CN113684194B - Mutant motor protein, application thereof and kit - Google Patents

Abstract

The invention discloses a mutant motor protein, application thereof and a kit. The amount of the motor protein is reduced through specific mutation, the affinity of the motor protein to a DNA template substrate is increased, and the melting speed of the motor protein is reduced, so that the functional cooperation between the motor protein and DNA polymerase can be accurately regulated and controlled, and further, the motor protein can be applied to nucleic acid amplification, for example, the in-vitro simulated isothermal amplification technology based on the mutant motor protein, and particularly, the effect of higher detection sensitivity is achieved when the DNA template is low in copy.

Description

Mutant motor protein, application thereof and kit

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to mutant motor protein, application thereof and a kit.

Background

Motor proteins are a class of proteins distributed inside or on the surface of cells and are responsible for macroscopic movement of parts of the inside or the whole cell. The movements of various tissues, organs, and even the whole individual within an organism can ultimately be attributed to movements of molecular motors on a microscopic scale. The molecular motor converts the energy coupling in the chemical bond into kinetic energy. While the energy in the chemical bonds ultimately derives from the electrochemical gradients inside and outside the cell membrane or mitochondrial membrane.

Helicases are a common motor protein. It moves along the nucleic acid strand in a directional manner with single-stranded nucleic acid as a trajectory, and is capable of releasing hydrogen bonds between double-stranded nucleic acids. The function of hydrogen bonding is typically performed by the energy supplied by the hydrolyzed ATP. Generally, they act to catalyze the unwinding of double-stranded DNA or RNA during replication of the DNA or RNA in an organism. Helicases are involved in a variety of cellular processes in organisms, such as DNA replication, transcription, recombination, DNA repair, and the like. There are many types of helicases in bacteria, and they have ATPase activity. Most of the movement directions are 5 'to 3', but there is also 3 'to 5' direction movement. The abundant helicase species in bacteria provides a rich source of research for our discovery and development of high performance enzymes to perform a variety of extracellular functions.

The most mature and most common technique for in vitro amplification of DNA is currently the PCR (polymerase chain reaction) technique. The technology is specifically described as designing a pair of primers at two ends of a target amplification region, and generating new target amplification fragments continuously by using raw dNTPs through denaturation, annealing and extension of a heat-resistant DNA polymerase under the conditions of proper ions and pH to form a temperature cycle. PCR amplification techniques require a specific thermal cycler (PCR instrument) to perform, and thus scientists have developed a variety of isothermal amplification techniques such as RPA (recombinase polymerase amplification technique), LAMP (loop-mediated isothermal amplification technique), RCA (rolling circle amplification technique), HDA (helicase dependent isothermal amplification technique) and the like, which do not require a thermal cycler, in order to meet the needs of different situations. They use different means to double-strand DNA and bind primers to templates. RPA (recombinase polymerase amplification technique) relies on the homologous recombinase RecA or T4Uvsx forming a complex with a primer, the complex performing a homologous sequence search of the primer on double-stranded DNA, opening the double-stranded template of the portion when a template sequence identical to the primer sequence is searched for, thereby binding the primer, followed by polymerase extension, thereby completing the amplification. We have surprisingly found in experimental tests that a fatal disadvantage of this technique is that the homologous recombinases RecA or T4Uvsx are not able to sequence the hybrid strands of DNA and RNA and insert primers. Thus, amplification sensitivity is very low when reverse transcription products of RNA (hybrid strands of DNA and RNA) are amplified. LAMP (loop-mediated isothermal amplification) techniques rely on relatively high reaction temperatures, e.g., between 60℃and 65 ℃. At this relatively high reaction temperature the "respiration" of the double stranded DNA is enhanced. That is, at this temperature, the double-stranded DNA occasionally becomes partially single-stranded by partial melting, and automatically becomes double-stranded after a while. Providing an opportunity for primer binding during the single-strand and double-strand interconversions. In this solution the chance of DNA "respiration" itself is not high and is not controllable, and therefore the amplification sensitivity is not high. And also has disadvantages in amplifying the heterozygous strands of DNA and RNA. Because the hybrid strands of DNA and RNA are more stable than the double-stranded bond formed by DNA and DNA, they are less prone to "respiration". Therefore, the amplification sensitivity becomes low. On the other hand, the technology often needs four or even six primers to participate in the reaction, and the false positive amplification phenomenon is easily caused by more primers. RCA (Rolling circle amplification) technology also often requires high temperature denaturation to open double strands to bind primers, and the rolling circle replication and amplification characteristics of RCA technology also have many limitations in application. The HDA (helicase-dependent isothermal amplification technique) technique is a technique in which a DNA double strand is opened using a helicase and then a primer is bound and amplified by a polymerase. The present invention surprisingly found that the interaction of helicase and polymerase in this isothermal amplification technique plays a very critical role in amplification. And after extensive analysis of the principle, a new mutant motor protein was successfully screened and developed. The amplification performance of the technology under the participation of the mutant motor protein far exceeds that of the existing isothermal amplification technology.

