WO1998048843A1

WO1998048843A1 - Method of treating hiv infection and related secondary infections thereof

Info

Publication number: WO1998048843A1
Application number: PCT/US1998/008357
Authority: WO
Inventors: Arsinur Burcoglu
Original assignee: Arsinur Burcoglu
Priority date: 1997-04-28
Filing date: 1998-04-28
Publication date: 1998-11-05
Also published as: CA2259041A1; HK1044896A1; AU754242B2; EP1202750A1; AU7160998A; EP1202750A4

Abstract

Defibrotide including its nucleic acid components and the variants thereof can be used to treat various disease conditions. Such therapeutic compounds can also be administered in combination with other nucleic acids and peptides.

Description

METHOD OF TREATING HIV INFECTION AND RELATED

SECONDARY INFECTIONS THEREOF

This application is a continuation-in-part of application Serial No. 08/185,416, filed January 24, 1994, which is a continuation-in-part of application Serial No. 08/002,395, filed January 13, 1993, which is a continuation-in-part of

application Serial No. 07/748,277, filed August 21, 1991, and application Serial No.

07/830,886, filed February 4, 1992 which is a continuation-in-part of application

Serial No. 07/815,130, filed December 27, 1991.

FTELD OF INVENTION

The present invention relates to a method of administering 1) the nucleic

acid components identified in defibrotide or the variants thereof, 2) the nucleic acid

components identified in defibrotide or the variants thereof in combination with

sequence specific oligonucleotides, 3) the nucleic acid components identified in defibrotide or the variants thereof in combination with amino acids or other protein factors, 4) oligonucleotides containing homologous sequences of HIV and cellular

regulatory factors or the variants thereof, 5) the nucleic acid components identified

in defibrotide or the variants thereof in combination with 4), or 6) sequence non¬

specific oligonucleotide to treat various disease conditions including HIV infection and its related diseases. The present invention discloses oligonucleotides and vectors which can be used as therapeutic compounds according to the invention.

The present invention also relates to a treatment of drug resistance.

BACKGROUND OF THE INVENTION

Defibrotide is a polyanion salt of a deoxyribonucleic acid obtained from

mammalian tissue. Defibrotide is a single-stranded polydeoxyribonucleotide with

molecular weight of approximately 20 kDa (low molecular weight form) which

may be obtained from bovine lung DNA by controlled hydrolysis. Patents

related to its manufacture include U.S. Patent 3,770,720 directed to a process for

extracting DNA from mammalian tissue, and U.S. Patent 3,899,481 directed to a

process for the controlled partial degradation of DNA extracted from animal

organs.

Experimental studies have been performed to investigate the active

component of defibrotide. U.S. Patent 3,770,720 discloses that the components of

defibrotide include phosphorus 8.5%, Na 9.0%, N 14.0%, deoxyribose 23.2%, total

bases 34.0%, guanine 9.4%, thymine 9.4%, adenine 9.2%, cytosine 6.0%, uracil

absent, Iodine, and Zinc.

Bracht et al., (Biochem. and Biophys. Res. Com., vol. 200, No.2, 1994, pp.933-937) have disclosed four aptamer sequences derived from the unfractionated

defibrotide DNA precursor molecule. Two aptamers

(5'-GGTTGGATTGGTTGG-3' and 5'-GGTTGGATCGGTTGG-3') were

identified by thrombin chromatography. Another aptamer (5'-GGATGGATCGGTTGG-3') was found in the PCR product from the double- stranded DNA precursor. The sequence of such aptamer was used to search the EMBL data base and was found in the bovine genome and Angiotensin II- ATI receptor. The three aptamers were found to have inhibitory activities of thrombin induced platelet aggregation, thromboxane biosynthesis, increase in

cytosolic Ca ++, and fibrin clot formation. In addition, there is a non-function

aptamer (5'GGTGGTGGTTGTGGT3*) which did not display any of the activities

characteristic of defibrotide.

HTV infection is characterized by a progressive decline in immune system

function, suppressing the infected host's ability to overcome other, secondary

infection. No cure has been found for HIV infection. The pathogenetic process in HIV infection is never unidimensional but, rather, extremely complex and multifactorial. The pathogenic progression may be only tangentially related to the direct infection of a given target cell. Death is almost inevitable, usually from an

overwhelming secondary infection and or HTV related neoplasm.

Current treatments for HIV infection attempt to retard the progress of the

disease or relieve its symptoms. Treatment in use today include certain

dideoxynucleotides such as azidothymidine (AZT or zidovudine, Burroughs

Wellcome), dideoxyinosine (ddl, Bristol-Myers Squibb) or dideoxycytidine

(ddC, Hoffman-LaRoche). These agents can be toxic. Their applicability is

limited because of the appearance in some patients of onerous, and sometimes

lethal, side effects. These side effects include myelosuppression, peripheral

neuropathy, and pancreatitis. In some patients, AZT has lost its effectiveness

after prolonged use. While other drugs have been proposed for treatment of HIV M infection, including the recent introduction of several HTV protease inhibitors, none have yet been demonstrated to be completely effective. Therefore, there

remains a need in the art to develop additional therapeutic agents to treat HIV infection. In particular, there is a need in the art to further identify the active components of defibrotide and their applications in various disease conditions. SUMMARY OF THE INVENTION

It is an object of the invention to provide a method useful in treating a

disease condition in a patient, such as infectious diseases, genetic diseases,

degenerative diseases, DNA damage, neoplasia, and skin diseases.

To accomplish this objective, the invention provides a method of

treatment comprising administering to a patient an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but

not including defibrotide.

Preferably, the method is practiced in a marker dependent manner, which method of treating a disease condition comprises:

(a) determining the initial state of a set of disease markers, the

disease markers being observable characteristics of a patient which deviate from

the normal condition due to the disease state and wherein each disease marker in

the set has a predetermined reference range which is indicative of the normal condition,

(b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including

defibrotide, (c) screening a panel of second messengers and signal

transducers and selecting a repair marker, the intensity of which increases

following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, the repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein

kinase A, protein kinase C, or G-protein,

(d) administering the therapeutic compound at a dose level incrementally higher than the previous dose,

(e) repeating step (d) each time the intensity of the repair

marker increases following an incrementally higher dose,

(f) repeating steps (d) and (e) until the intensity of the repair

marker in step (c) no longer increases,

(g) administering the therapeutic compound at the highest dose

level attained in step (f) until the intensity of the repair marker returns to the normal condition, and

(h) administering the therapeutic compound at a dose level

incrementally higher than the previous dose and repeating steps (c), (d), (e), (f)

and (g) with one or more additional repair markers until all disease markers of

the set of disease markers no longer deviate from the normal condition.

The patient is monitored weekly for three or more weeks. If relapse

occurs, as indicated by a deviation of one or more disease and/ or repair markers from the normal level, therapy is reinitiated at the highest dose level of the prior course of therapy until normalization is again reached.

In a particularly preferred embodiment of the invention, the method of

treating a disease condition comprises the steps of:

(a) determining the initial state of a set of disease markers, the

disease markers being observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a predetermined reference range which is indicative of the normal condition,

(b) administering to the patient a dose of a therapeutic

compound comprising a nucleic acid component of defibrotide, but not including

defibrotide, wherein the dose of the therapeutic compound is at a level which

raises a universal marker to at least five times its normal level, the universal

marker being a constitutively expressed molecule which is transcriptionally

activated by the therapeutic compound in all disease status, and

(c) continuing to administer the therapeutic compound at the

dose level of step (b) until the universal marker returns to its normal level.

The invention also provides a method of treating a disease condition via administering a nucleic acid component of defibrotide with a sequence specific

nucleic acids corresponding specifically to selected parts of the viral genome or

transcriptional factors.

The invention contemplates treating HIV infection in which HIV is not

expressed and wherein the concentration of at least one immunological molecule, such as CD4, CD25, IL-1, IL-3, IL-4, IL-6, TNF and sIL2R, is followed. The method comprises:

(a) administering to the patient an effective amount of a

therapeutic compound comprising a nucleic acid component of defibrotide, but

not including defibrotide, wherein the effective amount is the amount which

causes a universal marker to rise at least five times its normal level, the universal marker being the concentration of a constitutively expressed molecule which is transcriptionally activated by the therapeutic compound in all disease states, and

(b) continuing to administer the effective amount of the

therapeutic compound until the universal marker returns to its normal level.

The present invention identifies the active components of defibrotide and the variants thereof. The present invention also provides therapeutic

oligonucleotides. Such therapeutic compounds can be used to treat various

disease conditions.

BRIEF DESCRIPTION OF DR WINGS

Figure 1 is a diagram schematically illustrating a preferred embodiment of the invention.

Figure 2 is a graph showing normal peripheral blood cells labelled with 0,

10, 20 and 40 μg defibrotide-biotin combination.

Figure 3 shows the data of Figure 18 on a linear scale.

Figure 4 is a graph showing the lymphocyte uptake of defibrotide without

biotin and labelled with Cy5.18. ? Figure 5 is a graph showing the monocyte uptake of defibrotide without

biotin and labelled with Cy5.18.

Figure 6 is a graph showing the granulocyte uptake of defibrotide without

biotin and labelled with Cy5.18.

Figure 7 is a graph showing the percent expression of HIV viral proteins

remaining when blood lymphocytes of an HIV infected individual were exposed

to various doses of defibrotide with and without Con- A stimulation.

Figure 8 is a graph showing the laboratory response expressed in terms of

mean linear fluorescence intensity of the peripheral blood mononuclear cells of

an HIV infected individual, the cells being subjected in vitro to varying levels of

defibrotide using a cell culture assay technique with and without Con-A

stimulation.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a method for the clinical applications of

therapeutic compounds including 1) the nucleic acid components identified in

defibrotide or the variants thereof, 2) the nucleic acid components identified in

defibrotide or the variants thereof in combination with sequence specific

oligonucleotides, 3) the nucleic acid components identified in defibrotide or the

variants thereof in combination with amino acids or other protein factors, 4) oligonucleotides containing homologous sequences of HIV and cellular regulatory

factors or the variants thereof, 5) the nucleic acid components identified in

defibrotide or the variants thereof in combination with 4), and 6) sequence non¬

specific oligonucleotides. The therapeutic compounds described in the present invention can be employed to treat various disease conditions including HIV infection and its related

diseases. Preferably, the therapeutic compounds described in the present invention are administered in a marker dependent manner. A "marker" is an

observable characteristic of a patient which may be observed directly by a

clinician or determined by diagnostic procedures. The state of an individual

marker is correlatable with the status of the disease or repair processes in the

patient. Dosing of the therapeutic nucleic acids according to the method of this invention is based on changes in the status of these markers as taught herein.

Treatment of various disease conditions including HIV and its related disease states in accordance with the preferred method of the invention involves

the administration of a therapeutic compound of the present invention at a daily

dose level sufficient to increase the intensity, determined as concentration or

clinical observation, of a marker of cellular repair processes ("repair marker") to

a plateau level (i.e., where the intensity of the marker is not changed by

continued administration of the therapeutic compound). This daily dose level is

the "maximum efficacious dose" for the particular disease and repair marker.

Administration of the therapeutic compound is continued at the same dose level until the repair marker stabilizes by returning to the normal level.

If at least one disease marker remains in an abnormal state, the daily dose

level of the therapeutic compound is increased. At least one other repair marker

will increase in intensity, and the daily dose level is increased until the intensity

of the new marker reaches a plateau level. Administration of the therapeutic 1G compound is continued at this new maximum efficacious level until the respective repair marker stabilizes at the level and proportion assessed in normal laboratory controls.

When all disease markers have returned to the level of the normal state, administration of the therapeutic compound is discontinued, but the levels of the

disease and repair markers are monitored every three weeks, for an additional 3 -

6 months. If the levels of all markers remain at their normal state, cure has been achieved. If any marker deviates from normal at the end of any three week

period, administration of the therapeutic compound is resumed at the highest

"maximum efficacious dose" that has been used during the immediate prior

treatment, and the new maximum effective dose is established by the known methodology.

The term "maximum efficacious dose" is defined herein as the daily dose

rate, that will elicit, in nearly 100% of treated patients, the reversal of the

respective disease markers to the uniformly normal level, and establishment of

normal cellular markers. The maximum efficacious dose is usually expressed as

amount of therapeutic compound administered per kilogram body weight per day (DKGD). The maximum efficacious dose represents a novel concept of

administering a pharmaceutical agent in therapeutic medicine.

The term "maximum therapeutic dose" is defined herein as the total

cumulative dose (the daily dose summed over the duration of administration) that

will elicit in nearly 100% of treated patients the irreversible and complete \i normalization of the respective disease markers and resumption of normal cellular functions, i.e. , the state of cure.

The term "minimum efficacious dose" is used herein to refer to the dose used in the heretofore universal practiced method of administering a

pharmaceutical agent. The minimum efficacious dose is the dose (daily dose or

steady state level) that will elicit a particular pharmaceutical action in a certain percentage of patients, without inducing the pleiotropism of the whole repair process.

Pharmacological agents have heretofore been administered at set dose

levels (i.e., the "minimum efficacious dose") to treat the gross pathology and

discontinued when complete or partial remission of the gross pathology was achieved. Treatment according to the preferred method of this invention begins at the gross pathology stage which has one or more associated markers.

Normalization or improvement of those markers indicate that the treatment is

beneficial. However, such a remission is not the event which causes

discontinuation of therapy in accordance with this invention. Normalization of

the markers of gross pathology indicates, rather, that a disease state

corresponding to a lower level of disease activity has been reached. Markers of

that stage (i.e. , the lower level of disease activity) are identified and treatment is

continued to normalize those markers. Complete cure is reached only if all

stages of the revival process are treated.

