JP2016192963A - Yb-1 antisense oligonucleotide for reducing survival of tumor cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a nucleic acid that specifically and effectively inhibits YB-1 expression.SOLUTION: The present invention provides a nucleic acid having human YB-1 translation inhibitory activity by preparing a 25 base single-strand DNA antisense oligonucleotide on the basis of a nucleotide sequence of YBX1 mRNA.SELECTED DRAWING: None

Description

  The present invention relates to a nucleic acid that specifically and effectively suppresses the expression of Y box binding protein 1 (YB-1), and cancer cell death induction, cancer treatment / prevention, angiogenesis (particularly, including the nucleic acid). The present invention relates to a pharmaceutical composition for inhibiting tumor angiogenesis, and for inhibiting growth of tumor cells and tumor vascular endothelial cells.

  YB-1 is a multifunctional protein that is encoded by the YB-1 (YBX1) gene and is involved in transcription, translation, and replication (Non-patent Document 1). YB-1 has a cold shock domain and is localized in the nucleus and cytoplasm of human cancer cells. It is considered to increase the expression of ABC transporters such as P-glycoprotein (MDR1, ABCB1) and DNA repair-related enzymes and widely hold an important key for acquiring drug resistance. In various cancer types, it has been reported that the nuclear localization and expression level of YB-1 show significant correlation with P-glycoprotein-dependent or independent drug resistance and poor prognosis (Non-patent literature). 2). Regarding YB-1, research groups of Kyushu University and Occupational Medical University have reported that it is related to many human cancer types such as ovarian cancer, breast cancer, and osteosarcoma (Patent Document 1). They have also revealed that YB-1 regulates the expression of growth factors such as EGFR and cell cycle-related genes (Non-patent Document 3). For example, the presence of a Y-box, which is a binding site for the transcription factor YB-1, has been confirmed in the vicinity of promoter regions of several growth-related genes including EGFR.

  The present inventors have found that when the expression of YB-1 is suppressed with siRNA, the proliferation of cancer cells is remarkably suppressed and then cell death is induced (Non-patent Document 4). In addition, it was reported that YB-1 positively controls the expression of CDC6, which is essential in the early stages of DNA replication, as the mechanism (Non-patent Document 5). Furthermore, YB-1 was found to be highly expressed in vascular endothelial cells in tumors and low in existing vascular endothelial cells (Non-patent Document 6). The above results show that the cancer treatment method that targets YB-1 as a molecular target not only suppresses the growth of cancer cells, but also can suppress the angiogenesis in the cancer stroma, and thus a synergistic anticancer effect can be expected. (Patent Document 2, Non-Patent Documents 7 and 8). However, since YB-1 is a multifunctional protein, it was speculated that it would be difficult to develop a function inhibitor.

The development of nucleic acid drugs targeting YB-1 is reported in Patent Documents 2 and 3. Patent Document 2 discloses a tumor angiogenesis inhibitor comprising a 25-base antisense oligonucleotide targeting a nucleic acid encoding YB-1. Examples of treatment targets include glioblastoma, esophageal cancer, gastric cancer, colon cancer, and lung cancer. The vascular endothelial cell (HUVEC) growth inhibitory activity of double-stranded RNA (siRNA) targeting YB-1 has been evaluated.
Patent Document 3 discloses a nucleic acid drug (siRNA, miRNA, antisense nucleic acid) that suppresses the expression of YB-1 (YBX1) gene, and describes an anticancer agent that exhibits an HUVEC cell growth inhibitory action and has an apoptosis inducing action. ing.

JP-A-9-95499 JP 2011-088876 A JP 2013-216627 A

Bioessays. 2003; 25 (7): 691-698 Molecular Cancer Therapeutics, vol.3, pp.1485-1492, 2004 "Nikkei Medical" 2009/6/19 Kiyomi Morishita 49th Symposium of the Japanese Respiratory Society (Kurume Univ. Koichi Higashi 2009/6 / 12-14) article http://medical.nikkeibp.co.jp/leaf/ all / gakkai / sp / jrs2009 / 200906 / 511211.html Cancer Res. 2008; 68 (1): 98-105 Eur J Cancer. 2010; 46 (5): 954-965 Cancer Sci. 2010; 101 (6): 1367-1373 Cancer Sci. 2003; 94 (1): 9-14 Curr Med Chem Anticancer Agents. 2005; 5 (1): 15-27

  In order to develop a pharmaceutical composition that is more effective for the treatment and prevention of cancer, it is desired to search for a nucleic acid that can suppress the expression of YB-1 gene in cancer cells more strongly than ever.

  Accordingly, an object of the present invention is to provide a nucleic acid that effectively suppresses the expression of YB-1, and a pharmaceutical composition containing the nucleic acid for inducing cancer cell death, treating or preventing cancer, and the like. To do.

  The present inventors comprehensively prepared antisense oligonucleotides against the YB-1 (YBX1) gene mRNA, and introduced each into lung cancer cells. And it discovered that the expression of YB-1 decreased notably by several specific antisense oligonucleotide, and the survival rate of a lung cancer cell fell remarkably, and completed this invention.

That is, the present invention relates to the following.
[1] A nucleic acid having a nucleotide sequence of any of the following (A) to (D) and having a human YB-1 translation inhibitory activity and having a length of 50 nucleotides or less:
(A) a nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(B) a nucleotide sequence in which one or two bases are deleted, substituted, inserted, or added in the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(C) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5; and (D) any nucleotide sequence selected from (A) to (C) A contiguous subsequence of at least 16 nucleotides in length.
[2] The nucleic acid according to [1], comprising the nucleotide sequence represented by any one of SEQ ID NOs: 2 to 5.
[3] An expression vector for expressing the nucleic acid according to [1] or [2].
[4] A pharmaceutical composition comprising the nucleic acid according to [1] or [2] or the expression vector according to [3].
[5] The pharmaceutical composition according to [4], which is used for treatment or prevention of cancer.
[6] The pharmaceutical composition according to [4], which is used for inducing cancer cell death.
[7] The pharmaceutical composition according to [5] or [6], wherein the cancer expresses human YB-1.
[8] The pharmaceutical composition according to any one of [5] to [7], wherein the cancer is lung cancer.
[9] The pharmaceutical composition according to [8], wherein the lung cancer is non-small cell lung cancer.
[10] The pharmaceutical composition according to [4], which is used for inhibiting angiogenesis.
[11] The pharmaceutical composition according to [10], which is used for inhibiting angiogenesis of tumor blood vessels.
[12] The pharmaceutical composition according to [4], which is used for inhibiting growth of tumor cells and tumor vascular vascular endothelial cells.
[13] The pharmaceutical composition according to [12], wherein the tumor is lung cancer.