Disclosure of Invention

Helicases are a large class of enzymes in motor proteins. Totally divided into six families, three superfamilies SF1, SF2, SF3, two small families Rho and DnaB like families, and one branched family AAA+ family. The helicases described in the present invention structurally belong to the SF1 family. Enzymes of this family are generally divided in structure into four domains, 1a,1b,2a,2b, respectively. The four domains perform different functions. Through structural function analysis scientists generally consider that 1B and 2B are closely related to the combination of double-stranded DNA, and 1A and 2A are closely related to ATP hydrolysis and DNA unwinding. The individual domains cooperate to ultimately perform the functions of binding and unwinding double-stranded DNA.

The helicase has wide application in molecular biology. Taking the example of the HDA (helicase-dependent isothermal amplification technique) technique, isothermal amplification of DNA is achieved mainly by two enzymes. First, a helicase is used which binds to double stranded DNA and is energized by hydrolytic ATP to open hydrogen bonds between the double stranded DNA. This allows specific primers to bind to the single stranded DNA template, which is then extended by the DNA polymerase to complete the amplification. In this system, the action of both helicase and DNA polymerase needs to have near perfect coordination. The speed and ability of the first helicase to unwind double stranded DNA is difficult to control manually. Taking the helicase Tte UvrD as an example, the efficiency of the helication is often far greater than the polymerization efficiency of DNA polymerase. When the number of template DNA molecules in the system is small, the concentration of helicase is required to be high in order to efficiently act on the double-stranded DNA molecules of a small number of substrates. The helicase has a strong working advantage relative to the DNA polymerase, so that the helicase is easy to cause that the DNA helicase has a higher polymerization efficiency than the DNA polymerase, the DNA polymerase is not polymerized after the primer is combined with the DNA, and the primer is possibly released from the template DNA by the helicase, so that the problem of low amplification sensitivity caused by the fact that the primer is not combined is solved.

In order to solve the technical problems, the invention provides mutant motor proteins from SF1 family, which are divided into four domains 1A,1B,2A and 2B; obtained by at least one mutation of the following modes:

(1) The motor protein increases the affinity to the DNA duplex by base mutation of the 1B and/or 2B domains;

(2) The motor protein reduces the melting speed of DNA by base mutation of 1A and/or 2A domains.

The mutant motor protein comprises at least one of helicase Tte UvrD, tth UvrD, pcrA and Rep. The amino acid sequence of Tte UvrD is shown as SEQ ID No. 2.

The mutant motor protein is specifically as follows:

the 1A and/or 2A mutations include: at least one of R71S mutation, R597K mutation, T34I mutation and Y613I mutation.

The mutant motor protein is specifically as follows:

the 1B and/or 2B mutations include: at least one of an I418G mutation, a P414K mutation, an R415I mutation, an I418L mutation, and an A421K mutation.

The mutant motor protein comprises any combination of at least two of 1A and/or 2A mutation, 1B and/or 2B mutation;

the 1A and/or 2A mutations include: R71S mutation, R597K mutation, T34I mutation, Y613I mutation;

the 1B and/or 2B mutations include: I418G mutation, P414K mutation, R415I mutation, I418L mutation, a421K mutation.

The present invention finds that compared to the situation where amplification of the 30 copy template of the wild-type enzyme is not possible, the 1B/2B domain I418G mutant enzyme has been able to effectively amplify lower copy number templates due to its higher affinity capture capacity for very small amounts of DNA templates (e.g., as low as 30 copies) in the system.

The present invention finds that the P414K mutation, R415I mutation, I418L mutation, A421K mutation in the 1B/2B domain has been found to be effective in amplifying lower copy number templates due to its higher affinity capture capacity for very small amounts of DNA templates (e.g., as low as 30 copies) in the system, as compared to the case where the wild-type enzyme 30 copy template is not amplified.

