravenous route. The prototype drug defibrotide, although administered to patients over the past 5-6 years, has never heretofore been contemplated for gene therapy. In addition, in other modalities of gene therapy, dosage has never been assessed IDY molecule markers. Molecule markers have never been defined within lhe system of secondary messengers, CA 022~9041 1998-12-22 signal transduction systems, promoters (DNA sites which are on the same chromosome as the gene transcribed and to which RNA polymerase binds), enhancers (DNA regions that control a promotor from a great distance, sometimes as much as 30,000 bases), and ~ranscription factors (diffusible regulatory proteins which bind to DNA transcription activation domains and regulate the rate of transcription by RNA polymerase).
HIV-disease has not been previous]y interpreted as a disease of dismodulation involving the genomes, cellular secondary messengers and cellular signal transduction systems. The specific pathways affected by the HIV-retrovirus have not been clearly dPline~t~d. Therapy of HIV-disease has not previously attempted to reclaim the affected cellular function systems from the virus by reversing the dismodulation at the various levels by using exogenous therapy involving various modulators of these systems.
The therapeutic approach of the invention tli~eng~ges itself from the common practice of planning therapy based on clinical staging. The planning of therapy is based on the identified mismodulations of (a) membrane lipids and cytoskeleton; (b) cell-surface receptor/lig<md interactions; (c) secondary messengers; (d) signal transducers; (e) cellular transcription factors utilized in viral replication: as well as based on the identified (f) oncogenes; (g) viral transcription factors; and (h) viral genomes. The method of therapy disclosed herein for HIV may also be used in treatrnent of other viral infections and neoplasms.
CA 022~9041 1998-12-22 These mismodulations are classifie:d into marker categories of (I) repair markers (items a - e) and (ii) disease markers ~item f - h). The object of therapy in accordance with the invention is to (I) reestablish repair markers at the constitutively expressed tissue levels; and (ii) elimin~te disease markers (in case of the oncogenes to reverse the transformation).
Irrespective of disease stage or clinical status the patient is screened with the complete panel of secondary messengers and signal transducers (repair markers), since all repair markers are bic,chemically interdependent. Repair markers reflect the underlying logic of transcriptional regulation. Therapy is aimed to concurrently induce some markers and suppress other markers. The prototype nucleotide if used at the correct doses (which are guided by the respective repair markers) can accomplis'h this goal.
Flimin~ion of disease markers by the therapeutic nucleotide compound will occur at various levels. It can be an indirect phenomenon based on modulations of secondary messengers, such as cAMP; it can be a direct phenomenon based on modulations of the phosphorylation events involving genes and transcription factors. For example, cAMP activates protein kinase A
enzymes, Ca2+ activates protein kinase C' enzymes, the prototype nucleotide up-regulates cAMP, and downregulates Ca2+, or it can be a direct phenomenon based on modulation of cAMP responsive gene promoters (CREM, as enumerated above).
While not being bound to any sp~cific mechanism of action, the following are proposed.
5q Proposed Mech~nicm A. Induction of sIL2R gene and HIV-I LTR are interdependent phenomena. If the protein kinase C dependent sIL2R gene is turned off by high cAMP levels, activation of HIV-I LTR is concurrently suppressed as well.
Proposed Mech~nism R. Increasecl cAMP levels have been shown to induce viral replication (Nokta and Pollard, 1992, AIDS Research and Human Retroviruses s(n 1255-1261). HIV-I RE'V/ENV genes are both phosphoproteins. There may be other routes for cAMP-induced replication of HrV-I. Although ~dministration of the m;~cimum efficacious dose will increase cAMP levels, prolonged ~timini.ctration oi the nucleic acid at the maximum efficacious dose, so as to reali~ the succes.sful ~(imini~tration of the maximumtherapeutic dose would culmin~te in declinin~ cAMP levels, since vWAg decreases on therapy if and once the maximum therapeutic dose is ~minictered.
Hence ~(1minictration of the maximum therapeutic dose is paramount in overcoming cAMP induced viral replication. This phenomenon may at least partially, be based on the induction of protein kinase C, as a secondary biochemical event (i.e., protein kinase C induces sILR2 gene, which in turn modulates protein kinase C so as it can directly inhibit cAMP).
Proposed Mech~nism C. The transcription factor NF-kB binds to both the HIV-I enhancer, and the sILR2 gene. Protein kinase C phosphorylates its inhibitor Ik~3 and releases active NF-kB. Increased cAMP levels by inhibiting directly the Ca2+ induced activation of protein kinase C would moclulate this phosphorylation event, and downregulate the transcriptional activities related to NF-kB. Since NF-kB binds to both the HIV enhancer and IL2 receptor, increased cAMP levels will downregulate HIV-I replication.
Proposed mech~ni~ms B and C show that increased cAMP levels can be both deleterious and beneficial. It can be clearly seen that the prototype nucleotide is an overall "downregulator" of biochemical events, if maximum therapeutic and efficacious dose levels are ~dmini.ctered.
It has also been discovered that the co-~dministration of various sequence specific, anti-sense or mi.s.sen.~e nucleic ac:ids with, for example, defibrotide, would (1) alleviate the complication of cAMP induced viral replication; (2) induce inhibition of viral replication me~ t~ via modulations of cAMP, protein kinase A, protein kinase C, cellular redox state, G-proteins, or cAMP induced gene promoters (in this regard, defibrotide and other nucleotide derivatives introduce for the first time into anti-HIV therapy nucleotides with no sequence specificity that concurrently modulate the totality of the cellular second messenger/signal systems for rapidly transducing extracellular signals into specific patterns of gene expression in the nucleus); (3) concurrently induce inhibition of viral replication with sense, anti-sense, or missense nucleic acids (e.g., DNA, mRNA, DNA/RNA ribosornes, inhibitors of viral protease, viral integrase); and (4) introduce a modality of gene therapy (i.e., genetic engineering) which can be safely a(lmini~:t.o.red to humans, which does not utilize viral vectors, which can be a(lministered either intravenous or orally, which enables admini~tration of sequence specific combination of nucleic acids adjusted specifically to the selected parts of the HIV-genome and cellular repair pathways, (O~
which adjust the dose so as to modulate selected genes or cellular/viral molecules, which enables the most efficient ~dmini~tration of various different nucleotides with differing cellular uptake ~dynamics and chemical anti-viral potencies, and which ~(lminicters excess DNA to enable the self-integration of DNA.
This process is superior to present viral vector directed gene therapy and would also enable competitive inhibition of proviral integration, and/or dislocation of the integrated pro-virus. Cellular uptake dynamics would directly define the anti-viral and genetic modulatory capacities of each respective nucleotide. Nucleic acid derivatives having chemical modifications are as described previously (e.g., nucleotides conjugated with po}y(E-lysine) or which is modified by, for example, the addition of amino acids such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals ;and ions including zinc, m~n~nese and iodine, by the addition of 5'-polyalkyl moieties, cholesterol, vitamin E, 1-2-di-0-hexadecyl-3-glyceryl and other lipophilic moieties and/or modified by the replacement of phosphodiester bonds with phosphothiotate bonds) and combination nucleic acids would be emp]ioyed.
FXAMPT FS
Fx~le 1 To measure the effect of defibrobide on HIV it was first necessary to label the drug and determine whether defibrotide will enter the nucleus of the human cell. Knowing the phosphodiester linkag~es in defibrotide, its comparabive nuclear penetration was assessed by labelling defibrotide with a photo-activatable analogue of biotin. The biological activity of defibrotide after labelling was considered to have been preserved since published data shows that previous oligonucleotide probes have been labelled with conjugates and still remained biologically active. Image analysis utilizillg a cold CCD camera revealed that uptake of defibrotide was localized in the nucleus. This supports the hypothesis that the mechanism of efficacy for defibrotide is largely contributed to by its modulatory activity on the genetic materia~ of the cell, no matter what disease entity is being treated. As shown in Figures 2 and 3, the nuclear uptaLke of defibrotide is directly proportional to the concentration of defibrotide with biotin.
The observed uptake supported the increased efficacy of defibrotide with the larger doses used, and also supports the hypothesis that at critically high dose levels various previously unknown different effects of defibrotide can be seen. It was also observed that uptake by monocytes was significantIy greater than that by Iymphocytes.
The cellular uptake of defibrotide without biotin and labelled with cyanine dye Cy5. 18 was also measured. It was observed that biotinylation of defibrotide enhaLnced the cellular uptake of defibrotid,e in the lymphocyte population.
However, there was no difference in uptake between monocytes incubated with biotinylated or fluorescently tagged defibrotide. This can be seen by comparing Figures 4 and 5.
~3 Fx~ )le 2 To further confirm the specificity of defibrotide for the treatment of HIV
infection, HIV infected peripheral blood rnononuclear cells with varying doses of defibrotide were evaluated by staining for all viral envelope proteins using concanavalin A (Con-A) stimulated and unstimulated cells (Anti-HIV 1, and Anti-HIV 3 specific Anti-HIV antibody). The blood sample was obtained from a patient using an evacuated blood collection tube containing sufficient EDTA to prevent coagulation of the sample.
Mononuclear leukocytes (white cells) were obtained by layering a 1:1 (volume:volume) blood to RPMI 1640 tissue culture medium (Grand Island Biological Co.) aliquot over histopaque (d = 1.077, Sigma Chemical Co.) under sterile conditions. The white cell popula~ion was suspended in a solution of the ~PMI 1640 medium supplemented with ].0% heat-inactivated fetal calf serum and gentamicin, at the concentration of S micrograms/milliliter. The white cells were then concentrated to a level of two million cells per three milliliters (2 x 106 cellst3 ml) of the above solution. The white cells were collected in flat-bottomed microtiter containers (Cell Wells, Corning).
The cell populations were further divided into two groups. One group received stimulation by Con-A, the other group remained unstimulated by Con-A. Con-A stimulation enhances the uptake of the antibo~y-dye label by HIV-contaminated cell components, thereby demonstrating an increase in the expression of the HIV protein.
Subpopulations of unstimulated and stimulated white cells were then incubated in the presence of discrete concentrations of defibrotide. Each successive assay employed successively greater concentrations. A control sample of incubate containing no defibrotide was also prepared. A labelling antibody solution was prepared by directly conjugating CyS.18 with human a-HIV
antibody to a final dye/protein ratio of 5.() (a-HIV-CyS. 18).
The cell subpopulations were again divided into two groups, one group for intracellular antibody labelling, and one group for surface antibody labelling.
Cells reserved for intracellular labelling were fixed with 70% ETOH, washed twice with monoclonal wash, and then resuspended into a solution cont~ininE: 200 microliters of Hank's balanced salt solution (HBSS), supplemented with 2% FCS
and 0. 1 % sodium azide (monoclonal wash) and 5 microliters of a-HIV-CyS.18 solution. The entire cell preparation was incubated for 45 minutes at 4~C. The cell preparation was then washed twice with the monoclonal wash, and resuspended in 1% paraformaldehyde.
Cells reserved for surface labelling were prepared by washing twice in monoclonal wash to which 5 microliters of a-HIV-CyS.18 have been added.
Next, 20 microliters of specific surface glycoprotein monoclonal antibody was added to the incubation solution. The surface glycoprotein antibody solution contained CD3-FITC (heterogenous T-cell antibody conjugated with fluorescein isothiocyanate dye) and CD4-RPE (helper T-cell antibody conjugated with phycoerythrin dye) obtained from Becton-Dickinson.
All cells thus prepared were then analyzed using a Becton-Dickinson FACS 440 dual laser (argon/krypton) flow cytometer. The expression of HIV
proteins was deterrnined on a per-cell basis. Fluorescence was measured on a logarithmic scale but converted to a linear scale for analysis.
Figure 7 shows HIV protein expression at selected dosages. Assay results for the same sample shown in Figure 8 are in terms of the intensity of the fluorescence of certain antibody-labelled mononuclear leukocytes (Mean Linear Fluorescence Intensity). Fluorescence intensity is proportional to HIV protein ~pression, and thus the activity of HIV. It is seen that the expression of the HIV proteins decreases and then levels off with increasing concentrations of defibrotide.
Before ~(imini~tration of defibrotide, Con-A stimulated cells expressed 32 % more vi~al proteins. However, after adminis~ration of 20 mg of defibrotide, both stimulated and unstimulated cells express 70% less viral proteins. At 30 mg concentration of defibrotide in both Con-A stimulated and unstimulated cells the expression of viral proteins leveled off. This supports the specificity of defibrotide for HIV-virus as well as the fact that if cells are induced to divide, tr~nslating into proliferation of the virus, more HIV virus can be killed, albeit, at higher doses.
