CA2258291A1 - A recombinant enzyme with mutanase activity - Google Patents

Abstract

The present invention relates to method for constructing an expression vector comprising a mutanase gene obtained from a filamentous fungus suitable for heterologous production comprising the steps of a) isolating a DNA sequence encoding a mutanase from a filamentous fungus, b) introducing a kex2-site or kex2-like site between the DNA sequences encoding the pro-peptide and the mature region of the mutanase, c) cloning the DNA sequence obtained in step b) into a suitable expression vector. The invention also relates to a recombinant expression vector comprising said mutanase gene sequence and a kex2 cleavage site between the DNA sequence encoding the pro-peptide and the region encoding the mature mutanase, a filamentous fungus host cell, a process for producing recombinant mutanase and a recombinant mutanase. It is also the object of the invention to provide compositions useful in oral care products for humans and animals.

Description

CA 022~8291 1998-12-1~

WO 98/00525~ 1 PCT/DK97/00283 Title: A recombinant enzyme with mutanase activity FIELD OF THE lNvk..llON
The present invention relates to a method for constructing an 5 expression vector comprising a mutanase gene obtained from a filamentous fungus suitable for heterologous production, a re-combinant expression vector comprising said mutanase gene sequence and a kex2 cleavage site between the DNA sequence encoding the pro-peptide and the DN~ sequence encoding the mature 10 mutanase, a filamentous fungus host cell, a process of producing recombinant mutanase, and said recombinant mutanase.
It is also the object of the invention to provide compositions useful in oral care products for humans and animals.

15 B~CK~R~UND OF T~E INVENTION
Mutanases are a-1,3-glucanases (also known as a-1,3-glucanohydrolases) which degrade the a-1,3-glycosidic linkages in mutan. Mutanases have been described from two species of Tricho-derma (Hasegawa et al., (1969), Journal of Biological Chemistry 20 244, p. 5460-5470; Guggenheim and Haller, (1972), Journal of Dental Research 51, p. 394-402) and from a strain of Streptomyces (Takehara et al., (1981), Journal of Bacteriology 145, p. 729-735), Cladosporium resinae (Hare et al. (1978), Carbohydrate Research 66, p. 245-264), Pseudomonas sp. (US patent no.
25 4,438,093), Flavobacterium sp. (JP 77038113), Bacillus circulanse (JP 63301788) and Aspergillus sp.. A mutanase gene from Tricho-derma harzianum has been cloned and sequenced (Japanese Patent No. 4-58889-A from Nissin Shokuhin Kaisha LDT).
Although mutanases have commercial potential for use as an 30 antiplaque agent in dental applications and personal care pro-ducts, e.g., toothpaste, chewing gum, or other oral and dental care products, the art has been unable to produce mutanases in significant quantities to be commercial useful.
US patent no. 4,353,891 (Guggenheim et al.) concerns plac~e 35 removal using mutanase produced by Trichoderma harzianum CBS
~ 243.71 to degrade mutan synthesized by cultivating Streptococcus CA 022~8291 1998-12-l~

mutans strain CBS 350.71 identifiable as OMZ 176.
It is an object of the present invention to provide a recom-binant mutanase from Trichoderma harzianum which can be produced in commercially useful quantities.

BRIEF DESCRIPTION OF THE DRAWING
Figure 1 shows plasmid pMT1796 Figure 2 shows plasmid construction of plasmids pMT1796, pMT1802, and pMT1815, 10 Figure 3 shows an outline of the construction of the A. oryzae recombinant mutanase expression vector pMT1802, Figure 4 shows the pH-profile of recombinant and wild-type T.
harzianum CBS 243.71 mutanase Figure 5 shows the temperature profile of recombinant and wild-15 type T. harzianum CBS 243.71 mutanase at pH 7, Figure 6 shows the temperature stability of recombinant and wild-type T. harzianum CBS 243.71 mutanase at pH 7, Figure 7 shows the indirect Malthus standard curve for a mix culture of S. mutans, A. viscosus and F. nucleatum grown in 20 BHI at 37~C.

SUMM~RY OF THE lNV~iNllON
The object of the invention is to provide a recombinant mutanase derived from a filamentous fungus by heterologous 25 expression.
The present inventors have as the first been able to express the mutanase gene of a filamentous fungus heterologously and thus cleared the way for providing a single component, recom-binant mutanase essentially free of any contaminants.
30 In the first aspect the invention relates to a method for constructing an expression vector comprising a mutanase gene obtained from a filamentous fungus suitable for heterologous production comprising the steps of:
a) isolating a DNA sequence encoding a mutanase from a 35 filamentous fungus, b) introducing a kex2 site or kex2-like site between the DNA
sequences encoding the pro-peptide and the mature region of the CA 022~829l l998- l2- l~

W098/00528 PCT~K97/00283 mutanase, or replacing the mutanase (pre)pro-sequence with a (pre)pro-sequence comprising a kex2 or kex2-like site of another fungal enzyme, c) cloning the DNA sequence obtained in step b) into a suitable 5 expression vector.
In a preferred embodiment the mutanase is obtained from a strain within the genus Trichoderma.
In step b) the mutanase (pre)pro-sequence may for instance be replaced with the Lipolase~ (pre)pro-sequence or the TAKA-lo amylase (pre)pro-sequence.
It is also an object of the invention to provide an ex-pression vector comprising a mutanase gene and a DNA sequence encoding a (pre)pro-peptide with a kex2 site or kex2-like site between the DNA sequences encoding said (pre)pro-peptide and 15 the mature region of the mutanase.
The invention also relates to a filamentous host cell for production of recombinant mutanase derived from a filamentous fungus. Preferred host cells include filamentous fungi of the genera Trichoderma, Aspergillus, and Fusarium.
Further, the invention relates to a process for producing a recombinant mutanase in a host cell, comprising the steps:
a) transforming an expression vector comprising a mutanase gene with a kex2 site or kex2-like site between the DNA sequences encoding the pro-peptide and the mature region of the mutanase 25 into a suitable filamentous fungus host cell, b) cultivating the host cell in a suitable culture medium under conditions permitting expression and secretion of an active mutanase, c) recovering and optionally purifying the secreted active re-30 combinant mutanase from the culture medium.
The expression vector may be prepared according to the abovedescribed method of the invention.
A recombinant mutanase may according to the invention be produced according to the process of the invention.
35 A substantially pure wild-type mutanase obtained from ~ri-choderma harzianum CBS 243.71 essentially free of any contaminants is also part of the invention.

CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 The invention also relates to a composition comprising a recombinant mutanase of the invention or a substantially pure mutanase of the invention useful in oral care products and -food, feed and/or pet food products.
s Finally the invention relates to the use of the recombinant mutanase of the invention or the substantially purified mutanase of the invention or composition or product of the invention preventing the formation of human or animal dental plaque or removing dental plaque and for the use in food, feed and/or pet 10 food products.

DET~TT~n DESCRIPTION OF THE lNv~lON
The object of the invention is to provide a recombinant muta-nase derived from a filamentous fungus by heterologous 15 expression.
The present inventors have as the first been able to express the mutanase gene of a filamentous fungus heterologously and thus cleared the way for providing a single component recombinant mutanase essentially free of any contaminants.
The principle of the invention can be used for all mutanases derivable from filamentous fungi, such as from filamentous fungi of the genus Trichoderma, such a strain of Trichoderma harzianum, especially Trichoderma harzianum CBS 243.71, and the genera Streptomyces, Cladosporium or Aspergillus.
2s Previously it has not been possible to produce mutanases of filamentous fungi heterologously. Consequently, according to prior art mutanases are produced homologously and comprise a mixture of other enzyme activities besides the mutanase (i.e.
with undesired contaminants).
An example of this is Trichoderma harzianum CBS 243.71 which are known to produce a mutanase as also described above. The mutanase derived from Trichoderma harzianum CBS 243.71 has before the successful findings of the present invention only been produced homologously.
3s It is advantageous to be able to produce the mutanase hete-rologously, as it is then possible to provide a single component mutanase free of undesired contaminants. Further, it CA 022~829l l998- l2- l~

W098/00528 PCT~K~7/00283 facilitates providing an isolated and purified enzyme of the invention in industrial scale.
According to the invention it is possible to express mutanases derived from filamentous fungi in a suitable host 5 cell by introducing a kex2 cleavage site or ~ex2-like site between the DNA sequences encoding the pro-peptide and the mature mutanase, or replacing the mutanase (pre)pro-sequence with a (pre)pro-sequence comprising a kex2 site or kex2-like site of another fungal enzyme.
lo The (pre)pro-sequence have for instance be the Lipolase~
(pre)pro-sequence or the TAKA-amylase (pre)pro-sequence.

Pro-peptides A large number of mature proteins are initially synthesised 15 with a N-terminal extension, the pro-peptide, varying from very small peptides (e.g. GLA 6 amino acids) to relatively long pep-tides (e.g. PEPA 49 amino acids).
The pro-peptide can perform a number of different functions.
Firstly, pro-peptides might contribute to the efficiency of co-20 translational translocation of the protein across the ER-mem-brane. Secondly, pro-peptides might contribute to co-transla-tional proteolytic processing of the polypeptide. Thirdly, they might act as intracellular targeting signal for routing to specific cellular compartments. Fourthly, in some pro-proteins 25 the pro-peptide keeps the protein inactive until it reaches its site of action.
Removal of the pro-peptide from the mature protein occurs in general by processing by a specific endopeptidase, usually after the two positively charged amino acid residues Arg-Arg, 30 Arg-Lys or Lys-Arg. However, also other amino acid combinations, containing at least one basic amino acid, have been found to be processed.
The absence of these doublets in mature, endogenous secreted proteins might protect them from proteolytic cleavage. As di-35 basic cleavage is thought to occur in the Golgi, the internaldi-basic peptide sequences in cytoplasmic proteins will not be attacked by this processing.

CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 Rex2 sites Kex2 sites (see e.g. Methods in Enzymology Vol 185, ed. D.
Goeddel, Academic Press Inc. (1990), San Diego, CA, "Gene 5 Expression Technology") and kex2-like sites are di-basic recog-nition sites (i.e. cleavage sites) found between the pro-peptide encoding region and the mature region of some proteins.
Insertion of a kex2 site or a kex2-like site have in certain cases been shown to improve correct endopeptidase processing at o the pro-peptide cleavage site resulting in increased protein secretion levels.
However, in a number of other cases insertion of a Kex2 cleavage site did not increase the secretion level. For instance, Cullen et al., (1987), Bio/Technology, vol. 5, p.
15 369-376, found that insertion of a kex2 site in the secretion signal of chymosin (i . e . signal peptide and pro-peptide), which encoded the glucoamylase signal peptide and pro-peptide fused to prochymosin, did not increase the secretion level of recombinant chymosin expressed in a Aspergillus nidulans host 20 cell.
Other examples of references showing that insertion of a kex2 site or a kex2-like site do not always increase the secretion level include Valverde et al., (1995), J. of Biolog.
Chem, p. 15821-15826) 2 5 In the context of the present invention the term "heterologous" production means expression of a recombinant enzyme in an host organism different from the original donor organism or expression of a recombinant enzyme by the donor organism.
The term "homologous" production means expression of the wild-type enzyme by the original organism.
In the first aspect the invention relates to a method for construction of an expression vector comprising a mutanase gene suitable for heterologous production comprising the steps of:
35 a) isolating a DNA sequence encoding a mutanase from a filamentous fungus known to produce a mutanase, CA 022~8291 1998-12-1~

W098/OOS28 PCT~K97/00283 b) introducing a kex2 site or kex2-like site between the DNA
sequences encoding the pro-peptide and the mature region of the mutanase, or replacing the mutanase (pre)pro-sequence with a (pre)pro-sequence comprising a kex2 or kex2-like site of 5 another fungal enzyme, c) cloning the mutanase gene with the kex2 site or kex2-like site obtained in step b) into a suitable expression vector.
In a preferred embodiment of the mutanase gene is obtained from the genus Trichoderma, preferably a strain of the species lO T. harzianum, especially the strain T. harzianum CBS 243.71.
The complete mutanase gene DNA sequence derived from Trichoderma harzianum CBS 243.71 is shown in SEQ ID No. l In step b) the mutanase (pre)pro-sequence may for instance be replaced with the Lipolase~ (pre)pro-sequence or the TAKA-15 amylase (pre)pro-sequence.
In the examples below illustrating the present invention a kex2-site is inserted into the Tric~oderma harzianum mutanase gene presented in SEQ ID No. l as the site specific mutation E36 ~ K36.
Isolation of the mutanase gene The DNA sequence encoding a mutanase may, in accordance with well-known procedures, conveniently be isolated from DNA from a suitable source, such as any of the above mentioned organisms 2s known to comprise a mutanase gene, by use of synthetic oligo-nucleotide probes prepared on the basis of the DNA sequence disclosed herein.
For instance, a suitable oligonucleotide probe may be pre-pared on the basis of the nucleotide sequences shown in SEQ ID
30 no. l or the amino acid sequence shown in SEQ ID no. 2 or any suitable sub-sequence thereof.
According to this method primers are designed from the knowledge to at least a part of SEQ ID No. 2. Fragments of mutanase gene are then PCR amplified by the use of these 35 primers. These fragments are used as probes for cloning the complete gene.

CA 022~8291 1998-12-1~

WO 98/OQ5'~ PCTIDK97/00283 Alternatively, the DNA sequence encoding a mutanase may be isolated by a general method involving - cloning, in suitable vectors, a DNA or cDNA library from a strain of genus Trichoderma, 5 - transforming suitable host cells with said vectors, - culturing the host cells under suitable conditions to express any enzyme of interest encoded by a clone in the DNA
library, - screening for positive clones by determining any mutanase o activity of the enzyme produced by such clones, and - isolating the DNA coding an enzyme from such clones.
The general method is further disclosed in WO 93/11249 the contents of which are hereby incorporated by reference.

15 Expression vector In another aspect the invention relates to an expression vector comprising a mutanase gene and a DNA sequence encoding a pro-peptide with a kex2 site or kex2-like site inserted between the DNA sequences encoding said pro-peptide and the mature 2 0 region of the mutanase.
In preferred embodiments of the invention the expression vector comprises besides the kex2 site or kex2-like site an operably linked DNA sequence encoding a prepro-peptide (i.e.
signal peptide and a pro-peptide). The prepro-sequence may 25 advantageously be the original mutanase signal-sequence or the Lipolase~ signal-sequence or the TAKA signal-sequence and the original mutanase pro-sequence or the Lipolase~ pro-sequence or the TAKA pro-sequence.
The promoter may be the TAKA promoter or the TAKA:TPI
30 promoter.
In a specific embodiment of the invention the expression vector is the pMT1796 used to illustrate the concept of the invention in Example 3 below.
The choice of vector will often depend on the host cell into 35 which it is to be introduced.
Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the CA 022~8291 1998-12-l~

W098/00528 PCT~K97/00283 replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into 5 which it has been integrated.
In the vector, the DNA sequence encoding the mutanase should also be operably connected to a suitable promoter and terminator sequence. The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and o may be derived from genes encoding proteins either homologous or heterologous to the host cell.
The procedures used to ligate the DNA sequences coding for the mutanase, a prepro-sequence including the kex2 site or kex2-like site, the promoter and the terminator, respectively, 15 and to insert them into suitable vectors are well known to persons skilled in the art (cf., for instance, Sambrook et al., (1989), Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, NY).

20 Host Cell A third aspect of the invention relates to a filamentous fungi host cell for production of recombinant mutanase derived from a filamentous fungus of the genus Trichoderma, such as a strain of T. harzianum, especially T. harzianum CBS 243.71, or 25 the genus Aspergillus, such as a strain of A. oryzae or A.
niger, or a strain of the genus Fusarium, such as a strain of Fusarium oxysporium, ~usarium graminearum (in the perfect state named Gribberella zeae, previously Sphaeria zeae, synonym with Gibberella roseum and Gibberella roseum f. sp. cerealis)~ or 30 Fusarium sulphureum (in the prefect state named Gibberella - puricaris, synonym with Fusarium trichothecioides, Fusarium bactridioides, Fusarium sambucium, Fusarium roseum, and Fusarium roseum var. graminearum), Fusarium cerealis (synonym with Fusarium crokkwellnseJ or Fusarium venenatum.
35 The host cell may advantageously be a F. graminearum described in WO 96/00787 (from Novo Nordisk A/S), e.g. the strain deposited as Fusarium graminearum ATCC 20334. The strain ATCC

CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 20334 was previously wrongly classified as Fusarium graminearum (Yoder, W. and Christianson, L. 1997). RAPD-based and classical taxonomic analyses have now revealed that the true identity of the Quorn fungus, ATCC 20334, is Fusarium venenatum Nirenburg 5 Sp. nov.
In a preferred embodiment of the invention the host cell is a protease deficient or protease minus strain.
This may for instance be the protease deficient strain Aspergillus oryzae JaL125 having the alkaline protease gene o named "alp" deleted. This strain is described in PCT/DK97/00135 (from Novo Nordisk A/S).
Filamentous fungi cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a 15 manner known per se. The use of Aspergillus as a host microorganism is described in EP 238 023 (Novo Nordisk A/S), the contents of which are hereby incorporated by reference.
According to a further aspect the invention relates to a process for producing a recombinant mutanase in a host cell. Said 20 process comprises the following steps:
a) transforming an expression vector encoding a mutanase gene with a kex2 site or a kex2-like site between the DNA sequences encoding the pro-peptide and the mature region of the mutanase into a suitable filamentous fungus host cell, 25 b) cultivating the host cell in a suitable culture medium under conditions permitting the expression of the expression vector, c) recovering the secreted recombinant mutanase from the culture medium, d) and optionally purifying the recombinant mutanase.
The recombinant expression vector may advantageously be any of the above described.
Further, the filamentous fungi host cells to be used for production of the recombinant mutanase of the invention according to the process of the invention may be any of the 35 above mentioned host cell, especially of the genera Aspergillus, Fusarium or Trichoderma.

CA 022~829l l998-l2-l~

W098/00528 PCT~K~7/00283 The medium used to culture the transformed host cells may be any conventional medium suitable for growing the host cells in question. The expressed mutanase is secreted into the culture medium and may be recovered from there by well-known procedures 5 including separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous com-ponents of the medium by means of a salt such as ammonium sulphate, followed by chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
It is also an important object of the invention to provide a recombinant mutanase produced according to the process of the invention.
The isolated recombinant mutanase has essentially an amino acid sequence as shown in SEQ ID no. 2. From SDS-PAGE a mole-15 cular weight around 80 kDa was found.
The pH optimum of the recombinant mutanase was found to liein the range from 3.5 to 5.5 which equals the pH optimum of the wild-type mutanase (see Figure 4). The temperature optimum of both the recombinant and wild-type mutanase was found to be 20 around 45~C at pH 7 and around 55~C at pH 5.5 (see Figure 5).
Further, the residual activity starts to decline at 40~C at pH
7, while the enzyme is more stable at pH 5.5, where the residual activity starts to decline at 55~C.
The inventors have also provided a substantially pure wild-25 type mutanase obtained from Trichoderma harzianum CBS 243.71essentially free of any active contaminants, such as other enzyme activities.