The term "maximum tolerable dose," as used herein, is defined as the

highest daily dose that can be administered without any complications, e.g. , no bleeding complications or thrombopathy, etc. This in fact has been the sole and primary side effect of the high-molecular weight nucleic acid (defibrotide)

utilized in the studies reported herein, i.e., the antithrombotic effect inducing

bleeding complications at 300 mg/kg/day dose or above. If the maximum efficacious dose should be higher than the maximum tolerable dose, chemical modification of the nucleotide for more efficacious transmembrane transport and cellular entry would be necessary.

It has been determined that the therapeutic compound will not indefinitely

increase transcriptional activity with increasing doses. In this regard,

transcriptional activity will shut off when the repair molecules are no longer

needed, i.e. , when no more "injury signal" is transmitted via stimulation of

adenylate cyclase, second messengers, etc. In contrast, no matter how high the

dose range in the normal individual may be, there is no induction of

transcriptional activity (as indicated by, e.g. , elevation in the von Willebrandt antigen (vWAg) levels). This supports the fact that no complications are seen with therapy using nucleotides which modulate cellular repair mechanisms for a

therapeutic effect. For example, tissue plasminogen activator antigen (AgTPA)

will not continue to rise indefinitely with increasing doses but will increase only

in the presence of injury and at the locality of the injury, e.g. , the existence of a

thrombus which inevitably will be associated with the endothelial cell of the

locality specific lesion. Hence no bleeding complications are to be seen

secondary to systemic induction of the therapeutic compound at physiological dose ranges beyond the upper limits of the prior art thrombolytic therapy. This mechanism is supported by the way the cell modifies activation of the repair process. As is well known, 50% occupation of cell surface receptors

will lead to 50% increase in the baseline level of intracellular cAMP, 100%

occupation of cell surface receptors will lead to a 100% increase in the intracellular cAMP level. This will correspond to 5 times the elevation of the baseline vWAg level. Phosphorylation of various different transcriptional factors

simultaneously will lead to concurrent tissue specific turning on or off of the

respective transcriptional factors, e.g. , some molecules are turned on and some

are turned off. This constitutes the pleiotropism of the nucleic acids as herein defined. Treatable Disease States

Various disease conditions including HIV infection and its related diseases

characterized by injury-based alteration in the production, expression or activity

of compounds whose production, expression or activity is regulated by the cell at least in part through 1) cell surface receptors such as Adenosine Ai and A₂, collagen, thrombin, epinephrin and norepinephrine receptors, 2) through the

protein kinase A, protein kinase C, phosphorylation, or receptor tyrosine kinase

pathway, 3) through cytokine-receptor superfamily and regulatory factors

encoded by oncogenes, or by 4) protein factors whose phosphorylation affects

genomic translation and transcription may be treated with the therapeutic

compounds of the present invention in a marker dependent manner as described

herein. Treatable disease states include 1) infectious diseases such as HIV

infection, Protozoa infection, Schistosima infection, Schistocerca Leishmania

infection, e.g., Schistosoma japonicum infection, Trypanazoma infection, e.g., Trypanozoma Cruzi infection, fungus infection, e.g. , Candida tropicalis and

Candida Albicans, Aspergillus infection, Pneumocystis carinii infection, Malaria,

Plasmodium vivax, gram negative bacterial infection, Cytomegalovirus infection,

Hepatitis virus infection, human papilloma virus infection; 2) genetic diseases such as Duchenne's Muscular Dystrophy, Down's Syndrome; 3) degenerative diseases such as encephalopathy, dementia, Alzheimer's disease, Parkinson's disease, neuropathy, cardiomyopathy, aging, Kearn's Sayre syndrome, retinitis

pigmentosa, ataxia, seizures, proximal muscle weakness, leber's hereditary optic

neuropathy, optic neuritis, radiation damage; 4) neoplasia such as lympho-proliferative diseases, lymphomas, Kaposi's sarcoma, pancreaotic cancer, neuroblastoma , leukemia, bladder carcinoma, breast cancer, skin cancer, lung

cancer, colon cancer, and 5) skin diseases such as molluscum contagiosum, bacillary angiomatosis, seborrheic dermatitis, psoriasis, Reiter's syndrome, insect bite reactions, Staphylococcal folliculitis, Eosinophilic folliculitis.

The methodology described herein has universal application within the scope of disease states characterized by the absence or inadequacy of one or more

of those cell functions which are normally regulated through the cellular

mechanisms listed above so long as the abnormalities in these cell functions are

yet still reversible. The methodology is also applicable to the disease states

characterized by acquired or genetic dismodulation, and/or transformation. Revival, institution or reinstitution of the normal state of those functions is, by definition, a state of cure. Revival of the normal cell functions can occur where

the diseased cell preserves the biological capacity for the physiologically predefined events of the cellular repair functions of the recovery process, if those

events are pharmacologically induced by the correct use of the therapeutic

nucleic acids. Complete cure is the therapeutic objective. The decisive factor in

the success of this therapeutic approach is not only the pharmaceutical agent, but how it is utilized. If the biological capacity for regaining normalcy is there, therapeutic failure is eliminated. This biologically predetermined potential for

cure is reproducibly and predictably obtainable, however, only by the correctly

determined iatrogenetically controlled dose levels, and duration of therapy. Incorrect dose administration leads to the therapeutically missed event of complete cure. Complete cure, however, is not possible if necessary dose levels

cannot be attained without complications such as bleeding or thrombopathy.

While the marker dependent dose methodology is universally applicable,

it has been surprisingly discovered that HTV, as well as associated opportunistic

secondary infections can be effectively treated with the therapeutic compounds

described in the present invention. Therapeutic Compounds

The therapeutic compounds contemplated in the present invention include

1) sequence non-specific oligonucleotide, 2) nucleic acid components of

defibrotide, 3) variants and derivatives of 2), 4) sequence specific nucleic acid in

combination with 2), 5) amino acids or protein factors in combination with 2), 6) oligonucleotides containing homologous sequences of HIV sequence and other genes encoding cellular regulatory factors.

Sequence non-specific oligonucleotides of the present invention is an oligomer or a polymer of deoxyribonucleotides or derivatives thereof. The

compound may be native or chemically synthesized, or a fragment of a native

polydeoxyribonucleotide. The compound has at least three nucleotide residues,

and may have up to about 250 residues. Preferably, the nucleotide compound

will have from about 15 to about 200 residues, more preferably from about 20 to

about 150 residues, most preferably from about 50 to about 75 residues. The

sequence of the nucleotide residues in the polymer is not critical, and may include interdisposed sense, anti-sense, non-sense or missense sequences. A therapeutic composition may contain polynucleotide molecules with varying numbers of residues within the range described above. The skilled worker will

be able to select an appropriate length (degree of polymerization) based on the

ability of the compound to penetrate the cell and on the ability of the compound

to cause a change in the level of various repair markers in accordance with the

method of this invention.

The nucleic acid compound will preferably be relatively resistant to ecto-

and endonucleases. The 3' OH of the terminal residue of the therapeutic

compound according to this invention may be phosphorylated or not, and the compound will still function without the need for intracellular phosphorylation.

The therapeutic compound according to this invention is a polyanion, and the

negative charge is balanced by counter ions. The counter ions may be alkali ι metal ions or alkaline earth ions, biologic amines or other suitable counter ions which do not interfere with treatment according to the method of this invention. Preferably, at least some of the counter ions are zinc ions. The amount of zinc,

however, may be increased either be directly incorporating zinc into the nucleotide compound or, alternatively, by administering zinc, e.g., in the form of a dietary supplement, along with the therapeutic nucleotide. Zinc containing

compounds may be coadministered with the nucleotide to obtain a ratio of from 2

- 20 zinc atoms per phosphate group or iodine atom.

Defibrotide may be obtained from mammalian tissues as described in

U.S. Patent 3,770,720 or obtained from commercial source, e.g. , CRINOS

Farmacobiologica S.p.A., Villa Guardia (Como), Italy. Any means known in the art may be used to analyze the nucleic acid components of defibrotide.

Usually, HPLC can be used to separate defibrotide into its nucleotide and

oligonucleotide components. For instance, in reversed-phase HPLC, defibrotide may be run on a Vydac C8 or C18 analytical HPLC column using a Rainin

HPLC system. The flow rate could be set at 1 ml min and the eluent can be

monitored at 260 nm and 280 nm wavelengths. Such column run may be carried

out isocratically using 0.1 TFA in water. In some runs, peaks can be collected

for subsequent mass spectrometry.

It is a discovery of the present invention that all defibrotide components

are eluted in approximately 8-10 peaks within 10 minutes. In order to identify

the nucleotide composition of defibrotide, the mono-, di-, tri- and cyclic

monophosphates of T, C, G, A, and U may be chromatographed under conditions identical to those used for defibrotide. If the retention time for a

purified nucleotide is superimposeable (±. 0.1 min) on a defibrotide peak, it can be taken as evidence for the putative presence of such nucleotide in defibrotide. Peaks collected from HPLC runs may be concentrated by vacuum evaporation and be analyzed in mass spectrometry. All mass spectra may be collected on a matrix assisted laser desorption ionization-time of flight (MALDI-TOF) Voyager

Biospectrometry Workstation (Perseptive BioSystems) and run in the negative ion

mode.

It is a discovery of the present invention that a simple HPLC C8 column

elutes with 0.1 % TFA in water provides the best separation of defibrotide

obtained through commercial source, i.e., Noravid (CRINOS Farmacobiologica

S.p.A., Villa Guardia, Italy). Defibrotide elutes from a C8 column in approximately 10 peaks with retention times between approximately 3 and 9 minutes. One of the peaks, i.e. , peak number 4 represents two 25-30 mer

oligonucleotide with molecular weight of about 8171.58 and 8433.75 Dalton,

respectively. Only routine experimentations are needed to sequence the two 25-

30 mers.

The nucleic acid components of defibrotide include all nucleotides and/or

oligonucleotides identified in defibrotide which include but are not limited to

dCTP, dATP, dGTP, dTTP, dAMP, dGMP, dCDP, dADP, ATP, AMP, CTP,

CMP, UTP, cyclic TMP, cyclic UMP, cyclic GMP, oligonucleotides containing

from 6 nucleotides to less than 60 nucleotides, aptamer #1 GGTTGGATTGGTTGG (SEQ ID NO: l), aptamer #2 GGTTGGATCGGTTGG (SEQ ID NO:2), aptamer #3 GGATGGATCGGTTGG (SEQ ID NO:3), and aptamer #4 GGTGGTGGTTGTGGT (SEQ ID NO:4), and two 25-30 mer

oligonucleotides with molecular weight of about 8171.58 and 8433.75 dalton respectively and identified via HPLC analysis as discussed above.

Any variant of the nucleic acid components can also be used as the

therapeutic compounds in the present invention. Variants include

oligonucleotides having complete or partial sequence homology with the oligonucleotides of defibrotide. Variants include nucleic acid fragment comprising the oligonucleotide sequences identified in defibrotide. For example

any DNA fragment containing the oligonucleotide sequence of defibrotide and

additional sequences at the ends of the oligonucleotide sequence is contemplated

in the present invention as a variant. Normally the number of additional nucleotides at the ends is from 1 to 100, preferably from about 5 to 50, more

preferaby from about 10 to 30.

The homology level may be at least from about 50% to about 70 % ,

preferably 80% to 90% , more preferably 95%. The homologous region may be

continuous or scattered through out a nucleotide fragment. For example, aptamer #1 of defibrotide (5'-GGTTGGATTGGTTGG-3') has complete and partial homology to several genomes, e.g., Schizosaccharomyces, pombe GATA-binding

region, and Streptococcus pneumonia Dpn I gene. Aptamer #2 of defibrotide

(5'GGTTGGATCGGTTGG-3') has homology to several genomes, e.g., Mycobacterium leprae cosmid B0462. Aptamer #4 of defibrotide (5'-GGTGGTGGTTGTGGT-3') has homology to various genomes, e.g., chicken liver cell adhesion molecule, human gelanin receptor mRNA, Schistosoma japonicum eggshell protein, Schistosoma japonicum

ESG-1 protein mRNA, human mRNA with TGG repeat clone 83, Schistosoma

japonicum ESG-2AA protein mRNA, Candida tropicalis POX9 gene, Candida Tropicalis cat gene, Schistocerca americana Antennapedia, chicken liver cell adhesion molecule, human papilloma virus type 20, homo sapiens mitochondrial genome, gorilla mtDNA, human mtDNA, human DNA sequence from cosmid

U157D, Leishmania major cosmid clone L2759, Plasmodiun vivax Serine repeat

antigen, P. clarkii mRNA, Trypanosoma cruzi mucin-like protein, L. major mRNA for surface antigen P2, Aspergillus aculeatus (clone PC1G1), Candida Albicans

DNA for MNT2 gene, E.Coli K-12 genome, Mouse amyloid beta precursor,

Candida Albicans topoisomerase type, human homolog of Drosophila spilicing

gene, E. Coli gcvh gene 3 'end, human Down Syndrome region of Chromosome, E.

Coli gcv operon gene sequence, Drosophila melanogaster receptor protein and

polyheamotic DNA, human Papilloma virus type 25 genomic, Drosophila melanogaster Zn finger, Pneumocystis carinii, Dystrophin associated protein of Duchenne's muscular dystrophy, ( Sequence 7 from US #5,449,616), and DNA

Polymerase (Sequence 14 from US # 5,556,772).

Variants of aptamer # 4 also include homologous sequences of HIV and

aptamer #4. For example, homologous sequences may be found in gag/pol, c-vif,

or env regions of HIV. Particular homologous sequences may be found on three

sites on gag/pol HIV genome region. The translation of the aptamer #4 region on «2

gag site is a peptide 'PEPTA", and the pol gene fragment translates the same DNA

sequence into 'TRANS. In a preferred embodiment, S-Oligo variants of aptamer

#4 are

1)5OGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCC

CTTG3', 2) 5ΑCCAGAGCCAACAGC3', 3) 5' CCTGGCCTTCCCTTG3 ^* .