The invention discovers that the R71S mutant enzyme in the 1A/2A structural region is 3 CT values behind compared with the wild enzyme, namely, the R71S mutation reduces the unwinding activity of the enzyme to a certain extent.

The invention discovers that the CT value of R597K mutation, T34I mutation and Y613I mutation enzyme in the 1A/2A structural region is larger than the CT value of wild enzyme, namely, the R597K mutation, T34I mutation and Y613I mutation reduce the helicase activity to a certain extent.

The present invention finds that double mutant enzymes with T34I mutation in the 1A/2A structural region and I418L mutation in the 1B/2B structural region can carry out isothermal amplification on templates with the copy number as low as 10.

The invention discovers that seven mutant enzymes of P414K mutation, R415I mutation, I418L mutation, A421K mutation and R597K mutation, T34I mutation and Y613I mutation in the 1B/2B structural domain can carry out effective isothermal amplification on templates with copy numbers as low as 2 compared with wild type enzymes.

Further, the mutant motor protein further comprises an amino acid sequence with the similarity not lower than 95% and capable of achieving similar functions; the similar functions include: increasing affinity for DNA duplex and/or decreasing melting speed for DNA.

The invention also provides nucleic acid sequences expressing the mutated motor proteins described above.

The invention also provides application of the mutant motor protein in a DNA amplification system.

Further, for a helicase dependent DNA isothermal amplification system.

The invention also provides a DNA isothermal amplification kit depending on the helicase, which comprises the mutant motor protein.

The mutant motor proteins of the invention may be essentially one of the helicases. The application of the mutant motor proteins proposed in the present invention is only an example thereof, and the application of the actual mutant motor proteins is not limited thereto.

The mutant motor protein which is screened and optimized solves the contradiction of wild motor proteins. Motor proteins are composed of four domains, 1A,1B,2A and 2B, respectively. The 1A and 2A domains mainly have the functions of promoting ATP hydrolysis, coordinating magnesium ion activity, forming pi-ring stacking shape, finally unwinding double-stranded DNA, and the like. The 1B and 2B domains mainly serve to capture and bind firmly to double-stranded DNA. In the invention, two kinds of mutation are mainly carried out on the motor protein. The first mutation is mainly in the 1B and 2B domains, which act to increase the affinity of the motor protein for DNA duplex, so that small amounts of motor protein can bind and melt with relatively few templates with high efficiency. The second mutation is mainly in the 1A and 2A domains, and its effect is mainly that the mutation itself reduces the rate of DNA melting of the motor protein. The final effect achieved is that the amount of the motor protein is reduced, but the affinity of the motor protein to the DNA template substrate is increased, and the melting speed of the motor protein is reduced, so that the functional cooperation between the motor protein and the DNA polymerase can be accurately regulated, and the motor protein can be applied to nucleic acid amplification (such as an in-vitro simulated isothermal amplification technology based on mutant motor protein), and particularly, the effect of higher detection sensitivity is achieved when the DNA template is copied at low cost.

Drawings

FIG. 1 shows the wild-type helicase Tte UvrD and domains thereof;

FIG. 2 shows amplification results of wild-type helicase Tte UvrD compared to the use of commercial kits;

FIG. 3 is a three-dimensional structural comparison of wild-type helicase Tte UvrD and I418G mutant enzymes;

FIG. 4 shows amplification of 30 copies of the template by the wild-type helicase Tte UvrD and the I418G mutant;

FIG. 5 shows three-dimensional structures of 11 mutant helicases Tte UvrD in example 3;

FIG. 6 shows the amplification of 11 mutated helicase Tte UvrD30 copies templates in example 3;

FIG. 7 is a three-dimensional structural comparison of wild-type helicase Tte UvrD and R71S mutant enzymes;

FIG. 8 shows the amplification of 200 copies of the wild-type helicase Tte UvrD and the R71S mutase;

FIG. 9 shows three-dimensional structures of 9 mutant helicases Tte UvrD of example 5;

FIG. 10 shows the amplification of 9 mutant helicase Tte UvrD200 copies of plasmid in example 5;

FIG. 11 shows the three-dimensional structure of the double mutation of the wild-type helicase Tte UvrD;

FIG. 12 shows the amplification of wild-type helicase Tte UvrD and double mutant enzyme using 10 copies of the template;

FIG. 13 shows the seven mutant three-dimensional structure of the wild-type helicase Tte UvrD;

FIG. 14 shows the amplification of wild-type helicase Tte UvrD and seven mutant enzymes using 30 copies, 10 copies, 2 copies of template, respectively.