Composition It is also an object of the invention to provide a composition comprising the recombinant mutanase of the invention or the purified wild-type mutanase essentially free - of any active contaminants of the invention.

Oral care comPosition ....

CA 022~8291 1998-12-l~

W098/00528 PCT~K~7/00283 In a still further aspect, the present invention relates to an oral care composition useful as an ingredient in oral care products.
An oral care composition of the invention may suitably 5 comprise an amount of the recombinant Trichoderma harzianum mutanase equivalent to an enzyme activity, calculated as enzyme activity units in the final oral care product, in the range from 0.001 MU to 1000 MU/ml, preferably from 0.01 MU/ml to 500 MU/ml, such as from 0.1 MU/ml to 100 MU/ml, especially 0.05 MU/ml to 100 10 MU/ml.
It is also contemplated according to the invention to include other enzyme activities than mutanase activity in the oral care composition. Contemplated enzyme activities include activities from the group of enzymes comprising dextranases, 15 oxidases, such as glucose oxidase, L-amino acid oxidase, peroxidases, such as e.g. the Coprinus sp . peroxidases described in WO 95/10602 (from Novo Nordisk AtS) or lactoperoxidaseor, haloperoxidases, laccases, proteases, such as papain, acidic protease (e.g. the acidic proteases described in WO 95/02044 20 (Novo Nordisk A/S)), endoglucosidases, lipases, amylases, including amyloglucosidases, such as AMG (from Novo Nordisk A/S), and mixtures thereof.

Oral care Products 25 The oral care product may have any suitable physical form (i.e. powder, paste, gel, liquid, ointment, tablet etc.). An "oral care product" can be defined as a product which can be used for maintaining or improving the oral hygiene in the mouth of humans and animals, by preventing dental caries, preventing the 30 formation of dental plaque and tartar, removing dental plaque and tartar, preventing and/or treating dental diseases etc.
At least in the context of the present invention oral care products do also encompass products for cleaning dentures, artificial teeth and the like.
35 Examples of such oral care products include toothpaste, dental cream, gel or tooth powder, odontic, mouth washes, pre- or post brushing rinse formulations, chewing gum, lozenges, and candy.

CA 022~829l l998- l2- l~

W098/~528 PCT~K~7/00283 Toothpastes and tooth gels typically include abrasive polishing materials, foaming agents, flavouring agents, humectants, binders, thickeners, sweetening agents, whitening/bleaching/ stain removing agents, water, and optionally 5 enzymes.
Mouth washes, including plaque removing liquids, typically comprise a water/alcohol solution, flavour, humectant, sweetener, foaming agent, colorant, and optionally enzymes.

lo Abrasives Abrasive polishing material might also be incorporated into the dentifrice product of the invention. According to the inven-tion said abrasive polishing material includes alumina and hydrates thereof, such as alpha alumina trihydrate, magnesium 15 trisilicate, magnesium carbonate, kaolin, aluminosilicates, such as calcined aluminum silicate and aluminum silicate, calcium carbonate, zirconium silicate, and also powdered plastics, such as polyvinyl chloride, polyamides, polymethyl methacrylate, polystyrene, phenol-formaldehyde resins, melamine-formaldehyde 20 resins, urea-formaldehyde resins, epoxy resins, powdered polyethylene, silica xerogels, hydrogels and aerogels and the like. Also suitable as abrasive agents are calcium pyrophosphate, water-insoluble alkali metaphosphates, dicalcium phosphate and/or its dihydrate, dicalcium orthophosphate, 25 tricalcium phosphate, particulate hydroxyapatite and the like. It is also possible to employ mixtures of these substances.
Dependent on the oral care product the abrasive product may be present in from 0 to 70% by weight, preferably from 1% to 70%.
For toothpastes the abrasive material content typically lies in 30 the range of from 10% to 70% by weight of the final toothpaste product.
Humectants are employed to prevent loss of water from e.g.
toothpastes. Suitable humectants for use in oral care products according to the invention include the following compounds and 35 mixtures thereof: glycerol, polyol, sorbitol, polyethylene glycols (PEG), propylene glycol, 1,3-propanediol, 1,4-butanediol, hydrogenated partially hydrolysed polysaccharides and the like.

CA 022~8291 1998-12-l~

W098/00528 PCT~K97/00283 Humectants are in general present in from 0% to 80%, preferably 5 to 70% by weight in toothpaste.
Silica, starch, tragacanth gum, xanthan gum, extracts of Irish moss, alginates, pectin, cellulose derivatives, such as 5 hydroxyethyl cellulose, sodium carboxymethyl cellulose and hydroxypropyl cellulose, polyacrylic acid and its salts, polyvinylpyrrolidone, can be mentioned as examples of suitable thickeners and binders, which helps stabilizing the dentifrice product. Thickeners may be present in toothpaste creams and gels o in an amount of from 0.1 to 20% by weight, and binders to the extent of from 0.01 to 10% by weight of the final product.

Foaminq aqents As foaming agent soap, an-ionic, cat-ionic, non-ionic, ampho-15 teric and/or zwitterionic surfactants can be used. These may bepresent at levels of from o% to 15%, preferably from 0.1 to 13%, more preferably from 0.25 to 10% by weight of the final product.

Surfactants Surfactants are only suitable to the extent that they do not exert an inactivation effect on the present enzymes. Surfactants include fatty alcohol sulphates, salts of sulphonated mono-glycerides or fatty acids having 10 to 20 carbon atoms, fatty acid-albumen condensation products, salts of fatty acids amides 25 and taurines and/or salts of fatty acid esters of isethionic acid.

Sweeteninq aqents Suitable sweeteners include saccharin.

Flavourinq aqents Flavours, such as spearmint, are usually present in low amounts, such as from 0.01% to about 5% by weight, especially from 0.1% to 5%.

CA 022~829l l998-l2-l~

W098/00528 PCT~K~7/00283 Whiteninq/bleaching aqents Whitening/bleaching agents include H2~2 and may be added in amounts less that 5%, preferably from 0.25 to 4%, calculated on the basis of the weight of the final product.
The whitening/bleaching agents may be an enzyme, such as an oxidoreductase. Examples of suitable teeth bleaching enzymes are described in WO 97/06775 (from Novo Nordisk A/S).

Water 10 Water is usually added in an amount giving e.g. toothpaste a flowable form.

Additional aqents Further water-soluble anti-bacterial agents, such as 15 chlorhexidine digluconate, hexetidine, alexidine, quaternary ammonium anti-bacterial compounds and water-soluble sources of certain metal ions such as zinc, copper, silver and stannous (e.g. zinc, copper and stannous chloride, and silver nitrate) may also be included.
20 Also contemplated according to the invention is the addition of compounds which can be used as fluoride source, dyes/colorants, preservatives, vitamins, pH-adjusting agents, anti-caries agents, desensitizing agents etc.

2 5 EnzYmes Other essential components used in oral care products and in oral care products of the invention are enzymes. Enzymes are biological catalysts of chemical reactions in living systems.
Enzymes combine with the substrates on which they act forming an 30 intermediate enzyme-substrate complex. This complex is then converted to a reaction product and a liberated enzyme which continue its specific enzymatic function.
Enzymes provide several benefits when used for cleansing of the oral cavity. Proteases break down salivary proteins, which 35 are adsorbed onto the tooth surface and form the pellicle, the first layer of resulting plaque. Proteases along with lipases destroy bacteria by lysing proteins and lipids which form the CA 022~8291 1998-12-l~

W098/00528 PCT~K97100283 structural components of bacterial cell walls and membranes.
Dextranase breaks down the organic skeletal structure produced by bacteria that forms a matrix for bacterial adhesion. Proteases and amylases, not only prevents pla~ue formation, but also 5 prevents the development of calculus by breaking-up the carbohydrate-protein complex that binds calcium, preventing mineralization.

Toothpaste A toothpaste produced from an oral care composition of the invention (in weight % of the final toothpaste composition) may typically comprise the following ingredients:
Abrasive material lO to 70%
Humectant 0 to 80%
15 Thickener O.l to 20%
Binder O.Ol to 10%
Sweetener 0.1% to 5%
Foaming agent 0 to l5%
Whitener 0 to 5%
20 Enzymes 0.0001% to 20%
In a specific embodiment of the invention the oral care product is toothpaste having a pH in the range from 6.0 to about 8.0 comprising a) 10% to 70% Abrasive material 25 b) 0 to 80% Humectant c) O.l to 20% Thickener d) O.Ol to 10% Binder e) 0.1% to 5% Sweetener f) 0 to 15% Foaming agent 30 g) 0 to 5% Whitener i) 0.0001% to 20% Enzymes.
Said enzymes referred to under i) include the recombinant mutanase of the invention, and optionally other types of enzymes mentioned above known to be used in toothpastes and the like.

CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 Mouth wash A mouth wash produced from an oral care composition of the invention (in weight % of the final mouth wash composition) may 5 typically comprise the following ingredients:
0-20% Humectant 0-2% Surfactant o-5% Enzymes 0-20% Ethanol 0 0-2% Other ingredients (e.g. flavour, sweetener active ingredients such as fluorides).
0-70% Water The mouth wash composition may be buffered with an appropriate buffer e.g. sodium citrate or phosphate in the pH-range 6-7.5.
15 The mouth wash may be in none-diluted form (i. e. must be diluted before use).