  The nucleic acid of the present invention can specifically and effectively suppress the expression of YB-1. Since cancer cell death can be induced by suppressing YB-1 expression in cancer cells, the pharmaceutical composition containing the nucleic acid of the present invention is useful for cancer cell death induction and cancer treatment / prevention.

  Since YB-1 is specifically expressed in tumor neovascularization and contributes to growth factor-dependent proliferation of vascular endothelial cells (Japanese Patent Application Laid-Open No. 2011-088876), the pharmaceutical composition of the present invention is used for inhibiting angiogenesis. It is also useful.

  Furthermore, YB-1 is specifically expressed in vascular endothelial cells of tumor neovascularization, and is not or hardly expressed in vascular endothelial cells of normal tissue or inflamed tissue (Japanese Patent Laid-Open No. 2011-088876). The pharmaceutical composition is particularly useful for selectively inhibiting angiogenesis in tumor tissue. In addition, since YB-1 is known to be related to drug resistance and proliferation of tumor cells, the pharmaceutical composition of the present invention results in simultaneous inhibition of proliferation of both tumor cells and tumor vascular endothelial cells. Is possible.

Schematic showing the design of YBX1 antisense DNA oligonucleotide. Based on the nucleotide sequence of YBX1 mRNA, a 25-nucleotide single-stranded DNA antisense oligonucleotide was prepared. Each single-stranded DNA antisense oligonucleotide was prepared so that adjacent DNA oligonucleotides overlapped by 15 bases. Effect of YBX1 antisense DNA oligonucleotide on cell viability. Lung cancer cells (PC9 cells) were transfected with each DNA oligonucleotide and subjected to WST8 assay. The average survival rate (horizontal axis) of cells into which 153 types of YBX1 antisense DNA oligonucleotides (horizontal axis) were introduced is shown with the cell survival rate of the control DNA oligonucleotide being 1. Suppression of YB-1 expression by YBX1 antisense DNA oligonucleotide. Western blotting was performed on lung cancer cells (PC9 cells) transfected with each indicated YBX1 antisense DNA oligonucleotide using anti-YB-1 antibody and anti-β-actin antibody. The upper panel shows an image of the Western blot, and the lower panel shows a graph showing the result of quantifying the relative expression level of YB-1. It is a figure which shows the structure of schizophyllan (SPG). It is a figure which shows the candidate of the antisense oligonucleotide (AS-ODN) arrangement | sequence with respect to YB-1 mRNA. It is a figure showing the screening of the antisense DNA sequence with the highest effect. It is a figure which shows the binding site of four selected AS-ODNs, and the bulge / loop structure of YB-1 mRNA produced by UNAfold. It is the figure which showed silencing of YB-1 protein expression by antisense DNA by (A) Western blot analysis and (B) the graph which normalized the signal intensity with the signal intensity about (beta) actin. FIG. 3 is a diagram showing the formation of a dA ₄₀ / SPG complex and an AS014-dA ₄₀ / SPG (hereinafter sometimes abbreviated as AS014 / SPG) complex by gel electrophoresis. It is a figure which shows the cell survival rate of 12 lung cancer cell lines after a process by AS014 / SPG complex. (A) shows the survival rate of each cell line by WST-8 assay, (B) shows YB-1 expression of PC9 and A549 by Western blot. FIG. 4 shows uptake of FITC-labeled SPG and Alexa546-labeled dA ₄₀ / SPG complex. (A) Uptake of FITC-labeled SPG by B203L, PC9, A549, and PC1 cells, (B) Uptake of Alexa546-labeled dA ₄₀ / SPG complex by PC9 cells, (C) Unlabeled dA ₄₀ / SPG complex presence or by PC9 cells in the absence shows uptake of Alexa546-labeled dA ₄₀ / SPG complex.

1. Nucleic acid The present invention provides an antisense nucleic acid against the human YB-1 gene. An “antisense nucleic acid” includes a nucleotide sequence that can specifically hybridize to the target mRNA under physiological conditions of a cell that expresses the target mRNA (mature mRNA or early transcript), and is encoded by the target mRNA. A nucleic acid capable of inhibiting the translation of a polypeptide. That is, the nucleic acid of the present invention can be added to the human YB-1 gene mRNA (mature mRNA or initial transcription product) under physiological conditions (preferably, a human cell) that expresses the mRNA. It specifically hybridizes in the cytoplasm) and has the activity of inhibiting the translation of the human YB-1 polypeptide encoded by the mRNA. This activity is hereinafter referred to as “human YB-1 translation inhibitory activity”.

  The mechanism of inhibition of translation by the antisense nucleic acid is not limited, but the double-stranded part formed by hybridization of the antisense nucleic acid to the target mRNA becomes steric hindrance and the ribosome proceeds on the mRNA. When the antisense nucleic acid is DNA or the like, the intracellular RNase H recognizes and cleaves the double-stranded part formed by hybridizing the DNA to the target mRNA, A mechanism in which translation is inhibited by degrading the target mRNA can be mentioned.

  The nucleic acid of the present invention preferably specifically inhibits translation of human YB-1. “Specific inhibition” means that the translation of a target gene is suppressed more strongly than the translation of other genes.