Detailed Description

The following examples are intended to further illustrate and illustrate the invention, but not to limit it.

Example 1

Commercial kit and application of wild Tte UvrD in isothermal amplification

The wild type Tte UvrD DNA sequence is as follows:

SEQ ID No.1：

/>

the wild type Tte UvrD amino acid sequence is as follows:

SEQ ID No.2：

MKEILANLNEQQKEAVTTTEGPLLILAGAGSGKTRVLTHRIAYLIKEKKVSPSNILAITFTNKAAEEMKTRVENLLGYVGDLWVSTFHSACVRILRRDIDKLGYDRNFVIFDTTDQKALVQECLKELDLSEKQYPIKMVLNAISSAKDKMVYPDDYIDFFGDTYRNRKIKEIYKLYQHKLKKINALDFDDIIIKTIELFKENPEILEFYQRKFRYIMVDEYQDTNTPQYYFVNLLAQRHRNLCVVGDDDQSIYGWRGADVRNILNFEKDYPEAKVIKLEQNYRSTKIILEAANHVIDNNVYRKKKSLWTQNKEGEKIVLCELENEREEAEFVIQEIIKLKERENRSFKDFAILYRTNAQSRPFEEALMKVKVPYKVVGALRFYDRKEIKDILAYLRLIVNPYDDISFKRIVNVPRRGIGPATIEALEKVAREKDTSLFFAIEDLKNARNKGSLLQFKQFILDLIDKKDAMSVSDLIKYILEQTGYIEELKREESEEAEGRIENLNEFLNAAYEFEESSEDKSLEAFLAGITLVSDIDMAGDIGESVVLMTLHSAKGLEFPVVFMVGMEEGLFPSYSSFEDDHELEEERRLCYVGITRSKERLYLTYARQRNLYGRSQYNSYSRFISEIPERLIVRYNIPTSKKTGFVSVHTFSDVYERSFSLGDKVEHKIWGIGTVVKVEGEEITVAFPNVGIKKLDLRFAPIKAIS

the wild-type Tte UvrD DNA sequence was cloned into PET28a vector using the restriction endonucleases NdeI and XhoI to construct pWY-UvrD. And (5) purifying the nickel column histidine tag. The histidine tag was digested and then further ion-exchange column monoS purified. Dissolved in 20mM Tris (pH 8), 150mM NaCl,0.1mM EDTA,5mM DTT,5% glycerol and 3% isopropanol. The various mutant enzymes in the examples below were also purified by expression in this way.

The test and detection are carried out by adopting a BRAF gene segment region of human leukocyte genome DNA:

the detection sequence is as follows:

SEQ ID No.3：

TTCTTAAGGGGATCTCTTCCTGTATCCCTCTCAGGCATAAGGTAATGTACTTAGGGTGAAACATAAGGTTTTCTTTTTCTGTTTGGCTTGACTTGACTTTTTTACTGTTTTTATCAAGAAAACACTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGACAAAGAATTGGATCTGGATCATTTGGGGGGAACAGTCTCAAGGGAAAGTGGCATGGTAAGTATGTAATGTGGTGACATTGTGACAAGTCATAATAGGATATGTTTAACAACTTTTATTTTGTAAAAAATATCATCAAAGGAAATATTCACTGTTCGCATCAATAAACTATTTTGATTAGTTTCAGGACTCCTCCAAAAGTTTCTAACAAAAATTATGGGAAATAAAAACTGTTCACAG

corresponding detection primer:

SEQ ID No.4：

F：

TTATCAAGAAAACACTTGGTAG

SEQ ID No.5：

R：

CAATGTCACCACATTACATA

control experiments used IsoAmp II Universal tHDA Kit (biohelix, #h0110S).

Wild type Tte UvrD experimental reaction system:

composition of the components	Concentration of
		KCl	10mM
Tris-HCl(Ph8.8)	20mM
		SEQ ID No.4-F	350nM
SEQ ID No.5-R	350nM
		Magnesium sulfate	8mM
Sodium chloride	80mM
		dNTPs	0.8mM each
ATP	6mM
		Wild Tte UvrD	200ng
Bst DNA polymerase	20U

And simultaneously, 30 copies, 50 copies, 80 copies, 100 copies and 200 copies are used as templates for amplification.

Experimental conditions were 65 ℃ for 2 hours.

The experimental results are shown in fig. 2:

example 1 analysis of results: this example illustrates that the use of the wild-type helicase Tte UvrD is less effective than the use of commercial kits. The detection can be stably performed at 80 copies or more of the template, the detection can be performed at 50 copies of the template occasionally, and the detection is difficult at 30 copies or less.