FY~rnple 3 Patients with various diseases of vascular prothrombotic backgrounds were treated with esc~l~ting dose levels of defibrotide. A variety of coagulation and hematological assays with other molecular markers of inflammation, etc., , . . . .
W O 98/48843 PCT~S98/08357 (0~
were conducted on blood samples drawn from the patient before and after each dose esc~l~tion. From an analysis of the test results and clinical observations, it was discovered that certain effects of defi'brotide lead to a remission state of certain specific aspects of disease states corresponding to the various dose ranges employed.
As an example, hematological recovery in thrombotic microangiopathy, generally, yet not exclusively, occurred ~/hen the patient received doses of defibrotide ranging from 20 to 30 mg/kglday. These doses however did not cure the renal lesions since cre~tinine levels rernained above normal (or only partially corrected) at the dose levels where hematological recovery was complete. Renal recovery evidenced by norm~li7~tion of creatinine levels occurred between 40 and 250 mg/kg/day.
Even in the presence of norm~li7zltion of cre~tinine levels (the conventional criteria of complete recovery) it was observed that complete remission was yet to be reached by the olbservation of elevation of blood pressure, low AgTPA and high fPAI levels. Therefore, doses of defibrotide continued to be increased until blood pressure levels became normal. The dose elevation not only treated blood pressure, but also led to further improvement of cre~tinine. Thus, treatment with marker-dependent doses, applied correctly, led to a state of "cure".
F.x~mple 4 In a normal individual, increasing the DKGD dose does not induce any elevation in the vWAg since there is no ongoing repair process, i.e., no disease state. Doses ~dmini~tered to a normal individual, in contrast to the doses given to an individual exhibiting a pathological disease state, did not induce any alteration in vWAg levels, i.e., defibrotide did not induce transcriptional activity at the genomic level. vWAg predicts the transcriptional rate of the respective repair molecules induced by the nucleotide and will guide the ~sessmçnt of maximum efficacious dose and maximum therapeutic dose.
In a ~ ed individual, an increase in DKGD increases the preceding minimum highest value of vWAg by an increment smaller in each successive interval. Using defibrotide, the highest percentages of increments were found to occur at the borderline of 40 DKGD. Inc:reasing DKGD above 400 induces only negligible improvements over levels below this dose. In practice, this is the dose level above which complications of bleeding have been observed by the inventor with high molecular weight defibrotide.
Flr~mpiles 5-7 Examples 5-7 report the treatmen~: of three HIV infected patients. This patients were all treated in Turkey with defibrotide obtained from CRINOS. In Tables I-IV, below, the following are the normal laboratory ranges: IL-l = 3.6 pg; IL-2 - 4.3-4.8 pg; IL-6 = 7.1-7.3 pg; llNnFa = 25.1-26.3 pg; cAMP =
0.4-0.6 nM; cGMP = 0.85-0.95 nM; nc,rmal cGMP/cAMP = 2.125; ,B2-microglobulin = < 1900 ,Lg/l.
F.x~le 5 A 28-year old white HIV+/ARC male exhibiting waste syndrome, Herpes labialis and Herpes genitalis associated with widespread tissue damage, oral/pharyngeal candidiasis, polyarthralgias and tuberculosis was treated with defibrotide.
On Day 1 of treatment~ a 360 mg/lcg IV bolus of defibrotide was a~mini~tered. Thereafter, a dose of 160-275 mg/kg/day was administered.
Deilbrotide was ~-lministered 86 days out of a 118 day treatment course.
Progressive increase in weight and amelioration of diarrhea was observed throughout the therapy period, a total weight gain of 12 kg occurring during the treatment period. Improvement in Karnoisky performance score started at day 3 and increased from a score of 3 to a score of 10 over the treatment period.
The effect on arthralgia was obser~ed by the third consecutive day of treatment and was found to be strictly dose dependent. Upon cessation of therapy arthralgia relapsed to original condition and entered remission upon reiniti~tion of DNA therapy.
The effect on Herpes began on day 4 of treatment. By day 36 of the treatment period, genital Herpes lesions were in complete remission. By day 68, Herpes labialis lesions were in complete remission. No relapses were seen with temporary cessation of defibrotide.
Tables I and II summarize pertinent laboratory markers.
Table I
TIME Absolute CD4 Absolute CD8 Absolute B2-micro-(days) Lymphocyte % CD4 % CD8 globulin 1388 13.2 183 22 305 N.D.
26 1152 32.0 369 50 576N.D.
N.D. N.D. N.D. N.D. N.D.3582 104 N.D. N.D. N.D. N.D. N.D.1348 118 3300 21.0 693 32 1056N.D.
N.D. = notdetenni~
Table II
TIME IL2 TNFa IL6 cAMP cGMP cGMP/cAMP
(days) 8 14.3 30.1 41.6 2.0 1.03 0.52 76 7.3 14.7 3.7 3.65 2.10 0.58 Elevated cAMP/cGMP was observed at the onset of therapy, signifying activation of both protein kinase A and pr,otein kinase C pathways. A
progressive rise in absolute and T lymphocyte numbers, CD4 and CD8 was seen.
A decrease in ILl, IL-2, IL-6 and TNF-a was observed during treatment.
Complete remissions in accompanying disease states include Herpes labialis, oropharyngeal candidiasis, arthralgia, and Herpes genitalis as well as accompanying tissue damage. Complete norm~li7~tion of TB findings (Chest x-ray) with apparent radiological remission occurred.
.. . . . . ,, _ ..
r~
F.x~mple 6 A 25-year old white HIV+ female was treated with defibrotide. At the onset of therapy, the patient was asymptomatic but had a low CD4 count.
On day 1 of the treatment, a 200 mg/kg IV bolus of defibrotide was ~lministered. Thereafter a dose of 150 - 275 mglkg/day was administered.
Anabolic effects of the DNA were seen by day 13.
DNA therapy was terminated after 29 days secondary to a rise of CD4 percent and absolute counts. DNA therapy was reinitiated 25 days later secondary to a decline in CD4 percent and absolute counts. Therapy was continued on an outpatient basis, intravenous ~mini~tration being alternated with oral ~minis~ration.
Tables III and IV summari~ pertinent laboratory data. In this patient, all tested interleuk~n levels were normal.
Table III
TREATMENT CYCLE #1 TIME Absolute CD4 Absolute CD8 Absolute ~2-micro-(days) Lumphocytes % Cl)4 ~0 (: D8 globulin 973 15.2 148 20.1 196 N.D.
28 1100 48.0 5,~8 50.0 550 3300 TREATMENT CYCLE #2 429 34.0 146 22.0 94 N.D.
1945 15.0 292 20.0 389 2468 56 2600 29.0 754 20.0 520 N.D.
N.D. = notd~t~.~i~
~\
Table IV
TREATME~r CYCLE #2 TIME (days) cAMP cGMP cGMP/cAMP
1.25 0.98 0.78 8 1.55 3.00 1.94 1.50 3.40 2.27 Treatment was characterized by increases in CD4, CD8, total lymphocyte, total T-lymphocyte counts accompanied by elevations in cAMP and cGMP, and in therapy related decreases in IL-6 and TNF-a. A total weight gain of 7 kg was observed.
Fx~mple 7 A 33-year old white male with AIDS and opportunistic infections including Herpes labialis associate with necrotic lesions, oral/pharyngeal candidiasis, tuberculosis and crytococcal diarrhea.
On day 1 of treatment, a 200 mg/kg IV bolus was administered.
Treatment at a dose of 100 - 250 mg/kg/,day was continued until day 40. The lower doses being given on days 7 - 13 having been reduced secondary to prolonged API~. Tre~tment was thereafter discontinued due to unavailability of the drug. The patient died 8 days following cessation of therapy.
An anabolic effect was seen from day 6. Diarrhea was controlled from day 3 and cultures for cryptococcus became negative on day 15. Lesions of the lip began healing on day S and were completely healed by day 18. Odynophagia improved from day 5. Performance score began improving by day 3, reaching an optimum level of 5 between days 16 and 21.
Tables V and VI summari~ pertinent laboratory data.
Table V
TIME Absolute CD4 % Absolute CD8 % Absolute (days)Lymphocytes CD4 CD8 7 700 10.0 70 29.0 203 18 800 10.0 80 17.0 136 44 700 8.0 56 14.0 98 Table VI
TIME IL1 IL2 TNFa IL6 cAMP cGMP cGMP/cAMP
(days) 21 105 18.0 95. 1 40.~i1 .4 1. 1 0.79 33 85.5 7.6 14.8 45.]L 1.5 0.96 0.64 Decline in elevated IL-1, IL-2 levels and complete norm~li7~tion of TNF-a levels was observed. An increase in n-6 was seen with cessation of therapy.
At the time of death, a 3 kg weight gain w as observed, and Herpes labialis and oral/pharyngeal candidiasis were in complete remission.
Repair markers are compounds that participate in the regulatory pathways which include protein kinase A or protein kinase C. Adenylate cyclase is known to be activated by G-proteins (see Ross, 1992, Curren~ Biology, 2(10):517-519, the disclosure of which is incorporated herein by reference) with eventual production of cAMP and cAMP-dependent activation of protein kinase A, leading to phosphorylation of the respective transcription factors, until 100% of the cell membrane receptors are taken up by the ligands. For defibrotide these receptors are ~-adrenergic receptors, collagen receptors, adenosine Al/A2 receptors, ADP receptors, thrombin receptors, collagen receptors, etc). A
parallel pathway operates through actival~ion of protein kinase C, in response to intracellular calcium ion level, inositol triphosphate and diacylglycerol, responsive to ligand binding to another siet of receptors and similarly controlling transcription/tran~l~ti- n of respective proteins. These pathways, and their intermediate compounds are well known to those skilled in the art. However, their use in assessment of therapeutic dosage have not, heretofore, been known in the art.
In particular, "repair markers" are molecules in the pathways of the respective cellular repair processes defined by the type of injury. Repair markers are transcribed or shut off genes, second mçssçngers and/or molecules of the signal transduction pathways that may be increased, decreased, or absent in response to cellular injury. As discussed herein, the term "repair marker" may refer to the compound or its concentration or the measurement value of an assay associated with the concentration of the compound. Examples of suitable repair markers include but are not limited to cAMP, cGMP, IL-1, IL-2, TNF-a, IL-6, cGMP/cAMP ratio, total lymphocyte count, T lymphocyte count, CD4 count, CD8 count, cAMP dependent protein kinase A enzyme, adenylate cyclase, G-protein, phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol, intracell~ r calcium level, intracellular calcium ion level, c-myc, ras, c-fos, cjun, NK-kB, EIAI, AP-l, COUP, TCF-1~, TATA, TAT elem~nt, oxygen radical, CREB, CREM, Platelet ]Derived Growth Factor (PDGF), Colony Stimul~tin~r Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor (IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src Homology 3 domain (SH3), serine/threonine kinase, Mitogen Activated Protein Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and Activators of Transcription (STATs), JAJ 1, JAK2, Tumor Necrosis Factor -Receptor I signal Transducer TRADD, c:hemokines of Rantes, and MIP-Alpha, and MIP-Beta.
The level of a repair marker may deviate from the level present in the cell during normal function, and when it does so deviate, cellular repair processes are activated. This deviation may be positive or negative, depending on the disease state and the precise state of cellular repair currently in progress. As discussed herein, the "intensity" of the repair marker will refer to the degree of deviation from the level during normal cellular function, without regard to whether the deviation is positive or negative. The use of repair markers in establishing dose and duration of therapy is a novel mode of ~mini.ct~ring a pharm~eutical agent.
As defined herein, a "universal marker" is a constitutively expressed molecule transcriptionally activated by the respective nucleic acid universally in all disease states for which the nucleic acid is specific. "Universal markers" are specific for each nucleic acid employed. While the universal marker is the only molecule that is not injury specific and has no therapeutic value, it is expressive of the event and duration of the ongoing repair process. Transcriptional activation gets shut off with the establi~hmt.nt of the state of cure. As such, the universal marker does not get modulated unless there is a disease state and the respective nucleic acid has therapeutic specificity. The universal marker carries a direct quantitative relationship to the ~aily per kilo~gram body weight dose (DKGD) of the nucleic acid employed. A universal marker defined for the prototype nucleic acid (defibrotide) is vWAg. Other "housekeeping genes"
related to particular nucleic acids can be selected as per the target cell involved from the respective "house~ping genes."