Variants of aptamer #4 also include homologous sequences of a gene

encoding a cellular regulatory factor and aptamer #4. Examples of such

homologous sequences are listed in Table 1.

Table 1. Examples of Sequences Homologous to Aptamer #4

b 1-

»^ ^

Variants of aptamer #4 also include homologous sequences of mitochondrial DNA and aptamer #4. Aptamer #4 has 100 % homology to NADH Dehydrogenase

Subunit 6 at target site of 13741; homology of 86.6% to tRNA glu. at target site of

14101; homology of 80 % to NADH Dehydrogenase subunit 4 at target site 10249; homology of 80 % to 16 S rRNA at target site of 1924; homology of 73.3% to

D-loop at target site of 16470; homology of 73.3 % to NADH Dehydrogenase Subunit 5 at target site of 14227; homology of 73.3% to NAD Hydrogenase Subunit 6 at target site of 13819; homology of 73.3 % to NADH Dehydrogenase of

Subunit 6 at target site of 13744; homology of 73.3 % to NADDhydrogenase

Subunit 5 at target sites of 13467 and 11763; homology of 73.3 % of NAD

Dehydrogenase of Subunit 6 at target site 10246; homology of 73.3 % to

cytochrome oxidase Subunit 3 at target site of 8820; homology of 73.3% to cytochrome oxidase subunit 6 at target site 8327; homology of 73.3% to ATPase subunit 8 at target site 7810; homology of 73.3 % to tRNA-lys at target site of

7752; homology of 73.3 % to cytochrome c oxidase subunit lat target sites 5961,

5478 ; homology of 73.3 % to NAD Dehydrogenase Subunit 2 at target sites of 4871, 4733, 45594145; homology of 73.3 % to NADH Dehydrogenase Subunit 1 at y target sites of 2922, 2919; and homology of 73.3 % to 16S rRNA at target sites of 1936, 1635.

Derivatives of the nucleic acid components are contemplated in the present invention. Derivatives include the nucleic acid components conjugated

with poly(L-lysine) or modified by, for example, the addition of amino acids

such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals and ions

including zinc, manganese and iodine, by the addition of 5'-polyalkyl moieties,

cholesterol, vitamin E, l-2-di-O-hexadecyl-3-glyceryl and other lipophilic

moieties and/or modified by the replacement of phosphodiester bonds with

phosphothiotate bonds, and/or modified nucleotide sequences of the prototype nucleic acid, defibrotide.

Derivatives of the nucleic acid components of defibrotide also include modified nucleic acid components. Any modification method known in the art

may also be employed to modify the nucleic acid components of defibrotide. For

example, addition of RNA monomer, i.e., adenosine on the 3' end of a DNA

oligonucleotide by using an RNA-3' solid support with (di)phosphorodimite

chemistry; insertion of adenine, deoxyadenosine, or dA adnine base in a

oligonucleotide; insertion of 5' monophosphate, e.g., 5'-P-A-C-G-T or 3*

monophosphate, e.g. , A-C-G-T-P-3' at any selected spot on an oligo using

(di)phosphoramidite chemistry; addition of any nucleotide on the end of tri- phosphates, e.g. N-P-P-P-A-C-G-T; production of di-nucleotides, e.g. , N-5'-P- P-P-P-5'-N; conjugate NTP to any oligonucleotide, e.g. , N-5'-P-P-P-P-5' ; coupling of cyclic nucleotides, e.g. , use of APPPPA-synthase to make A-5'-P-P-

P-P-5'A; membrane support modifications including addition of cholesterol to any position of an oligonucleotide with (di)phosphorodimite chemistry; addition

of peptides via carboxy-dT to any position on an oligonucleotide (carboxy-dT can

be coupled directly to a molecule containing a primary amino group using peptide chemistry or via the intermediate N-hydroxysuccinimide (NHS) ester);

attaching molecules to any site on an oligonucleotide using amino linkers and linker-spacers via NHS ester chemistry; linking oligonucleotides together, e.g. ,

5'-5' or 3'-3' with (di)phosphorodite chemistry; thiolated, methylayed, or in the

form of propyne oligonucleotides antisense oligonucleotides produced via

(di)phosphorodite chemistry; multiple symmetric (same sequence) or asymmetric (different sequence) braced oligonucleotides with targeted virus and subtargeted

cellular elements via (di)phosphorodite.

Oligonucleotides containing a homologous sequence of HTV and a gene

encoding a cellular regulatory factor are also contemplated in the present invention. The sequence homology between HIV and other cellular regulatory

factors may be at least 40%, preferably at least from 60% to 70%, and more

preferably from 80% to 90%. The length of the homology region may be from 3

nucleotides to 100 nucleotides, preferably from 6 to 60 nucleotides. The cellular

regulatory factors include transcription factors, oncogene products, and any factors involved in the signal transduction pathway, e.g. , TNF receptor, RIP, IL-

2 receptor, IL-1 analog, TNF-α, c-myc, c-abl, c-fos, c-ras, dystrophin, surface glycoprotein proteins of L-CAM and cathedrin, and B-myb. Table 6 lists a few

examples of such oligonucleotides.

Table 6. Examples of Oligonucleotides

Defibrotide or the nucleic acid components of defibrotide and variants thereof may be administered in combination with l) sequence specific nucleic

acids, 2) amino acids, 3) protein factors, 4) sequence specific nucleic acids and

sequence non-specific nucleic acids, 5) sequence specific nucleic acids and

sequence specific peptides including but are not limited to peptides encoded by

oligonucleotides of defibrotides and the variants thereof, 6) sequence specific

nucleic acids and sequence non-specific peptides.

The sequence specific nucleic acids include but are not limited to anti- protease sequences, retroviral promoter sequences, TAR sequences, HIV mutants of TAR decoy RNA, mutants TAR decoy RNA, negative mutants of the viral

REV transactivator, synthetic promoters with the consensus sequence for binding

of the transcription factor Spl and the TATA box, mutants of TATA box, TAT

mutants wherein the mutations involving the seven cysteine residues, sense, anti¬

sense, missense derivative of CIS acting negative elements (CRS) present in the

integrase gene and REV mutants, transdominant suppressors of REV (mutations

involving amino acid 78 and 79), NEF-cDNA sequences and its mutants with or

without U3 region sequence of the 3'LTR, POL reverse transcriptase gene

mutants, POL viral integrase gene and its mutants, POL viral protease gene mutants, HIV-I LTR enhancer (-137 to -17) mutants, HIV LTR promoters starting at -78, HIV LTR sequences encoding a arginine fork from aa27 to aa38,

HIV-I LTR sense sequences of the negative regulatory element (-340 to -185),

HIV-1 LTR consensus sequences for binding of transcription factors of

API/COUP, NFAT-1, USF, TCF- , NF-KB, TCF-la, TBP, and inhibitors of ax the consensus sequence, LTR NFkB mutants (-104 to -80), LTR Spl (GC box) binding site and TATA box mutants, LTR GAG gene sequence mutants, LTR

mutants (-454 to +180), LTR genomic repeats at +80, LTR regions responsive for cellular transcription factors between and to the left of U3 to -454 extending

to -7, 3' LTR and its variants, 5' LTR and its variants, LTR variants, inhibitors

of UBP-1 or LBP-1 binding sequence (-5 to +82), ENV, GAG, POL gene

sequences placed 3' of the REV mutant codon,

short sequence mutants (15-60 mer), and host DNA sequences of preferred targets for proviral integration.

Amino acids administered in combination with the nucleic acid components and the variants thereof include these involved in signal transduction

pathways and phosphorylations. They include but are not limited to threonine,

serine, tyrosine, and proline.

Protein factors administered in combination with the nucleic acid

components and the variants thereof include DNA polymerase, protease

inhibitor, and reverse transcriptase inhibitor.

In addition, N-containing ring compounds, e.g. , pyrimidine, purine,

adenylic, and guanosine can also be administered in combination with the nucleic acid compounds and the variants thereof in the present invention.

The homologous sequences of HIV and a gene encoding a cellular

regulatory factor may also be administered in combination with homologous

sequences of nucleic acid components of defibrotide and the variants thereof, especially the homologous sequences of aptamer #4 and a gene encoding a

cellular regulatory factor.

The nucleic acid compounds of the present invention can be administered

directly or via a vector. Any vector capable of replicating in vivo can be used to

carry the nucleic acid compounds. Preferably, the vectors employed are suitable

for gene delivery. Expression/replication vectors are readily available in the art,

e.g., pCI, pCI-neo.

It is a discovery of the present invention that mitochondrial genome,

especially origin of replication, e.g., from a human can be used to construct

replication/expression vectors. Preferably, 5' end of mitochondrial 12S RNA

containing sequences from about nucleotide 72 to 1025 and mitochondrial DNA

containing sequences from nucleotide 1 to 72 can be used.

In replication/expression vectors, the oligonucleotides of the present

invention can be flanked by some buffer sequences. In a preferred embodiment,

pCI-neo vector can be cut by Bgl2 and BamHI, and eIF-4E initiation factor gene

may be inserted. The sequence of eIF-4E gene specifically relevent to such

vector is

GGCCAGGCATGGTAAGTCATACCTATAATCCCAGCACTGTGGGAGGCC

AAGGAAGGGGGATCCCTTGAGCTCAAGAGTTTAAGACCGAGATCGAT

(upstream of Alu) and

AAAGAGTTTAAGACCAGCTTGGGCAACACAGTCAGACTTCATCTCTAT

AAATAATTTAAAAATTAGCCAAGCATGGTGGCGTGGTACCCTTGTGGG

TTCCAGGCTTATTTGGGAGGTTGAGGTAAAGGAATTCTCTTGGACGCCC AGGTAGTCAAGGTTGCAGTGAGCCATAATCAAACCACTGCACTCCAGC

ATGGCAACAGAGCAAGACCCCATCTCAAATATAT (downstream of Alu). Subsequently, the oligonucleotides of the present invention can be inserted into the eIF-4E gene, preferably at the Alu site of eIF-4E gene.

In replication/expression vectors, the oligonucleotides of the present

invention can be driven by a promoter, especially a TAR promoter, a HIV LTR promoter, or a promoter of DNA polymerase. Alternatively, the oligonucleotides

of the present invention can be co-expressed or co-replicated with a gene

encoding DNA polymerase. Tat protein may be added to enhance vector

replication.

The mitochondrial vectors discussed above can also be used to supply oligonucleotides with wild- type mitochondrial sequences. HIV patients are likely to have mutations in mitochondrial DNA, e.g, cytochrome-oxidase (COX) gene, NADH subunits, origin of replication, D-loop, t-RNA lysine, tRNA glu, and

ATPase subunits. It is routine to screen these genes for mutations. Upon

finding of mutations in mitochondrial DNA, oligonucleotides containing the corresponding wild-type mitochondrial DNA sequences can be administered to

treat the disease conditions associated with such genetic alterations.

It is also a discovery of the present invention that a drug resistance can be

treated via administering the nucleic acid components of defibrotide and the

variants thereof in combination with the drug, e.g. , a protease inhibitor. 3!

Marker-Driven Therapy

The claimed method involves the use of a "marker dependent dose

assessment" methodology for determining the therapeutically most efficacious use

of the respective pharmaceutical agents. The use of incremental marker

stratification reflects the concept that "maximum efficacious dose" is redefined through the different stages of treatment, each time adjusted to the respective specific marker most representative of the respective pathogenic/clinical picture of the disease state. Treatment at respectively higher doses corresponding to the

progressively lower disease activity levels are continued until a state of total cure

is reached.

Intrinsic to the claimed method is the total elimination of empirically

assessed doses or constant therapy doses, arrived at by the universal

pharmaceutical principal of "minimum efficacious dose" for a class of drugs,

which, until the present time, has been the standard for the definition of the

"effective therapeutic dose. " The respective doses thereof are defined to elicit a response corresponding to different disease functions of the treated cell and

revival of the respective disease parameters, in a stratified fashion.

The method of treating various diseases provided by this invention uses

specific clinical and laboratory markers to assess dosages to be administered.

The markers vary from gross clinical observations of pathology to the progressively subclinical yet valid detection of certain laboratory levels

associated with a particular disease. The preferred markers are the clinical parameters as well as the molecular products produced, or inhibited, present or absent when cellular events associated with a particular disease occur.

Certain laboratory assays are used to assure that the dosages are safe for

the patient being treated. For therapy with defibrotide these may include

prothrombin time, activated partial prothromboplastin time, thrombin time, reptilase time, bleeding time, platelet function assays, and coagulation factors. A second set of laboratory assays (i.e. , "disease markers") are utilized to indicate

the efficacy of the doses. "Repair markers" are used to assess clinical adequacy

of dose escalation and duration of therapy.

As defined herein, "normal cellular markers" are molecules of normal cellular function. They are tissue and cell specific and may share common

pathways of second messengers or signal transduction pathways and normal

cellular genomes. At the genome level, normal cell markers are genes that are

constitutively expressed, transcribed, translated and transduced. Establishing

dose and duration of therapy based on second messengers, signal transduction pathways and induction of genomic transcription is a novel modality of

administering a pharmaceutical agent.

As defined herein, "disease markers" are markers which are induced and

defined by the type of disease process. Disease markers are clinical or

laboratory parameters that deviate from normalcy. A disease marker may be

absent or present, decreased or increased. At the genome level, disease markers

are genomes of genetic dismodulation (e.g. viral genome, transcribed oncogenes,

mistranscribed genomes); non transcribed genomes (e.g. , familial/ genetically absent genomes, under-regulated/suppressed genomes), and/or over-expressed, not appropriately shut off transcriptions of genomes (e.g. activated repair

molecules, second messengers and molecules of signal transduction pathways).

Disease markers are observable characteristics of the organism whose status in a disease state differs from the status in the normal (non-disease) state.