Example 2

Effect of I418G mutation in 1B/2B Domain on motor protein capture of double stranded DNA

G417, I418, G419 and their vicinity form a circular ring portion in the three-dimensional structure, which is a key region for capturing double-stranded DNA by helicase binding. FIG. 3 shows a three-dimensional structural comparison of wild-type enzyme and I418G mutant enzyme.

The experimental method for expression of the I418G mutant enzyme was the same as that of the wild-type enzyme in example 1. The experimental system, target region, primer, etc. for isothermal amplification reaction were the same as in example 1.

The experimental results are shown in FIG. 4.

Example 2 analysis of results: the I418G mutant enzyme has been able to amplify lower copy number templates effectively due to its higher affinity capture capacity for very small amounts of DNA templates (e.g., as low as 30 copies) in the system, as compared to the case where the wild-type enzyme 30 copy template is not amplified.

Example 3

Effect of P414K, R415I, R416I, G417E, I418L, I418R, I418T, I418V, P420V, A421K, T D mutation in 1B/2B domain on motor protein grasping double stranded DNA

FIG. 5 shows three-dimensional structures of 11 single point mutant enzymes.

The experimental method for expression of 11 single mutant enzymes was the same as that of the wild-type enzyme in example 1. The experimental system, target region, primer, etc. for isothermal amplification reaction were the same as in example 1.

The experimental results are shown in FIG. 6.

Example 3 analysis of results: the P414K mutation, R415I mutation, I418L mutation, a421K mutation have been shown to be effective in amplifying lower copy number templates due to their higher affinity capture capacity for very small amounts of DNA templates (e.g., as low as 30 copies) in the system, as compared to the case where the wild-type enzyme 30 copy template is not amplified.

Example 4:

effect of 1A/2A structural region R71S mutation on the ability of motor proteins to unwind

FIG. 7 shows the three-dimensional structures of wild-type and R71S mutant enzymes.

A segment of the S gene of the novel coronavirus COVID-19 sequence is used as a detection sequence. The sequence of the region to be detected is as follows:

SEQ ID No.6：

primer sequence:

SEQ ID No.7：

F：

ATAATGAAAATGGAACCA

SEQ ID No.8：

R：

TGGTTGGACTCTAAAGTTA

probe sequence:

SEQ ID No.9：

P：

5’FAM-GTGCACTTGACCCTCT-BHQ1 3’

a plasmid containing the sequence of SEQ ID No.6 was used as a template.

Wild-type enzyme and mutant enzyme experimental reaction system:

composition of the components	Concentration of
		KCl	10mM
Tris-HCl(Ph8.8)	20mM
		SEQ ID No.7-F	350nM
SEQ ID No.8-R	350nM
		SEQ ID No.9-P	500nM
Magnesium sulfate	8mM
		Sodium chloride	80mM
dNTPs	0.8mM each
		ATP	6mM
Wild-type enzyme/mutant enzyme	200ng
		Bst Full Length DNA polymerase	20U

And simultaneously, 200 copies of plasmid are used as templates for amplification.

Experimental conditions were 65 ℃ for 2 hours. Fluorescence signals were collected every 45 seconds.

The experimental results are shown in FIG. 8.

Example 4 analysis:

the R71S mutant enzyme is 3 CT behind the wild-type enzyme, i.e. the R71S mutation reduces the helicase activity to some extent.

Example 5:

effect of 1A/2A structural region K33T, R283L, R597K, T34I, D H, E219 220V, Y613G, Y613I, Y K mutation on motor protein helicity

FIG. 9 shows three-dimensional structures of 9 single point mutant enzymes.

The experimental procedure is as in example 4.

The experimental results are shown in FIG. 10.

Example 5 analysis:

the CT value of R597K mutation, T34I mutation and Y613I mutation enzyme is larger than that of wild type enzyme, the CT value of K33T mutation, R283L mutation, D219H mutation, E220V mutation, Y613G mutation and Y613K mutation enzyme is smaller than that of wild type enzyme, namely, the R597K mutation, T34I mutation and Y613I mutation reduce the unwinding activity of the enzyme to a certain extent.

Example 6:

effect of I418L mutation in 1B/2B Domain and T34I mutation in 1A/2A Domain on isothermal amplification

FIG. 11 shows the three-dimensional structure of the double mutant (I418L mutation and T34I) enzyme.