Method of Manufacture The oral care composition and products of the present 20 invention can be made using methods which are common in the oral product area.
According to the present invention the recombinant mutanase and/or the substantially purified mutanase free of active contaminants can be use in food, feed and/or pet food products.

MAT~T~TR AND N~,n~D~
Materials Micro-orqanisms 30 Trichoderma harzianum CBS 243.71 A. oryzae JaL 125: Aspergillus oryzae IFO 4177 available from Institute for Fermentation, Osaka; 17-25 Juso Hammachi 2-Chome Yodogawa-ku, Osaka, Japan, having the alkaline protease gene named "alp" (described by Murakami K et al., (1991), Agric. Biol.
35 Chem. 55, p. 2807-2811) deleted by a one step gene replacement method (described by G. May in "Applied Molecular Genetics of Filamentous Fungi" (1992), p. 1-25. Eds. J. R. Kinghorn and G.

CA 022~8291 1998-12-1~

W098/00528 PCT~K97/00283 Turner; Blackie Academic and Professional), using the A. oryzae pyrG gene as marker.
E. col i DH5a 5 Plasmids and Vectors:
pMT1796 (Figure 1 and Figure 2) pMT1802 (Figure 2) pMT1815 (Figure 2) pHD414: Aspergillus expression vector is a derivative of the o plasmid p775 (described in EP 238.023). The construction of the pHD414 is further described in W0 93/11249. pHD414 contains the A. niger glucoamylase terminator and the A. oryzae TAKA amylase promoter.
pHD414+mut (Figure 3) 15 pHan37 containing the TAKA:TPI promoter Linkers:
Linker #1:
GATCCTCACA ATG TTG GGC GTT GTC CGC CGT CTA GGC CTA GG
GAGTGT TAC AAC CCG CAA CAG GCT GCA GAT CCG GAT CCG C
Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly Linker #2:
C CAA TAC TGT TAG T
GT ACG GTT ATG ACA ATC AGATC
Ala Cys Gln Tyr Cys ***

Primers:
Primer 1: 5' GGGGGGATCCACCATGAG 3' (SEQ ID No. 3) 30 Primer 2: 5' ACGGTCAGCAGAAGAAGCTCGACGAATAGGACTGGC 3' (SEQ ID
No. 4) Primer 3: 5' GCCAGTCCTATTCGTCGAGCTTCTTCTGCTGACCGT 3' (SEQ ID
No. 5) Primer 4: 5' CCACGGTCACCAACAATAC 3' (SEQ ID No. 6) 35 Primer 5: GGGGGGATCCACCATGAG (SEQ ID No. 7), Primer 6: ACGGTCAGCAGAAGAAGCTCGACGAATAGGACTGGC (SEQ ID No. 8) Primer 7: GCCAGTCCTATTCGTCGAGCTTCTTCTGCTGACCGT (SEQ ID N0. 9), Primer 8: CCACGGTCACCAACAATAC (SEQ ID No. 10).

CA 022~8291 1998-12-1~

W098/~S28 PCT~K97/~283 ~ Enzymes:
lysyl-specific protease from Achromobacter Trichoderma harzianum CBS 243.71 fermentation broth (Batch no.
5 PPM 3897) Media, Substrates and Solutions:
YPM: 2~ maltose, 1% bactopeptone and 0.5% yeast extract) DAPI: 4',6-diamidino-2-phenylindole (Sigma D-9542) lo Britton-Robinson Buffer BHI: Brain Heart Infusion broth Equipment:
10 kDa cut-off ultra-filtration cassette (Alpha Minisette from 15 Filtron).
Phenyl-sepharose FF (high sub) column (Pharmacia) Seitz EK1 filter plate Q-sepharose FF column (Pharmacia) Applied Biosystems 473A protein sequencer 20 2 litre Kieler fermenter Olympus model BX50 microscope Malthus Flexi M2060 (Malthus Instrument Limited) Methods:
25 Molecular biology procedures All molecular biology procedures including restriction digests, DNA ligations, E. coli transformations, DNA
isolations, Southern hybridizations, PCR amplifications, and library constructions and screenings were completed using stan-30 dard techniques (Sambrook, J., Fritsch, E. F., and Maniatis, T.
1989. Molecular cloning: A laboratory manual /E.F. Cold Spring Harbor Laboratory Press, Plainview, NY).

Preparation of Mutan Mutan is prepared by growing streptococcus mutans CBS 350.71 at pH 6.5, 37~C (kept constant), and with an aeration rate of 75 rpm in a medium comprised of the following components:

CA 022~829l l998-l2-l~

W098/00528 PCT~K~7/00283 NZ-Case 6.5 g/litre Yeast Extract 6 g/litre (NH4)2SO4 20 g/litre K2PO4 3 g/litre Glucose 50 g/litre Pluronic PE6100 0.1%
After 35 hours, sucrose is added to a final concentration of 60 g/litre to induce glucosyltransferase. The total fermentation time is 75 hours. The supernatant from the fermentation is 10 centrifuged and filtered (sterile). Sucrose is then added to the supernatant to a final concentration of 5% (pH is adjusted to pH
7.0 with acetic acid) and the solution is stirred overnight at 37~C. The solution is filtered and the insoluble mutan is harvested on propex and washed extensively with deionized water 15 containing 1% sodium benzoate, pH 5 (adjusted with acetic acid).
Finally, the insoluble mutan is lyophilized and ground.

Determination of mutanase activity (MU) One Mutanase _nit (MU) is the amount of enzyme which under 20 standard conditions liberates 1 ~mol reducing sugar (calculated as glucose) per minute. Reducing sugars were measured with alkaline K3Fe(CN)6.
Standard Conditions Substrate............ 1.5% mutan 25 Reaction time........ 15 minutes Temperature.......... 40~C
pH................... .5.5 A detailed description of Novo Nordisk's analytical method (AF
180/1-GB) is available from Novo Nordisk A/S on request.
Mutanase Plate Assay A 5% mutan suspension is made in 50 mM sodium acetate, pH 5.5 and the suspension is homogenised for 15 minutes in an Ultra Turrax T25 homogenizer at 4~C. 1% agarose in 50 mM sodium 35 acetate, pH 5.5 is made 0.2% with respect to mutan and 12.5 ml - agarose is casted in each petri dish (d=lo cm). The sample to be CA 022~829l l998- l2- l~

W098/00528 PCT~K97/00283 analyzed for mutanase activity is applied in sample wells punched in the agarose, and the plate is incubated overnight at 37~C, whereafter clearing zones are formed around mutanase containing samples.

Western hybridization Western hybridizations are performed using the ECL western blotting system (Amersham International, plc, Buckinghamshire, England) and a primary antibody solution containing polyclonal o rabbit-anti-mutanase. The limit of detection is O.OO1 MU/ml.

Mass spectrometry Mass spectrometry of purified wild-type mutanase is done using matrix assisted laser desorption ionization time-of-flight mass 15 spectrometry in a VG Analytical TofSpec. For mass spectrometry 2 ml of sample is mixed with 2 ml saturated matrix solution (a-cyano-4-hydroxycinnamic acid in 0.1% TFA:acetonitrile (70:30)) and 2 ml of the mixture spotted onto the target plate. Before introduction into the mass spectrometer the solvent is removed by 20 evaporation. Samples are desorbed and ionized by 4 ns laser pulses (337 nm) at threshold laser power and accelerated into the field-free flight tube by an accelerating voltage of 25 kV. Ions are detected by a microchannel plate set at 1850 V.

2 5 Preparation of Hydroxyapatite disks IHA) Hydroxyapatite tablets are prepared by compressing 250 mg of hydroxyapatite in a tablet die at about 5,900 kg (13,000 lbs) of pressure for 5 minutes. The tablets are then sintered at 600~C
for 4 hours and finally hydrated with sterile deionized water.
Plaque coating of Hydroxyapatite disks (HA) Hydroxyapatite disks (HA) were dry sterilised (121~C, 2 bar, 20 minutes) and coated with filter sterilised saliva for 18 hours at 37~C. The HA disks were placed in a sterile rack in a beaker, 35 Brain Heart Infusion broth (BHI) containing 0.2% sucrose was poured into the beaker covering the disks. Sterile Na2S (pH 7.0) was added immediately before inoculation given the final concen-~, .

CA 022~829l l998-l2-l~

W098/00528 PCT~Kg7/00283 tration of 5 g/litre. A mixture 1:1:1 of Streptococcus mutans, Actinomyces viscosus and Fusobacterium nucleatum grown anaero-bically (BHI, 37~C, 24 h) was used as inoculum in the concen-tration of approximately 106 cfu/ml. The disks were incubated 5 anaerobic at 37~C for 4 days with slight stirring.

Malthus-method for plaque The Malthus-method is based on the methods described in Johnston et al., (1995), Journal of Microbiological Methods 21, o p. 15-26 and Johansem et al. (1995), Journal of Applied Bacteriology 78, p. 297-303.