  YB-1 (Y box binding protein 1) has a cold shock domain and is a known polypeptide that contributes to acquisition and proliferation of drug resistance in cancer cells (Molecular Cancer Therapeutics 2004; 3: 1485-1492) .

The nucleotide sequence and amino acid sequence of human YB-1 are known. A representative nucleotide sequence of human YB-1 is registered in NCBI as follows.
Nucleotide sequence (mRNA or cDNA sequence): Accession number NM_004559 (version NM_004559.3) (SEQ ID NO: 1)
That is, human YB-1 gene mRNA is, for example, RNA containing the nucleotide sequence represented by SEQ ID NO: 1.

  In this specification, the nucleotide sequence is described as a DNA sequence unless otherwise specified. However, when the polynucleotide is RNA, thymine (T) is appropriately read as uracil (U).

  The human YB-1 translation inhibitory activity of a nucleic acid is obtained by introducing a nucleic acid to be evaluated into a cell that expresses human YB-1 mRNA (preferably a human cell), and a translation product of human YB-1 in the cell (ie, , Polypeptide) expression level can be evaluated by comparing with a negative control in which no nucleic acid is introduced. The expression level of the translation product of human YB-1 can be evaluated by detecting the translation product by a known immunological technique using an antibody that specifically recognizes the translation product of human YB-1. . Examples of immunological methods include flow cytometry analysis, radioisotope immunoassay (RIA method), ELISA method (Methods in Enzymol. 70: 419-439 (1980)), Western blotting, immunohistochemical staining, etc. Can do.

The nucleic acid of the present invention has human YB-1 translation inhibitory activity and comprises any of the following nucleotide sequences:
(A) a nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(B) a nucleotide sequence in which one or two bases are deleted, substituted, inserted, or added in the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(C) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5; and (D) any nucleotide sequence selected from (A) to (C) A contiguous subsequence of at least 16 nucleotides in length.

Specifically, the nucleotide sequences represented by the above SEQ ID NOs: 2 to 5 are as follows.
Sequence number 2 ACTGGGGCCGGCTGCGGCAGCTGCG
SEQ ID NO: 3 TGCCCGTAGTGCCGGGCTTGGTGTC
SEQ ID NO: 4 AAGTTGCGGCGGTACCGACGTTGAG
SEQ ID NO: 5 GGCAGGCGCCGCCGATGTGAGGCCG

The nucleotide sequences represented by SEQ ID NOs: 2 to 5 are complementary to the following portions in the human YB-1 gene mRNA nucleotide sequence represented by SEQ ID NO: 1, respectively.
SEQ ID NO: 2: nucleotide numbers 131 to 155
SEQ ID NO: 3: nucleotide numbers 241-265
SEQ ID NO: 4: nucleotide numbers 1001 to 1025
SEQ ID NO: 5: nucleotide numbers 291 to 315

  In the nucleotide sequence of (B) above, the number of nucleotides to be deleted, substituted, inserted or added is not particularly limited as long as the resulting nucleic acid has human YB-1 translation inhibitory activity. One or two, preferably one.

  In the nucleotide sequence (C) above, the degree of sequence identity is not particularly limited as long as the resulting nucleic acid has human YB-1 translation inhibitory activity, but usually 90% or more, preferably about 95% or more. It is.

  Nucleotide sequence identity can be determined by methods known per se. For example, the program can be determined by using a program commonly used in the field (for example, BLAST, FASTA, etc.) by default. For example, using NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool), under the following conditions (expected value = 10; gap cost = Linear; filtering = ON; match score = 1; mismatch score = -2) Can be calculated. In another aspect, identity (%) is determined by any algorithm known in the art, such as Needleman et al. (1970) (J. Mol. Biol. 48: 444-453), Myers and Miller (CABIOS, 1988, 4: It can be determined using the algorithm of 11-17). The Needleman et al. Algorithm is incorporated into the GAP program of the GCG software package, and the percent identity is, for example, BLOSUM 62 matrix or PAM250 matrix, and gap weight: 16, 14, 12, 10, 8, 6 or 4 and length weight: can be determined by using any of 1, 2, 3, 4, 5 or 6. The Myers and Miller algorithms are also incorporated into the ALIGN program that is part of the GCG sequence alignment software package. When using the ALIGN program to compare nucleotide sequences, for example, PAM120 weight residue table, gap length penalty 12, and gap penalty 4 can be used. For calculation of nucleotide sequence identity, a method showing the lowest value among the above methods may be adopted.

  The length of the partial sequence included in the nucleotide sequence (D) is 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides long, and the hybridization specificity for the target mRNA is determined. From the viewpoint of enhancing, the longer the better. It is preferably 20 nucleotides or more (20, 21, 22, 23 or 24), more preferably 23 nucleotides or more (23 or 24), and most preferably 24 nucleotides in length.

  The length of the nucleic acid of the present invention is usually 16 nucleotides or more, preferably 20 nucleotides or more, more preferably 23 nucleotides or more, still more preferably 24 nucleotides or more, and even more preferably 25 nucleotides or more. The length of the nucleic acid of the present invention is usually 200 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less (eg, 29 nucleotides or less, 28 nucleotides or less, 27 nucleotides) due to ease of synthesis or antigenicity problems. 26 nucleotides or less). Most preferably, the nucleic acid of the present invention is 25 nucleotides in length.

  The nucleic acid of the present invention most preferably consists of a nucleotide sequence represented by any of SEQ ID NOs: 2 to 5.

  The nucleic acid of the present invention is DNA, RNA, RNA-DNA chimeric nucleic acid (hereinafter referred to as chimeric nucleic acid) or hybrid nucleic acid. Here, a chimeric nucleic acid refers to a single-stranded or double-stranded nucleic acid containing RNA and DNA in a single nucleic acid, and a hybrid nucleic acid is a double-stranded nucleic acid having one strand of RNA or DNA. A nucleic acid which is a chimeric nucleic acid and the other strand is DNA or a chimeric nucleic acid. The nucleic acid of the present invention is preferably DNA.