The experimental procedure is as in example 4.

Both wild-type and double mutant enzymes were amplified using 10 copies of the template.

The experimental results are shown in FIG. 12.

Example 6 analysis:

double mutant enzymes with T34I mutation in the 1A/2A domain and I418L mutation in the 1B/2B domain are capable of isothermal amplification of templates as low as 10 copies.

Example 7:

effect of P414K mutation, R415I mutation, I418L mutation, a421K mutation and R597K mutation, T34I mutation, Y613I mutation in 1A/2A structural region on isothermal amplification

FIG. 13 shows the three-dimensional structure of seven mutant enzymes.

The experimental procedure is as in example 4.

The wild-type enzyme and the seven mutant enzyme were amplified using 30 copies, 10 copies, and 2 copies of the template, respectively.

The experimental results are shown in FIG. 14.

Example 7 analysis:

seven mutant enzymes of P414K mutation, R415I mutation, I418L mutation, A421K mutation and R597K mutation, T34I mutation and Y613I mutation in the 1A/2A structural region can carry out effective isothermal amplification on templates with as low as 2 copies compared with wild type enzyme.

Sequence listing

<110> same year Biotechnology Co., ltd. In the south of lake

<120> a mutant motor protein, use thereof, kit

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2124

<212> DNA

<213> Tengchong thermophilic anaerobic bacterium (Thermoanaerobacter tengcongensis)