Such characteristics and their association with their respective disease states are

well known to the skilled practitioner. In the practice of the method of this

invention, it is contemplated that the practitioner will monitor the status of

multiple disease markers related to the disease being treated, either simultaneously or sequentially. The disease markers include both clinical markers, which are observed directly by clinician, and laboratory markers, which

represent quantitative values determined by support staff. These characteristics

include, but are not limited to, the concentration of compounds whose production

or expression is affected by injury-based alteration of cell surface receptors such

as Adenosine A, and A₂, collagen, thrombin, epinephrin and norepinephrine

receptors, of protein kinase A or protein kinase C pathways, or of protein factors

whose phosphorylation affects genomic translation and transcription, or

hybridization of genomic enhancers/ inhibitors infusion or excess enhancers, infusion of excess genomes to deplete viral/cellular transactivation transcription factors, etc. where the concentration in the disease state differs from the

concentration in the normal state. Disease markers for HIV related disease states

include odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptococcal

diarrhea, Karnofsky performance score, waste syndrome. The normal state concentration of these markers will be known to the skilled practitioner, and usually represents a range of concentration values

determined by measurement of the concentration of the compound in a large number of individuals who are not in a disease state, by the respective laboratory.

Repair markers are compounds that participate in the regulatory pathways

which include protein kinase A or protein kinase C. Adenylate cyclase is known

to be activated by G-proteins (see Ross, 1992, Current Biology, 2(10) :517-519, the disclosure of which is incorporated herein by reference) with eventual production of cAMP and cAMP-dependent activation of protein kinase A, leading to phosphorylation of the respective transcription factors, until 100% of

the cell membrane receptors are taken up by the ligands. For defibrotide these

receptors are β-adrenergic receptors, collagen receptors, adenosine A,/A₂ receptors, ADP receptors, thrombin receptors, collagen receptors, etc). A

parallel pathway operates through activation of protein kinase C, in response to

intracellular calcium ion level, inositol triphosphate and diacylglycerol,

responsive to ligand binding to another set of receptors and similarly controlling

transcription/translation of respective proteins. These pathways, and their intermediate compounds are well known to those skilled in the art. However, their use in assessment of therapeutic dosage have not, heretofore, been known in

the art.

In particular, "repair markers" are molecules in the pathways of the

respective cellular repair processes defined by the type of injury. Repair markers are transcribed or shut off genes, second messengers and/or molecules of the

signal transduction pathways that may be increased, decreased, or absent in response to cellular injury. As discussed herein, the term "repair marker" may refer to the compound or its concentration or the measurement value of an assay associated with the concentration of the compound. Examples of suitable repair

markers include but are not limited to cAMP, cGMP, IL-1, IL-2, TNF-α, IL-6,

cGMP/cAMP ratio, total lymphocyte count, T lymphocyte count, CD4 count,

CD8 count, cAMP dependent protein kinase A enzyme, adenylate cyclase, G-

protein, phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol, intracellular calcium level, intracellular calcium ion level, c-myc,

ras, c-fos, c-jun, NK-kB, EIAI, AP-1, COUP, TCF-lα, TATA, TAT element, oxygen radical, CREB, CREM, Platelet Derived Growth Factor (PDGF), Colony Stimulating Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor (IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src Homology 3 domain (SID), serine threonine kinase, Mitogen Activated Protein Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and

Activators of Transcription (STATs), JAJ1, JAK2, Tumor Necrosis Factor -Receptor 1 signal Transducer TRADD, chemokines of Rantes, and MIP- Alpha,

and MIP-Beta.

The level of a repair marker may deviate from the level present in the cell

during normal function, and when it does so deviate, cellular repair processes are

activated. This deviation may be positive or negative, depending on the disease state and the precise state of cellular repair currently in progress. As discussed herein, the "intensity" of the repair marker will refer to the degree of deviation from the level during normal cellular function, without regard to whether the deviation is positive or negative. The use of repair markers in establishing dose and duration of therapy is a novel mode of administering a pharmaceutical agent.

As defined herein, a "universal marker" is a constitutively expressed

molecule transcriptionally activated by the respective nucleic acid universally in all disease states for which the nucleic acid is specific. "Universal markers" are

specific for each nucleic acid employed. While the universal marker is the only

molecule that is not injury specific and has no therapeutic value, it is expressive

of the event and duration of the ongoing repair process. Transcriptional

activation gets shut off with the establishment of the state of cure. As such, the universal marker does not get modulated unless there is a disease state and the

respective nucleic acid has therapeutic specificity. The universal marker carries a direct quantitative relationship to the daily per kilogram body weight dose

(DKGD) of the nucleic acid employed. A universal marker defined for the

prototype nucleic acid (defibrotide) is vWAg. Other "housekeeping genes"

related to particular nucleic acids can be selected as per the target cell involved

from the respective "housekeeping genes. "

Clinical and clinical laboratory markers may be determined through blood

tests, urine tests, clinical observation or identification of blood clots by any of

several conventional techniques, as well as the more novel techniques of determining genomic transcriptional and translational activity by DNA finger printing, PCR and the like. To evaluate the markers, the laboratory analyses measure levels of certain proteins, lymphokines, enzymes and relevant

molecules. Clinical markers include blood pressure, visible tissue damage, signs

of inflammation, ecchymoses, and the like. Clinical markers vary from one

disease to another. Moreover, like HIV, many diseases progress through several clinical stages during the process of recovery. The clinical markers of one stage of a disease are frequently different from the clinical markers in other stages of

the disease, befitting different stages of the pathogenic picture.

The detection of markers relevant to the particular disease, stage of that

disease, and as baseline for dose escalation, must first be identified. Any

observable characteristic generally accepted by the skilled practitioner as being

associated with a specific disease state may be employed as a clinical marker.

See, e.g. , Harrison's PRINCIPLES OF INTERNAL MEDICINE, 10th Edition, Petersdorf et al. Eds., McGraw Hill. The skilled artisan would readily recognize

those markers indicative of a pathological state.

One critical marker is chosen at each respective stage of the repair

process and the maximum efficacious dose for that marker established.

Administration of that dose induces correction of other stage-specific markers not

necessarily identified or aimed at during therapy (i.e. , "stage specific

pleiotropism"). Following normalization of the first chosen marker, a second

marker which continues to deviate from the normal condition is chosen. The

dose that normalizes the second marker (i.e. , the higher dose) is likely to further

improve the first marker incrementally. Initial administration of the selected dosage is followed by incrementally increasing dosages until the "maximum efficacious dose" is reached. A panel of

laboratory assays to determine the state of the markers (e.g. , absence, increase,

decrease) is repeated every 3 to 7 days during therapy. These results together with the clinical markers of disease would indicate whether the defibrotide, or other nucleic acid derivative, is adequate in dose and duration to cause

improvement in the pertinent marker or markers while simultaneously being totally safe to administer. Therapy is continued with escalating doses over

sufficient time to assure complete normalization (i.e. , the clinical laboratory assays, when compared to the reference range, are indicative of the normal

condition) of the pertinent markers. When normalization is reached, therapy is

stopped.

Although therapy is discontinued, the patient is tested weekly for the

current state of the pertinent disease marker. If relapse occurs, therapy is reinitiated at the highest dose level of the prior course of therapy until

normalization is again reached. While optional, it is advisable to continue escalating the dose level to potentially reach a shorter duration of therapy.

The highest tolerable dose per day which is complication free (e.g. , no

bleeding, thrombopathy) is preferred since treatment periods are usually shorter at higher dose levels. Therapy cycles are repeated until there is complete and

irreversible normalization of the pertinent markers at which point the patient is

cured. A marker is considered to be irreversibly normalized if it remains normal

for three months without therapy. There is a certain dose level which will ultimately give plateau levels on a particular marker, and irrespective of how long the dose range is continued, the

level of the molecule will not go higher unless the dose (or cellular uptake of the

respective nucleotide) is increased. This agrees with accepted biochemical knowledge, i.e. , the more the number of receptors receiving signals, the more

cAMP is produced and, as a consequence, the higher the transcriptional activity

pertaining to vWAg is.

Minimum effective dosing is therefore counterproductive and markers have to be used to assess the maximum efficacious dose. Application of the higher dose will promptly lead to higher levels in a shorter time (high inefficiency score). This is confirmed from the cellular uptake curves.

Once a plateau is reached with the maximum efficacious dose, the in¬

efficiency score can thereafter be used along with the maximum highest levels of

the last day to assess how long therapy should be continued to complete the

repair process, i.e. , when the maximum efficacious dose is continued when in¬

efficiency score is less than 1.0, the nucleotide no longer exerts any further

therapeutic effect. This observation leads to the statistical definition of

"maximum therapeutic dose," i.e. , the time slot of the total administered dose beyond which further repair of the selected marker would not take place at that

particular dose level.

If another disease marker were selected, the maximum efficacious dose

and maximum therapeutic dose would be redefined for that second stage marker. |0 One skilled in the art, based on the information presented herein, would

be able to detect and determine finer disease/repair markers so as not to miss complete cure. Any abnormality in any marker should prompt reinitiation of therapy, even if no visible disease markers are observed, since many of the

markers of the subclinical stage will be biochemical molecules, e.g., an interleukin.

Treatment in Accordance with the Invention

A preferred embodiment of the treatment method according to this

invention is diagramed in Figure 1. An initial laboratory test panel (box 1) is first run which would consist of the respective set of "disease markers" and the

universal panel of "repair markers" consisting of signal transduction/second

messenger panel molecules. Additionally certain laboratory assays are used to assure that the dosages are safe for the patient being treated. For defibrotide

these may include prothrombin time, activated partial prothromboplastin time,

thrombin time, reptilase time, bleeding time, platelet function assays and

coagulation factors (see baseline coagulation panel). "Disease markers" are

utilized to indicate the overall therapeutic efficacy of the doses. These markers may be identified through blood tests, urine tests, clinical observation or identification of blood clots by any of several conventional techniques, or by the more refined techniques such as DNA fingerprinting and PCR. To evaluate the

"disease markers" the laboratory analyses measure levels of certain proteins,

lymphokines, enzymes and relevant molecules. Clinical markers may include blood pressure, visible tissue damage, signs of inflammation, ecchymoses, and the like.

An initial bolus of defibrotide (box 2) or its nucleic acid components is given intravenously over 15 to 30 minutes. Immediately thereafter the patient is given the daily dose of 40 - 400 mg/kg by continuous infusion. Preferably, the

initial dose is a bolus (25 - 50 mg/kg) followed by 24-hour dose which is

increased in 50 mg/kg/day increments every 1 - 3 days. The starting base-line

dose may be from 40 - 400 mg/kg/day depending upon physician preference and

the respective disease state treated. Lower initial doses are preferred for those

therapeutic compounds which enter the cell nucleus more readily and are thus

effective at lower doses. The bolus and daily dose for chemical derivatives of the nucleic acids may be calculated as a proportion of the defibrotide dose based on the relative cell-entry rate. It is preferred to administer this dose

intravenously using two IV bags of 50 ml D5W, each bag infused over 12 hours.

If for any reason the infusion is interrupted, the rate of infusion would be

thereafter adjusted so that the patient will have received the calculated 12 hour

dosage at the completion of the specified time period. This 24 hour dose range

can also be administered in 2 - 4 bolus injections or per oral administration.

Defibrotide or other selected nucleic acid derivative may be administered

parenterally, orally or locally by application to the skin. Parenteral

administration is in the form of continuous intravenous infusion or intravenous bolus injection. Intravenous infusion may be accomplished by gravity feed, pump delivery or other clinically accepted methods. Oral administration may include the use of vials, capsules, tablets or powders for any method of enteric administration.

To permit clinically practicable administration of defibrotide in the amount necessary, materials for delivery of the agent optionally comprise 2 x 50

ml D5W IV bags each containing one-half of the calculated total 24 hour dose in milligrams of defibrotide, each bag infused over 12 hours for the IV-continuous infusion at the maximum tolerable doses. Alternatively, the total 24-hour dose

can be administered by bolus injection every 8 - 12 hours. The initial bolus

injection and the subsequent outpatient bolus maintenance infusions are given,

for example, in 3 x 25 ml D5W bags, each bolus to be infused over fifteen to

thirty minutes. The oral dosage outpatient maintenance therapy in milligrams given daily (divided into 3 - 6 doses by mouth) would be the multiples of 2X the

maximum tolerable IV dose.

The same dose is given for three days and the laboratory test panel is

repeated (box 3). A full coagulation profile and tests for markers should be run

before and after any dose escalation. These tests results are compared with the

initial test data to determine if any of the markers (which may include laboratory

data or clinical observation for the disease being treated) have changed. A

change is expected to occur in at least one marker within 3 - 21 days, indicating

that defibrotide is having an effect. After each test the dose of defibrotide is

increased by 50 mg/kg/day, dose for chemical derivatives being proportional to the cell entry rate for the respective nucleic acid, and continued at that dose for three days before retesting. This pattern of escalating the dose and repeating the laboratory panels is repeated (boxes 4 and 5) until the patient's "maximum

tolerable dose" (MTD) is reached or until the disease/repair markers have

plateaued or completely normalized.

If three consecutive values for a selected marker are about the same, a plateau has been reached. This procedure is followed for a minimum of 21 days (box 6). Disease/repair markers are checked and coagulation profiles are run on

weekly intervals to monitor response. If no response is observed, i.e. , no change in the level of any marker (box 7), therapy is discontinued (box 8), and treatment

is determined to have failed. If, after 21 days (box 6), no plateau is reached, but

improvement in the disease markers has occurred (box 14), the dose may be doubled or the MTD may be given (box 15).

If the markers are normal (box 9), therapy is discontinued (box 10).