  The nucleic acid of the present invention is single-stranded or double-stranded. Double-stranded embodiments include double-stranded DNA, double-stranded RNA, double-stranded chimeric nucleic acid, RNA / DNA hybrid, RNA / chimeric nucleic acid hybrid, chimeric nucleic acid / chimeric nucleic acid hybrid, and chimeric nucleic acid / DNA hybrid. . The nucleic acid of the present invention is preferably single-stranded (single-stranded DNA, single-stranded RNA or single-stranded chimeric nucleic acid), more preferably single-stranded DNA.

  The antisense nucleic acid not only hybridizes with the mRNA of the human YB-1 gene to inhibit translation, but also binds to the double-stranded DNA YB-1 gene to form a triplex. In addition, it may be capable of inhibiting transcription to mRNA.

  The nucleic acids of the present invention are polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are purine or pyrimidine base N-glycosides , Other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence specific nucleic acid polymers) or other polymers containing special linkages, provided that such polymers are found in DNA or RNA Base pairing and nucleotides with a configuration allowing base attachment). They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those having uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine etc. ), Sugars (eg, monosaccharides), etc., side chain groups, intercurrent compounds (eg, acridine, psoralen, etc.), chelate compounds (eg, metals, radioactive metals) , Boron, an oxidizing metal, etc.), an alkylating agent, and a modified bond (for example, α-anomeric nucleic acid). Here, “nucleoside”, “nucleotide” and “nucleic acid” may include not only purine and pyrimidine bases but also those having other heterocyclic bases modified. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also be modified at the sugar moiety, eg, one or more hydroxyl groups are replaced by halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may be converted.

The nucleotide molecule constituting the nucleic acid of the present invention may be natural DNA or RNA, but in order to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA), various nucleotide molecules can be used. Chemical modifications can be included. For example, in order to prevent degradation by a hydrolase such as nuclease, a phosphate residue (phosphate) of each nucleotide constituting a nucleic acid is changed to a chemically modified phosphate such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a residue. In addition, the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R═CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH ₂ CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl, etc. Is mentioned.

  The conformation of the sugar part of RNA is dominated by C2'-endo (S type) and C3'-endo (N type). In single-stranded RNA, it exists as an equilibrium between the two, but double-stranded Is fixed to the N type. Therefore, in order to give strong binding ability to the target RNA, BNA (LNA) (Imanishi) is an RNA derivative in which the conformation of the sugar moiety is fixed to N-type by cross-linking 2 'oxygen and 4' carbon. , T. et al., Chem. Commun., 1653-9, 2002; Jepsen, JS et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides Nucleotides Nucleicides Nucleic Acids , 22, 1619-21, 2003) can also be preferably used.

  The nucleic acids of the invention are preferably isolated. “Isolated” means that an operation to remove factors other than the target component has been performed, and that the naturally occurring state has been removed. The purity of the “isolated nucleic acid” (percentage of the target nucleic acid weight in the total weight of the evaluation target) is usually 70% or more, preferably 80% or more, more preferably 90% or more, and still more preferably 99%. % Or more.

  Other important factors for the design of antisense nucleic acids include increasing water solubility and cell membrane permeability, but these can also be overcome by devising dosage forms such as using liposomes and microspheres. .

  The antisense nucleic acid of the present invention can be synthesized using, for example, a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.) based on the sequence information disclosed in the present specification. it can.

2. Expression vector The present invention also provides an expression vector capable of expressing (encoding) the nucleic acid of the present invention. In the expression vector, the above-described nucleic acid of the present invention or the nucleic acid encoding it (preferably DNA) can exert promoter activity in human cells (for example, cancer cells, vascular endothelial cells, etc.) to be administered. It is operably linked to a promoter.

  The promoter used is not particularly limited as long as it can function in human cells to be administered. As the promoter, a pol I promoter, pol II promoter, pol III promoter, or the like can be used. Specifically, SV40-derived early promoter, viral promoter such as cytomegalovirus LTR, mammalian constituent protein gene promoter such as β-actin gene promoter, and RNA promoter such as tRNA promoter are used.

  When expression of RNA is intended, it is preferable to use a pol III promoter as a promoter. Examples of the polIII promoter include U6 promoter, H1 promoter, tRNA promoter and the like.

  The expression vector preferably contains a transcription termination signal, that is, a terminator region, downstream of the nucleic acid of the present invention or the nucleic acid encoding the nucleic acid. Furthermore, a selection marker gene for selecting transformed cells (a gene that imparts resistance to drugs such as tetracycline, ampicillin, and kanamycin, a gene that complements an auxotrophic mutation, and the like) can be further contained.

  The type of vector used for the expression vector in the present invention is not particularly limited, and examples of suitable vectors for human administration include retroviruses, adenoviruses, adeno-associated virus virus vectors, plasmid vectors, and the like. Among these, adenovirus has advantages such as extremely high gene transfer efficiency and can be introduced into non-dividing cells. However, since integration of the transgene into the host chromosome is extremely rare, gene expression is transient and usually lasts only about 4 weeks. Considering the persistence of the therapeutic effect, use of an adeno-associated virus that has relatively high gene transfer efficiency, can be introduced into non-dividing cells, and can be integrated into the chromosome via an inverted terminal repeat (ITR) Also preferred.

3. Pharmaceutical Composition The present invention provides a pharmaceutical composition comprising the nucleic acid or expression vector of the present invention.

  The pharmaceutical composition of the present invention can contain any carrier, for example, a pharmaceutically acceptable carrier, in addition to the nucleic acid or expression vector of the present invention.