Clinical and clinical laboratory markers may be determined through blood tests, urine tests, clinical observation or identification of blood clots by any of several conventional techniques, as well as the more novel techniques of determining genomic transcriptional and translational activity by DNA finger printing, PCR and the like. To evaluate the markers, the laboratory analyses W O 98t48843 PCT/US98/08357 ''3~) measure levels of certain proteins, lymphokines, enzymes and relevant molecules. Clinical markers include blood pressure, visible tissue damage, signs of infl~mm~tion, ecchymoses, and the like. Clinical markers vary from one disease to another. Moreover, like HIV, many ~ es progress through several clinical stages during the process of recovery. The clinical markers of one stage of a disease are frequently different from the clinical markers in other stages of the disease, befitting different stages of the pathogenic picture.
The detection of markers relevant to the particular disease, stage of that disease, and as baseline for dose escalation, must first be identified. Any observable characteristic generally accepted by the skilled practitioner as being associated with a specific disease state may be employed as a clinical marker.
See, e.g., Hamson's P~lNClPLES OF l VTERNAL MEDICINE, 10th Edition, Petersdorf et al. Eds., McGraw Hill. The skilled artisan would readily recognize those markers indicative of a pathological state.
One critical marker is chosen at each respective stage of the repair process and the maximum efficacious dose for that marker established.
Admini~tration of that dose induces correction of other stage-specific markers not neces~rily identified or aimed at during therapy (i.e., "stage specific pleiotropism"). Following norm~li7~tion of the first chosen marker, a second marker which continues to deviate from ~he normal condition is chosen. The dose that normalizes the second marker (i.e., the higher dose) is likely to further improve the first marker incrementally.
CA 022~9041 1998-12-22 3~'~
Initial ~dmini.ctration of the selected dosage is followed by incrementally increasing dosages until the "maximum efficacious dose" is reached. A panel of laboratory assays to determine the state of the markers (e.g., absence, increase, decrease) is repeated every 3 to 7 days during therapy. These results together with the clinical markers of disease would indicate whether the defibrotide, or other nucleic acid derivative, is adequate in dose and duration to cause improvement in the pertinent marker or markers while simultaneously being totally safe to administer. Therapy is continued with esc~l~ting doses over sufficient time to assure complete norm~li7~tion (i.e., the clinical laboratory assays, when compared to the reference r~mge, are indicative of the norrnal condition) of the pertinent markers. When norm~li7~tion is reached, therapy is stopped.
Although therapy is discontinued, the patient is tested weekly for the current state of the pertinent disease marker. If relapse occurs, therapy is reinitiated at the highest dose level of the prior course of therapy until norm~li7~tion is again reached. While optional, it is advisable to continue esc~l~ting the dose level to potentially rea.ch a shorter duration of therapy.
The highest tolerable dose per day which is complication free (e.g., no bleeding, thrombopathy) is preferred since treatment periods are usually shorter at higher dose levels. Therapy cycles are repeated until there is complete and irreversible normalization of the pertinenl~ markers at which point the patient is cured. A marker is considered to be irreversibly norm~li7~ if it remains normal for three months without therapy.
CA 022~9041 1998-12-22 WO 98/48843 PCTA~S98/08357 There is a certain dose level which will ultimately give plateau levels on a particular marker, and irrespective of how long the dose range is continued, the level of the molecule will not go higher unless the dose (or cellular uptake of the respective nucleotide) is increased. This ;agrees with accepted biochemical knowledge, i.e., the more the number of receptors receiving signals, the more cAMP is produced and, as a consequence, the higher the transcriptional activity pertaining to vWAg is.
Minimum effective dosing is therefore counterproductive and markers have to be used to assess the maximum efficacious dose. Application of the higher dose will promptly lead to higher levels in a shorter time (high m-efficiency score). This is confirmed from the cellular uptake curves.
Once a plateau is reached with the maximum efficacious dose, the m-efficiency score can thereafter be used along with the maximum highest levels of the last day to assess how long therapy should be continued to complete the repair process, i. e., when the maximum efficacious dose is continued when m-efficiency score is less than 1.0, the nucleotide no longer exerts any further therapeutic effect. This observation leads to the statistical definition of "maximum therapeutic dose," i.e., the time slot of the total ~dminictered dose beyond which further repair of the selected marker would not take place at that particular dose level.
If another disease marker were selected, the maximum efficacious dose and maximum therapeutic dose would be redefined for that second stage marker.
One skilled in the art, based on the information presented herein, would be able to detect and determine finer disease/repair markers so as not to miss complete cure. Any abnormality in any marker should prompt reinitiation of therapy, even if no visible disease markers are observed, since many of the markers of the subclinical stage will be biochemical molecules, e.g., an interleukin.
Tr~tment in Accor~nce wi'h the ~nv~r-tion A prefelled embodiment of the treatment method according to this invention is diagramed in Figure 1. An initial laboratory test panel (box 1) is first run which would consist of the respec:tive set of "disease markers" and the universal panel of "repair markers" con~i~ting of signal transduction/second messe~ger panel molecules. Additionally oertain laboratory assays are used to assure that the dosages are safe for the patient being treated. For defibrotide these may include prothrombin time, activated partial prothromboplastin time, thrombin time, reptilase time, bleeding tinne, platelet function assays and coagulation factors (see baseline coagulation panel). "Disease markers" are utilized to in~lic~te the overall therapeutic efficacy of the doses. These markers may be identified through blood tests, urine tests, clinical observation or identification of blood clots by any of several conventional techniques, or by the more refined techniques such as DNA fingerprinting and PCR. To evaluate the "disease markers" the laboratory analyses measure levels of certain proteins, lymphokines, enzymes and relevant molecules. Clinical markers may include CA 022~9041 1998-12-22 ~ll blood pressure, visible tissue damage, SigllS of inflammation, ecchymoses, and the like.
An initial bolus of defibrotide (box 2) or its nucleic acid components is given intravenously over 15 to 30 minutes. Immediately thereafter the patient is given the daily dose of 40 - 400 mg/kg by continuous infusion. Preferably, the initial dose is a bolus (25 - 50 mg/kg) followed by 24-hour dose which is increased in 50 mg/kglday increments every 1 - 3 days. The starting base-line dose may be from 40 - 400 mglkglday depending upon physician preference and the respective disease state treated. Lower initial doses are preferred for those therapeutic compounds which enter the cell nucleus more readily and are thus effective at lower doses. The bolus and cliaily dose for chemical derivatives of the nucleic acids may be calculated as a proportion of the defibrotide dose based on the relative cell-entry rate. It is preferred to ~ministçr this dose intravenously using two IV bags of 50 m]l DSW, each bag infused over 12 hours.
If for any reason the infusion is interrupted, the rate of infusion would be thereafter adjusted so that the patient will have received the calculated 12 hour dosage at the completion of the specified time period. This 24 hour dose range can also be administered in 2 - 4 bolus injections or per oral ~dminictration.
Defibrotide or other selected nucleic acid derivative may be adminictçred parenterally, orally or locally by application to the skin. Parenteral a~1mini~ration is in the form of continuous intravenous infusion or intravenous bolus injection. Intravenous infusion ma,y be accomplished by gravity feed, pump delivery or other clinicaLlly accepted methods. Oral ~lmini~tration may include the use of vials, capsules, tablets or powders for any method of enteric admini ~tration.
To permit clinically practicable ~mini~tration of defibrotide in the amount ne~es~ry, materials for delivery of the agent optionally comprise 2 x 50 ml D5W IV bags each containing one-hali of the calculated total 24 hour dose in milligrams of defibrotide, each bag infused over 12 hours for the IV-continuous infusion at the maximum tolerable doses. Alternatively, the total 24-hour dose can be ~mini~tered by bolus injection every 8 - 12 hours. The initial bolus injection and the subsequent outpatient bolus maintenance infusions are given, for example, in 3 x 25 ml D5W bags, each bolus to be infused over fifteen to thirty minutes. The oral dosage outpatient m~inten~nce therapy in milligrams given daily (divided into 3 - 6 doses by mlouth) would be the multiples of 2X the maximum tolerable IV dose.
The same dose is given for three clays and the laboratory test panel is repeated (box 3). A full coagulation prof;le and tests for markers should be run before and after any dose escalation. These tests results are compared with the initial test data to determine if any of the markers (which may include laboratory data or clinical observation for the diseas~ being treated) have changed. A
change is expected to occur in at least one marker within 3 - 21 days, indicating that defibrotide is having an effect. After each test the dose of defibrotide is increased by 50 mg/kg/day, dose for chemical derivatives being proportional to the cell entry rate for the respective nucleic acid, and continued at that dose for three days before retesting. This pattern of esc~l~ting the dose and repeating the 'l3 laboratory panels is repeated (boxes 4 ancl 5) until the patient's "maximum tolerable dose" (MTD) is reached or unti]. the diseaselrepair markers have pl~e~ued or completely norm~li7ed.
If three consecutive values for a se~lected marker are about the same, a plateau has been reached. This procedurl is followed for a minimum of 21 days (box 6). Disease/repair markers are chec ked and coagulation profiles are run on weekly intervals to monitor response. If no response is observed, i.e., no change in the level of any marker (box 7), therapy is discontinued (box 8), and treatment is determined to have failed. If, after 21 days (box 6), no plateau is reached, but improvement in the disease markers has occurred (box 14), the dose may be doubled or the M'rD may be given (box 15).
If the .,lalkel~ are normal (box 9), therapy is discontinued (box 10).
Tests continue to be repeated weekly for up to three months, noting any change in markers that would indicate relapse. '[f no relapse has occurred and no new markers have appeared after three monthls (box 11), therapy is discontinued (box 12) and the patient is considered cured. Should an old marker reappear or a new marker appear (box 13), the last previous dose is doubled, and therapy is resumed at that dose level. If doubling of the dose would exceed the MTD, the MTD would be ~mini~t~red.
Seleclion of M~rk~rs The correct identification of mar'kers are based on the identification of the pathways of disease pathogenesis and th,e respective repair processes and pathways. The mech~ni~m of efficacy of the therapeutic nucleic acid simulate or CA 022~9041 1998-12-22 '\'-1 are superimposed on the cellular pathways of the respective repair process they induce. For example, using defibrotide as the clinical agent, one would (1) identify the known signal transduction sysltems and second messengers of the repair process, (2) define the most probable nucleic acid-induced repair markersof the known cellular repair pathway, and (3) define markers of the disease process related to disease pathogenesis.
Many disease processes are pathogenically based on overactive body defense mech~ni~ms. As such, a compound whose intracellular concentration can be a repair marker in one disease stat~ can be a disease marker in another disease state. In such a case, the marker would usually be under-regulated by defibrotide instead of induced. Similarly, a marker of normal cellular function, if deficient, may be a disease marker. For example, the paralysis of cellular function of CD4 cells by the HIV retrovirus is secondary to the co.l-plumise of normal cellular markers of transduction pathways and second messengers.
G-proteins instrumental in the activation of adenylyl cyclase are likely to be deficient in their active form with a low dose threshold level. In this case, the deficiency of the normal cellular marker of G-proteins would be a disease marker. Since defibrotide affects the adenylate cyclase pathway (increased cAMP by defibrotide), defibrotide would restore the second messenger of cAMP, which therefore would be a repair marker.
The maximum therapeutic dose in turn would again follow the guidelines described above for vWAg, since this universal marker will get elevated with modulatiûn of any phase of repair process such as, for example, receptor up-~C;~
regulation, signal transduction or induction of translation and/or transcription, shutting off of transcription/translation which in turn may happen by activation of CREM, which is the inhibitor transcription factor of CREB, i.e., the latter is cAMP dependent initiator of the transcription factor of the CRE which in turn is the portion of the DNA enhancer sequence responsive to cAMP and cAMP
associated transcription factors, such as c myc products, c-fos products, ATP
Activation Factor, Serum Responsive Element (SRE), API transcription factor (ATF), HIV-Long Terminal Repeat (LTR ), leucine zipper transcription factors of c-foslc jun. (ATF, SRE, AP1 sites in c-Jos promoter/enhancer all respond to cAMP without the requirement of SRE. Protein Kinase A activates endogenous CREB activity and will enhance viral transactivation).