Tests continue to be repeated weekly for up to three months, noting any change

in markers that would indicate relapse. If no relapse has occurred and no new

markers have appeared after three months (box 11), therapy is discontinued (box 12) and the patient is considered cured. Should an old marker reappear or a new

marker appear (box 13), the last previous dose is doubled, and therapy is

resumed at that dose level. If doubling of the dose would exceed the MTD, the

MTD would be administered. Selection of Markers

The correct identification of markers are based on the identification of the

pathways of disease pathogenesis and the respective repair processes and

pathways. The mechanism of efficacy of the therapeutic nucleic acid simulate or are superimposed on the cellular pathways of the respective repair process they induce. For example, using defibrotide as the clinical agent, one would (1)

identify the known signal transduction systems and second messengers of the

repair process, (2) define the most probable nucleic acid-induced repair markers

of the known cellular repair pathway, and (3) define markers of the disease

process related to disease pathogenesis.

Many disease processes are pathogenically based on overactive body

defense mechanisms. As such, a compound whose intracellular concentration can be a repair marker in one disease state can be a disease marker in another

disease state. In such a case, the marker would usually be under-regulated by defibrotide instead of induced. Similarly, a marker of normal cellular function,

if deficient, may be a disease marker. For example, the paralysis of cellular

function of CD4 cells by the HIV retiovirus is secondary to the compromise of

normal cellular markers of transduction pathways and second messengers.

G-proteins instrumental in the activation of adenylyl cyclase are likely to

be deficient in their active form with a low dose threshold level. In this case, the deficiency of the normal cellular marker of G-proteins would be a disease

marker. Since defibrotide affects the adenylate cyclase pathway (increased

cAMP by defibrotide), defibrotide would restore the second messenger of cAMP, which therefore would be a repair marker.

The maximum therapeutic dose in turn would again follow the guidelines

described above for vWAg, since this universal marker will get elevated with

modulation of any phase of repair process such as, for example, receptor up- regulation, signal transduction or induction of translation and/or transcription, shutting off of transcription/translation which in turn may happen by activation

of CREM, which is the inhibitor transcription factor of CREB, i.e. , the latter is cAMP dependent initiator of the transcription factor of the CRE which in turn is the portion of the DNA enhancer sequence responsive to cAMP and cAMP

associated transcription factors, such as c-myc products, C-70--J products, ATP

Activation Factor, Serum Responsive Element (SRE), API transcription factor

(ATF), HIV-Long Terminal Repeat (LTR), leucine zipper transcription factors of c-fos/c-jun. (ATF, SRE, API sites in c-fos promoter/enhancer all respond to cAMP without the requirement of SRE. Protein Kinase A activates endogenous CREB activity and will enhance viral transactivation).

The prototype high molecular weight defibrotide, native defibrotide, low

molecular weight native defibrotide, and chemical defibrotide derivatives

regulate genes which are regulated by cAMP. These genes include vasoactive

intestinal peptide (VIP), somatostatin, human chorionic gonadotropin,

phosphoenolpyruvate carboxy lkinase, tyrosine hydroxylase, fibronectin,

prolactin, ornithine decarboxylase, interleukin-6 gene, c-fos oncogene,

haptoglobin, hemopexin, C-reactive protein (CRP), as well as other cellular genes which are regulated by cAMP responsive element (CRE), transcriptional factors interacting with CREB (which is 43 kd protein that interacts with CRE

via leucine zipper, such as c-myc products, c-fos products, ATP (Activating

Protein), SRE (serum responsive element), API. Protein kinase A will activate

endogenous CREB activity and will also enhance viral transactivation. CRE/CREB related transcription of genes including HIV Long Terminal Repeat

(LTR) will be positively induced with high cAMP levels.

The selected nucleic acid, e.g. , defibrotide, will affect only injury- dependent parameters in each individual patient. As such, no uniform action will be observable in all patients. For the nucleotide transcriptionally-activated

parameters, analysis is made for the highest values in each dose range. For the

nucleotide transcriptionally shut-off parameters, analysis is made for the lowest

value in each dose range. Therapy Based on Universal Markers

Several markers have now been shown to reflect transcriptional genomic

activity by nucleotides which increase cAMP, adenylate cyclase via the interaction of G-proteins, and phosphorylate transcriptional factors via protein kinase A. Such markers include von Willebrandt antigen (vWAg), tissue plasminogen activator antigen (AgTPA) and β₂-microglobulin. While vWAg,

AgTPA and β₂-microglobulin are representative markers, any molecules which

are initiated by nucleotides, or derivatives such as defibrotide, to induce

transcriptional activity are included.

It has been discovered that vWAg may be employed as a universal marker

to guide the assessment of the duration of therapy, i.e. , the most therapeutic dose, as well as the most efficacious daily dose. The inventors have discovered

that vWAg is transcriptionally activated by defibrotide irrespective of the type of

injury. Analysis of patient data has led to the unexpected finding that with the onset of cure, vWAg levels decline. The production of vWAg will be activated by defibrotide only for the duration of the injury and the repair process. In this regard, defibrotide will not effect vWAg levels in healthy individuals or following the establishment of cure, i.e. , vWAg level will decline to baseline regardless of ongoing therapy. Concurrent analysis of vWAg with various "disease markers" correlated with changes in the disease marker levels. In other

words, it has been discovered that therapy dependent absolute changes in disease

markers (decline or increase) correlate with peak vWAg levels. The normalization of disease markers, in turn, correlates with decline in vWAg

levels.

vWAg is classified according to this invention as being a universal dose

marker. vWAg can be utilized as the universal marker for all nucleotides that

induce activation of cAMP and protein kinase A enzymes. vWAg is a plasma glycoprotein having a molecular weight of approximately 200,000 which is

constitutively secreted by the endothelial cell. It is important in hemostasis as a

prothrombotic factor (factor VHI/vWAg protein) and as an inducer of adherence

of platelets to the exposed subendothelium. In every disease state, vWAg levels

go up with increasing defibrotide dose levels when the dose is adequate to

stimulate vascular endothelial function.

In accordance with the invention, an increase in the vWAg level

corresponds to the induction of transcriptional activity of this gene by the nucleic

acid. Elevation of vWAg is representative of the ongoing repair process. The

decline in the level and eventual normalization of vWAg during therapy is representative of the cure process. Plateau in the level of vWAg correlates with the application of the maximum efficacious dose. Without exception, the elevation in the level of vWAg is concurrent with modulation of the disease

marker and activation of the repair marker. Here the maximum efficacious dose is determined along with vWAg, so as to normalize the levels of these molecules between 65 - 150% , and eliminate the intracellular oxygen radicals (measured by

chemiluminescence, normal state being negative). For the prototype drug, defibrotide, the maximum efficacy in inducing transcriptional activation of

vWAg occurs at doses of 40 DKGD and above, ideally within the DKGD range

of 40 - 400. The universal marker vWAg dose levels are representative dose

levels by the prototype's transcriptional/translational modulatory effects. Fitting

the definition of universal marker, vWAg does not contribute to the expected

correction of bleeding time but acts as a functionally dormant molecule.

Another option is to empirically repeat therapy after three weeks following cessation of therapy on the above principles. In this regard, the half

life of the nucleic acid appears to be about three weeks, based on the observation

that universal marker vWAg requires 2 - 3 weeks to come down to baseline levels with cessation of therapy. If the universal marker vWAg is elevated

during therapy with the previous maximum efficacious dose, there is still a lesion

to treat, irrespective of the fact that there are no known or visible clinical, and/or

documented biochemical repair or disease markers.

Therapy, in accordance with the invention, is geared to continue until vWAg is normalized while on established maximum effective dose. Thereafter therapy is discontinued and the same cycles are repeated until the maximum efficacious dose therapeutically initiated no longer induces any elevation in vWAg, as would be observed in a normal healthy individual.

Statistical Analysis

A statistical model has been used to assess the dose and duration of therapy with the ultimate objective of irreversible cure. For each molecular

marker, calculations are presented, based on analysis of the data from all the

patients for the "first day value," the "last day value," the "highest value" or

"lowest value" (i.e. , for transcriptionally activated molecular markers and for

transcriptionally inhibited molecular markers, respectively), the "m-efficiency score," and the "time required to reach the optimal effect of the nucleotide" at the dose ranges employed. The "first day value" at a particular dose is the "last day value" of the preceding dose range. The "minimum of increasing values"

has been found to be the best parameter to follow for transcriptionally turned on molecules while the "maximum of the lowest values" has been found to be the

best parameter to follow for transcriptionally turned off molecules.

The best parameter to follow the dose related induction of transcriptional

activity is the "minimum values of the increasing levels" obtained on the first day

of the initiation of each dose range. "Highest or increasing levels" represent the increase in level of a molecule whose production (transcription) is turned on with

increasing dose levels. Choosing the minimum increase in the level in the transcribed genome among all patients treated in any dose range enables the

prediction of the worst performance with that dose of the therapeutic compound.

This enables the treatment of the worst performer, which allows turning on the genomic transcriptional activity in the greatest number of patients within each

respective dose range. Increase in the marker, as shown by "minimum highest

value" represents that the repair process is ongoing, that is, repair molecules are

being produced and transcriptional activity is ongoing.

The quantitative relationship between vWAg level and daily dose of the therapeutic compound is best visualized when the minimum value of the

increasing vWAg levels in the population are analyzed (i. e. , the worst performance levels in any one patient at any one dose range, "worst

performance" implying that increasing the dose will incrementally continue to

elevate the vWAg, which is biologically interpreted as meaning that there are more repair events to go through).

Minimum increasing value is the parameter to use to confirm the event of

ongoing cellular repair. Maximum increasing value is the statistical parameter to

use to follow the completion of the repair event. Maximum therapeutic dose is

the dose at which vWAg on continued therapy will decline to a normal level.

The "maximum values of the lowest levels" obtained among all patient

data on the last days of treatment at each dose range are similarly used to analyze

how increasing dose ranges affect the transcriptional activities involving the

"turned on" molecules. The levels will show progressive declines, i.e. , the

progressive turning off of the repair process with the onset of cure, in spite of the higher doses.

Once maximum stimulation takes place (as assessed by the use of first day

minimum highest levels), the cell gets turned off. By the use of the maximum lowest levels of the last day, therapy is continued at that particular dose level until these levels return to the baseline levels on therapy, i.e. , until there is no

more ongoing transcriptional activity, i.e. , the repair process is completed.

The m-efficiency value is the ratio of the respective elevated level over the time taken for elevation to occur. The higher the dose, the higher the value

of the numerator and the higher the m-efficiency level. Alternatively, the shorter

the time (denominator), the higher is the m-efficiency value. Method of Treating HTV-Infected Patients with Defibrotide or Its Nucleic Acid

Components

Defibrotide or its nucleic acid components modulate cell functions at the nuclear genomic level through one or more pathways by modulation of the cell's

genetic material, i.e. , DNA itself or translation or transcription of the genetic

information. Defibrotide or its nucleic acid components-induced cellular

modulation restores the normal functions of the cell such as the production of normal proteins needed by the cell and, in the case of HIV, the correction of the

effects of the abnormal, viral encoded genetic material by inhibiting its further

production at the expense of the normal, virus-free genetic material. In the

course of the multiphase treatment, defibrotide or its nucleic acid components is administered at dosages much greater than previously described in the literature for other disease states. The dosages and durations of the phases of therapy are

adjusted according to the results of laboratory studies performed on the patient's

infected cells. Preferably, in treating HIV, an initial bolus dose of 100 mg/kg in

50 ml DSW is infused over a period of 30 - 60 minutes followed by 200 mg/kg/day infused in 250 - 500 ml DSW over a period of 3 - 24 hours. From day 2, dose is escalated to maximum tolerable dose, maximum efficacious dose and maximum therapeutic dose levels. In this way, the HIV virus may be inactivated and its proliferation arrested. Therefore, the progress of the disease

may be arrested or ameliorated.

Because HIV virus adversely affects the genetic material and function of

the cells, defibrotide or its nucleic acid components can effectively treat HIV

infection as long as the carrier CD4⁺ cell and/ or the monocyte harboring the

virus preserves the physiological ability to revive itself. Therapeutic success

with defibrotide, however, is strictly dependent upon the assessment of the

correct treatment doses for the respective disease states. Moreover, since the

optimum function of the normal cell, by definition, would not be compatible with any complications, defibrotide or its nucleic acid components at any defined maximum efficacious dose, specific for any patient and disease state would be

complication-free.

Sarin et al. (Proc. Natl. Acad. Sci. U.S.A. , 1988, 85:7448-7451), as well

as Leonetti et al. (Bioconjugate Chem. , 1990, 1: 149-153), have shown that anti¬

sense oligonucleotides are potent inhibitors of HIV-1 replication in cell culture.

The methylphosphonate linked oligonucleotides were found to be superior in this effect over the phosphodiester linked oligonucleotides, apparently as a result of

their resistance to nucleases. This property was deemed to be the factor in the

superiority, since oligonucleotides less than 20 bases in length proved to be ineffective inhibitors. Efficacy of defibrotide or its nucleic acid components may have several concurrently active mechanisms. Defibrotide or its nucleic acid components may provide anti-sense neutralization of the viral proteins. Defibrotide¹ s mechanism of efficacy may be at the nuclear level by modulation of genetic functions via

other pathways as well. Defibrotide' s actions may be more apparent during viral

phases which involve translation and/or transcription of the DNA message, so as

to revive the normal function of the cell at the expense of the disease-specific

molecules. This action may be analogous to anti-viral effects of Ampligen (a

mismatched double stranded RNA-molecule). However, whereas Ampligen

exhibits immunostimulating effects, agents such as defibrotide are both

immunostimulants and immunosuppressants. Defibrotide or its nucleic acid components may modulate viral penetration into the cell via its known action of inhibiting intracellular calcium mobilization. Also, defibrotide or its nucleic acid

components may directly inhibit viral enzyme reverse transcriptase via inducing

ATP production analogous to ddl (dedeoxyinosine), by virtue of its known action

of inducing high energy metabolites (ATP, ADP, NADP/NADPH), possibly via

modulation of Complex-I respiratory molecule. Defibrotide or its nucleic acid

components may inhibit protein kinase C, analogous to Hypericin. Defibrotide

may also decrease Tissue Necrosis Factor (TNF), a cytokine known to promote

HIV activation, by its known effect on increasing cAMP levels at the correct

defibrotide dose level similar to Pentoxyfilline.