  Examples of pharmaceutically acceptable carriers include sucrose, starch, mannitol, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate and other excipients, cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone. , Gelatin, gum arabic, polyethylene glycol, sucrose, starch and other binders, starch, carboxymethylcellulose, hydroxypropyl starch, sodium-glycol starch, sodium bicarbonate, calcium phosphate, calcium citrate and other disintegrants, magnesium stearate , Aerosil, Talc, Lubricant such as sodium lauryl sulfate, Citric acid, Menthol, Glycyrrhizin / Ammonium salt, Glycine, Orange powder and other fragrances, Sodium benzoate Preservatives such as lithium, sodium hydrogen sulfite, methyl paraben, propyl paraben, stabilizers such as citric acid, sodium citrate, acetic acid, suspensions such as methyl cellulose, polyvinyl pyrrolidone, aluminum stearate, dispersants such as surfactants, Examples include, but are not limited to, water, physiological saline, diluents such as orange juice, base waxes such as cacao butter, polyethylene glycol, and white kerosene.

  In order to promote introduction of the nucleic acid or expression vector of the present invention into cells, the pharmaceutical composition of the present invention can further contain a reagent for nucleic acid introduction. The nucleic acid introduction reagent may be a cationic lipid such as lipofectin, lipofectamine, DOGS (transfectum), DOPE, DOTAP, DDAB, DHDAB, HDAB, polybrene, or poly (ethyleneimine) (PEI) Polysaccharides such as schizophyllan (SPG) can be used. When a retrovirus is used as an expression vector, retronectin, fibronectin, polybrene, or the like can be used as an introduction reagent.

  When using schizophyllan, the target cell preferably expresses Dectin-1. This is because the schizophyllan / nucleic acid complex is taken up by Dectin-1 (Gene Ther., 22: 217-26 (2015); Bioconjugate Chem. 22: 9-15 (2011)). Dectin-1 expression can be confirmed by an immunological technique such as Western blotting, flow cytometry, and immunohistochemical staining with an antibody that specifically recognizes Dectin-1.

  Examples of the dosage unit form of the pharmaceutical composition of the present invention include liquids, tablets, pills, drinking liquids, powders, suspensions, emulsions, granules, extracts, fine granules, syrups, soaking agents, decoctions, and eye drops. , Lozenges, poultices, liniments, lotions, ointments, plasters, capsules, suppositories, enemas, injections (solutions, suspensions, etc.), patches, ointments, jelly, pasta Examples include agents, inhalants, creams, sprays, nasal drops, aerosols and the like.

  The content of the nucleic acid or expression vector of the present invention in the pharmaceutical composition is not particularly limited and is appropriately selected over a wide range, and is, for example, about 0.01 to 100% by weight of the whole pharmaceutical composition.

  The concentration of the nucleic acid or expression vector of the present invention in the pharmaceutical composition is not particularly limited and is appropriately selected within a wide range. For example, it is about 0.01 nM to 1 M, preferably 0.1 nM of the whole pharmaceutical composition. Or 10 mM, more preferably 1 nM to 100 nM.

  The pharmaceutical composition of this invention is administered by the method according to various forms in the case of the use. For example, in the case of an external preparation, it is sprayed, affixed or applied directly to the required site such as the skin or mucous membrane, and in the case of tablets, pills, drinking liquids, suspensions, emulsions, granules and capsules, it is administered orally. In the case of an injection, it is administered intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, intraperitoneally or intratumorally, and in the case of a suppository, it is administered intrarectally.

  The dosage of the pharmaceutical composition of the present invention includes the activity and type of the active ingredient, the mode of administration (eg, oral and parenteral), the severity of the disease, the animal species to be administered, the drug acceptability of the administration target, the body weight The amount of active ingredient per day for an adult is usually about 0.001 mg to about 2.0 g, although it varies depending on the age and the like.

  The pharmaceutical composition of the present invention usually allows the nucleic acid or expression vector of the present invention to be delivered to a target cell (eg, cancer cell, neovascular endothelial cell (eg, tumor neovascular endothelial cell)). In addition, it is safely administered to humans.

  As shown in Examples described later, when the expression of YB-1 in cancer cells is suppressed by the nucleic acid of the present invention, the survival rate of the cancer cells decreases. Therefore, the pharmaceutical composition of the present invention is useful as a pharmaceutical composition for inducing cancer cell death. By administering an effective amount of the nucleic acid or expression vector of the present invention to a target human, cancer cell death in the human can be induced. If cell death can be induced in cancer cells, formation of cancer tissues can be prevented, and existing cancer tissues can be degenerated / erased. Cancer can be treated and prevented by using the pharmaceutical composition for inducing cancer cell death of the present invention. Therefore, the pharmaceutical composition of the present invention is useful for cancer treatment / prevention. By administering an effective amount of the nucleic acid or expression vector of the present invention to a target human, cancer in the human can be treated or prevented.

  Further, as described in JP 2011-088876 A, when the expression of YB-1 is suppressed, the proliferation of vascular endothelial cells (particularly, proliferation dependent on vascular endothelial growth factor) is inhibited. Furthermore, YB-1 is specifically expressed in tumor neovascular vascular endothelial cells. Accordingly, the pharmaceutical composition of the present invention is a pharmaceutical composition for inhibiting angiogenesis (or a pharmaceutical composition for inhibiting vascular endothelial cell proliferation), particularly for inhibiting angiogenesis of tumor blood vessels (or a pharmaceutical composition for inhibiting vascular endothelial cell proliferation). Useful as. By administering an effective amount of the nucleic acid or expression vector of the present invention to a target human, angiogenesis (for example, neovascularization of tumor blood vessels) in the human is inhibited, or vascular endothelial cells (for example, vascular endothelial cells of tumor blood vessels). ) Cell growth can be inhibited. YB-1 is also expressed in tumor cells, is involved in drug resistance and growth of tumor cells, and it is known that tumor cell growth is inhibited when YB-1 expression is suppressed. Therefore, the agent of the present invention is also useful as a pharmaceutical composition for inhibiting the growth of tumor cells and tumor vascular endothelial cells (preferably a pharmaceutical composition for inhibiting the growth of tumor cells and neovascular vascular endothelial cells). An effective amount of the nucleic acid or the expression vector of the present invention is administered to a target human and tumor cells and tumor vascular endothelial cells (preferably tumoriogenesis) are preferably suppressed by suppressing the expression of YB-1 in tumor cells and tumor vascular endothelial cells. It is possible to inhibit the proliferation of both (vascular endothelial cells).