The prototype high molecular weight defibrotide, native defibrotide, low molecular weight native defibrotide, and chemical defibrotide derivatives regulate genes which are regulated by cAMP. These genes include vasoactive intestinal peptide (VI-P), somatostatin, human chorionic gonadotropin, phosphoenolpyruvate carboxylkinase, tyrosine hydroxylase, fibronectin, prolactin, ornithine decarboxylase, interleukin-6 gene, c-fos oncogene, haptoglobin, hemopexin, C-reactive protein (CRP), as well as other cellular genes which are regulated by cAMP responsive element (CRE), transcriptional factors interacting with CREB (which is 43 kd protein that interacts with CRE
via leucine zipper, such as c-myc products, c-fos products, ATP (Activating Protein), SRE (serum responsive element), API Protein kinase A will activate endogenous CREB activity and will also enhance viral transactivation.
CA 022~9041 1998-12-22 CRE/CREB related transcription of genes including HIV Long Terminal Repeat (LTR) will be positively induced with high cAMP levels.
The selected nucleic acid, e.g., defibrotide, will affect only injury-dependent parameters in each individual patient. As such, no uniform action will be observable in all patients. For the nucleotide transcriptionally-activated parameters, analysis is made for the highest values in each dose range. For the nucleotide transcriptionally shut-off parameters, analysis is made for the lowest value in each dose range.
Ther~py R~c~A on Univers~ rk~rs Several markers have now been sblown to reflect transcriptional genomic activity by nucleotides which increase cAMP, adenylate cyclase via the interaction of G-proteins, and phosphorylate tramscriptional factors via protein kinase A. Such markers include von Willebrandt antigen (vWAg), tissue plasminogen activator antigen (AgTPA) alnd ~2-microglobulin. While vWAg, AgTPA and ~2-microglobulin are representative markers, any moleeules which are initiated by nucleotides, or derivatives such as defibrotide, to induee transeriptional aetivity are ineluded.
It has been diseovered that vWAg may be employed as a universal marker to guide the ~e~m~nt of the duration of therapy, i.e., the most therapeutic dose, as well as the most effieacious daily dose. The inventors have discovered that vWAg is transeriptionally activated by defibrotide irrespective of the type of injury. Analysis of patient data has led to the unexpected finding that with the onset of cure, vWAg levels deeline. The production of vWAg will be activated CA 022~9041 1998-12-22 by defibrotide only for the duration of the injury and the repair process. In this regard, defibrotide will not effect vWAg levels in healthy individuals or following the establishment of cure, i.e., vWAg level will decline to baseline regardless of ongoing therapy. Concurrent analysis of vWAg with various "disease markers" correlated with changes in the disease marker levels. In other words, it has been discovered that therapy dependent absolute changes in disease markers (decline or increase) correlate with peak vWAg levels. The norm~li7~tion of disease markers, in turn, correlates with decline in vWAg levels.
vWAg is classified according to this invention as being a universal dose marker. vWAg can be utilized as the universal marker for all nucleotides that induce activation of cAMP and protein kinase A enzymes. vWAg is a plasma glycoprotein having a molecular weight of approximately 200,000 which is constitutively secreted by the endothelial cell. It is important in hemostasis as a prothrombotic factor (factor VIII/vWAg ]protein) and as an inducer of adherence of platelets to the exposed subendotheliurn. In every disease state, vWAg levels go up with increasing defibrotide dose levels when the dose is adequate to stimulate vascular endothelial function.
In accordance with the invention, an increase in the vWAg level corresponds to the induction of transcriptional activity of this gene by the nucleic acid. Elevation of vWAg is representative of the ongoing repair process. The decline in the level and eventual normali:zation of vWAg during therapy is representative of the cure process. Plateau in the level of vWAg correlates with ~1~
the application of the maximum efficacious dose. Without exception, the elevation in the level of vWAg is concurrent with modulation of the disease marker and activation of the repair marker. Here the maximum efficacious dose is determined along with vWAg, so as to normalize the levels of these molecules between 65 - 150%, and eliminatt the intracellular oxygen radicals (measured by chemilumin~scence, normal state being negative). For the prototype drug, defibrotide, the maximum efficacy in inducing transcriptional activation of vWAg occurs at doses of 40 DKGD and above, ideally within the DKGD range of 40 - 400. The universal marker vWAg dose levels are representative dose levels by the prototype's transcriptional/translational modulatory effects. Fitting the definition of universal marker, vWAg does not contribute to the expected correction of bleeding time but acts as a fiunctionally dormant molecule.
Another option is to empirically repeat therapy after three weeks following cessation of therapy on the above principles. In this regard, the half life of the nucleic acid appears to be about three weeks, based on the observation that universal marker vWAg requires 2 - 3 weeks to come down to baseline levels with cessation of tlnerapy. If the universal marker vWAg is elevated during therapy with the previous maximum efficacious dose, there is still a lesion to treat, irrespective of the fact that there are no known or visible clinical, and/or documented biochemical repair or disease markers.
Therapy, in accordance with the invention, is geared to continue until vWAg is norm~li7ed while on established~ maximum effective dose. Thereafter therapy is discontinued and the same cyc]es are repeated until the maximum efficacious dose therapeutically initiated no longer induces any elevation in vWAg, as would be observed in a normal healthy individual.
St~ti~tin~l An~lysi~
A statistical model has been used to assess the dose and duration of therapy with the ultimate objective of irreversible cure. For each molecular marker, calculations are presented, based on analysis of the data from all the patients for the "first day value," the "last day value," the "highest value" or "lowest value" (i.e., for transcriptionally activated molecular markers and for transcriptionally inhibited molecular markers, respectively), the "m-efficiency score," and the "time required to reach the optimal effect of the nucleotide" at the dose ranges employed. The "first day value" at a particular dose is the "last day value" of the preceding dose range. The "minimum of increasing values"
has been found to be the best parameter to follow for transcriptionally turned on molecules while the "maximum of the lowest values" has been found to be the best parameter to follow for transcriptionally turned off molecules.
The best parameter to follow the dose related induction of transcriptional activity is the "minimum values of the increasing levels" obtained on the first day of the initiation of each dose range. "Highest or increasing levels" represent the increase in level of a molecule whose production (transcription) is turned on with increasing dose levels. Choosing the minimum increase in the level in the transcribed genome among all patients treated in any dose range enables the prediction of the worst performance with that dose of the therapeutic compound.
This enables the treatment of the worst pPrformer, which allows turning on the CA 022~9041 1998-12-22 genomic transcriptional activity in the greatest number of patients within each respective dose range. Increase in the marker, as shown by "minimum highest value" represents that the repair process is ongoing, that is, repair molecules are being produced and transcriptional activity is ongoing.
The quantitative relationship between vWAg level and daily dose of the therapeutic compound is best visualized when the minimum value of the increasing vWAg levels in the population are analyzed (i. e., the worst performance levels in any one patient at any one dose range, "worst performance" implying that increasing the dose will incrementally continue to elevate the vWAg, which is biologically interpreted as me~ning that there are more repair events to go through).
Minimum increasing value is the plarameter to use to confirm the event of ongoing cellular repair. Maximum increa.sing value is the statistical parameter to use to follow the completion of the repair event. Maximum therapeutic dose is the dose at which vWAg on continued therapy will decline to a normal level.
The "maximum values of the lowest levels" obtained among all patient data on the last days of treatment at each dose range are similarly used to analyze how increasing dose raLnges affect the transcriptional activities involving the "turned on" molecules. The levels will show progressive declines, i.e., the progressive turning off of the repair process with the onset of cure, in spite of the higher doses.
Once maximum stimulation takes place (as assessed by the use of first day minimum highest levels), the cell gets turned off. By the use of the maximum ~\
lowest levels of the last day, therapy is continued at that particular dose level until these levels return to the baseline levels on therapy, i.e., until tlnere is no more ongoing transcriptional activity, i.e., the repair process is completed.
The m-efficiency value is the ratio of the respective elevated level over the time taken for elevation to occur. The higher the dose, the higher the value of the numerator and the higher the m-eff;ciency level. Alternatively, the shorter the time (denominator), the higher is the m-efficiency value.
Method of TrP~tin~ H~V-Infect~ Patient~ with nefihrotiAe or Itc Nucleic Acid Compon~nt~
Defibrotide or its nucleic acid connponents modulate cell functions at the nuclear genomic level through one or more pathways by modulation of the cell' s genetic material, i.e., DNA itself or translation or transcription of the genetic information. Defibrotide or its nucleic acid components-induced cellular modulation restores the normal functions of the cell such as the production of normal proteins needed by the cell and, in the case of HIV, the correction of the effects of the abnormal, viral encoded genetic material by inhibiting its further production at the expense of the normal, virus-free genetic material. In the course of the multiphase treatment, defibrotide or its nucleic acid components is ~ministered at dosages much greater than previously described in the literature for other disease states. The dosages and durations of the phases of therapy are adjusted according to the results of laboratory studies performed on the patient's infected cells. Preferably, in treating HIV, an initial bolus dose of 100 mg/kg in 50 ml DSW is infused over a period of 30 - 60 minutes followed by 200 5~
mglkg/day infused in 250 - 500 ml DSW over a period of 3 - 24 hours. From day 2, dose is esc~l~te~ to maximum tolerable dose, maximum efficacious dose and maximum therapeutic dose levels. In this way, the HIV virus may be inactivated and its proliferation arrested. Therefore, the progress of the disease may be arrested or ameliorated.
ReMuse HIV virus adversely affects the genetic material and function of the cells, defibrotide or its nucleic acid components can effectively treat HIV
infection as long as the carrier CD4+ cell and/or the monocyte harboring the virus preserves the physiological ability to revive itself. Therapeutic success with defibrotide, however, is strictly dependent upon the ~sessment of the correct treatment doses for the respective disease states. Moreover, since the optimum function of the normal cell, by defmition, would not be compatible with any complications, defibrotide or its nucleic acid compDnents at any defined maximum efficacious dose, specific for any patient and disease state would be complication-free .
Sarin etal. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85:7448-7451), aswell as Leonetti et al. (Bioconjugate Chem., 1990, 1:149-153), have shown that anti-sense oligonucleotides are potent inhibitors of HIV-l replication in cell culture.
The methylphosphonate linked oligonucleotides were found to be superior in this effect over the phosphodiester linked oligonucleotides, apparently as a result of their resistance to nucleases. This property was deemed to be the factor in the superiority, since oligonucleotides less than 20 bases in length proved to be ineffective inhibitors.
CA 022~9041 1998-12-22 - W O 98/48843 PCT/~S98/08357 ~3 Efficacy of defibrotide or its nucleiic acid components may have several concurrently active mech~nicmc. Defibrolide or its nucleic acid eomponents may provide anti-sense neutralization of the viral proteins. Defibrotide's mechanism of efficacy may be at the nuclear level by modulation of genetic functions via other pathways as well. Defibrotide's actiions may be more apparent during viral phases which involve translation and/or transcription of the DNA message, so as to revive the normal function of the cell at the expense of the disease-specifie molecules. This action may be analogous to anti-viral effects of Ampligen (a micm~tched double stranded RNA-molecule). However, whereas Ampligen exhibits immunostimulating effects, agents such as defibrotide are both immunostimulants and immunosuppressants. Defibrotide or its nucleic acid components may modulate viral penetration into the cell via its known action of inhibiting intracellular ealcium mobilization. Also, defibrotide or its nucleic aeid components may direetly inhibit viral enzyme reverse transeriptase via inducing ATP production analogous to ddI (dedeoxyinosine), by virtue of its known action of inducing high energy metabolites (ATP, ADP, NADPtNADPH), possibly via modulation of Complex-I respiratory moleeule. Defibrotide or its nucleie acid components may inhibit protein kinase C, analogous to Hypericin. Defibrotide may also decrease Tissue Necrosis Factor (INF), a cytokine known to promote HIV activation, by its known effect on increasing cAMP levels at the correct defibrotide dose level similar to Pentoxyf;lline.
Whatever the mechanism, zinc is known to have an inhibitory effect upon nucleases acting on phosphodiester linkages, as well as an enhancing effect on CA 022~9041 1998-12-22 base pairing. U.S. Patent 3,770,720, teaches that in the production of defibrotide, zinc should be removed from the molecule. However, in the treatment of AIDS, it is preferred that zinc be present. Moreover, it is preferred that iodine should also be present. In the defibrotide used in the Examples iodine was present in an approximate ratio of one zinc atom per iodine atom and a two to one ratio of zinc + iodine to nucleotide base.
As can be seen from comparing thie cellular uptake data shown in Figures 2 and 3 with the data shown in Figures 4, 5 and 6, a greater level of defibrotide enters the lymphocytes when biotin is present. Horn et al. (Planl Physiol, 1990, ~:1492-1496) has observed that biotinylated molecules enter the cell via the folate endocytic pathway. The data of Figures 2 - 6 read in conjunction with the above-cited Horn reference, indicate that defibrotide with biotin may also use the folate endocytic pathway.
