MXPA98000419A - Haloperoxidasas of vervulular curvular and nucleic acids that codify for the mis - Google Patents

Abstract

The present invention relates to haloperoxidases of Curvularia verruculosa and isolated nucleic acid fragments comprising nucleic acid sequences encoding the haloperoxidases as well as nucleic acid constructs, vectors and recombinant host cells comprising the nucleic acid sequences. The invention also relates to methods for the recombinant production of the haloperoxidase. The invention is further related to compositions comprising the haloperoxidases and methods of using the compositions to kill microbial cells or inhibit the growth of microbian cells.

Description

OF Verticultural Curvularia AND NUCLEIC ACIDS THAT CODIFY FOR THE SAME AH, 1? < ---? ÜEWTSS OF IA --- NVE-NCIOH FIELD OF THE INVENTION The present invention relates to haloperoxidases of Curvularia verruculosa and isolated nuclei; acid fragments comprising nucleic acid sequences encoding the haloperoxidases. The invention also relates to nucleic acid constructs, vectors and host cells comprising the nucleic acid sequences of nuclei as well as methods for producing the haloperoxidases. The invention is further related to methods of using the haloperoxidases.

DESCRIPTION DS LA TROTTC-ft FKTACIQNM? Haloperoxidases catalyze the oxidation of a halide ion (X = Cl ", Br" or i ") in the presence of a hydrogen peroxide (H, 02) to the corresponding hypohalide acid (HOX): H202 + X + H * - > H20 + HOX REF: 26704 If an appropriate nucleophilic acceptor compound is present, the hypohalose acid will react with the compound to form a halogenated compound. Haloperoxidases can also catalyze peroxidase reactions in certain substrates in the absence of halide ions, but the spectrum of substrates is extended in the presence of halide ions due to unspecific substrate and hypohalide ion reactions. Haloperoxidases are widely distributed in nature and are produced by mammals, plants, algae, lichens, bacteria and fungi. Probably the haloperoxidases are the enzymes responsible for the formation of halogenated compounds that occur naturally. There are three types of haloperoxidases, classified according to their specificity by halide ions: chloroperoxidases (E.C.; .11.1.10), which catalyze the chlorination, bromination and iodination of compounds; bromoperoxidases, which show specificity with ions bromide and iodide and iodoperoxidases (E.C., .11.1.8), which only catalyze the oxidation of iodide ions. Haloperoxidases discovered for the first time were determined to contain heme as the prosthetic group or cofactor. However, more recently, it has become apparent that there are also many haloperoxidases without a heme group. Bacterial haloperoxidases without a prosthetic group have been found. In addition, it has been shown that many other haloperoxidases without heme possess a prosthetic vanadium group. Haloperoxidases containing a vanadium prosthetic group are known to include bromoperoxidases from seaweed, and at least one type of fungal chloroperoxidase from Curvularia inaequalis (van Schijndel et al., 1993, Biochipdca Bicphysica Acta 1161: 249-256; simons et al. , 1995, European Journal of Bioc emistry 229: 566-574; wo 95/27046. Haloperoxidases, like other oxidoreductases, are of current interest due to their wide range of potential industrial uses. For example, haloperoxidases have been proposed for use as an antimicrobial agent. It is an object of the present invention to provide novel haloperoxidases which can be produced in commercially useful amounts.

BRIEF DESCRIPTION OF THE INVEHC-TÓN The present invention relates to isolated haloperoxidases obtained from Curvularia verruculosa and to isolated nucleic acid fragments comprising a nucleic acid sequence which codes for a haloperoxidase from Curvularia verruculosa. The present invention further provides nucleic acid constructs, vectors and recombinant host cells comprising a nucleic acid fragment of the present invention. In addition, the present invention provides methods for producing a haloperoxidase of the present invention, compositions and methods for destroying microbial cells or for inhibiting the growth of microbial cells.

BRIEF DESCRIPTION OF THE FIC-IDRAS Figure 1 illustrates the effect of zinc, vanadium and iron on the activity of the haloperoxidase of Curvularia verruculosa CBS 147.63. Figure 2 shows the effect of pH at 30 ° C on the activity of the haloperoxidase of Curvularia verruculosa CBS 147.63. Figure 3 illustrates the effect of temperature at pH 5.5 on the activity of the haloperoxidase of Curvularia verruculosa CBS 147.63. Figure 4 shows the effect of temperature at pH 7 on the stability of the haloperoxidase of Curvularia verruculosa CBS 147.63. Figure 5 illustrates the effect of pH at 30 ° C on the stability of the haloperoxidase of Curvularia verruculosa CBS 147.63.