Whatever the mechanism, zinc is known to have an inhibitory effect upon

nucleases acting on phosphodiester linkages, as well as an enhancing effect on n base pairing. U.S. Patent 3,770,720, teaches that in the production of defibrotide, zinc should be removed from the molecule. However, in the treatment of AIDS, it is preferred that zinc be present. Moreover, it is preferred that iodine should also be present. In the defibrotide used in the Examples iodine

was present in an approximate ratio of one zinc atom per iodine atom and a two to one ratio of zinc + iodine to nucleotide base.

As can be seen from comparing the cellular uptake data shown in Figures

2 and 3 with the data shown in Figures 4, 5 and 6, a greater level of defibrotide

enters the lymphocytes when biotin is present. Horn et al. (Plant Physiol, 1990,

22: 1492-1496) has observed that biotinylated molecules enter the cell via the folate endocytic pathway. The data of Figures 2 - 6 read in conjunction with the

above-cited Horn reference, indicate that defibrotide with biotin may also use the

folate endocytic pathway.

Defibrotide may jointly and/or selectively modulate one or several

pathways. This modulation will be, only to the appropriate degree thus surpassing all of the other anti-HIV agents in its lack of side effects, yet presence

of proven efficacy. Defibrotide will achieve this result only when the dose levels

are tailored to the patient, stage of disease activity and/or reigning stage of viral

activity.

The method of treating the HIV-infected patient begins with a panel of laboratory studies which include the quantitative evaluation of the activated

peripheral blood mononuclear cell subsets, circulating viral proteins, cytokinases and soluble cell-surface receptors. There are no patient inclusion or exclusion criteria for therapy. Patients in any or all of the four clinical stages of HIV-

infection including history of exposure (i.e. , HIV⁺, Pre- ARC, ARC, and AIDS)

are candidates for therapy. The initial administration of a selected dosage of defibrotide is followed by incrementally increasing the dosage of defibrotide until a maximum tolerable dose is reached. The laboratory panel is repeated weekly during this therapy. These results together with the clinical markers of disease

would indicate whether the defibrotide is efficacious and whether defibrotide

should be continued to be given alone or with other therapeutic agents.

The details of treatment and the dose ranges fitting the various stages of

the HTV disease will be expressed by retrospective analysis of respective

laboratory and clinical markers. Additionally, dosage levels and frequencies as

well as the use of other anti-HIV medication will also depend upon the individual

patient or stage of disease and/or other concurrent medical conditions.

Before the initiation of therapy and weekly thereafter blood is drawn from the patient and subjected to a panel of tests which preferably include activated

peripheral blood mononuclear cell subsets by two-color flow cytometry,

lymphokines and soluble cell surface receptors by ELISA, and HIV-viral proteins

by Western blot analysis. The peripheral blood mononuclear cell subset analysis

will usually include either CD4⁺, CD8⁺, CD19⁺, CD25⁺, CD56⁺, and HLA-

DR alone, combined with one another, or combined with the quantification of

monocytes. The Western blot protein tests include gp-24, gp-17, gp-120 and gp-

160. The ELISA test measures TNF, sIL2R, sILl and soluble CD8. Every third week, it is preferred that cell cultures for HIV antibody neutralization, PCR and

reverse transcriptase determinations be made.

HIV-I Gene Therapy in Accordance with the Invention

Gene delivery thus far has been a method by which foreign genetic material is introduced into a suitable target cell usually via viral vectors. Such

strategy generally consisted of an ex vivo and an in vivo phase. In the ex vivo

phase the foreign gene is inserted into target cells derived from the recipient. The engineered cells containing the newly inserted gene are expanded ex vivo. In

the in vivo phase, the expanded engineered cells are transplanted into the recipient.

This modulatory therapy is the first of its kind which manages therapy

from cell surface signaling to genomic modulation utilizing the oral and/or

intravenous administration of nucleotides, without utilizing retiovirus, adenovirus

or other gene viral vectors traditionally employed in gene therapy. Gene therapy has not, heretofore, been utilized without cellular transfection with viral vectors,

and never before by oral or intravenous administration of nucleotides to humans.

Gene therapy has not, heretofore, been tried without the interaction of viral vectors, i.e. , by the administration of nucleic acid-based pharmaceutical agents orally and/or by intravenous route. The prototype drug defibrotide,

although administered to patients over the past 5-6 years, has never heretofore

been contemplated for gene therapy. In addition, in other modalities of gene

therapy, dosage has never been assessed by molecule markers. Molecule markers have never been defined within the system of secondary messengers, signal transduction systems, promoters (DNA sites which are on the same chromosome as the gene transcribed and to which RNA polymerase binds),

enhancers (DNA regions that control a promotor from a great distance,

sometimes as much as 30,000 bases), and transcription factors (diffusible

regulatory proteins which bind to DNA transcription activation domains and

regulate the rate of transcription by RNA polymerase).

HIV-disease has not been previously interpreted as a disease of dismodulation involving the genomes, cellular secondary messengers and cellular signal transduction systems. The specific pathways affected by the HIV-

retrovirus have not been clearly delineated. Therapy of HIV-disease has not

previously attempted to reclaim the affected cellular function systems from the virus by reversing the dismodulation at the various levels by using exogenous

therapy involving various modulators of these systems.

The therapeutic approach of the invention disengages itself from the

common practice of planning therapy based on clinical staging. The planning of

therapy is based on the identified mismodulations of (a) membrane lipids and cytoskeleton; (b) cell-surface receptor/ligand interactions; (c) secondary messengers; (d) signal transducers; (e) cellular transcription factors utilized in

viral replication: as well as based on the identified (f) oncogenes; (g) viral

transcription factors; and (h) viral genomes. The method of therapy disclosed

herein for HIV may also be used in treatment of other viral infections and

neoplasms. These mismodulations are classified into marker categories of (I) repair markers (items a - e) and (ii) disease markers (item f - h). The object of therapy

in accordance with the invention is to (I) reestablish repair markers at the

constitutively expressed tissue levels; and (ii) eliminate disease markers (in case

of the oncogenes to reverse the transformation).

Irrespective of disease stage or clinical status the patient is screened with

the complete panel of secondary messengers and signal transducers (repair

markers), since all repair markers are biochemically interdependent. Repair

markers reflect the underlying logic of transcriptional regulation. Therapy is aimed to concurrently induce some markers and suppress other markers. The prototype nucleotide if used at the correct doses (which are guided by the respective repair markers) can accomplish this goal.

Elimination of disease markers by the therapeutic nucleotide compound

will occur at various levels. It can be an indirect phenomenon based on

modulations of secondary messengers, such as cAMP; it can be a direct

phenomenon based on modulations of the phosphorylation events involving genes

and transcription factors. For example, cAMP activates protein kinase A enzymes, Ca²⁺ activates protein kinase C enzymes, the prototype nucleotide up-

regulates cAMP, and downregulates Ca²⁺, or it can be a direct phenomenon

based on modulation of cAMP responsive gene promoters (CREM, as enumerated above).

While not being bound to any specific mechanism of action, the following

are proposed. Proposed Mechanism A. Induction of sIL2R gene and HIV-I LTR are interdependent phenomena. If the protein kinase C dependent sIL2R gene is turned off by high cAMP levels, activation of HIV-I LTR is concurrently

suppressed as well.

Proposed Mechanism B. Increased cAMP levels have been shown to

induce viral replication (Nokta and Pollard, 1992, AIDS Research and Human

Retroviruses 8(7): 1255-1261). HIV-I REV/ENV genes are both

phosphoproteins. There may be other routes for cAMP-induced replication of

HTV-I. Although administration of the maximum efficacious dose will increase cAMP levels, prolonged administration of the nucleic acid at the maximum efficacious dose, so as to realize the successful administration of the maximum

therapeutic dose would culminate in declining cAMP levels, since vWAg

decreases on therapy if and once the maximum therapeutic dose is administered.

Hence administration of the maximum therapeutic dose is paramount in

overcoming cAMP induced viral replication. This phenomenon may at least

partially, be based on the induction of protein kinase C, as a secondary

biochemical event (i.e. , protein kinase C induces sILR2 gene, which in turn

modulates protein kinase C so as it can directly inhibit cAMP).

Proposed Mechanism C. The transcription factor NF-kB binds to both the HIV-I enhancer, and the sILR2 gene. Protein kinase C phosphorylates its

inhibitor IkB and releases active NF-kB. Increased cAMP levels by inhibiting

directly the Ca²⁺ induced activation of protein kinase C would modulate this

phosphorylation event, and downregulate the transcriptional activities related to NF-kB. Since NF-kB binds to both the HIV enhancer and IL2 receptor,

increased cAMP levels will downregulate HIV-I replication.

Proposed mechanisms B and C show that increased cAMP levels can be both deleterious and beneficial. It can be clearly seen that the prototype nucleotide is an overall "downregulator" of biochemical events, if maximum

therapeutic and efficacious dose levels are administered.

It has also been discovered that the co-administration of various sequence

specific, anti-sense or missense nucleic acids with, for example, defibrotide,

would (1) alleviate the complication of cAMP induced viral replication; (2) induce inhibition of viral replication mediated via modulations of cAMP, protein

kinase A, protein kinase C, cellular redox state, G-proteins, or cAMP induced

gene promoters (in this regard, defibrotide and other nucleotide derivatives introduce for the first time into anti-HIV therapy nucleotides with no sequence

specificity that concurrently modulate the totality of the cellular second

messenger/ signal systems for rapidly transducing extracellular signals into

specific patterns of gene expression in the nucleus); (3) concurrently induce

inhibition of viral replication with sense, anti-sense, or missense nucleic acids

(e.g. , DNA, mRNA, DNA/RNA ribosomes, inhibitors of viral protease, viral

integrase); and (4) introduce a modality of gene therapy (i.e. , genetic engineering) which can be safely administered to humans, which does not utilize

viral vectors, which can be administered either intravenous or orally, which

enables administration of sequence specific combination of nucleic acids adjusted specifically to the selected parts of the HIV -genome and cellular repair pathways, which adjust the dose so as to modulate selected genes or cellular/ viral molecules, which enables the most efficient administration of various different nucleotides with differing cellular uptake dynamics and chemical anti-viral potencies, and which administers excess DNA to enable the self-integration of DNA.

This process is superior to present viral vector directed gene therapy and would also enable competitive inhibition of proviral integration, and/or

dislocation of the integrated pro-virus. Cellular uptake dynamics would directly

define the anti-viral and genetic modulatory capacities of each respective

nucleotide. Nucleic acid derivatives having chemical modifications are as

described previously (e.g., nucleotides conjugated with poly(L-lysine) or which is modified by, for example, the addition of amino acids such as lysine, histidine and arginine, the addition of optimum concentrations of folate and/or biotin, the addition of the optimum ratios of metals and ions including zinc, manganese and

iodine, by the addition of 5'-polyalkyl moieties, cholesterol, vitamin E, 1-2-di-O-

hexadecyl-3-glyceryl and other lipophilic moieties and/or modified by the

replacement of phosphodiester bonds with phosphothiotate bonds) and

combination nucleic acids would be employed.

EXAMPLES

Example 1 To measure the effect of defibrotide on HIV it was first necessary to label the drug and determine whether defibrotide will enter the nucleus of the human cell. Knowing the phosphodiester linkages in defibrotide, its comparative nuclear penetration was assessed by labelling defibrotide with a photo-activatable

analogue of biotin. The biological activity of defibrotide after labelling was

considered to have been preserved since published data shows that previous oligonucleotide probes have been labelled with conjugates and still remained biologically active. Image analysis utilizing a cold CCD camera revealed that uptake of defibrotide was localized in the nucleus. This supports the hypothesis that the mechanism of efficacy for defibrotide is largely contributed to by its modulatory activity on the genetic material of the cell, no matter what disease

entity is being treated. As shown in Figures 2 and 3, the nuclear uptake of

defibrotide is directly proportional to the concentration of defibrotide with biotin.

The observed uptake supported the increased efficacy of defibrotide with the

larger doses used, and also supports the hypothesis that at critically high dose

levels various previously unknown different effects of defibrotide can be seen. It

was also observed that uptake by monocytes was significantly greater than that by

lymphocytes.

The cellular uptake of defibrotide without biotin and labelled with cyanine

dye Cy5.18 was also measured. It was observed that biotinylation of defibrotide

enhanced the cellular uptake of defibrotide in the lymphocyte population.

However, there was no difference in uptake between monocytes incubated with

biotinylated or fluorescently tagged defibrotide. This can be seen by comparing

Figures 4 and 5. Example 2

To further confirm the specificity of defibrotide for the treatment of HIV

infection, HTV infected peripheral blood mononuclear cells with varying doses of

defibrotide were evaluated by staining for all viral envelope proteins using concanavalin A (Con-A) stimulated and unstimulated cells (Anti-HIV 1 , and

Anti-HIV 3 specific Anti-HIV antibody). The blood sample was obtained from a patient using an evacuated blood collection tube containing sufficient EDTA to

prevent coagulation of the sample.

Mononuclear leukocytes (white cells) were obtained by layering a 1 : 1 (volume:volume) blood to RPMI 1640 tissue culture medium (Grand Island

Biological Co.) aliquot over histopaque (d = 1.077, Sigma Chemical Co.) under

sterile conditions. The white cell population was suspended in a solution of the

RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum

and gentamicin, at the concentration of 5 micrograms/milliliter. The white cells were then concentrated to a level of two million cells per three milliliters (2 x 10⁶

cells/3 ml) of the above solution. The white cells were collected in flat-bottomed

microtiter containers (Cell Wells, Corning).