<400> 1

atgaaagaga ttctagctaa tttgaatgaa cagcaaaaag aagcagtaac caccacagaa 60

gggcctcttt taatactggc aggtgctgga agtggaaaaa ctagagtttt gacccacaga 120

attgcctatc tcataaagga aaaaaaggtc tctccttcca atatcctcgc aataaccttt 180

accaataaag cggcagagga aatgaagacg agagtggaaa atttgctggg atacgtcgga 240

gacctgtggg tgtctacttt tcattccgcc tgtgtcagaa tcttgagaag agatattgat 300

aaactgggtt acgacagaaa ttttgtaata tttgatacga ctgaccagaa ggcactagtc 360

caggaatgcc ttaaagaact agacttaagc gaaaagcaat acccgataaa aatggtatta 420

aatgccatct catctgcaaa agataaaatg gtatatccag acgattacat tgattttttt 480

ggagatacct ataggaatag aaaaataaag gaaatttaca agctttatca gcacaaacta 540

aaaaagataa atgctcttga ctttgacgac attatcataa aaacgataga gttatttaaa 600

gaaaatccag aaattttaga attttatcaa agaaaattta gatacataat ggtggacgag 660

tatcaggaca caaatactcc tcagtattac tttgtaaatt tgttagcgca aaggcacaga 720

aatttatgtg ttgtagggga tgatgaccag agcatttacg gctggagagg ggcagatgtg 780

agaaacatat taaactttga aaaagattat cccgaagcaa aagtgataaa attagaacaa 840

aactataggt ctacaaaaat catactggag gctgccaatc acgtcataga caacaatgta 900

tatcgaaaga aaaaatccct ctggacacaa aataaagagg gagagaaaat agttctgtgt 960

gagctggaaa atgaaagaga agaggcagaa tttgttatac aggagataat aaaactaaaa 1020

gaaagagaaa acagaagctt taaagacttt gcgatactct acaggacaaa cgcccagtca 1080

aggccttttg aagaagctct gatgaaagta aaagtgcctt ataaagtggt gggagcccta 1140

agattttatg acaggaaaga gataaaagat atacttgctt atcttcgcct cattgtaaat 1200

ccttatgacg acatatcctt caaaaggata gtaaatgttc caagaagagg cattggtcct 1260

gctacgattg aggcattgga gaaggtagcg agggaaaaag atactagtct tttttttgca 1320

atagaggatt taaaaaacgc aaggaacaaa ggaagccttc ttcagtttaa acagtttatt 1380

ttggatttaa ttgataaaaa agatgcaatg agtgtcagcg atttgataaa atatattctg 1440

gagcagacag gttatataga agagttaaaa agggaagaat ctgaagaagc agagggaagg 1500

atagaaaact taaacgaatt tttaaatgct gcctatgagt ttgaagaatc ttctgaagat 1560

aagtctttgg aagcattttt ggcgggcata actttagttt ctgatataga catggctgga 1620

gatattggag aaagtgtagt tctgatgaca cttcattctg ccaagggatt ggaatttcct 1680

gtagttttta tggtagggat ggaagaagga ctgtttcctt cttacagctc ctttgaagat 1740

gaccacgagc tggaagaaga aaggcgcctt tgttacgtgg gaattaccag atccaaagaa 1800

agattgtatt taacttatgc taggcagaga aacctttacg gtaggtccca gtacaattct 1860

tactccaggt ttataagtga aatacctgag aggctaattg tgaggtataa tataccgact 1920

tccaaaaaaa cgggctttgt ttccgtccat actttttcag atgtttatga aaggtctttt 1980

tcgcttgggg ataaggtgga gcacaagata tggggaatag ggactgttgt taaagtggaa 2040

ggggaagaga ttacagtagc ctttccgaac gttggtataa aaaagcttga tttgagattt 2100

gctcctatta aggcaatttc ttaa 2124

<210> 2

<211> 707

<212> PRT

<213> Tengchong thermophilic anaerobic bacterium (Thermoanaerobacter tengcongensis)