EXAMPLES

15 Example 1 Purification of wild-type Mutanase lOO g fermentation broth of Trlchoderma harzianum CBS 243.71 (Batch no. PPM 3897) were dissolved in 1 litre 10 mM sodium acetate, pH 5.2 overnight at 4~C.
65 g DEAE-Sephadex A-50 were swelled in 3 litre lO mM sodium acetate, pH 5.2. Excess buffer was removed after swelling. DEAE-Sephadex was mixed with the crude mutanase preparation for 1 hour and unbound material was collected by filtration through Propex cloth. The gel was further washed with 2.5 l of 10 mM sodium ace-25 tate, pH 5.2. A pool containing the unbound material was made;
volume 4 litre. Remaining DEAE-Sephadex particles were removed by filtration through a Whatman GF/F filter.
350 ml S-Sepharose was equilibrated in 10 mM sodium acetate, pH 5.2 and mixed with 600 ml of the pool from the DEAE-Sephadex 30 for 10 minutes. Unbound material was collected by filtration through Propex cloth and the gel was washed with 500 ml 10 mM
sodium acetate buffer, pH 5.2. Bound material was eluted with the same buffer containing 1 M NaCl. The procedure was repeated 7 times. The combined pool containing the unbound material (7 35 litre) was concentrated on a Filtron concentrator equipped with a 10 kDa cut-off membrane and followed by a buffer change to 10 mM
sodium acetate, pH 4.7. The concentrate was filtrated through a CA 022~829l l998- l2- l~

W098/00528 PCT~K97/00283 Whatmann GF/F filter. The final volume of the concentrate was 600 ml.
An S-Sepharose column (180 ml, 2.6 x 33 cm) was equilibrated with 10 mM sodium acetate, pH 4.7. The pH adjusted concentrate 5 from the S-Sepharose batch ion exchange was applied onto the column in 50 ml portions with a flow of 10 ml/min. The mutanase was eluted with a linear gradient from 0 to 20 mM NaCl in 3 column volumes. The residual protein was eluted with the same buffer containing 1 M NaCl. Fractions were analyzed for mutanase o activity (plate assay) and fractions with high activity were pooled. The procedure was repeated 12 times. The combined mutanase pool was concentrated in a Filtron concentrator equipped with a lo kDa cut-off membrane and followed by a buffer change to 10 mM Tris-HCl, pH 8Ø The final volume of the concentrate was 15 870 ml.
The concentrated pool from the S-Sepharose column was further purified on a HiLoad Q-Sepharose column (50 ml, 2.6 x 10 cm) equilibrated with 10 mM Tris-HCl, pH 8Ø Portions of 130 ml was applied with a flow of 8 ml/min. Elution of the mutanase was per-20 formed with a linear gradient from 0 to 50 mM NaCl in 12 columnvolumes. Fractions with high mutanase activity (plate assay) were pooled, concentrated in an Amicon cell equipped with a 10 kDa cut-off membrane. Finally, the mutanase preparation was dialyzed extensively against 10 mM sodium phosphate, pH 7.0 and filtrated 25 through a 0.45 mm filter.
The yield of the mutanase in the purification described above was 300 mg. The purity of the HiLoad-Q preparation was analyzed by SDS-PAGE and N-terminal sequencing and judged by both methods the purity was around 95%.
Example 2 N-terminal sequencing of wild-type Mutanase N-terminal amino acid sequencing was carried out in an Applied Biosystems 473A protein sequencer.
35 To generate peptides reduced and S-carboxymethylated mutanase (" 450 mg) was digested with the lysyl-specific protease from Achromobacter (lO mg) in 20 mM NH4HC03 for 16 hours at 37~C. The . ~ .. _ .... . .

CA 022~829l lsss-l2-l~

W098/00528 PCT~K~7/00283 resulting peptides were separated by reversed phase HPLC using a Vydac C18 column eluted with a linear gradient of 80% 2-propanol containing 0.08% TFA in 0.1% aqueous TFA. Peptides were repurified by reversed-phase-HPLC using a Vydac C1g column eluted 5 with linear gradients of 80% acetonitrile containing 0.08% TFA in 0.1% aqueous TFA before being subjected to N-terminal amino acid sequencing.
The amino acid sequences determined are given below.
N-terminal:
lO Ala-Ser-Ser-Ala-Asp-Arg-Leu-Val-Phe-Cys-His-Phe-Met-Ile-Gly-Ile-Val-Gly-Asp-Arg-Gly-Ser-Ser-Ala-Asp-Tyr-Asp-Asp-Asp-Peptide 1:
Val Phe-Ile-Ser-Phe-Asp-Phe-Asn-Trp-Trp-Ser-Pro-~ly-Asn-Ala-Val-Gly-Val-Gly-Gln-Lys 15 Peptide 2:
Pro-Tyr-Leu-Ala-Pro-Val-Ser-Pro-Trp-Phe-Phe-Thr-His-Phe-Gly-Pro-Glu-Val-Ser-Tyr-Ser-Peptide 3:
Trp-Val-Asn-Asp-Met-Pro-His-Asp-Gly-Phe-Leu-Asp-Leu-Ser-Lys Example 3 Construction of the mutanase expression vectors, pMT1796, pMT1802 and pMT1815 A cDNA clone encoding mutanase was identified in a 25 Trichoderma harzianum CBS 243.71 library by hybridization with a fragment of the gene amplified by PCR using primers based on the mutanase sequence shown in SEQ ID NO. 1.
DNA sequence analysis of the isolated clone, pHD414+mut, showed that it indeed encoded the mutanase gene, and that the 30 5 ' end of the construct contained a long leader sequence. To remove this leader, pHD414+mut was restricted with the enzymes EcoRI, NarI and XhoI. From this digestion a 3499 nt (nucleotide) vector fragment and a 610 nt NarI/XhoI fragment were isolated. These two fragments were then ligated with 35 linker #1 (see above) and a 618 nt EcoRI/BamHI fragment from pHan37 containing the TAKA:TPI promoter, giving plasmid pJW99.
HD414+mut was next digested with XhoI and SphI, and a 1790 nt CA 022~829l lsss-l2-l~

W098/00528 PCT~K97/00283 fragment encoding amino acids 35-598 of the mutanase gene was isolated.
This fragment was ligated with linker #2 (see above) and pJW99 that had been linearized with the restriction enzymes 5 XbaI and XhoI. The resulting plasmid, pMT1802, contains the ~.
harzianum mutanase gene under the control of the TAKA:TPI pro-moter. Plasmid pMT1796 is identical to pMT1802 except that E36 of the mutanase protein has been changed to K36 by replacing the XhoI/RpnI fragment of pMT1802 with a PC~ amplified fragment lo containing the desired mutation.
This PCR fragment was created in a two step procedure as reported in Ho, et al. (198g), Gene, 77, p. 51-59, using the following primers:
Primer 1 (nt 2751 5'CAGCGTCCACATCACGAGC nt 2769) and ~5 Primer 2 (nt 3306 5'GAAGAAGCACGTTTCTCGAGAGACCG nt 3281);
Primer 3 (nt 3281 5' CGGTCTCTGAGAAACGT~CTTCTTC nt 3306) and Primer 4 (nt 4266 5 GCCACTTCCGTTATTAGCC nt 4248); nucleotide numbers refer to the pMT1802 plasmid (See SEQ ID No. 11).
To create pMT1815, a 127 nt DNA fragment was PCR amplified 20 using again a two step procedure and the primers:
Primer 5: GGGGGGATCCACCATGAG;
Primer 6: ACGGTCAGCAGAAGAAGCTCGACGAATAGGACTGGC;
Primer 7: GCCAGTCCTATTCGTCGAGCTTCTTCTGCTGACCGT;
Primer 8: CCACGGTCACCAACAATAC, 25 and the plasmids pHan37 and pMT1802 as templates in the first round of amplification.
This fragment contains a BamHI restriction enzyme site followed by the Lipolase~ prepro-sequence in frame with residues 38-54 of the mutanase protein and ending with a BstEII
30 site.
The fragment was digested with the restriction enzymes BstEII and BamHI and inserted into pMTl802 that had been linearized with the same pair of enzymes. Changes in constructs were confirmed and the integrity of the resulting coding 35 regions were checked by nucleotide sequencing.

CA 022~829l l998-l2-l~

W O g8/OQ~2~ PCT~DK97/00283 Example 4 Expression of recombinant Mutanase in Aspergillus oryzae The strain A. oryzae JaL125 was transformed using a PEG-mediated protocol (see EP 238 023) and a DNA mixture containing O. 5 ~g of a plasmid encoding the gene that confers resistance to the herbicide Basta and 8.0 ~g of one of the three mutanase expression plasmids. Transformants were selected on minimal plates containing 0.5~ basta and 50 mM urea as a nitrogen source.

Shake flask cultures Transformed colonies were spore purified twice on selection media and spores were harvested. A 20 ml universal container (Nunc, cat #364211) containing 10 ml YPM (2~ maltose, 1%
15 bactopeptone and 0.5% yeast extract) was inoculated with spores and grown for 5 days with shaking at 30~C. The supernatant was harvested after 5 days growth.

highest mutanase number of Construct level detected transformants tested pMT1802, mutanase <0.001 10 prepro + mutanase pMT1796, mutanase 3.8 4 prepro + KEX2 +
mutanase pMT1815, Lipolase~ 0.16 22 prepro + mutanase Table 1 Compari~on of mutanase expression from the three different 20 expression constructs. The limit of detection was O.OO1 MU/ml The presence of mutanase in culture supernatants was examined by western hybridizations. SDS-PAGE and protein transfers were performed using standard protocols.