Defibrotide may jointly and/or selectively modulate one or several pathways. This modulation will be, only to the apl)ropliate degree thus surpassing all of the other anti-HIV agents in its lack of side effects, yet presence of proven efficacy. Defibrotide will achieve this result only when the dose levels are tailored to the patient, stage of disease activity and/or reigning stage of viral activity.
The method of treating the HIV-infected patient begins with a panel of laboratory studies which include the quantitative evaluation of the activated peripheral blood mononuclear cell subsets, circulating viral proteins, cytokinases and soluble cell-surface receptors. There are no patient inclusion or exclusion ~ 5 criteria for therapy. Patients in any or all of the four clinical stages of HIV-infection including history of exposure (i.e., HIV+, Pre-ARC, ARC, and AIDS) are candidates for therapy. The initial adtninictration of a selected dosage of defibrotide is followed by incrementally increasing the dosage of defibrotide until a maximum tolerable dose is reached. The laboratory panel is repeated weekly during this therapy. These results together with the clinical markers of diseasewould indicate whether the defibrotide is e fficacious and whether defibrotide should be continued to be given alone or with other therapeutic agents.
The details of treatment and the dose ranges fitting the various stages of the HIV disease will be expressed by retrospective analysis of respective laboratory and clinical markers. Additionally, dosage levels and frequencies as well as the use of other anti-HIV medication will also depend upon the individual patient or stage of disease and/or other concurrent medical conditions.
Before the initiation of therapy and weekly thereafter blood is drawn from the patient and subjected to a panel of tests which preferably include activated peripheral blood mononuclear cell subsets by two~olor flow cytometry, lymphokines and soluble cell surface receptors by ELISA, and HIV-viral proteins by Western blot analysis. The peripheral blood mononuclear cell subset analysis will usually include either CD4+, CD~+, CV19+, CD25+, CD56+, and HLA-DR alone, combined with one another, or combined with the quantification of monocytes. The Western blot protein tests include gp-24, gp-17, gp-120 and gp-160. The ELISA test measures TNF, sIL2R, sILl and soluble CD8. Every third W O 98/48843 PCT/~S98/083~7 ~' week, it is p~c;Çelled that cell cultures for ]HIV antibody neutralization, PCR and reverse transcriptase determinations be made.
H~V-I Gene Therapy in Accor~nce with l:he Tnv~ontion Gene delivery thus far has been a method by which foreign genetic material is introduced into a suitable target cell usually via viral vectors. Such strategy generally consisted of an ex vivo ;md an in vivo phase. In the ~x vivo phase the foreign gene is inserted into target cells derived from the recipient.
The engineered cells containing the newly inserted gene are expanded ex vivo. In the in vivo phase, the expanded engineered cells are transplanted into the recipient.
This modulatory therapy is the first of its kind which manages therapy from cell surface signaling to genomic modulation utilizing the oral and/or intravenous ~Iminictration of nucleotides, without utili7ing retrovirus, adenovirus or other gene viral vectors traditionally employed in gene therapy. Gene therapy has not, heretofore, been utilized without cellular transfection with viral vectors, and never before by oral or intravenous administration of nucleotides to humans.
Gene therapy has not, heretofore, been tried without the interaction of viral vectors, i. e., by the ~-lmini.ctration of nucleic acid-based pharmaceutical agents orally and/or by intravenous route. The prototype drug defibrotide, although administered to patients over the past 5-6 years, has never heretofore been contemplated for gene therapy. In addition, in other modalities of gene therapy, dosage has never been assessed IDY molecule markers. Molecule markers have never been defined within lhe system of secondary messengers, CA 022~9041 1998-12-22 signal transduction systems, promoters (DNA sites which are on the same chromosome as the gene transcribed and to which RNA polymerase binds), enhancers (DNA regions that control a promotor from a great distance, sometimes as much as 30,000 bases), and ~ranscription factors (diffusible regulatory proteins which bind to DNA transcription activation domains and regulate the rate of transcription by RNA polymerase).
HIV-disease has not been previous]y interpreted as a disease of dismodulation involving the genomes, cellular secondary messengers and cellular signal transduction systems. The specific pathways affected by the HIV-retrovirus have not been clearly dPline~t~d. Therapy of HIV-disease has not previously attempted to reclaim the affected cellular function systems from the virus by reversing the dismodulation at the various levels by using exogenous therapy involving various modulators of these systems.
The therapeutic approach of the invention tli~eng~ges itself from the common practice of planning therapy based on clinical staging. The planning of therapy is based on the identified mismodulations of (a) membrane lipids and cytoskeleton; (b) cell-surface receptor/lig<md interactions; (c) secondary messengers; (d) signal transducers; (e) cellular transcription factors utilized in viral replication: as well as based on the identified (f) oncogenes; (g) viral transcription factors; and (h) viral genomes. The method of therapy disclosed herein for HIV may also be used in treatrnent of other viral infections and neoplasms.
CA 022~9041 1998-12-22 These mismodulations are classifie:d into marker categories of (I) repair markers (items a - e) and (ii) disease markers ~item f - h). The object of therapy in accordance with the invention is to (I) reestablish repair markers at the constitutively expressed tissue levels; and (ii) elimin~te disease markers (in case of the oncogenes to reverse the transformation).
Irrespective of disease stage or clinical status the patient is screened with the complete panel of secondary messengers and signal transducers (repair markers), since all repair markers are bic,chemically interdependent. Repair markers reflect the underlying logic of transcriptional regulation. Therapy is aimed to concurrently induce some markers and suppress other markers. The prototype nucleotide if used at the correct doses (which are guided by the respective repair markers) can accomplis'h this goal.
Flimin~ion of disease markers by the therapeutic nucleotide compound will occur at various levels. It can be an indirect phenomenon based on modulations of secondary messengers, such as cAMP; it can be a direct phenomenon based on modulations of the phosphorylation events involving genes and transcription factors. For example, cAMP activates protein kinase A
enzymes, Ca2+ activates protein kinase C' enzymes, the prototype nucleotide up-regulates cAMP, and downregulates Ca2+, or it can be a direct phenomenon based on modulation of cAMP responsive gene promoters (CREM, as enumerated above).
While not being bound to any sp~cific mechanism of action, the following are proposed.
5q Proposed Mech~nicm A. Induction of sIL2R gene and HIV-I LTR are interdependent phenomena. If the protein kinase C dependent sIL2R gene is turned off by high cAMP levels, activation of HIV-I LTR is concurrently suppressed as well.
Proposed Mech~nism R. Increasecl cAMP levels have been shown to induce viral replication (Nokta and Pollard, 1992, AIDS Research and Human Retroviruses s(n 1255-1261). HIV-I RE'V/ENV genes are both phosphoproteins. There may be other routes for cAMP-induced replication of HrV-I. Although ~dministration of the m;~cimum efficacious dose will increase cAMP levels, prolonged ~timini.ctration oi the nucleic acid at the maximum efficacious dose, so as to reali~ the succes.sful ~(imini~tration of the maximumtherapeutic dose would culmin~te in declinin~ cAMP levels, since vWAg decreases on therapy if and once the maximum therapeutic dose is ~minictered.
Hence ~(1minictration of the maximum therapeutic dose is paramount in overcoming cAMP induced viral replication. This phenomenon may at least partially, be based on the induction of protein kinase C, as a secondary biochemical event (i.e., protein kinase C induces sILR2 gene, which in turn modulates protein kinase C so as it can directly inhibit cAMP).
Proposed Mech~nism C. The transcription factor NF-kB binds to both the HIV-I enhancer, and the sILR2 gene. Protein kinase C phosphorylates its inhibitor Ik~3 and releases active NF-kB. Increased cAMP levels by inhibiting directly the Ca2+ induced activation of protein kinase C would moclulate this phosphorylation event, and downregulate the transcriptional activities related to NF-kB. Since NF-kB binds to both the HIV enhancer and IL2 receptor, increased cAMP levels will downregulate HIV-I replication.
Proposed mech~ni~ms B and C show that increased cAMP levels can be both deleterious and beneficial. It can be clearly seen that the prototype nucleotide is an overall "downregulator" of biochemical events, if maximum therapeutic and efficacious dose levels are ~dmini.ctered.
It has also been discovered that the co-~dministration of various sequence specific, anti-sense or mi.s.sen.~e nucleic ac:ids with, for example, defibrotide, would (1) alleviate the complication of cAMP induced viral replication; (2) induce inhibition of viral replication me~ t~ via modulations of cAMP, protein kinase A, protein kinase C, cellular redox state, G-proteins, or cAMP induced gene promoters (in this regard, defibrotide and other nucleotide derivatives introduce for the first time into anti-HIV therapy nucleotides with no sequence specificity that concurrently modulate the totality of the cellular second messenger/signal systems for rapidly transducing extracellular signals into specific patterns of gene expression in the nucleus); (3) concurrently induce inhibition of viral replication with sense, anti-sense, or missense nucleic acids (e.g., DNA, mRNA, DNA/RNA ribosornes, inhibitors of viral protease, viral integrase); and (4) introduce a modality of gene therapy (i.e., genetic engineering) which can be safely a(lmini~:t.o.red to humans, which does not utilize viral vectors, which can be a(lministered either intravenous or orally, which enables admini~tration of sequence specific combination of nucleic acids adjusted specifically to the selected parts of the HIV-genome and cellular repair pathways, (O~
which adjust the dose so as to modulate selected genes or cellular/viral molecules, which enables the most efficient ~dmini~tration of various different nucleotides with differing cellular uptake ~dynamics and chemical anti-viral potencies, and which ~(lminicters excess DNA to enable the self-integration of DNA.
This process is superior to present viral vector directed gene therapy and would also enable competitive inhibition of proviral integration, and/or dislocation of the integrated pro-virus. Cellular uptake dynamics would directly define the anti-viral and genetic modulatory capacities of each respective nucleotide. Nucleic acid derivatives having chemical modifications are as described previously (e.g., nucleotides conjugated with po}y(E-lysine) or which is modified by, for example, the addition of amino acids such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals ;and ions including zinc, m~n~nese and iodine, by the addition of 5'-polyalkyl moieties, cholesterol, vitamin E, 1-2-di-0-hexadecyl-3-glyceryl and other lipophilic moieties and/or modified by the replacement of phosphodiester bonds with phosphothiotate bonds) and combination nucleic acids would be emp]ioyed.
FXAMPT FS
Fx~le 1 To measure the effect of defibrobide on HIV it was first necessary to label the drug and determine whether defibrotide will enter the nucleus of the human cell. Knowing the phosphodiester linkag~es in defibrotide, its comparabive nuclear penetration was assessed by labelling defibrotide with a photo-activatable analogue of biotin. The biological activity of defibrotide after labelling was considered to have been preserved since published data shows that previous oligonucleotide probes have been labelled with conjugates and still remained biologically active. Image analysis utilizillg a cold CCD camera revealed that uptake of defibrotide was localized in the nucleus. This supports the hypothesis that the mechanism of efficacy for defibrotide is largely contributed to by its modulatory activity on the genetic materia~ of the cell, no matter what disease entity is being treated. As shown in Figures 2 and 3, the nuclear uptaLke of defibrotide is directly proportional to the concentration of defibrotide with biotin.
The observed uptake supported the increased efficacy of defibrotide with the larger doses used, and also supports the hypothesis that at critically high dose levels various previously unknown different effects of defibrotide can be seen. It was also observed that uptake by monocytes was significantIy greater than that by Iymphocytes.
The cellular uptake of defibrotide without biotin and labelled with cyanine dye Cy5. 18 was also measured. It was observed that biotinylation of defibrotide enhaLnced the cellular uptake of defibrotid,e in the lymphocyte population.
However, there was no difference in uptake between monocytes incubated with biotinylated or fluorescently tagged defibrotide. This can be seen by comparing Figures 4 and 5.
~3 Fx~ )le 2 To further confirm the specificity of defibrotide for the treatment of HIV
infection, HIV infected peripheral blood rnononuclear cells with varying doses of defibrotide were evaluated by staining for all viral envelope proteins using concanavalin A (Con-A) stimulated and unstimulated cells (Anti-HIV 1, and Anti-HIV 3 specific Anti-HIV antibody). The blood sample was obtained from a patient using an evacuated blood collection tube containing sufficient EDTA to prevent coagulation of the sample.