<400> 2

Met Lys Glu Ile Leu Ala Asn Leu Asn Glu Gln Gln Lys Glu Ala Val

1 5 10 15

Thr Thr Thr Glu Gly Pro Leu Leu Ile Leu Ala Gly Ala Gly Ser Gly

20 25 30

Lys Thr Arg Val Leu Thr His Arg Ile Ala Tyr Leu Ile Lys Glu Lys

35 40 45

Lys Val Ser Pro Ser Asn Ile Leu Ala Ile Thr Phe Thr Asn Lys Ala

50 55 60

Ala Glu Glu Met Lys Thr Arg Val Glu Asn Leu Leu Gly Tyr Val Gly

65 70 75 80

Asp Leu Trp Val Ser Thr Phe His Ser Ala Cys Val Arg Ile Leu Arg

85 90 95

Arg Asp Ile Asp Lys Leu Gly Tyr Asp Arg Asn Phe Val Ile Phe Asp

100 105 110

Thr Thr Asp Gln Lys Ala Leu Val Gln Glu Cys Leu Lys Glu Leu Asp

115 120 125

Leu Ser Glu Lys Gln Tyr Pro Ile Lys Met Val Leu Asn Ala Ile Ser

130 135 140

Ser Ala Lys Asp Lys Met Val Tyr Pro Asp Asp Tyr Ile Asp Phe Phe

145 150 155 160

Gly Asp Thr Tyr Arg Asn Arg Lys Ile Lys Glu Ile Tyr Lys Leu Tyr

165 170 175

Gln His Lys Leu Lys Lys Ile Asn Ala Leu Asp Phe Asp Asp Ile Ile

180 185 190

Ile Lys Thr Ile Glu Leu Phe Lys Glu Asn Pro Glu Ile Leu Glu Phe

195 200 205

Tyr Gln Arg Lys Phe Arg Tyr Ile Met Val Asp Glu Tyr Gln Asp Thr

210 215 220

Asn Thr Pro Gln Tyr Tyr Phe Val Asn Leu Leu Ala Gln Arg His Arg

225 230 235 240

Asn Leu Cys Val Val Gly Asp Asp Asp Gln Ser Ile Tyr Gly Trp Arg

245 250 255

Gly Ala Asp Val Arg Asn Ile Leu Asn Phe Glu Lys Asp Tyr Pro Glu

260 265 270

Ala Lys Val Ile Lys Leu Glu Gln Asn Tyr Arg Ser Thr Lys Ile Ile

275 280 285

Leu Glu Ala Ala Asn His Val Ile Asp Asn Asn Val Tyr Arg Lys Lys

290 295 300

Lys Ser Leu Trp Thr Gln Asn Lys Glu Gly Glu Lys Ile Val Leu Cys

305 310 315 320

Glu Leu Glu Asn Glu Arg Glu Glu Ala Glu Phe Val Ile Gln Glu Ile

325 330 335

Ile Lys Leu Lys Glu Arg Glu Asn Arg Ser Phe Lys Asp Phe Ala Ile

340 345 350

Leu Tyr Arg Thr Asn Ala Gln Ser Arg Pro Phe Glu Glu Ala Leu Met

355 360 365

Lys Val Lys Val Pro Tyr Lys Val Val Gly Ala Leu Arg Phe Tyr Asp

370 375 380

Arg Lys Glu Ile Lys Asp Ile Leu Ala Tyr Leu Arg Leu Ile Val Asn

385 390 395 400

Pro Tyr Asp Asp Ile Ser Phe Lys Arg Ile Val Asn Val Pro Arg Arg

405 410 415

Gly Ile Gly Pro Ala Thr Ile Glu Ala Leu Glu Lys Val Ala Arg Glu

420 425 430

Lys Asp Thr Ser Leu Phe Phe Ala Ile Glu Asp Leu Lys Asn Ala Arg

435 440 445

Asn Lys Gly Ser Leu Leu Gln Phe Lys Gln Phe Ile Leu Asp Leu Ile

450 455 460

Asp Lys Lys Asp Ala Met Ser Val Ser Asp Leu Ile Lys Tyr Ile Leu

465 470 475 480

Glu Gln Thr Gly Tyr Ile Glu Glu Leu Lys Arg Glu Glu Ser Glu Glu

485 490 495

Ala Glu Gly Arg Ile Glu Asn Leu Asn Glu Phe Leu Asn Ala Ala Tyr

500 505 510

Glu Phe Glu Glu Ser Ser Glu Asp Lys Ser Leu Glu Ala Phe Leu Ala

515 520 525

Gly Ile Thr Leu Val Ser Asp Ile Asp Met Ala Gly Asp Ile Gly Glu

530 535 540

Ser Val Val Leu Met Thr Leu His Ser Ala Lys Gly Leu Glu Phe Pro

545 550 555 560

Val Val Phe Met Val Gly Met Glu Glu Gly Leu Phe Pro Ser Tyr Ser

565 570 575

Ser Phe Glu Asp Asp His Glu Leu Glu Glu Glu Arg Arg Leu Cys Tyr

580 585 590

Val Gly Ile Thr Arg Ser Lys Glu Arg Leu Tyr Leu Thr Tyr Ala Arg

595 600 605

Gln Arg Asn Leu Tyr Gly Arg Ser Gln Tyr Asn Ser Tyr Ser Arg Phe

610 615 620

Ile Ser Glu Ile Pro Glu Arg Leu Ile Val Arg Tyr Asn Ile Pro Thr

625 630 635 640

Ser Lys Lys Thr Gly Phe Val Ser Val His Thr Phe Ser Asp Val Tyr

645 650 655

Glu Arg Ser Phe Ser Leu Gly Asp Lys Val Glu His Lys Ile Trp Gly

660 665 670

Ile Gly Thr Val Val Lys Val Glu Gly Glu Glu Ile Thr Val Ala Phe

675 680 685

Pro Asn Val Gly Ile Lys Lys Leu Asp Leu Arg Phe Ala Pro Ile Lys

690 695 700

Ala Ile Ser

705

<210> 3

<211> 422

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 3

ttcttaaggg gatctcttcc tgtatccctc tcaggcataa ggtaatgtac ttagggtgaa 60

acataaggtt ttctttttct gtttggcttg acttgacttt tttactgttt ttatcaagaa 120

aacacttggt agacgggact cgagtgatga ttgggagatt cctgatgggc agattacagt 180

gggacaaaga attggatctg gatcatttgg ggggaacagt ctcaagggaa agtggcatgg 240

taagtatgta atgtggtgac attgtgacaa gtcataatag gatatgttta acaactttta 300

ttttgtaaaa aatatcatca aaggaaatat tcactgttcg catcaataaa ctattttgat 360

tagtttcagg actcctccaa aagtttctaa caaaaattat gggaaataaa aactgttcac 420

ag 422

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttatcaagaa aacacttggt ag 22

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

caatgtcacc acattacata 20

<210> 6

<211> 131

<212> DNA

<213> New coronavirus (COVID-19)

<400> 6

ataatgaaaa tggaaccatt acagatgctg tagactgtgc acttgaccct ctctcagaaa 60

caaagtgtac gttgaaatcc ttcactgtag aaaaaggaat ctatcaaact tctaacttta 120

gagtccaacc a 131

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ataatgaaaa tggaacca 18

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tggttggact ctaaagtta 19

<210> 9

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gtgcacttga ccctct 16

Claims (3)

1. A mutant motor protein characterized by:

at least one of the following mutations is carried out on a wild-type motor protein Tte UvrD with an amino acid sequence shown as SEQ ID No. 2:

T34I mutation and I418L mutation, R597K mutation, T34I mutation, Y613I mutation, P414K mutation, R415I mutation, I418L mutation, A421K mutation, R71S, I418G mutation.

2. Use of a mutated motor protein according to claim 1, in a DNA amplification system.

3. Use according to claim 2, characterized by a DNA isothermal amplification system for helicase dependent applications.

Images