Example 5 Purification of recombinant mutanase 700 ml fermentation broth was filtered and concentrated. The pH was adjusted to 4.7 (conductivity around 300 ~S/cm) and the 30 broth was loaded onto an S-Sepharose column (XK 50/22) - (Pharmacia) equilibrated in 10 mM sodium acetate pH 4.7. The CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 mutanase was eluted in a linear NaCl gradient. The major part of the mutanase appeared in the unbound fractions. These fractions were pooled and concentrated. Then the concentrate was loaded onto a HiLoad Q-Sepharose column (Pharmacia) 5 equilibrated in 10 mM Tris-HCl, pH 8.0 (around 600 ~S/cm). The mutanase was eluted in a linear gradient of NaCl and the mutanase containing-fractions were pooled according to purity and activity. The pooled fractions were concentrated and a fraction was further purified by gelfiltration on a Superdex 75 10 (16/60) column (Pharmacia) in sodium acetate pH 6Ø
The purified mutanase has a specific activity around l9 MU
pr. absorption unit at 280 nm. From SDS-PAGE (Novex 4-20 %; run according to the manufacturer's instructions) a molecular weight around 80 kDa is found.
15 The N-terminal amino acid sequence was confirmed to be identical to the N-terminal amino acid sequence of the wt mutanase (Ala-Ser-Ser-Ala-) (see Example 2) Example 6 20 pH-profile of mutana~e 500 ml 5 % mutan in 50 mM Britton-Robinson buffer at varying pH was added 2 ml enzyme sample (diluted in MilliQ-filtered water) in large vials (to ensure sufficient agitation) and incubated for 15 minutes at 40~C while shaking vigorously. The 25 reaction was terminated by adding 0.5 ml 0.4 M NaOH and the samples were filtered on Munktell filters. lO0 ~l filtrate in Eppendorf vials were added 750 ~l ferricyanide reagent (0.4 g/l K3Fe(CN)6, 20 g/l Na2CO3) and incubated 15 minutes at 85~C.
After allowing the samples to cool, the decrease in absorption 30 at 420 nm was measured. A dilution series of glucose was included as a standard. Substrate and enzyme blanks were always included. Samples were run in duplicate. The pH-optimum for both wild-type and recombinant enzyme is around pH 3.5-5.5 (see Figure 4).

Example 7 . .

CA 022~829l l998-l2-l~

W098/00528 PCT~K97/00283 Temperature profile of mutanase:
500 ml 5 % mutan in 100 mM sodium acetate, pH 5.5 or in 100 mM sodium phosphate, pH 7 was added 2 ml enzyme sample (diluted in MilliQ-filtered water) in large vials (to ensure sufficient 5 agitation) and incubated for 15 minutes at various temperatures while shaking vigorously. The reaction was terminated by adding 0.5 ml 0.4 M NaOH and the samples were filtered on Munktell filters. 100 ~l filtrate in Eppendorf vials were added 750 ~l ferricyanide reagent (0.4 g/l K3Fe(CN)6, 20 g/l Na2CO3) and in-10 cubated 15 minutes at 85~C. After allowing the samples to cool,the drop in absorption at 420 nm was measured. A dilution series of glucose was included as a standard. Substrate and enzyme blanks were always included. Samples were run in duplicate. The temperature profiles for the recombinant and wt 15 mutanase were identical. The temperature optimum at pH 7 was around 45 ~C. The temperature optimum at pH 5.5 was above 55~
(See Figure 5).

Example 8 20 Temperature stability of mutanase:
The temperature stability was investigated by pre-incubating enzyme samples for 30 minutes at various temperatures in 0.1 M
sodium acetate, pH 5.5 or in 0.1 M sodium phosphate, pH 7 before assaying the residual activity. Both recombinant and wt 25 mutanase have similar temperature stability profiles. The residual activity starts to decline at 40 oc at pH 7, while the enzyme is more stable at pH 5.5, where the residual activity starts to decline at 55~C (See Figure 6).

30 Example 9 Molecular weight of purified wild-type MutAn~e The mass spectrometry, performed as described above, of the mutanase revealed an average mass around 75 kDa. In addition, it was clear from the spectra that the glycosylation of the mutanase 35 is heterogeneous. The peptide mass of the mutanase is more than 64 kDa meaning that more than 11 kDa of carbohydrate is attached CA 022~8291 1998-12-1~

W098/00528 PCT~K97/00283 to the enzyme.

Example 10 Activity of mutanase against Dental Plaque 5 A plaque biofilm was grown anaerobic on saliva coated hydro-xyapatite disks as described in the Material and Methods Section above. The plaque was a mixed culture of Streptococcus mutans (SFAG, CBS 350.71), Actinomyces viscosus (DSM 43329) and F~so-bacterium nucleatum subsp. polymorphum (DSM 20482).
o HA disks with plaque were transferred to acetate buffer (pH
5.5) containing recombinant Trichoderma mutanase 1 MU/ml and whirled for 2 minutes (sterile buffer was used as control).
After enzyme treatment, the disks were either DAPI stained or transferred to Malthus cells, as indirect impedance measurements 15 were used when enumerating living adherent cells (Malthus Flexi M2060, Malthus Instrument Limited).
For the impedance measurements 3 ml of BHI were transferred to the outer chamber of the indirect Malthus cells, and 0.5 ml of sterile KOH (0.1 M) was transferred to the inner chamber. After 20 mutanase treatment the disks with plaque were slightly rinsed with phosphate buffer and transferred to the outer chamber. The detection times (dt) in Malthus were converted to colony counts by use of a calibration curve relating cfu/ml to dt (Figure 7).
The calibration curve was constructed by a series of 10-fold 25 dilution rate prepared from the mixed culture. Conductance dt of each dilution step was determined in BHI and a calibration curve relating cfu/ml of the 10 fold dilutions to dt in BHI was constructed for the mixed culture (Figure 7).
The removal of plaque from the disks was also determined by 30 fluorescent microscopy, after mutanase treatment disks were stained with DAPI (3 mM) and incubated in the dark for 5 minutes (20~C). The DAPI stained cells were examined with the x 100 oil immersion fluorescence objective on an Olympus model BX50 microscope equipped with a 200 W mercury lamp and an W - filter.
35 The result was compared with the quantitative data obtained by the impedance measurements.

, CA 022~829l l998-l2-l~

W O 98/00~28 PCTADK97/00283 The number of living cells on the saliva treated HA-surface after enzyme treatment was determined by the Malthus method and shown in Table 1. However, by the Malthus method it is not possible to distinguish between a bactericidal activity of 5 mutanase or an enzymatic removal of the plaque. Therefore a decrease in living bacteria on the surface has to be compared with the simultaneously removal of plaque from the surface which is estimated by the DA~I staining.

Mutanase Log10 reduction Removal ofNo. of (MU/ml) (cfu/cm )plaque (%) observations ~ ~ ~ 10 1 1.4 96 6 10 Table 2: Enzymatic plaque removal (pH 5.5, 2 minutes) from saliva trea-ed hydroxyapatite det~rminAd by ~ nAe measurements.

A significant removal of plaque was determined by fluorescent microscopy after treatment with mutanase. Thus mutanase reduced 15 the amount of adhering cells. However, the activity was observed as a removal of plaque and not as a bactericidal activity against cells in plaque.

CA 022~8291 1998-12-1~

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
'A' NAME: Novo Nordisk A/S
B STREET: Novo Alle C CITY: Bagsvaerd E COUN~ : Denmark F POSTAL CODE (ZIP): DK-2880 G TELEPHONE: +45 4444 8888 H TELEFAX: +45 4449 3256 ~ T-TLE OF lNV~ lON: A recombinant enzyme with mutanase activity (iii) NUMBER OF ~Q~N~S: 11 ~iv) COMPUTER ~An~Rn~ FORN:
'A' MEDIUM TYPE: Floppy disk B COMPUTER: IBM PC compatible C OPERATING SYSTEM: PC-DOS/MS-DOS
D, SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
~'A) LENGTH: 1905 base pairs B) TYPE: nucleic acid 'C) STRANDEDNESS: single D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~vi) ORIGINAL SOURCE:
(B) STRAIN: Trich~enma harzianum CBS 243.71 (ix) FEATURE:
'A) NAME/KEY: CDS
B) LOCATION:1..1905 'A) NAME/KEY: sig peptide IB) LOCATION:1..120 (xi) S':QUENCE DESCRIPTION: SEQ ID NO: 1:

Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly Ala Leu Ala Ala Ala Ala Leu Ser Ser Leu Gly Ser Ala Ala Pro Ala Asn Val Ala Ile Arg Ser Leu Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys His Phe Met Ile Gly Ile Val Gly Asp Arg Gly Ser Ser Ala Asp Tyr Asp Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln Leu Gly Tyr Ala Tyr Asp Ser Ala Asp Arg Asn Gly Met Lys Val Phe Ile Ser Phe Asp Phe Asn Trp Trp Ser Pro Gly Asn Ala Val Gly Val Gly Gln Lys Ile Ala CA 022~829l l998-l2-l~

W O 98/00528 PCT~DK~7/00283 Gln Tyr Ala Ser Arg Pro Ala Gln Leu Tyr Val Asp Asn Arg Pro Phe Ala Ser Ser Phe Ala Gly Asp Gly Leu A5p Val Asn Ala Leu Arg Ser Ala Ala Gly Ser Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln Ser Ser Pro Ser Asn Ile Asp Gly Ala Leu Asn Trp Met Ala Trp Asp Asn Asp Gly Asn Asn Lys Ala Pro Lys Pro Gly Gln Thr Val Thr Val Ala Asp Gly Asp Asn Ala Tyr Lys Asn Trp Leu Gly Gly Lys Pro Tyr Leu Ala Pro Val Ser Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val Ser Tyr Ser Lys Asn Trp Val Phe Pro Gly Gly Pro Leu Ile Tyr Asn Arg Trp Gln Gln Val Leu Gln Gln Gly Phe Pro Met Val Glu Ile Val Thr Trp Asn Asp Tyr Gly Glu Ser Hi~ Tyr Val Gly Pro Leu Lys Ser AAG CAT TTC GAT GAT GGC AAC TCC A~A TGG GTC AAT GAT ATG CCC CAT 912 Lys His Phe Asp Asp Gly Asn Ser Lys Trp Val Asn Asp Met Pro His GAT GGA TTC TTG GAT CTT TCA A~G CCG TTT ATT GCT GCA TAT AAG AAC 960 Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile Ala Ala Tyr Lys Asn Arg Asp Thr Asp Ile Ser Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr Trp Tyr Arg Arg Asn Leu Lys Ala Leu Asp Cys Asp Ala Thr Asp Thr Thr Ser Asn Arg Pro Ala Asn Asn Gly Ser Gly Asn Tyr Phe Met Gly Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val Tyr Val Ala Ala Leu Leu Lys Thr Ala Gly Ser Val Thr Val Thr Ser Gly Gly Thr Thr CA 022~X291 1998-12-1~