Mononuclear leukocytes (white cells) were obtained by layering a 1:1 (volume:volume) blood to RPMI 1640 tissue culture medium (Grand Island Biological Co.) aliquot over histopaque (d = 1.077, Sigma Chemical Co.) under sterile conditions. The white cell popula~ion was suspended in a solution of the ~PMI 1640 medium supplemented with ].0% heat-inactivated fetal calf serum and gentamicin, at the concentration of S micrograms/milliliter. The white cells were then concentrated to a level of two million cells per three milliliters (2 x 106 cellst3 ml) of the above solution. The white cells were collected in flat-bottomed microtiter containers (Cell Wells, Corning).
The cell populations were further divided into two groups. One group received stimulation by Con-A, the other group remained unstimulated by Con-A. Con-A stimulation enhances the uptake of the antibo~y-dye label by HIV-contaminated cell components, thereby demonstrating an increase in the expression of the HIV protein.
Subpopulations of unstimulated and stimulated white cells were then incubated in the presence of discrete concentrations of defibrotide. Each successive assay employed successively greater concentrations. A control sample of incubate containing no defibrotide was also prepared. A labelling antibody solution was prepared by directly conjugating CyS.18 with human a-HIV
antibody to a final dye/protein ratio of 5.() (a-HIV-CyS. 18).
The cell subpopulations were again divided into two groups, one group for intracellular antibody labelling, and one group for surface antibody labelling.
Cells reserved for intracellular labelling were fixed with 70% ETOH, washed twice with monoclonal wash, and then resuspended into a solution cont~ininE: 200 microliters of Hank's balanced salt solution (HBSS), supplemented with 2% FCS
and 0. 1 % sodium azide (monoclonal wash) and 5 microliters of a-HIV-CyS.18 solution. The entire cell preparation was incubated for 45 minutes at 4~C. The cell preparation was then washed twice with the monoclonal wash, and resuspended in 1% paraformaldehyde.
Cells reserved for surface labelling were prepared by washing twice in monoclonal wash to which 5 microliters of a-HIV-CyS.18 have been added.
Next, 20 microliters of specific surface glycoprotein monoclonal antibody was added to the incubation solution. The surface glycoprotein antibody solution contained CD3-FITC (heterogenous T-cell antibody conjugated with fluorescein isothiocyanate dye) and CD4-RPE (helper T-cell antibody conjugated with phycoerythrin dye) obtained from Becton-Dickinson.
All cells thus prepared were then analyzed using a Becton-Dickinson FACS 440 dual laser (argon/krypton) flow cytometer. The expression of HIV
proteins was deterrnined on a per-cell basis. Fluorescence was measured on a logarithmic scale but converted to a linear scale for analysis.
Figure 7 shows HIV protein expression at selected dosages. Assay results for the same sample shown in Figure 8 are in terms of the intensity of the fluorescence of certain antibody-labelled mononuclear leukocytes (Mean Linear Fluorescence Intensity). Fluorescence intensity is proportional to HIV protein ~pression, and thus the activity of HIV. It is seen that the expression of the HIV proteins decreases and then levels off with increasing concentrations of defibrotide.
Before ~(imini~tration of defibrotide, Con-A stimulated cells expressed 32 % more vi~al proteins. However, after adminis~ration of 20 mg of defibrotide, both stimulated and unstimulated cells express 70% less viral proteins. At 30 mg concentration of defibrotide in both Con-A stimulated and unstimulated cells the expression of viral proteins leveled off. This supports the specificity of defibrotide for HIV-virus as well as the fact that if cells are induced to divide, tr~nslating into proliferation of the virus, more HIV virus can be killed, albeit, at higher doses.
FY~rnple 3 Patients with various diseases of vascular prothrombotic backgrounds were treated with esc~l~ting dose levels of defibrotide. A variety of coagulation and hematological assays with other molecular markers of inflammation, etc., , . . . .
W O 98/48843 PCT~S98/08357 (0~
were conducted on blood samples drawn from the patient before and after each dose esc~l~tion. From an analysis of the test results and clinical observations, it was discovered that certain effects of defi'brotide lead to a remission state of certain specific aspects of disease states corresponding to the various dose ranges employed.
As an example, hematological recovery in thrombotic microangiopathy, generally, yet not exclusively, occurred ~/hen the patient received doses of defibrotide ranging from 20 to 30 mg/kglday. These doses however did not cure the renal lesions since cre~tinine levels rernained above normal (or only partially corrected) at the dose levels where hematological recovery was complete. Renal recovery evidenced by norm~li7~tion of creatinine levels occurred between 40 and 250 mg/kg/day.
Even in the presence of norm~li7zltion of cre~tinine levels (the conventional criteria of complete recovery) it was observed that complete remission was yet to be reached by the olbservation of elevation of blood pressure, low AgTPA and high fPAI levels. Therefore, doses of defibrotide continued to be increased until blood pressure levels became normal. The dose elevation not only treated blood pressure, but also led to further improvement of cre~tinine. Thus, treatment with marker-dependent doses, applied correctly, led to a state of "cure".
F.x~mple 4 In a normal individual, increasing the DKGD dose does not induce any elevation in the vWAg since there is no ongoing repair process, i.e., no disease state. Doses ~dmini~tered to a normal individual, in contrast to the doses given to an individual exhibiting a pathological disease state, did not induce any alteration in vWAg levels, i.e., defibrotide did not induce transcriptional activity at the genomic level. vWAg predicts the transcriptional rate of the respective repair molecules induced by the nucleotide and will guide the ~sessmçnt of maximum efficacious dose and maximum therapeutic dose.
In a ~ ed individual, an increase in DKGD increases the preceding minimum highest value of vWAg by an increment smaller in each successive interval. Using defibrotide, the highest percentages of increments were found to occur at the borderline of 40 DKGD. Inc:reasing DKGD above 400 induces only negligible improvements over levels below this dose. In practice, this is the dose level above which complications of bleeding have been observed by the inventor with high molecular weight defibrotide.
Flr~mpiles 5-7 Examples 5-7 report the treatmen~: of three HIV infected patients. This patients were all treated in Turkey with defibrotide obtained from CRINOS. In Tables I-IV, below, the following are the normal laboratory ranges: IL-l = 3.6 pg; IL-2 - 4.3-4.8 pg; IL-6 = 7.1-7.3 pg; llNnFa = 25.1-26.3 pg; cAMP =
0.4-0.6 nM; cGMP = 0.85-0.95 nM; nc,rmal cGMP/cAMP = 2.125; ,B2-microglobulin = < 1900 ,Lg/l.
F.x~le 5 A 28-year old white HIV+/ARC male exhibiting waste syndrome, Herpes labialis and Herpes genitalis associated with widespread tissue damage, oral/pharyngeal candidiasis, polyarthralgias and tuberculosis was treated with defibrotide.
On Day 1 of treatment~ a 360 mg/lcg IV bolus of defibrotide was a~mini~tered. Thereafter, a dose of 160-275 mg/kg/day was administered.
Deilbrotide was ~-lministered 86 days out of a 118 day treatment course.
Progressive increase in weight and amelioration of diarrhea was observed throughout the therapy period, a total weight gain of 12 kg occurring during the treatment period. Improvement in Karnoisky performance score started at day 3 and increased from a score of 3 to a score of 10 over the treatment period.
The effect on arthralgia was obser~ed by the third consecutive day of treatment and was found to be strictly dose dependent. Upon cessation of therapy arthralgia relapsed to original condition and entered remission upon reiniti~tion of DNA therapy.
The effect on Herpes began on day 4 of treatment. By day 36 of the treatment period, genital Herpes lesions were in complete remission. By day 68, Herpes labialis lesions were in complete remission. No relapses were seen with temporary cessation of defibrotide.
Tables I and II summarize pertinent laboratory markers.
Table I
TIME Absolute CD4 Absolute CD8 Absolute B2-micro-(days) Lymphocyte % CD4 % CD8 globulin 1388 13.2 183 22 305 N.D.
26 1152 32.0 369 50 576N.D.
N.D. N.D. N.D. N.D. N.D.3582 104 N.D. N.D. N.D. N.D. N.D.1348 118 3300 21.0 693 32 1056N.D.
N.D. = notdetenni~
Table II
TIME IL2 TNFa IL6 cAMP cGMP cGMP/cAMP
(days) 8 14.3 30.1 41.6 2.0 1.03 0.52 76 7.3 14.7 3.7 3.65 2.10 0.58 Elevated cAMP/cGMP was observed at the onset of therapy, signifying activation of both protein kinase A and pr,otein kinase C pathways. A
progressive rise in absolute and T lymphocyte numbers, CD4 and CD8 was seen.
A decrease in ILl, IL-2, IL-6 and TNF-a was observed during treatment.
Complete remissions in accompanying disease states include Herpes labialis, oropharyngeal candidiasis, arthralgia, and Herpes genitalis as well as accompanying tissue damage. Complete norm~li7~tion of TB findings (Chest x-ray) with apparent radiological remission occurred.
.. . . . . ,, _ ..
r~
F.x~mple 6 A 25-year old white HIV+ female was treated with defibrotide. At the onset of therapy, the patient was asymptomatic but had a low CD4 count.
On day 1 of the treatment, a 200 mg/kg IV bolus of defibrotide was ~lministered. Thereafter a dose of 150 - 275 mglkg/day was administered.
Anabolic effects of the DNA were seen by day 13.
DNA therapy was terminated after 29 days secondary to a rise of CD4 percent and absolute counts. DNA therapy was reinitiated 25 days later secondary to a decline in CD4 percent and absolute counts. Therapy was continued on an outpatient basis, intravenous ~mini~tration being alternated with oral ~minis~ration.
Tables III and IV summari~ pertinent laboratory data. In this patient, all tested interleuk~n levels were normal.
Table III
TREATMENT CYCLE #1 TIME Absolute CD4 Absolute CD8 Absolute ~2-micro-(days) Lumphocytes % Cl)4 ~0 (: D8 globulin 973 15.2 148 20.1 196 N.D.
28 1100 48.0 5,~8 50.0 550 3300 TREATMENT CYCLE #2 429 34.0 146 22.0 94 N.D.
1945 15.0 292 20.0 389 2468 56 2600 29.0 754 20.0 520 N.D.
N.D. = notd~t~.~i~
~\
Table IV
TREATME~r CYCLE #2 TIME (days) cAMP cGMP cGMP/cAMP
1.25 0.98 0.78 8 1.55 3.00 1.94 1.50 3.40 2.27 Treatment was characterized by increases in CD4, CD8, total lymphocyte, total T-lymphocyte counts accompanied by elevations in cAMP and cGMP, and in therapy related decreases in IL-6 and TNF-a. A total weight gain of 7 kg was observed.
Fx~mple 7 A 33-year old white male with AIDS and opportunistic infections including Herpes labialis associate with necrotic lesions, oral/pharyngeal candidiasis, tuberculosis and crytococcal diarrhea.
On day 1 of treatment, a 200 mg/kg IV bolus was administered.
Treatment at a dose of 100 - 250 mg/kg/,day was continued until day 40. The lower doses being given on days 7 - 13 having been reduced secondary to prolonged API~. Tre~tment was thereafter discontinued due to unavailability of the drug. The patient died 8 days following cessation of therapy.
An anabolic effect was seen from day 6. Diarrhea was controlled from day 3 and cultures for cryptococcus became negative on day 15. Lesions of the lip began healing on day S and were completely healed by day 18. Odynophagia improved from day 5. Performance score began improving by day 3, reaching an optimum level of 5 between days 16 and 21.
Tables V and VI summari~ pertinent laboratory data.
Table V
TIME Absolute CD4 % Absolute CD8 % Absolute (days)Lymphocytes CD4 CD8 7 700 10.0 70 29.0 203 18 800 10.0 80 17.0 136 44 700 8.0 56 14.0 98 Table VI
TIME IL1 IL2 TNFa IL6 cAMP cGMP cGMP/cAMP
(days) 21 105 18.0 95. 1 40.~i1 .4 1. 1 0.79 33 85.5 7.6 14.8 45.]L 1.5 0.96 0.64 Decline in elevated IL-1, IL-2 levels and complete norm~li7~tion of TNF-a levels was observed. An increase in n-6 was seen with cessation of therapy.
At the time of death, a 3 kg weight gain w as observed, and Herpes labialis and oral/pharyngeal candidiasis were in complete remission.
Claims (52)
1. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases, comprising administering to the patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
2. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases comprising the following steps:
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, said repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) administering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) and (e) until the intensity of the repair marker in step (c) no longer increases, (g) continuing administration of the therapeutic compound at the highest dose level attained in step (f) until the intensity of the repair marker returns to the normal condition, and (h) administering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of said set of disease markers no longer deviate from the normal condition.