The cell populations were further divided into two groups. One group

received stimulation by Con-A, the other group remained unstimulated by Con- A. Con-A stimulation enhances the uptake of the antibody-dye label by HIV-

contaminated cell components, thereby demonstrating an increase in the

expression of the HIV protein. Subpopulations of unstimulated and stimulated white cells were then

incubated in the presence of discrete concentrations of defibrotide. Each successive assay employed successively greater concentrations. A control sample

of incubate containing no defibrotide was also prepared. A labelling antibody

solution was prepared by directly conjugating Cy5.18 with human α-HIV

antibody to a final dye/protein ratio of 5.0 (α-HIV-Cy5.18).

The cell subpopulations were again divided into two groups, one group for intracellular antibody labelling, and one group for surface antibody labelling. Cells reserved for intracellular labelling were fixed with 70% ETOH, washed twice with monoclonal wash, and then resuspended into a solution containing 200

microliters of Hank's balanced salt solution (HBSS), supplemented with 2% FCS

and 0.1 % sodium azide (monoclonal wash) and 5 microliters of α-HIV-Cy5.18

solution. The entire cell preparation was incubated for 45 minutes at 4°C. The

cell preparation was then washed twice with the monoclonal wash, and

resuspended in 1 % paraformaldehyde.

Cells reserved for surface labelling were prepared by washing twice in

monoclonal wash to which 5 microliters of α-HIV-Cy5.18 have been added. Next, 20 microliters of specific surface glycoprotein monoclonal antibody was added to the incubation solution. The surface glycoprotein antibody solution

contained CD3-FΓTC (heterogenous T-cell antibody conjugated with fluorescein

isothiocyanate dye) and CD4-RPE (helper T-cell antibody conjugated with

phycoerythrin dye) obtained from Becton-Dickinson. All cells thus prepared were then analyzed using a Becton-Dickinson FACS 440 dual laser (argon/krypton) flow cytometer. The expression of HIV proteins was determined on a per-cell basis. Fluorescence was measured on a

logarithmic scale but converted to a linear scale for analysis.

Figure 7 shows HIV protein expression at selected dosages. Assay results

for the same sample shown in Figure 8 are in terms of the intensity of the fluorescence of certain antibody-labelled mononuclear leukocytes (Mean Linear Fluorescence Intensity). Fluorescence intensity is proportional to HTV protein expression, and thus the activity of HIV. It is seen that the expression of the

HIV proteins decreases and then levels off with increasing concentrations of

defibrotide.

Before administration of defibrotide, Con-A stimulated cells expressed 32% more viral proteins. However, after administration of 20 mg of defibrotide,

both stimulated and unstimulated cells express 70% less viral proteins. At 30 mg

concentration of defibrotide in both Con-A stimulated and unstimulated cells the

expression of viral proteins leveled off. This supports the specificity of

defibrotide for HIV-virus as well as the fact that if cells are induced to divide, translating into proliferation of the virus, more HIV virus can be killed, albeit, at higher doses.

Example 3

Patients with various diseases of vascular prothrombotic backgrounds

were treated with escalating dose levels of defibrotide. A variety of coagulation

and hematological assays with other molecular markers of inflammation, etc. , were conducted on blood samples drawn from the patient before and after each dose escalation. From an analysis of the test results and clinical observations, it was discovered that certain effects of defibrotide lead to a remission state of

certain specific aspects of disease states corresponding to the various dose ranges

employed.

As an example, hematological recovery in thrombotic microangiopathy,

generally, yet not exclusively, occurred when the patient received doses of

defibrotide ranging from 20 to 30 mg/kg/day. These doses however did not cure

the renal lesions since creatinine levels remained above normal (or only partially

corrected) at the dose levels where hematological recovery was complete. Renal recovery evidenced by normalization of creatinine levels occurred between 40

and 250 mg/kg/day.

Even in the presence of normalization of creatinine levels (the

conventional criteria of complete recovery) it was observed that complete

remission was yet to be reached by the observation of elevation of blood

pressure, low AgTPA and high fPAI levels. Therefore, doses of defibrotide

continued to be increased until blood pressure levels became normal. The dose elevation not only treated blood pressure, but also led to further improvement of

creatinine. Thus, treatment with marker-dependent doses, applied correctly, led

to a state of "cure".

Example 4

In a normal individual, increasing the DKGD dose does not induce any

elevation in the vWAg since there is no ongoing repair process, i.e. , no disease state. Doses administered to a normal individual, in contrast to the doses given to an individual exhibiting a pathological disease state, did not induce any alteration in vWAg levels, i.e. , defibrotide did not induce transcriptional activity at the genomic level. vWAg predicts the transcriptional rate of the respective repair molecules induced by the nucleotide and will guide the assessment of maximum efficacious dose and maximum therapeutic dose.

In a diseased individual, an increase in DKGD increases the preceding

minimum highest value of vWAg by an increment smaller in each successive

interval. Using defibrotide, the highest percentages of increments were found to occur at the borderline of 40 DKGD. Increasing DKGD above 400 induces only

negligible improvements over levels below this dose. In practice, this is the dose level above which complications of bleeding have been observed by the inventor

with high molecular weight defibrotide.

Examples 5-7

Examples 5-7 report the treatment of three HIV infected patients. This

patients were all treated in Turkey with defibrotide obtained from CRINOS. In

Tables I-IV, below, the following are the normal laboratory ranges: IL-1 = 3.6

pg; IL-2 = 4.3-4.8 pg; IL-6 = 7.1-7.3 pg; TNFα = 25.1-26.3 pg; cAMP =

0.4-0.6 nM; cGMP = 0.85-0.95 nM; normal cGMP/cAMP = 2.125; β₂- microglobulin = < 1900 μg/1.

Example 5

A 28-year old white HIV⁺/ARC male exhibiting waste syndrome, Herpes

labialis and Herpes genitalis associated with widespread tissue damage, oral/pharyngeal candidiasis, polyarthralgias and tuberculosis was treated with

defibrotide.

On Day 1 of treatment, a 360 mg/kg IV bolus of defibrotide was administered. Thereafter, a dose of 160-275 mg/kg/day was administered. Defibrotide was administered 86 days out of a 118 day treatment course.

Progressive increase in weight and amelioration of diarrhea was observed

throughout the therapy period, a total weight gain of 12 kg occurring during the

treatment period. Improvement in Karnofsky performance score started at day 3

and increased from a score of 3 to a score of 10 over the treatment period.

The effect on arthralgia was observed by the third consecutive day of

treatment and was found to be strictly dose dependent. Upon cessation of

therapy arthralgia relapsed to original condition and entered remission upon reinitiation of DNA therapy.

The effect on Herpes began on day 4 of treatment. By day 36 of the treatment period, genital Herpes lesions were in complete remission. By day 68,

Herpes labialis lesions were in complete remission. No relapses were seen with

temporary cessation of defibrotide.

(^β

Tables I and II summarize pertinent laboratory markers.

Table I

* N.D. = not determined

Table II

Elevated cAMP/cGMP was observed at the onset of therapy, signifying

activation of both protein kinase A and protein kinase C pathways. A progressive rise in absolute and T lymphocyte numbers, CD4 and CD 8 was seen. A decrease in IL1, IL-2, IL-6 and TNF-α was observed during treatment.

Complete remissions in accompanying disease states include Herpes

labialis, oropharyngeal candidiasis, arthralgia, and Herpes genitalis as well as

accompanying tissue damage. Complete normalization of TB findings (Chest x- ray) with apparent radiological remission occurred. Example 6

A 25-year old white HIV⁺ female was treated with defibrotide. At the

onset of therapy, the patient was asymptomatic but had a low CD4 count.

On day 1 of the treatment, a 200 mg/kg IV bolus of defibrotide was administered. Thereafter a dose of 150 - 275 mg/kg/day was administered. Anabolic effects of the DNA were seen by day 13.

DNA therapy was terminated after 29 days secondary to a rise of CD4 percent and absolute counts. DNA therapy was reinitiated 25 days later

secondary to a decline in CD4 percent and absolute counts. Therapy was

continued on an outpatient basis, intravenous administration being alternated with

oral administration.

Tables in and IV summarize pertinent laboratory data. In this patient, all tested interleukin levels were normal.

Table III

* N.D. = not determined • \

Table IV

Treatment was characterized by increases in CD4, CD8, total

lymphocyte, total T-lymphocyte counts accompanied by elevations in cAMP and

cGMP, and in therapy related decreases in IL-6 and TNF-α. A total weight gain of 7 kg was observed.

Example 7

A 33-year old white male with AIDS and opportunistic infections

including Herpes labialis associate with necrotic lesions, oral/pharyngeal

candidiasis, tuberculosis and crytococcal diarrhea.

On day 1 of treatment, a 200 mg/kg IV bolus was administered. Treatment at a dose of 100 - 250 mg/kg/day was continued until day 40. The lower doses being given on days 7 - 13 having been reduced secondary to

prolonged APTT. Treatment was thereafter discontinued due to unavailability of

the drug. The patient died 8 days following cessation of therapy.

An anabolic effect was seen from day 6. Diarrhea was controlled from

day 3 and cultures for cryptococcus became negative on day 15. Lesions of the

lip began healing on day 5 and were completely healed by day 18. Odynophagia improved from day 5. Performance score began improving by day 3, reaching

an optimum level of 5 between days 16 and 21.

Tables V and VI summarize pertinent laboratory data.

Table V

Table VI

Decline in elevated IL-1, IL-2 levels and complete normalization of TNF-

α levels was observed. An increase in 11-6 was seen with cessation of therapy.

At the time of death, a 3 kg weight gain was observed, and Herpes labialis and oral pharyngeal candidiasis were in complete remission.

Claims

CLAIMS;

1. A method of treating a disease condition in a patient selected from

the group consisting of infectious diseases, genetic diseases, degenerative

diseases, DNA damage, neoplasia, and skin diseases, comprising administering

to the patient an effective amount of a therapeutic compound comprising a

nucleic acid component of defibrotide, but not including defibrotide.

2. A method of treating a disease condition in a patient selected from

the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases comprising the following

steps:

(a) determining the initial state of a set of disease markers associated with the disease condition, the disease markers being clinically

observable characteristics of a patient which deviate from the normal condition

due to the disease state and wherein each disease marker in the set has a

predetermined reference range which is indicative of the normal condition,

defibrotide,

(c) screening a panel of second messengers and signal

transducers and selecting a repair marker, the intensity of which increases

following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal condition, said repair marker being the concentration of a compound which participates in a cellular regulatory pathway which operates through protein kinase A, protein kinase C, or G-protein,

(d) administering the therapeutic compound at a dose level

incrementally higher than the previous dose,

(e) repeating step (d) each time the intensity of the repair

marker increases following an incrementally higher dose,

(f) repeating steps (d) and (e) until the intensity of the repair

marker in step (c) no longer increases,

(g) continuing administration of the therapeutic compound at

the highest dose level attained in step (f) until the intensity of the repair marker returns to the normal condition, and

(h) administering the therapeutic compound at a dose level

and (g) with one or more additional repair markers until all disease markers of

said set of disease markers no longer deviate from the normal condition.

3. The method of claim 2 further comprising:

(i) monitoring repair markers selected in steps (c) and (h) for

3 weeks following the last dose of the therapeutic compound given in step (h)

and if the intensity of one or more repair markers deviate from the normal

condition, reinitiating therapy in step (g) at the highest dose level achieved in step (h).

4. A method of treating a disease condition in a patient selected from the group consisting of infectious diseases, genetic diseases, degenerative diseases, DNA damage, neoplasia, and skin diseases comprising the following

steps:

observable characteristics of a patient which deviate from the normal condition

due to the disease state and wherein each disease marker in the set has a

predetermined reference range which is indicative of the normal condition,

(b) administering to the patient a dose of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide,

(c) screening a panel of second messengers and signal

transducers and selecting a repair marker, the intensity of which increases

following administration of the therapeutic compound, where intensity is the extent to which the state of the repair marker differs from its state in the normal

condition, the repair marker being the concentration of a compound which

participates in a cellular regulatory pathway which operates through protein

kinase A, protein kinase C, or G-protein,

(d) administering the therapeutic compound at a dose level

incrementally higher than the previous dose,

(e) repeating step (d) each time the intensity of the repair

marker increases following an incrementally higher dose, (f) repeating steps (d) and (e) until the intensity of the repair marker in step (c) no longer increases,

(g) administering the therapeutic compound at the dose level

where the intensity of the repair marker no longer increases until the intensity of the repair marker returns to the normal condition,

(h) administering the therapeutic compound at a dose level

and (g) with one or more additional repair markers until all disease markers of

said set of disease markers no longer deviate from the normal condition, and

(i) administering the therapeutic compound at a dose level

incrementally higher than the previous dose given in step (h) and repeating steps

(c), (d), (e), (f) and (g) until the intensity of a universal marker returns to the

normal condition, the universal marker being a constitutively expressed molecule

which is transcriptionally activated by the therapeutic compound in all disease states.

5. The method of claim 4 further comprising:

(j) monitoring the universal marker for 3 weeks following the

last dose given in step (i) and if the intensity deviates from the normal condition,

reinitiating therapy at step (i) at the highest dose level achieved in step (i).

6. A method of treating a disease condition in a patient selected from

the group consisting of infectious diseases, genetic diseases, degenerative

diseases, DNA damage, neoplasia, and skin diseases comprising the following

steps: (a) determinin ngo the initial state of a set of disease markers

associated with the disease condition, the disease markers being clinically

observable characteristics of a patient which deviate from the normal condition due to the disease state and wherein each disease marker in the set has a

predetermined reference range which is indicative of the normal condition,

(b) administering to the patient a dose of a therapeutic

compound comprising a nucleic acid component of defibrotide, but not including

defibrotide, wherein the dose of the therapeutic compound is at a level which raises a universal marker to at least five times its normal level, the universal marker being a constitutively expressed molecule which is transcriptionally

activated by the therapeutic compound in all disease states, and

(c) continuing to administer the therapeutic compound at the

dose level of step (b) until the universal marker returns to its normal level.