WO 98/00528 PCT~DK97/00283 Gln Thr Phe Gln Ala Asn Ala Gly Ala Asn Leu Phe Gln Ile Pro Ala Ser Ile Gly Gln Gln Lys Phe Ala Leu Thr Arg Asn Gly Gln Thr Val Phe Ser Gly Thr Ser Leu Met Asp Ile Thr Asn Val Cys Ser Cys Gly Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Ile Pro Ala Gly Phe Asp Asp Pro Leu Gln Ala Asp Gly Leu Phe Ser Leu Thr Ile Gly Leu His Val Thr Thr Cys Gln Ala Lys Pro Ser Leu Gly Thr Asn Pro Pro Val Thr Ser Gly Pro Val Ser Ser Leu Pro Ala Ser Ser Thr Thr Arg Ala Ser Ser Pro Pro Val Ser Ser Thr Arg Val Ser Ser Pro Pro Val Ser Ser Pro Pro Val Ser Arg Thr Ser Ser Pro Pro Pro Pro Pro Ala Ser Ser Thr Pro Pro Ser Gly Gln Val Cys Val Ala Gly Thr Val Ala Asp Gly Glu Ser Gly Asn Tyr Ile Gly Leu Cys Gln Phe Ser Cys Asn Tyr Gly Tyr Cy5 Pro Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala Pro Ile Ser Pro Pro Ala Ser Asn Gly Arg Asn Gly Cys Pro Leu Pro Gly Glu Gly Asp Gly Tyr Leu Gly Leu Cys Ser Phe Ser Cys Asn His Asn Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys *

~2) INFORMATION FOR SEQ ID NO: 2:
yU~N~ CHARACTERISTICS:
(A) LENGTH: 635 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear CA 022~829l l998-l2-l~

W O ~8/005~8 PCT~DK~7100283 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly Ala Leu Ala Ala Ala ~la Leu Ser Ser Leu Gly Ser Ala Ala Pro Ala Asn Val Ala Ile Arg Ser Leu Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys His Phe Met Ile Gly Ile Val Gly Asp Arg Gly Ser Ser Ala Asp Tyr Asp Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu ~sn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln Leu Gly Tyr Ala Tyr ~sp Ser Ala Asp Arg Asn Gly Met Lys Val Phe Ile Ser Phe Asp Phe Asn Trp Trp Ser Pro Gly Asn Ala Val Gly Val Gly Gln Lys Ile Ala Gln Tyr Ala Ser Arg Pro Ala Gln Leu Tyr Val Asp Asn Arg Pro Phe Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn Ala Leu Arg Ser ~la Ala Gly Ser Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln ~er Ser Pro Ser Asn Ile Asp Gly Ala Leu Asn Trp Met Ala Trp Asp 1~0 185 190 Asn Asp Gly Asn Asn Lys Ala Pro Lys Pro Gly Gln Thr Val Thr Val Ala Asp Gly Asp Asn Ala Tyr Lys Asn Trp Leu Gly Gly Lys Pro Tyr Leu Ala Pro Val Ser Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val ~er Tyr Ser Lys Asn Trp Val Phe Pro Gly Gly Pro Leu Ile Tyr Asn ~rg Trp Gln Gln Val Leu Gln Gln Gly Phe Pro Met Val Glu Ile Val Thr Trp Asn Asp Tyr Gly Glu Ser His Tyr Val Gly Pro Leu Lys Ser Lys His Phe Asp Asp Gly Asn Ser Lys Trp Val Asn Asp Met Pro His Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile Ala Ala Tyr Lys Asn ~rg Asp Thr Asp Ile Ser Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr ~rp Tyr Arg Arg Asn Leu Lys Ala Leu Asp Cys Asp Ala Thr Asp Thr CA 022~8291 1998- 12- 1~

WO ~8t0052X PCT/DK97/00283 Thr Ser Asn Arg Pro Ala Asn Asn Gly Ser Gly Asn Tyr Phe Met Gly Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val Tyr Val Ala Ala Leu Leu Lys Thr Ala Gly Ser Val Thr Val Thr Ser Gly Gly Thr Thr ~ln Thr Phe Gln Ala Asn Ala Gly Ala Aan Leu Phe Gln Ile Pro Ala ~er Ile Gly Gln Gln Lys Phe Ala Leu Thr Arg Asn Gly Gln Thr Val Phe Ser Gly Thr Ser Leu Met Asp Ile Thr Asn Val Cys Ser Cys Gly Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Ile Pro Ala Gly Phe Asp Asp Pro Leu Gln Ala Asp Gly Leu Phe Ser Leu Thr Ile Gly Leu His ~al Thr Thr Cys Gln Ala Lys Pro Ser Leu Gly Thr Asn Pro Pro Val ~hr Ser Gly Pro Val Ser Ser Leu Pro Ala Ser Ser Thr Thr Arg Ala Ser Ser Pro Pro Val Ser Ser Thr Arg Val Ser Ser Pro Pro Val Ser Ser Pro Pro Val Ser Arg Thr Ser Ser Pro Pro Pro Pro Pro Ala Ser Ser Thr Pro Pro Ser Gly Gln Val Cys Val Ala Gly Thr Val Ala Asp ~ly Glu Ser Gly Asn Tyr Ile Gly Leu Cys Gln Phe Ser Cys Asn l'yr ~ly Tyr Cys Pro Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala Pro Ile Ser Pro Pro Ala Ser Asn Gly Arg Asn Gly Cys Pro Leu Pro Gly Glu Gly Asp Gly Tyr Leu Gly Leu Cys Ser Phe Ser Cys Asn His Asn Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys *

~2) INFORMATION FOR SEQ ID NO: 3:
;yu~;N~: CEIARACTERISTICS:
A LEN-GTH: 19 baqe pairs B TYPE: nucleic acid C STRANDEDNESS: single D TOPOLOGY: linear tii) MOL 'CULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 1"

CA 022~829l l998-l2-l~

W O 98/00528 PCT~DK97/00283 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
I~A) LENGTH: 26 base pairs .B) TYPE: nucleic acid ,C) STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 2"

(2) INFORMATION FOR SEQ ID NO: 5:
Qu~N~ CHARACTERISTICS:
'A' LENGTH: 26 base pairs Bl TYPE: nucleic acid ,C STR~NDEDNESS: single D TOPOLOGY: linear (ii) MOL,CULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 3"

(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(Al LENGTH: 19 base pairs (B TYPE: nucleic acid (C STRANDEDNESS: single ~D TOPOLOGY: linear (ii) MOL-CULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 4"

(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
'A LENGTH: 18 base pairs B TYPE: nucleic acid C STRANDEDNESS: single D TOPOLOGY: linear (ii) MOL.'CULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 5"

(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
'A) LENGTH: 36 base pairs B) TYPE: nucleic acid C) STR~NDEDNESS: single ,D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~Primer 6"

ACGGTCAGCA GAAGAAGCTC GAC~.AATAGG ACTGGC 36 (2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs ~ (B) TYPE: nucleic acid (C) STRANDEDNESS: single CA 022~8291 1998-12-1~

~D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /de6c = "Primer 7"
GCCAGTCCTA TTCGTCGAGC ll~Ll~lGCT GACCGT 36 (2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
~A' LENGTH: l9 base pairs B TYPE: nucleic acid ,C STRANDEDNESS: single ~D TOPOLOGY: linear (ii) MOL''CULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "Primer 8"

(2) INFORMATION FOR SEQ ID NO: ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6032 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(B) STRAIN: Trichoderma harzianum CBS 243.71 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION:3188..5092 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: ll:

TCTAAATACA TTCAAATATG TATCCGCTCA T~-AGA~AATA ACCCTGATAA ATGCTTCAAT 180 TTGCGGCATT TTGCCTTCCT Gllll~GCTC ACCCAGAAAC GCTGGTGAAA GTAAAAGATG 300 ACTTACTTCT GACAACGATC GGAGGACCGA AGGAGCTAAC CG~l L 111 ~G ~ACAA~ATGG 660 GCGAACTACT TACTCTAGCT TCCCGGCAAC AATTAATA~A CTGGATGGAG GCGGATAAAG 840 TC~lllllGA TAATCTCATG ACCAAAATCC CTTAACGTGA GTTTTCGTTC CACTGAGCGT 1200 CAGACCCCGT AGAAAAGATC AAAGGATCTT CTTGAGATCC 'l--.LllCTG CGCGTAATCT 1260 GCTGCTTGCA AA~AAAAAAA CCACCGCTAC CAGCGGTGGT llGlllGCCG GATCAAGAGC 1320 .. . . . .