  The cells (eg, cancer cells, vascular endothelial cells) to which the nucleic acid or expression vector or pharmaceutical composition of the present invention is applied are cells that express human YB-1.

  “Tumor blood vessel” means a blood vessel present in tumor tissue. “Tumor neovascularization” means a blood vessel that exists in a tumor tissue and is formed by branching off from an existing vasculature and renewing.

  The type of tumor to which the pharmaceutical composition of the present invention can be applied is not particularly limited as long as it is a solid tumor. Examples of the tumor include glioblastoma, esophageal cancer (preferably esophageal squamous cell carcinoma), gastric cancer (preferably gastric adenocarcinoma), colon cancer (preferably colon adenocarcinoma), lung cancer (preferably non-small cell lung cancer). More preferably lung adenocarcinoma), renal cancer, thyroid cancer, parotid gland cancer, head and neck cancer, bone / soft tissue sarcoma, ureter cancer, bladder cancer, uterine cancer, liver cancer, breast cancer, ovarian cancer, fallopian tube cancer, etc. Can be mentioned. The tumor is preferably glioblastoma, esophageal cancer (preferably esophageal squamous cell carcinoma), gastric cancer (preferably gastric adenocarcinoma), colon cancer (preferably colon adenocarcinoma) or lung cancer (preferably non-small cell lung cancer). And more preferably lung adenocarcinoma). Most preferred is lung cancer (preferably non-small cell lung cancer, more preferably lung adenocarcinoma).

  The contents of all publications, including patents and patent application specifications cited in this specification, are hereby incorporated by reference herein to the same extent as if all were explicitly stated. Is.

  EXAMPLES Hereinafter, although an Example is shown and this invention is demonstrated more concretely, this invention is not limited at all by the Example shown below.

[Example 1]
(Materials and methods)
Design of YBX1 antisense DNA oligonucleotide
Based on the nucleotide sequence of YBX1 mRNA, 153 types of 25-base single-stranded DNA antisense oligonucleotides were prepared (Table 1-1 to Table 1-6).

  The 153 types of single-stranded DNA antisense oligonucleotides were prepared so that adjacent DNA oligonucleotides overlapped by 15 bases (FIG. 1).

  Lung cancer cells PC9 cells were seeded at 1,000 cells in a 96-well plate. After 24 hours, 3 wells were transfected with each DNA oligonucleotide. To each well, 50 nM YBX1 antisense DNA oligonucleotide, 0.4 μL of transfection reagent (RNAiMAX) (Life Technologies), and 120 μL of medium were added. 72 hours later, 10 μL of Cell Counting Kit 8 (Dojindo, Tokyo, Japan) was added and WST8 assay was performed. Taking the cell viability of the control DNA oligonucleotide as 1, the average and standard deviation of each YBX1 antisense DNA oligonucleotide was quantified.

  100,000 of the PC9 cells were solubilized with lysis buffer containing 50 mM Tris / HCl (pH 8.0), 1 mM EDTA, 120 mM NaCl, 0.5% Nonidet P-40, and 1 mM PMSF. The lysate is centrifuged at 21,000 g for 10 minutes at 4 ° C., and the supernatant (25 μg) is separated by 10% (w / v) SDS polyacrylamide gel electrophoresis, followed by PVDF microporous membrane (Millipore, Bedford, MA , USA). The membrane was immunoblotted with anti-YB-1 antibody (Cancer Research 1999; 59: 342-346) 1: 10,000 or anti-β-actin antibody (A5441, Sigma Aldrich, MO, USA) 1: 10,000 for 1 hour to bind HRP Incubated with anti-rabbit Ig antibody or anti-mouse Ig antibody for 40 minutes. Detection was performed using enhanced chemiluminescence (Amersham, Piscataway, NJ, USA). Protein expression levels were numerically evaluated using Multi Gauge Version 3.0 (Fujifilm, Tokyo, Japan) (FIG. 3).

Results Table 2 shows the cell viability for each YBX1 antisense DNA oligonucleotide. Four types of YBX1 antisense DNA oligonucleotides (AS014, AS025, AS101, AS030) reduced cell viability to 1/3 or less (FIG. 2, Table 2). In FIG. 2 and Table 2, the cell viability when the control oligonucleotide (Ctrl) is introduced is 1.

  Four types of YBX1 antisense DNA oligonucleotides (AS014, AS025, AS101, AS030) reduced the expression level of YB-1 from 50% to 20% (FIG. 3).

Consideration
Four YBX1 antisense DNA oligonucleotides that suppress the expression level of YB-1 and reduce the survival rate of cancer cells to 1/3 or less were identified. Many of the cancer cells have high expression of YB-1, low expression in normal cells, and suppression of YB-1 suppresses cancer cell growth and induces cell death. Antisense DNA oligonucleotides are considered effective for cancer treatment.

[Example 2]
2.1. Preparation of antisense oligonucleotide sequence for YB-1
YB-1 mRNA (NM_004559.3) consisting of 1561 bases was obtained from the NCBI database. In order to identify sequences with a high antisense effect, 153 types of oligonucleotides (AS001-AS153) having a length of 25 bases were prepared. Designed so that the base shifted from the 5 ′ end of AS001 by 10 bases downstream becomes the 5 ′ end of AS002, and all sequences are shown in FIG.

2.2. Complex formation with SPG
SPG (average molecular weight, 4.5 × 10 ⁵ ) was provided by Mitsui Sugar Co., Ltd (Tokyo, Japan). This is the same SPG used in other DDS studies. We prepared AS-ODNs / SPG complexes using phosphorothioate AS-ODNs for YB-1 with SPG and (dA) 40 added to the 3 'end. All phosphorothioate oligonucleotides, including dA40 nucleotides with AS-ODNs and Alexa546 added, were synthesized by GeneDesign Co., Ltd (Osaka, Japan) and purified by high performance liquid chromatography. SPG was soaked in a solution of 0.25N NaOH (aq) for 2-5 days to dissociate the triple helix into a single strand. SPG solution, AS-ODNs in H ₂ O and phosphate buffered saline (330 mM NaH ₂ PO ₄ , pH 4.7) are mixed, then the mixture (60 μM AS-ODNs, pH 7.4) Was stored at 4 ° C. overnight.