7. The method of claim 6 wherein the universal marker is vWAg.

8. The method of claim 7 further comprising:

(d) monitoring the universal marker for 3 weeks following the

last dose given in step (c) and if the intensity deviates from the normal condition,

reinitiating therapy at step (c).

9. The method of claim 2, wherein the disease condition is HIV

infection, wherein HIV is not expressed by said patient, and the concentration of

at least one immunological molecule is elevated above the normal level

comprising: a) administering to the patient an effective amount of a

therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide, wherein the effective amount is the amount which causes a universal marker to rise at least five times its normal level, the universal

marker being the concentration of a constitutively expressed molecule which is

transcriptionally activated by the therapeutic compound in all disease states, and

b) continuing to administer the effective amount of the therapeutic compound until the universal marker returns to its normal level.

10. The method of claim 9 wherein said immunological molecule is selected from the group consisting of CD4, CD25, IL-l, IL-3, IL-4, IL-6, TNF and sIL2R.

11. The method of claim 9 wherein the universal marker is the

concentration of vWAg.

12. A method of treating a patient having a HIV associated disease

state selected from the group consisting of tuberculosis, chronic wasting

syndrome, and Herpesvirus infection comprising administering to an individual

in need thereof an effective amount of a therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.

13. A method of stimulating tissue repair associated with HIV infection comprising:

administering to a patient in need thereof, an effective amount of a

therapeutic compound comprising a nucleic acid component of defibrotide, but not including defibrotide.

14. The method of claim 2 wherein the disease condition is HIV

infection and wherein said disease marker is selected from the group consisting

of odynophagia, arthralgia, Herpes labialis, Herpes genitalis, cryptosporidium

diarrhea, Karnofsky performance score, waste syndrome, oral and pharyngeal

candidiasis, and tuberculosis.

15. The method of claim 2 wherein said repair marker is selected from

the group consisting of cAMP, cGMP, IL-l, IL-2, TNF-╬▒, IL-6, cGMP/cAMP

ratio, total lymphocyte count, T lymphocyte count, CD4 count, CD8 count,

cAMP dependent protein kinase A enzyme, adenylate cyclase, G-protein,

phosphoinositol, protein kinase C enzyme, inositol triphosphate, diacylglycerol,

intracellular calcium level, intracellular calcium ion level, c-myc, ras, c-fos, c-

jun, NK-kB, EIAI, AP-1, COUP, TCF-l╬▒, TATA, TAT element, oxygen

radical, CREB, CREM, Platelet Derived Growth Factor (PDGF), Colony

Stimulating Factor (CSF), Epidermal Growth Factor (EGF), Insulin Growth Factor

(IGF), cytosolic tyrosine kinase, src, Src Homology 2 (SH2) domain, Src

Homology 3 domain (SID), serine/threonine kinase, Mitogen Activated Protein

Kinase (MAP Kinase), Cytokine Receptor Superfamily, Signal Transducers and

Activators of Transcription (STATs), JAJ1, JAK2, Tumor Necrosis Factor

-Receptor 1 signal Transducer TRADD, chemokines of Rantes, and MIP- Alpha,

and MIP-Beta.

16. The method of claim 1 wherein the nucleic acid component of

defibrotide is an oligonucleotide from about 6 nucleotides to less than 60

nucleotides in length.

17. The method of claim 1 wherein the nucleic acid component of defibrotide is selected from the group consisting of dCTP, dATP, dGTP, dTTP, dAMP, dGMP, dCDP, dADP, ATP, AMP, CTP, CMP, UTP, cyclic TMP,

cyclic UMP, cyclic GMP, GGTTGGATTGGTTGG (SEQ ID NO: l),

GGTTGGATCGGTTGG (SEQ ID NO:2), GGATGGATCGGTTGG (SEQ ID

NO:3) and GGTGGTGGTTGTGGT (SEQ ID NO:4).

18. The method of claim 1 wherein the nucleic acid component is a

variant of an oligonucleotide selected from the group consisting of

GGTTGGATTGGTTGG (SEQ ID NO: l), GGTTGGATCGGTTGG (SEQ ID

NO:2), GGATGGATCGGTTGG (SEQ ID NO:3) and GGTGGTGGTTGTGGT

(SEQ ID NO:4).

19. The method of claim 1 wherein the nucleic acid component is an

oligonucleotide comprising the sequence of GGTGGTGGTTGTGGT (SEQ ID

NO:4) and wherein said oligonucleotide is not a naturally existing nucleic acid

component of defibrotide.

20. The method of claim 18, wherein the variant containing a

sequence selected from the group consisting of HIV sequences, sequences

encoding cellular regulatory factors and mitochondrial sequences.

21. The method of claim 20, wherein the variant is selected from the

group consisting of

GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCCCTT

G (SEQ ID NO: 15), ACCAGAGCCAACAGC (SEQ ID NO: 16), and

CCTGGCCTTCCCTTG (SEQ ID NO: 17).

22. The method of claim 1 wherein the nucleic acid component is an

oligonucleotide from about 25 nucleotides to about 30 nucleotides long and has a molecular weight of about 8171.58 Dalton.

23. The method of claim 1 wherein the nucleic acid component is an

oligonucleotide from about 25 nucleotides to about 30 nucleotides long and has a molecular weight of about 8433.75 Dalton.

24. The method of claim 1 wherein the nucleic acid component of

defibrotide is administered in combination with one or more sequence specific

nucleic acid.

25. The method of claim 1 wherein the sequence specific nucleic acid

is selected from the group consisting of

an anti-protease sequence, a retroviral promoter sequence,

a TAR sequence,

a HTV mutant of TAR decoy RNA, a mutant TAR decoy RNA,

a negative mutant of the viral REV transactivator,

a synthetic promoter with the consensus sequence for binding of the

transcription factor a Spl and the TATA box,

a mutant of TATA box, a TAT mutant wherein the mutations involving the seven cysteine

residues, a sense, anti-sense, missense derivative of CIS acting negative elements

(CRS) present in the integrase gene and REV mutant,

a transdominant suppressor of REV (mutations involving amino acid 78

and 79), a NEF-cDNA sequence and its mutant with or without U3 region

sequence of the 3'LTR, a POL reverse transcriptase gene mutant,

a POL viral integrase gene and its mutant,

a POL viral protease gene mutant, a HTV-I LTR enhancer (-137 to -17) mutant, a HTV LTR promoter starting at -78,

a HTV LTR sequence encoding a arginine fork from aa27 to aa38,

a HTV-I LTR sense sequence of the negative regulatory element (-340 to -

185), a HTV-l LTR consensus sequence for binding of transcription factors of API/COUP, NFAT-1, USF, TCF-╬▒, NF-KB, TCF-la, TBP, and an inhibitor of

the consensus sequence,

a LTR NF B mutant (-104 to -80),

a LTR Spl (GC box) binding site and TATA box mutant,

a LTR GAG gene sequence mutant,

a LTR mutant (-454 to + 180),

a LTR genomic repeat at +80, a LTR region responsive for cellular transcription factors between and to

the left of U3 to -454 extending to -7,

a 3' LTR and its variant,

a 5' LTR and its variant, a LTR variant,

an inhibitor of UBP-1 or LBP-1 binding sequence (-5 to +82),

a ENV, GAG, POL gene sequences placed 3' of the REV mutant codon,

a short sequence mutant (15-60 mer) and a host DNA sequence of preferred targets for proviral integration.

26. The method of claim 1 wherein said nucleic acid component of

defibrotide is a nucleic acid derivative.

27. The method of claim 1 wherein the dose of the therapeutic

compound is from about 0.1 mg/kg patient body weight per day to about 1000

mg/kg patient body weight per day.

28. The method of claim 1 wherein the dose of the therapeutic

compound is from about 40 mg/kg patient body weight per day to about 600

mg/kg patient body weight per day.

29. The method of claim 1 wherein the nucleic acid component of

defibrotide is administered in combination with an amino acid selected from the group consisting of threonine, serine, tyrosine, and proline.

30. The method of claim 1 wherein the nucleic acid component of

defibrotide is administered in combination with a N-containing ring compound selected from the group consisting of pyrimidine, purine, adenylic acid, and

guanosine.

31. A method of treating a disease condition in a patient selected from

the group consisting of infectious diseases, genetic diseases, degenerative

diseases, DNA damage, neoplasia, and skin diseases, comprising administering

to the patient an effective amount of a therapeutic compound comprising an

oligonucleotide containing a homologous sequence of HIV and a gene encoding a

cellular regulatory factor.

32. The method of claim 31 wherein the cellular regulatory factor is

selected from the group consisting of human TNF receptor, mouse TNF-receptor

CCCR5, human RIP protein kinase, IL-2 receptor, TNF receptor/cell death

protein, IL-la, TNF-╬▒, c-myc, c-abl, c-fos, c-ras, dystrophin, surface

glycoprotein proteins of L-CAM and cathedrin, and B-myb.

33. The method of claim 32 wherein the oligonucleotide is selected

from the group consisting of CAGCTGCACCTGCCAAGC (SEQ ID NO: 5),

ATAAAATATACCATATACA (SEQ ID NO:6),

TCATAAAATATACTATATTCA (SEQ ID NO:7), ATATTAAAGAACGCTGTTTACAATACTTGG (SEQ ID NO: 8), ATGCAGTTGTGAAGAGAA (SEQ ID NO:9),

AATTAAGGCATAAGAAAACTAAGAAATATGCAC (SEQ ID NO: 10),

TCTCTCCCTCAAGGACTCAGCTTTCTGAAG (SEQ ID NO: 11),

CAATAATAAAAGGGGAAA (SEQ ID NO: 12),

AGTGCAACCGGCAGGAGGTGA (SEQ ID NO: 13), and GCCACCAGCCCCTCCCCAGACTCTCAGGTGGAGGCAACAG (SEQ ID

NO: 14).

34. The method of claim 31 wherein the oligonucleotide is administered in combination with a homologous sequence of a gene encoding a cellular

regulatory factor and GGTGGTGGTTGTGGT (SEQ ID NO:4).

35. The method of claim 34 wherein the cellular regulatory factor is

selected from the group consisting of myc, TNF receptor, ras, abl, bcl, fos, IL-

1, and musnos.

36. An oligonucleotide consisting of a sequence selected from the

group consisting of CAGCTGCACCTGCCAAGC (SEQ ID NO:5),

ATAAAATATACCATATACA (SEQ ID NO:6), TCATAAAATATACTATATTCA (SEQ ID NO:7), ATATTAAAGAACGCTGTTTACAATACTTGG (SEQ ED NO:8),

ATGCAGTTGTGAAGAGAA (SEQ ID NO:9),

AATTAAGGCATAAGAAAACTAAGAAATATGCAC (SEQ ID NO: 10),

TCTCTCCCTCAAGGACTCAGCTTTCTGAAG (SEQ ID NO: 11),

CAATAATAAAAGGGGAAA (SEQ ID NO: 12),

AGTGCAACCGGCAGGAGGTGA (SEQ ID NO: 13), GCCACCAGCCCCTCCCCAGACTCTCAGGTGGAGGCAACAG (SEQ ID

NO: 14).

GGGCTGTTGGCTCTGGTCTGCTCTGAAGGAAATTCCCTGGCCTTCCCTT

G (SEQ D NO: 15), ACCAGAGCCAACAGC (SEQ ID NO: 16), and CCTGGCCTTCCCTTG (SEQ ID NO: 17).

37. An oligonucleotide comprising the same sequence of an oligonucleotide of defibrotide obtainable via passing defibrotide through a C8 HPLC column and eluting with 0.1% TFA in water, wherein the length of the oligonucleotide of defibrotide is from about 25 to about 30 nucleotides and the molecular weight is 8171.58 Dalton, and wherein the oligonucleotide is not a

naturally existing nucleic acid component of defibrotide.

38. A vector comprising an origin of replication and a sequence of the oligonucleotide in claim 36.

39. The vector of claim 38 further comprising a sequence encoding an

origin of replication of mitochondrion.

40. The vector of claim 39 wherein the sequence encoding an origin of

replication of mitochondrion is from a human.

41. The vector of claim 40 wherein the sequence is selected from the group consisting of 5' end of mitochondrial 12S RNA containing sequences from

nucleotide 72 to 1025 and mitochondrial DNA containing sequences from

nucleotide 1 to 72.

42. The vector of claim 40 further comprising a promoter sequence

selected from the group consisting of TAR promoter, HIV LTR promoter, and

promoter of DNA polymerase.

43. The vector of claim 42 further comprising a sequence encoding

DNA polymerase.

44. The method of claim 1,2,4,6, 12 or 13 wherein the therapeutic compound comprising the vector of claim 38.

45. The method of claim 44 wherein the therapeutic compound is administered in combination with DNA polymerase, protease inhibitor, or

reverse transcriptase.

46. A method of treating a patient having a resistance to a drug

comprising administering an effective amount of a nucleic acid component of defibrotide in combination with the drug.

47. The method of 46 wherein the drug is protease inhibitor.

48. The method of claim 1 wherein the disease condition is HIV

infection.

49. An oligonucleotide comprising the same sequence of an oligonucleotide of defibrotide obtainable via passing defibrotide through a C8 HPLC column and eluting with 0.1% TFA in water, wherein the length of the oligonucleotide of defibrotide is from about 25 to about 30 nucleotides and the molecular weight is 8433.75 Dalton, and wherein the oligonucleotide is not a naturally existing nucleic acid component of defibrotide.

50. A method of treating a disease condition in a patient selected from

the group consisting of infectious diseases, genetic diseases, degenerative

diseases, DNA damage, neoplasia, and skin diseases, comprising administering

to the patient an effective amount of defibrotide in combination with one or more

sequence specific nucleic acid.

51. The method of claim 50 wherein defibrotide is administered in

combination with one or more sequence specific nucleic acid and one or more sequence specific peptide.

52. The method of claim 51, wherein a nucleic acid component of defibrotide is administered in combination with one or more sequence specific

nucleic acid and one or more sequence specific peptide.