CA 022~829l l998-l2-l~

W O 98/00528 PCT~DK97/00283 ATAGTCCTGT CGGGTTTCGC CACCTCTGAC TTGAGCGTCG Alllll~lGA TGCTCGTCAG 1800 CTGCGAATCG CTTGGATTCC CCGCCCCTAG TCGTAGAGCT TAAAGTATGT CC~llGlCGA 3060 AATTTACCTC TATCCACACT TCT~llC~Ll CCTCAATCCT CTATATACAC AACTGGGGAT 3180 Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly Ala Leu Ala Ala Ala Ala Leu Ser Ser Leu Gly Ser Ala Ala Pro Ala Asn Val Ala Ile Arg Ser Leu Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys His Phe Met Ile Gly Ile Val Gly Asp Arg Gly Ser Ser Ala Asp Tyr Asp Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln Leu Gly Tyr Ala Tyr Asp Ser Ala Asp Arg Asn Gly Met Lys Val Phe Ile Ser Phe Asp Phe Asn Trp Trp Ser Pro Gly Asn Ala Val Gly Val Gly Gln Lys Ile Ala Gln Tyr Ala Ser Arg Pro Ala Gln Leu Tyr Val Asp Asn Arg Pro Phe Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn Ala Leu Arg Ser Ala Ala Gly Ser Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln Ser Ser Pro Ser Asn Ile Asp Gly Ala Leu Asn Trp Met Ala Trp Asp Asn Asp Gly Asn Asn Lys Ala Pro Lys Pro Gly Gln Thr Val Thr Val Ala Asp Gly Asp Asn Ala Tyr Lys Asn Trp Leu Gly Gly Lys CA 022~829l l998-l2-l~

Pro Tyr Leu Ala Pro Val Ser Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val Ser Tyr Ser Lys Asn Trp Val Phe Pro Gly Gly Pro Leu Ile Tyr Asn Arg Trp Gln Gln Val Leu Gln Gln Gly Phe Pro Met Val Glu Ile Val Thr Trp Asn Asp Tyr Gly Glu Ser His Tyr Val Gly Pro Leu Lys Ser Lys His Phe Asp Asp Gly Agn Ser Lys Trp Val Asn A p Met Pro His Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile Ala Ala Tyr Lys Asn Arg Asp Thr Asp Ile Ser Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr Trp Tyr Arg Arg Asn Leu Lys Ala Leu Asp Cys Asp Ala Thr Asp Thr Thr Ser Asn Arg Pro Ala Asn Asn Gly Ser Gly Asn Tyr Phe Met Gly Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val Tyr Val Ala Ala Leu Leu Lys Thr Ala Gly Ser Val Thr Val Thr Ser Gly Gly Thr Thr Gln Thr Phe Gln Ala Asn Ala Gly Ala Asn Leu Phe Gln Ile Pro Ala Ser Ile Gly Gln Gln Lys Phe Ala Leu Thr Arg Asn Gl.y Gln Thr Val Phe Ser Gly Thr Ser Leu Met Asp Ile Thr Asn Val Cys Ser Cys Gly Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Ile Pro Ala Gly Phe Asp Asp Pro Leu Gln Ala A~p Gly Leu Phe Ser Leu Thr Ile Gly Leu His Val Thr Thr Cys Gln Ala Lys Pro Ser Leu Gly Thr Asn Pro Pro Val Thr Ser Gly Pro Val Ser Ser Leu Pro Ala Ser Ser Thr Thr Arg Ala Ser Ser Pro Pro Val Ser Ser Thr Arg Val Ser Ser Pro Pro Val Ser Ser Pro Pro Val Ser Arg Thr Ser Ser Pro Pro Pro Pro Pro Ala Ser Ser Thr Pro Pro Ser Gly Gln Val Cys Val Ala Gly Thr Val Ala Asp Gly Glu Ser Gly Asn Tyr Ile Gly Leu Cys Gln Phe Ser Cys ~ 560 565 570 , . . . . . . .

CA 022~829l l998-l2-l~

W O 98/00528 PCT~DK97/00283 Asn Tyr Gly Tyr Cys Pro Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala Pro Ile Ser Pro Pro Ala Ser Asn Gly Arg Asn Gly Cys Pro Leu Pro Gly Glu Gly Asp Gly Tyr Leu Gly Leu Cys Ser Phe Ser Cys Asn His Asn Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys *

GGCAATTGGT TATATGATCA TGTATGTAGT GGGTGTGCAT AATAGTAGTG A~ATGGAAGC 5222 GAAAGCCATG Gl~lllC~ll CGTGTAGAAG ACCAGACAGA CAGTCCCTGA TTTACCCTGC 5342 ACAAAGCACT A~AAAATTAG CATTCCATCC ll~l~iGCTT GCTCTGCTGA TATCACTGTC 5402 TCAAGAGTAT ATCTCTACCG TCCAATAGAT CG1~llCGCT TCAAAATCTT TGACAATTCC 5582 TGCTCCCGGC ATCCGCTTAC AGACAAGCTG TGACCGTCTC CGGGAGCTGC Ai~l~l~AGA 6002

Claims (24)

1. A method for constructing an expression vector comprising a mutanase gene obtained from a filamentous fungus suitable for heterologous production comprising the steps of:
a) isolating a DNA sequence encoding a mutanase from a filamentous fungus, b) introducing a kex2 site or kex2-like site between the DNA
sequences encoding the pro-peptide and the mature region of the mutanase, or replacing the mutanase (pre)pro-sequence with a (pre)pro-sequence comprising a kex2 or kex2-like site of another fungal enzyme, c) cloning the DNA sequence obtained in step b) into a suitable expression vector.

2. The method according to claim 1, wherein the mutanase is obtained from the genus Trichoderma, preferably a strain of the species T. harzianum, especially the strain T. harzianum CBS
243.71.

3. The method according to claim 2, in which the mutanase DNA
sequence is isolated from or produced on the basis of a nucleic acid library of Trichoderma harzianum CBS 243.71.

4. The method according to any of claims 1 to 3, wherein the mutanase (pre)pro-sequence is replaced by the Lipolase R
(pre)pro-sequence or the TAKA-amylase (pre)pro-sequence.

5. An expression vector comprising a mutanase gene and a DNA
sequence encoding a pro-peptide with a kex2 site or kex2-like site between the DNA sequences encoding said pro-peptide and the mature region of the mutanase.

6. The expression vector according to claim 5, further comprising an operably linked promoter sequence and/or a prepro-sequence.

7. The expression vector according to claims 5 and 6, wherein the prepro-sequence comprise the original mutanase signal sequence, or the Lipolase R signal-sequence, or the TAKA
pro-sequence and the original mutanase pro-sequence with a kex2 or kx2-like site, or the Lipolase R pro-sequence, or the TAKA
pro-sequence.

8. The expression vector according to claim 7, wherein the promoter is the TAKA promoter or TAKA:TPI promoter.

9. The expression vector according to any claims 5 to 8, being the vector pMT1796.

10. A filamentous host cell for production of recombinant mutanase derived from a filamentous fungus being from the genus Trichoderma, such as a strain of T. harzianum, or the genus Aspergillus, such as a strain of A. oryzae or A. niger, or a strain of the genus Fusarium, such as a strain of Fusarium oxysporium, Fusarium graminearum, Fusarium sulphureum, Fusarium cerealis.

11. The host cell according to claim 10 wherein the host cell is a protease deficient of protease minus strain.

12. The host cell according to claim 11, wherein the host cell is the protease deficient strain Aspergillus oryzae JaL125 having the alkaline protease gene named "alp" deleted.

13. A process for producing a recombinant mutanase in a host cell, comprising the steps:
a) transforming an expression vector comprising a mutanase gene with a kex2 site or kex2-like site between the DNA sequences encoding the pro-peptide and the mature region of the mutanase into a suitable filamentous fungus host cell, b) cultivating the host cell in a suitable culture medium under conditions permitting expression and secretion of an active mutanase, c) recovering and optionally purifying the secreted active recombinant mutanase from the culture medium.

14. The process according to claim 13 wherein the recombinant expression vector is prepared according to the method of claim 1 to 4.

15. The process according to claim 13 and 14, wherein the filamentous host is a host cell according to any of claims 7 to 9.

16. An isolated recombinant mutanase produced according to the process according to any of claims 13 to 15.

17. A substantially pure wild-type mutanase obtained from Trichoderma harzianum CBS 243.71 essentially free of any contaminants.

18. A composition comprising a recombinant mutanase according to claim 16 or a substantially pure wild-type mutanase according to claim 17 and further other ingredients conventionally used in food, feed and/or pet food products.

19. An oral care composition comprising a recombinant mutanase according to claim 16 or a substantially pure wild-type mutanase according to claim 17, further comprising an enzyme selected from the group of dextranases, oxidases, peroxidases, haloperoxidases, laccases, proteases, endoglucosidases, lipases, amylases, and mixtures thereof.

20. An oral care product comprising a recombinant mutanase according to claim 16 or a substantially purified mutanase according to claim 17 or an oral care composition according to claim 19 and further comprising ingredients conventionally used in oral care products.

21. The oral care product according to claim 20, being a dentifrice, such as a toothpaste, tooth powder or a mouth wash.

22. Use of the recombinant mutanase according to claim 16 or the substantially purified mutanase according to claim 17 or an oral care composition of claim 19 or oral care product according to claims 20 and 21 for preventing the formation of dental plaque or removing dental plaque.

23. The use of the recombinant mutanase according to claims 16 or the substantially purified mutanase according to claim 17 or a oral care composition of claim 19 or oral care product according to claims 18 and 20 in oral care products for humans and/or animals.

24. Use of the composition according to claim 18, in food, feed and/or pet food products.