2.3. Lung cancer cell lines The following 12 lung cancer cell lines were used: B203L, PC9, A110L, A549, H1299, QG56, SQ1, B1203L, PC10, 904L, PC1, A529L. The characteristics of these cells have already been reported. All cell lines were cultured in RPMI 1640 medium and maintained at 37 ° C. in a 5% CO ₂ environment.

2.4. Assessment of cell viability by water-soluble tetrazolium salt-8 (WST-8) analysis Cell viability analysis has been described in previous papers. Briefly, PC9 cells (1 × 10 ³ ) were seeded in 96-well plates and 24 hours later AS-ODNs were transiently introduced into the cells using 0.4 μl RNAiMax. The final concentration of AS-ODNs was 50 nM in 120 μl of culture medium. For AS-ODNs / SPG complexes, these were added directly to the medium. After 96 h, surviving cells were stained with TetraColor ONE for 2-3 hours at 37 ° C. according to the manufacturer's instructions and measured at an absorbance of 450 nm.

2.5. Uptake cells (2.5 × 10 ⁴ ) of FITC-added SPG and Alexa546-added dA40 nucleotide / SPG complex were seeded in 24-well plates and cultured at 37 ° C. under 5% CO ₂ . Cells were cultured in RPMI-1640 containing 10% FBS, 100 U / ml penicillin, 0.1 mg / ml streptomycin. After 24 hours, 0.1 μM FITC-added SPG (FITC-SPG) or 0.5 μM SPG and Alexa546-added dA40 nucleotide complex (A546-dA40 / SPG) was added to the cells in the presence of serum. After 8 hours, the cells treated with FITC-SPG were observed with an EVOS® FL imaging system after washing twice with PBS. In competitive analysis, 6 hours after administration of 0.5 μM A546-dA40 / SPG simultaneously with 0.5 μM A546-dA40 / SPG complex of 10 μM dA40 nucleotide and SPG (20-fold excess in dA40 / SPG complex) without fluorescence And then observed with an EVOS® FL image processing system.

2.6. Western blot analysis
PC9 cells were suspended in a lysis buffer consisting of 10 mM Tris-HCl (pH 7.9), 150 mM NaCl, 0.5% NP40, and 1 mM PMSF, and treated with an ultrasonic crusher for 10 seconds. Whole cell extracts (2.5, 5, 10 μg) were separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane. The transfer membrane was immunoblotted with anti-YB-1 antibody diluted 1: 10,000 and anti-β-actin antibody diluted 1: 10,000 (A5441; Sigma-Aldrich) for 1 hour. Next, it was treated with HRP-conjugated anti-rabbit IgG or anti-mouse IgG for 40 minutes. The signal was detected by chemiluminescence (GE healthcare, Tokyo, Japan), and the expression level was analyzed by Multi Gauge Version 3.0 (Fujifilm, Tokyo, Japan).

Results and discussion
3.1. Selection of antisense sequence
The effect of all AS-ODNs transfected into PC9 cells on cell viability is shown in FIG. This is an in vitro screen to assess cell viability. We used RNAiMax reagent (Lipofectamine transfection reagent) for introduction into cells. The RNAiMax reagent is a cationic liposome formulation and forms a complex with negatively charged DNA or siRNA. Such a complex can allow the bound DNA or siRNA to enter the cytoplasm. YB-1 is overexpressed in PC9 cells, and the decrease in cell viability is thought to be due to YB-1 silencing by AS-ODNs. Furthermore, each difference in cell viability is associated with the silencing effect of individual AS-ODNs. The five most effective sequences are indicated by arrows. Four AS-ODNs other than AS101 (AS010, AS014, AS025 and AS030) decreased cell viability to less than 1/3 and were close to the start codon (FIG. 7; positions AS014, AS025, AS030) , Shown for AS101).

  The recruitment of RNaseH1 to antisense DNA / mRNA duplexes is widely considered to be a key step in protein silencing. In order to facilitate the binding of antisense DNA, it is required that the binding site of mRNA be a single strand and that the binding site should face outward, but there are few such sites on the mRNA. The bulge loop structure of YB-1 mRNA was estimated using UNAfold. The results are shown in FIG. The binding sites for the four AS-ODNs are shown by solid lines. All AS-ODNs binding sites contain a loop structure. Thus, these loops are thought to be important for YB-1 silencing. Therefore, it is expected that RNaseH1 is mobilized to a double strand in which a DNA strand and an mRNA strand are bound to cleave mRNA.

  The inhibitory effect of YB-1 expression on five AS-ODNs that strongly suppressed cell viability was compared. The result of Western blot analysis is shown in FIG. 8A. Four AS-ODNs (AS10, AS14, AS25 and AS30) reduced YB-1 expression to 50% or less of the control (FIG. 8B). From these results, it can be confirmed that the decrease in cell viability is caused by YB-1 silencing by transfection. The results of Western blot analysis show that AS014 and AS025 repress YB-1 expression very efficiently among AS-ODNs. Since AS014 was closest to the start codon region and showed a fairly good effect in both analyses, AS014 was used in subsequent analyses.