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, said repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) administering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) and (e) until the intensity of the repair marker in step (c) no longer increases, (g) continuing administration of the therapeutic compound at the highest dose level attained in step (f) until the intensity of the repair marker returns to the normal condition, and (h) administering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of said set of disease markers no longer deviate from the normal condition.
3. The method of claim 2 further comprising:
(i) monitoring repair markers selected in steps (c) and (h) for 3 weeks following the last dose of the therapeutic compound given in step (h) and if the intensity of one or more repair markers deviate from the normal condition, reinitiating therapy in step (g) at the highest dose level achieved in step (h).
(i) monitoring repair markers selected in steps (c) and (h) for 3 weeks following the last dose of the therapeutic compound given in step (h) and if the intensity of one or more repair markers deviate from the normal condition, reinitiating therapy in step (g) at the highest dose level achieved in step (h).
4. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases comprising the following steps:
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, the repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) administering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) and (e) until the intensity of the repair marker in step (c) no longer increases, (g) administering the therapeutic compound at the dose level where the intensity of the repair marker no longer increases until the intensity of the repair marker returns to the normal condition, (h) administering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of said set of disease markers no longer deviate from the normal condition, and (i) administering the therapeutic compound at a dose level incrementally higher than the previous dose given in step (h) and repeating steps (c), (d), (e), (f) and (g) until the intensity of a universal marker returns to the normal condition, the universal marker being a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states.
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, (c) screening a panel of second messengers and signal transducers and selecting a repair marker, the intensity of which increases following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, the repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein, (d) administering the therapeutic compound at a dose level incrementally higher than the previous dose, (e) repeating step (d) each time the intensity of the repair marker increases following an incrementally higher dose, (f) repeating steps (d) and (e) until the intensity of the repair marker in step (c) no longer increases, (g) administering the therapeutic compound at the dose level where the intensity of the repair marker no longer increases until the intensity of the repair marker returns to the normal condition, (h) administering the therapeutic compound at a dose level incrementally higher than the previous dose and repeating steps (c), (d), (e), (f) and (g) with one or more additional repair markers until all disease markers of said set of disease markers no longer deviate from the normal condition, and (i) administering the therapeutic compound at a dose level incrementally higher than the previous dose given in step (h) and repeating steps (c), (d), (e), (f) and (g) until the intensity of a universal marker returns to the normal condition, the universal marker being a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states.
5. The method of claim 4 further comprising:
(j) monitoring the universal marker for 3 weeks following the last dose given in step (i) and if the intensity deviates from the normal condition, reinitiating therapy at step (i) at the highest dose level achieved in step (i).
(j) monitoring the universal marker for 3 weeks following the last dose given in step (i) and if the intensity deviates from the normal condition, reinitiating therapy at step (i) at the highest dose level achieved in step (i).
6. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases comprising the following steps:
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the dose of the therapeutic compound is at a level which raises a universal marker to at least five times its normal level, the universal marker being a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states, and (c) continuing to administer the therapeutic compound at the dose level of step (b) until the universal marker returns to its normal level.
(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition, (b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the dose of the therapeutic compound is at a level which raises a universal marker to at least five times its normal level, the universal marker being a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states, and (c) continuing to administer the therapeutic compound at the dose level of step (b) until the universal marker returns to its normal level.
7. The method of claim 6 wherein the universal marker is vWAg.
8. The method of claim 7 further comprising:
(d) monitoring the universal marker for 3 weeks following the last dose given in step (c) and if the intensity deviates from the normal condition, reinitiating therapy at step (c).
(d) monitoring the universal marker for 3 weeks following the last dose given in step (c) and if the intensity deviates from the normal condition, reinitiating therapy at step (c).
9. The method of claim 2, wherein the disease condition is HIV
infection, wherein HIV is not expressed by said patient, and the concentration of at least one immunological molecule is elevated above the normal level comprising:
a) administering to the patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the effective amount is the amount which causes a universal marker to rise at least five times its normal level, the universal marker being the concentration of a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states, and b) continuing to administer the effective amount of the therapeutic compound until the universal marker returns to its normal level.
infection, wherein HIV is not expressed by said patient, and the concentration of at least one immunological molecule is elevated above the normal level comprising:
a) administering to the patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the effective amount is the amount which causes a universal marker to rise at least five times its normal level, the universal marker being the concentration of a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states, and b) continuing to administer the effective amount of the therapeutic compound until the universal marker returns to its normal level.
10. The method of claim 9 wherein said immunological molecule is selected from the group consisting of CD4, CD25, IL-1, IL-3, IL-4, IL-6, TNF
and sIL2R.
and sIL2R.
11. The method of claim 9 wherein the universal marker is the concentration of vWAg.
12. A method of treating a patient having a HIV associated disease state selected from the group consisting of tuberculosis, chronic wasting syndrome, and Herpesvirus infection comprising administering to an individual in need thereof an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
13. A method of stimulating tissue repair associated with HIV
infection comprising:
administering to a patient in need thereof, an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
infection comprising:
administering to a patient in need thereof, an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.
14. The method of claim 2 wherein the disease condition is HIV
infection and wherein said disease marker is selected from the group consisting of odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptosporidium diarrhea, Karnofsky performance score, waste syndrome, oral and pharyngeal candidiasis, and tuberculosis.
infection and wherein said disease marker is selected from the group consisting of odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptosporidium diarrhea, Karnofsky performance score, waste syndrome, oral and pharyngeal candidiasis, and tuberculosis.
15. The method of claim 2 wherein said repair marker is selected from the group consisting of cAMP, cGMP, IL-1, IL-2, TNF-.alpha., IL-6, cGMP/cAMP
ratio, total lymphocyte count, T lymphocyte count, CD4 count, CD8 count, cAMP dependent protein kinase A enzyme, adenylate cyclase, G-protein, phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol, intracellular calcium level, intracellular calcium ion level, c-myc, ras, c-fos, c-jun, NK-kB, ELAI, AP-1, COUP, TCF-1.alpha., TATA, TAT element, oxygen radical, CREB, CREM, Platelet Derived Growth Factor (PDGF), Colony Stimulating Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor (IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src Homology 3 domain (SH3), serine/threonine kinase, Mitogen Activated Protein Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and Activators of Transcription (STATs), JAJ1, JAK2, Tumor Necrosis Factor -Receptor 1 signal Transducer TRADD, chemokines of Rantes, and MIP-Alpha, and MIP-Beta.
ratio, total lymphocyte count, T lymphocyte count, CD4 count, CD8 count, cAMP dependent protein kinase A enzyme, adenylate cyclase, G-protein, phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol, intracellular calcium level, intracellular calcium ion level, c-myc, ras, c-fos, c-jun, NK-kB, ELAI, AP-1, COUP, TCF-1.alpha., TATA, TAT element, oxygen radical, CREB, CREM, Platelet Derived Growth Factor (PDGF), Colony Stimulating Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor (IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src Homology 3 domain (SH3), serine/threonine kinase, Mitogen Activated Protein Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and Activators of Transcription (STATs), JAJ1, JAK2, Tumor Necrosis Factor -Receptor 1 signal Transducer TRADD, chemokines of Rantes, and MIP-Alpha, and MIP-Beta.
16. The method of claim 1 wherein the nucleic acid component of defibrotide is an oligonucleotide from about 6 nucleotides to less than 60 nucleotides in length.
17. The method of claim 1 wherein the nucleic acid component of defibrotide is selected from the group consisting of dCTP, dATP, dGTP, dTTP, dAMP, dGMP, dCDP, dADP, ATP, AMP, CTP, CMP, UTP, cyclic TMP, cyclic UMP, cyclic GMP, GGTTGGATTGGTTGG (SEQ ID NO:1), GGTTGGATCGGTTGG (SEQ ID NO:2), GGATGGATCGGTTGG (SEQ ID
NO:3) and GGTGGTGGTTGTGGT (SEQ ID NO:4).
NO:3) and GGTGGTGGTTGTGGT (SEQ ID NO:4).
18. The method of claim 1 wherein the nucleic acid component is a variant of an oligonueleotide seleeted from the group consisting of GGTTGGATTGGTTGG (SEQ ID NO:1), GGTTGGATCGGTTGG (SEQ ID
NO:2), GGATGGATCGGTTGG (SEQ ID NO:3) and GGTGGTGGTTGTGGT
(SEQ ID NO:4).
NO:2), GGATGGATCGGTTGG (SEQ ID NO:3) and GGTGGTGGTTGTGGT
(SEQ ID NO:4).
19. The method of claim 1 wherein the nucleic acid component is an oligonucleotide comprising the sequence of GGTGGTGGTTGTGGT (SEQ ID
NO:4) and wherein said oligonucleotide is not a naturally existing nucleic acid component of defibrotide.
NO:4) and wherein said oligonucleotide is not a naturally existing nucleic acid component of defibrotide.
20. The method of claim 18, wherein the variant containing a sequence selected from the group consisting of HIV sequences, sequences encoding cellular regulatory factors and mitochondrial sequences.
21. The method of claim 20, wherein the variant is selected from the group consisting of GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCCCTT
G (SEQ ID NO:15), ACCAGAGCCAACAGC (SEQ ID NO:16), and CCTGGCCTTCCCTTG (SEQ ID NO:17).
G (SEQ ID NO:15), ACCAGAGCCAACAGC (SEQ ID NO:16), and CCTGGCCTTCCCTTG (SEQ ID NO:17).
22. The method of claim 1 wherein the nucleic acid component is an oligonucleotide from about 25 nucleotides to about 30 nucleotides long and has a molecular weight of about 8171.58 Dalton.
23. The method of claim 1 wherein the nucleic acid component is an oligonucleotide from about 25 nucleotides to about 30 nucleotides long and has a molecular weight of about 8433.75 Dalton.
24. The method of claim 1 wherein the nucleic acid component of defibrotide is administered in combination with one or more sequence specific nucleic acid.
25. The method of claim 1 wherein the sequence specific nucleic acid is selected from the group consisting of an anti-protease sequence, a retroviral promoter sequence, a TAR sequence, a HIV mutant of TAR decoy RNA, a mutant TAR decoy RNA, a negative mutant of the viral REV transactivator, a synthetic promoter with the consensus sequence for binding of the transcription factor a Sp1 and the TATA box, a mutant of TATA box, a TAT mutant wherein the mutations involving the seven cysteine residues, a sense, anti-sense, missense derivative of CIS acting negative elements (CRS) present in the integrase gene and REV mutant, a transdominant suppressor of REV (mutations involving amino acid 78 and 79), a NEF-cDNA sequence and its mutant with or without U3 region sequence of the 3'LTR, a POL reverse transcriptase gene mutant, a POL viral integrase gene and its mutant, a POL viral protease gene mutant, a HIV-I LTR enhancer (-137 to -17) mutant, a HIV LTR promoter starting at -78, a HIV LTR sequence encoding a arginine fork from aa27 to aa38, a HIV-I LTR sense sequence of the negative regulatory element (-340 to -185), a HIV-1 LTR consensus sequence for binding of transcription factors of AP1/COUP, NFAT-1, USF, TCF-.alpha., NF-KB, TCF-1a, TBP, and an inhibitor of the consensus sequence, a LTR NFkB mutant (-104 to -80), a LTR Sp1 (GC box) binding site and TATA box mutant, a LTR GAG gene sequence mutant, a LTR mutant (-454 to +180), a LTR genomic repeat at +80, a LTR region responsive for cellular transcription factors between and to the left of U3 to -454 extending to -7, a 3' LTR and its variant, a 5' LTR and its variant, a LTR variant, an inhibitor of UBP-1 or LBP-1 binding sequence (-5 to +82), a ENV, GAG, POL gene sequences placed 3' of the REV mutant codon, a short sequence mutant (15-60 mer) and a host DNA sequence of preferred targets for proviral integration.
26. The method of claim 1 wherein said nucleic acid component of defibrotide is a nucleic acid derivative.
27. The method of claim 1 wherein the dose of the therapeutic compound is from about 0.1 mg/kg patient body weight per day to about 1000 mg/kg patient body weight per day.
28. The method of claim 1 wherein the dose of the therapeutic compound is from about 40 mg/kg patient body weight per day to about 600 mg/kg patient body weight per day.
29. The method of claim 1 wherein the nucleic acid component of defibrotide is administered in combination with an amino acid selected from the group consisting of threonine, serine, tyrosine, and proline.
30. The method of claim 1 wherein the nucleic acid component of defibrotide is administered in combination with a N-containing ring compound selected from the group consisting of pyrimidine, purine, adenylic acid, and guanosine.
31. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases, comprising administering to the patient an effective amount of a therapeutic compound comprising an oligonucleotide containing a homologous sequence of HIV and a gene encoding a cellular regulatory factor.
32. The method of claim 31 wherein the cellular regulatory factor is selected from the group consisting of human TNF receptor, mouse TNF-receptor CCCR5, human RIP protein kinase, IL-2 receptor, TNF receptor/cell death protein, IL-1a, TNF-.alpha., c-myc, c-ab1, c-fos, c-ras, dystrophin, surface glycoprotein proteins of L-CAM and cathedrin, and B-myb.
33. The method of claim 32 wherein the oligonucleotide is selected from the group consisting of CAGCTGCACCTGCCAAGC (SEQ ID NO:5), ATAAAATATACCATATACA (SEQ ID NO:6), TCATAAAATATACTATATTCA (SEQ ID NO:7), ATATTAAAGAACGCTGTTTACAATACTTGG (SEQ ID NO:8), ATGCAGTTGTGAAGAGAA (SEQ ID NO:9), AATTAAGGCATAAGAAAACTAAGAAATATGCAC (SEQ ID NO:10), TCTCTCCCTCAAGGACTCAGCTTTCTGAAG (SEQ ID NO:11), CAATAATAAAAGGGGAAA (SEQ ID NO:12), AGTGCAACCGGCAGGAGGTGA (SEQ ID NO:13), and GCCACCAGCCCCTCCCCAGACTCTCAGGTGGAGGCAACAG (SEQ ID
NO:14).
NO:14).
34. The method of claim 31 wherein the oligonucleotide is administered in combination with a homologous sequence of a gene encoding a cellular regulatory factor and GGTGGTGGTTGTGGT (SEQ ID NO:4).
35. The method of claim 34 wherein the cellular regulatory factor is selected from the group consisting of myc, TNF receptor, ras, ab1, bc1, fos, IL-1, and musnos.
36. An oligonucleotide consisting of a sequence selected from the group consisting of CAGCTGCACCTGCCAAGC (SEQ ID NO:5), ATAAAATATACCATATACA (SEQ ID NO:6), TCATAAAATATACTATATTCA (SEQ ID NO:7), ATATTAAAGAACGCTGTTTACAATACTTGG (SEQ ID NO:8), ATGCAGTTGTGAAGAGAA (SEQ ID NO:9), AATTAAGGCATAAGAAAACTAAGAAATATGCAC (SEQ ID NO:10), TCTCTCCCTCAAGGACTCAGCTTTCTGAAG (SEQ ID NO:11), CAATAATAAAAGGGGAAA (SEQ ID NO:12), AGTGCAACCGGCAGGAGGTGA (SEQ ID NO:13), GCCACCAGCCCCTCCCCAGACTCTCAGGTGGAGGCAACAG (SEQ ID
NO:14).
GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCCCTT
G (SEQ ID NO:15), ACCAGAGCCAACAGC (SEQ ID NO:16), and CCTGGCCTTCCCTTG (SEQ ID NO:17).
NO:14).
GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCCCTT
G (SEQ ID NO:15), ACCAGAGCCAACAGC (SEQ ID NO:16), and CCTGGCCTTCCCTTG (SEQ ID NO:17).
37. An oligonucleotide comprising the same sequence of an oligonucleotide of defibrotide obtainable via passing defibrotide through a C8 HPLC column and eluting with 0.1% TFA in water, wherein the length of the oligonucleotide of defibrotide is from about 25 to about 30 nucleotides and the molecular weight is 8171.58 Dalton, and wherein the oligonucleotide is not a naturally existing nucleic acid component of defibrotide.
38. A vector comprising an origin of replication and a sequence of the oligonucleotide in claim 36.
39. The vector of claim 38 further comprising a sequence encoding an origin of replication of mitochondrion.
40. The vector of claim 39 wherein the sequence encoding an origin of replication of mitochondrion is from a human.
41. The vector of claim 40 wherein the sequence is selected from the group consisting of 5' end of mitochondrial 12S RNA containing sequences from nucleotide 72 to 1025 and mitochondrial DNA containing sequences from nucleotide 1 to 72.
42. The vector of claim 40 further comprising a promoter sequence selected from the group consisting of TAR promoter, HIV LTR promoter, and promoter of DNA polymerase.
43. The vector of claim 42 further comprising a sequence encoding DNA polymerase.
44. The method of claim 1,2,4,6, 12 or 13 wherein the therapeutic compound comprising the vector of claim 38.
45. The method of claim 44 wherein the therapeutic compound is administered in combination with DNA polymerase, protease inhibitor, or reverse transcriptase.
46. A method of treating a patient having a resistance to a drug comprising administering an effective amount of a nucleic acid component of defibrotide in combination with the drug.
47. The method of 46 wherein the drug is protease inhibitor.
48. The method of claim 1 wherein the disease condition is HIV
infection.
infection.
49. An oligonucleotide comprising the same sequence of an oligonucleotide of defibrotide obtainable via passing defibrotide through a C8 HPLC column and eluting with 0 1% TFA in water, wherein the length of the oligonucleotide of defibrotide is from about 25 to about 30 nucleotides and the molecular weight is 8433.75 Dalton, and wherein the oligonucleotide is not a naturally existing nucleic acid component of defibrotide.
50. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases, comprising administering to the patient an effective amount of defibrotide in combination with one or more sequence specific nucleic acid.
51. The method of claim 50 wherein defibrotide is administered in combination with one or more sequence specific nucleic acid and one or more sequence specific peptide.
52. The method of claim 51, wherein a nucleic acid component of defibrotide is administered in combination with one or more sequence specific nucleic acid and one or more sequence specific peptide.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US84801397A | 1997-04-28 | 1997-04-28 | |
US848,013 | 1997-04-28 |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2259041A1 true CA2259041A1 (en) | 1998-11-05 |
Family
ID=25302109
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002259041A Abandoned CA2259041A1 (en) | 1997-04-28 | 1998-04-28 | Method of treating hiv infection and related secondary infections thereof |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1202750A4 (en) |
AU (1) | AU754242B2 (en) |
CA (1) | CA2259041A1 (en) |
HK (1) | HK1044896A1 (en) |
WO (1) | WO1998048843A1 (en) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000039304A2 (en) | 1998-12-31 | 2000-07-06 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
CA2487171A1 (en) * | 2002-05-31 | 2003-12-11 | Klinikum Der Universitat Regensburg | Method for the protection of endothelial and epithelial cells during chemotherapy |
ITMI20031714A1 (en) * | 2003-09-05 | 2005-03-06 | Gentium Spa | FORMATIONS FOR ANTITUMORAL ACTION. |
WO2005082144A1 (en) * | 2004-02-25 | 2005-09-09 | Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Office Of Technology Transfer | Methylation inhibitor compounds |
US20080194507A1 (en) * | 2005-03-03 | 2008-08-14 | Massimo Iacobelli | Defibrotide An/Or Oligodeoxyribonucleotides For Treating Angiogenesis-Dependent Tumors |
ITMI20050336A1 (en) * | 2005-03-03 | 2006-09-04 | Gentium Spa | FORMULATION FOR ANTI-TUMOR ACTIVITY |
AU2007231651B2 (en) * | 2005-03-03 | 2011-09-15 | Gentium Spa | Defibrotide and/or oligodeoxyribonucleotides for treating angiogenesis-dependent tumors |
CN107007617A (en) | 2010-11-12 | 2017-08-04 | 真蒂奥姆责任有限公司 | Fibrin polynucleotides are used to prevent and/or treat graft versus host disease(GVH disease) (GVHD) |
AU2012383169B2 (en) | 2012-06-22 | 2017-12-21 | Gentium S.R.L. | Euglobulin-based method for determining the biological activity of defibrotide |
EP3026122A1 (en) | 2014-11-27 | 2016-06-01 | Gentium S.p.A. | Cellular-based method for determining the potency of defibrotide |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
IT1170215B (en) * | 1983-09-12 | 1987-06-03 | Crinos Industria Farmaco | PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF STATES OF ACUTE RENAL INSUFFICIENCY |
IT1170214B (en) * | 1983-09-12 | 1987-06-03 | Crinos Industria Farmaco | PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF PERIPHERAL ARTERIOPATHIES |
IT1206341B (en) * | 1984-02-16 | 1989-04-14 | Crinos Industria Farmaco | PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF ACUTE MYOCARDIUM ISCHHEMIA. |
BR9106418A (en) * | 1990-05-04 | 1993-05-04 | Isis Pharmaceuticals Inc | PROCESS TO MODULATE THE EXPRESSION OF A GENE, OLIGONUCLOETIDE, OR OLIGONUCLEOTIDE ANALOG AND PROCESSES TO TREAT AN SUSPECTED ANIMAL HAVING HIV DISEASE AND INFECTION |
IT1252174B (en) * | 1991-12-09 | 1995-06-05 | Crinos Industria Farmaco | OLIGODESOXYBONUCLEOTIDES WITH ANTI-SCHEMICAL ACTIVITY AND PROCEDURES FOR THEIR OBTAINING |
AU692433B2 (en) * | 1993-01-13 | 1998-06-11 | Arsinur Burcoglu | Method for using polynucleotides, oligonucleotides and derivatives thereof to treat various disease states |
AU7516494A (en) * | 1993-07-29 | 1995-02-28 | Isis Pharmaceuticals, Inc. | Oligomers for modulating human immunodeficiency virus |
-
1998
- 1998-04-28 CA CA002259041A patent/CA2259041A1/en not_active Abandoned
- 1998-04-28 AU AU71609/98A patent/AU754242B2/en not_active Ceased
- 1998-04-28 WO PCT/US1998/008357 patent/WO1998048843A1/en not_active Application Discontinuation
- 1998-04-28 EP EP98918740A patent/EP1202750A4/en not_active Withdrawn
-
2002
- 2002-09-04 HK HK02106517.9A patent/HK1044896A1/en unknown
Also Published As
Publication number | Publication date |
---|---|
AU754242B2 (en) | 2002-11-07 |
HK1044896A1 (en) | 2002-11-08 |
WO1998048843A1 (en) | 1998-11-05 |
EP1202750A4 (en) | 2002-10-16 |
AU7160998A (en) | 1998-11-24 |
EP1202750A1 (en) | 2002-05-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6699985B2 (en) | Method of treating HIV infection and related secondary infections thereof | |
US11077195B2 (en) | IL-2 conjugates and methods of use thereof | |
US5977083A (en) | Method for using polynucleotides, oligonucleotides and derivatives thereof to treat various disease states | |
JP5608024B2 (en) | Immunostimulatory G and U-containing oligoribonucleotides | |
JP5209204B2 (en) | Polymer oligonucleotide prodrug | |
JP2020529977A (en) | Cytokine conjugates for the treatment of proliferative diseases and infectious diseases | |
EP1181304B1 (en) | Antiproliferative activity of g-righ oligonucleotides and method of using same to bind to nucleolin | |
CN108271351A (en) | For adjusting the Compounds and methods for of proangiotensin expression | |
WO2015095351A1 (en) | LEPTIN mRNA COMPOSITIONS AND FORMULATIONS | |
US20060074034A1 (en) | Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof | |
AU754242B2 (en) | Method of treating HIV infection and related secondary infections thereof | |
US5593973A (en) | Treatment of viral hepatitis with mismatched dsRNA | |
JP2021529173A (en) | RIG-I agonist and treatment with it | |
US11939581B2 (en) | Methods and compositions for targeting PD-L1 | |
US5624912A (en) | Method of treating HIV infection and related secondary infections with defibrotide | |
AU692433B2 (en) | Method for using polynucleotides, oligonucleotides and derivatives thereof to treat various disease states | |
US20140275214A1 (en) | Custirsen treatment with reduced toxicity | |
US6342485B1 (en) | Synergistic compositions useful as anti-tumor agents | |
WO2003025139A2 (en) | Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof | |
JP2016192963A (en) | Yb-1 antisense oligonucleotide for reducing survival of tumor cell | |
WO2007058323A1 (en) | Method for production of nucleic acid homopolymer-bound functional nucleic acid medicine | |
JP2021518372A (en) | Modified oligonucleotides and usage | |
KR102061924B1 (en) | Composition for preventing or treating of cardiovascular disease comprising p32 inhibitor | |
CN114574496B (en) | Nucleoside derivative modified aptamer sgc8 | |
KR20230108728A (en) | Compounds and methods for modulating angiotensinogen expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Dead |