3.2. Delivery of AS-ODN complexed with SPG to target
SPG forms stoichiometric complexes with certain homonucleotides such as poly (C) and ploy (dA). Complex formation takes place via a combination of hydrogen bonding and hydrophobic interactions. Based on our previous work, dA40 was added to AS-ODN and complexed with SPG to provide effective gene silencing. When the position where dA is added is at the 3 'end of AS-ODNs, the phosphorothioate linkage forms a more stable complex than that of the phosphodiester. We therefore added phosphorothioate dA40 to the 3 ′ end of AS014 to form a complex with SPG. The exact stoichiometric composition is [mG]: [dA] = 2: 1 (mG is the main chain glucose). However, in reality, a complex is prepared with a ratio composition in which SPG is larger than that. The AS014-dA40 / SPG complex used in this analysis was prepared with [mG]: [dA] = 4: 1. At this time, the signal of AS014-dA40 alone was not observed by gel electrophoresis (FIG. 9).

  We have previously reported that the complex is taken up by Dectin-1 expressed in immune cells. Recently, a binding affinity analysis was performed between a protein in the extracellular region of mouse Dectin-1 and an SPG / DNA complex using a quartz crystal microbalance. Phosphorothioate dA40 dramatically enhanced binding affinity with Dectin-1 compared to phosphodiester. In addition, the Dectin-1 mutant in which the Trp221 and His223 residues in the 3 'end exon were substituted with alanine showed different binding affinities. There appeared to be multiple binding sites, with the same sites as SPG and additional sites that were mainly involved in phosphate anion-specific electrostatic interactions. The enhanced affinity of the phosphorothioate DNA / SPG complex is another reason that encourages its use in this experiment.

  FIG. 10 shows the results of evaluating cell viability by treating 0.4 or 1.0 μM AS014 / SPG complex with various lung cancer cells. There are over 200 known lung cancer cell lines, from small cell lung cancer to non-small cell lung cancer, exceeding the number of other common epithelial cancers. We selected 12 lung cancer cell lines available among them. The decrease in cell viability rate by administration of AS014 / SPG complex was indefinite. All these cells expressed YB-1 at a high level and were retested in this study (data not shown). The decrease in cell viability is due to the number of AS014 molecules taken up into the cell and bound to YB-1. However, it is unclear whether cells with reduced cell viability express Dectin-1. This issue is currently being analyzed. The cells with the greatest decrease in cell viability were B203L cells, PC9 cells, B1203L cells and PC10 cells (FIG. 10A). The AS014 / SPG complex reduced YB-1 expression by approximately 40% in PC9 cells but not in A549 cells (FIG. 10B). This result is consistent with the cell viability assessment (FIG. 10A). We observed B203L cells and PC9 cells whose cell viability decreased with AS014 / SPG complex, and SPG with FITC added to A549 cells and PC1 cells that did not decrease, and then observed with a fluorescence microscope. SPG was actively taken up by B203L cells and PC9 cells, but not A549 cells or PC1 cells (FIG. 11A). These results are consistent with cell viability results. That is, it can be said that the difference in the effect of the antisense DNA due to the difference in the cell line reflects the difference in the uptake of the antisense DNA / SPG complex due to the difference in the cell line. Furthermore, it was observed that A546-dA40 / SPG was also taken up by PC9 cells (FIG. 11B). This uptake was partially abolished by administration of the non-fluorescent dA40 / SPG complex (FIG. 11C). As previously mentioned, the expression of Dectin-1 in these cells is currently under analysis. Although the expression of Dectin-1 is unresolved, it can be concluded that B203L and PC9 cells take up AS014. That is, Dectin-1 facilitates recognition of AS014 / SPG complex. Furthermore, these results suggest that AS014 suppressed YB-1 expression, resulting in decreased cell viability.

  According to the present invention, a nucleic acid capable of specifically and effectively suppressing the expression of YB-1 and a pharmaceutical composition containing the nucleic acid are provided. Since cancer cell death can be induced by suppressing YB-1 expression, the pharmaceutical composition of the present invention is useful for inducing cancer cell death and thus for treating or preventing cancer. Moreover, since YB-1 is specifically expressed in vascular endothelial cells of tumor neovascularization and not or hardly expressed in vascular endothelial cells of normal tissue or inflamed tissue, the pharmaceutical composition of the present invention is used for inhibiting angiogenesis. Particularly useful for the selective inhibition of angiogenesis in tumor tissue. Moreover, since YB-1 is known to be related to drug resistance and proliferation of tumor cells, the angiogenesis inhibitor of the present invention results in simultaneous growth inhibition of both tumor cells and tumor vascular endothelial cells. And is useful as an excellent antitumor agent.

  The present invention is based on a Japanese patent application filed on April 1, 2015, Japanese Patent Application No. 2015-075292, the entire contents of which are included in the present specification.

Claims (13)

A nucleic acid having a nucleotide sequence of any of the following (A) to (D) and having a human YB-1 translation inhibitory activity, having a length of 50 nucleotides or less:
(A) a nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(B) a nucleotide sequence in which one or two bases are deleted, substituted, inserted, or added in the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5;
(C) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by any of SEQ ID NOs: 2 to 5; and (D) any nucleotide sequence selected from (A) to (C) A contiguous subsequence of at least 16 nucleotides in length.   The nucleic acid according to claim 1, comprising a nucleotide sequence represented by any one of SEQ ID NOs: 2 to 5.   An expression vector for expressing the nucleic acid according to claim 1 or 2.   A pharmaceutical composition comprising the nucleic acid according to claim 1 or 2 or the expression vector according to claim 3.   The pharmaceutical composition according to claim 4, which is used for treatment or prevention of cancer.   The pharmaceutical composition according to claim 4, which is used for inducing cancer cell death.   The pharmaceutical composition according to claim 5 or 6, wherein the cancer expresses human YB-1.   The pharmaceutical composition according to any one of claims 5 to 7, wherein the cancer is lung cancer.   The pharmaceutical composition according to claim 8, wherein the lung cancer is non-small cell lung cancer.   The pharmaceutical composition according to claim 4, which is used for inhibiting angiogenesis.   The pharmaceutical composition according to claim 10, which is used for inhibiting angiogenesis of tumor blood vessels.   The pharmaceutical composition according to claim 4, which is used for inhibiting the growth of tumor cells and tumor vascular endothelial cells.   The pharmaceutical composition according to claim 12, wherein the tumor is lung cancer.