Figure 6 shows the effect of the concentration of H202 at pH 7 and 60 ° C on the stability of the haloperoxidase of Curvularia verruculosa CBS 147.63. Figure 7 illustrates an agarose electrophoretic gel of the PCR amplification product of the gene sequences specific for haloperoxidase using the genomic DNA of Curvularia verruculosa CBS 147.63 as the template. Figure 8 shows an autoradiogram of a Southern blot of the genetic DNA of Curvularia verruculosa probed with a PCR-derived segment of the gene for haloperoxidase. Figure 9 illustrates an agarose electrophoretic gel of haloperoxidases clones digested with Bsil plus HindIII or Xhol plus HindIII. Figure 10 shows the DNA sequence encoding the amino acid sequence deduced from haloperoxidase of Curvularia verruculosa. Figure 11 illustrates an alignment of the haloperoxidase amino acid sequences of Curvularia verruculosa and Curvularia inaequalis. Figure 12 shows a restriction map of pBANed. Figure 13 shows a restriction map of pAJ014-l.

Figure 14 shows the course in time of the production of haloperoxidase during fermentation.

DESCRIPTION DETAT.T-ADA DE LA INVEMCI? W As mentioned above, the present invention relates to haloperoxidases obtained from the Curvularia verruculosa strain. In a preferred embodiment, the present invention relates to haloperoxidases obtained from Curvularia verruculosa CBS 147.63 or a mutant strain thereof, for example the haloperoxidase having the amino acid sequence set forth in SEQ. FROM IDENT. NO: 2 In another preferred embodiment, the present invention relates to haloperoxidases obtained from Curvularia verruculosa CBS 444.70 or a mutant strain thereof. The physicochemical properties of the haloperoxidases of the present invention can be determined using various techniques well known in the art. In a preferred embodiment, the haloperoxidases of the present invention contain a vanadium prosthetic group (see Figure 1). In another preferred embodiment, the haloperoxidases have a mass in the range between about 2 kDa and about 66 kDa, determined by mass spectrometry. In another preferred embodiment, the haloperoxidases of the present invention prefer bromine ion over chlorine ion, as a substrate. In another preferred embodiment, the haloperoxidases of the present invention have activity over a pH range between about 4 and about 11, preferably between about 5 and about 8. In another preferred embodiment, the haloperoxidases of the present invention have an optimum pH in the range from about 5.25 to about 6.25, preferably about 5.75 (see Figure 2). In another preferred embodiment, the haloperoxidases of the present invention have an optimum temperature in the range of 50-70 ° C, more preferably in the range of 55-65 ° C, more preferably at about 60 ° C (see Figure 3). In another preferred embodiment, the haloperoxidases of the present invention retain at least 50% activity, preferably at least 80% activity, after incubation for 1 hour at pH 7 and 60 ° C (see Figure 4). ). In another preferred embodiment, the haloperoxidases of the present invention retain at least 50% activity, preferably at least 80% activity after incubation for 1 hour at any pH in the range from about 4 to about 11 hours. 30 ° C (see Figure 5). In another preferred embodiment, the haloperoxidases of the present invention retain at least 50% activity, preferably at least 75% activity, after incubation in the presence of 0.1% H202 or one hour at pH 7 and 60 °. C (see Figure 6). The present invention also relates to haloperoxidases obtained from fungi which are synonymous with Curvularia verruculosa as defined by M.B. Ellis in -Dematiacesus Hy? Phcmycetes, Commonwealtrh Mycological Institute, Surrey, England, 1971. The genus Curvularia is a terrestrial member of the fungal group hifomycete dematiaceous. Vervucular Curvularia spores are usually curved, which acquire a rough wall and usually have only three septa. Strains of Curvularia verruculosa are easily accessible to the public in many culture collections, such as American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Research Service Patent Culture Collection, Northern Regional Research Center (NRRL), for example, ATCC 60943 -60948, DSM 1157, CBS 147.63 and CBS 444.70. The present invention also relates to haloperoxidases which are encoded by nucleic acid sequences which are capable of hybridization under conditions of high restriction (for example, prehybridization and hybridization at 45 ° C in 5 X SSPE, 0.3% SDS, 200 μg / ml of salmon sperm DNA subjected to cut and denatured, and 50% formamide) with a probe which hybridizes with the nucleic acid sequence established in SEC. FROM IDENT. NO: l under the same conditions. The gene, or an oligonucleotide based thereon, can be used as a probe in Southern hybridization to isolate homologous genes from any species of Curvularia verruculose. In particular, such probes can be used for use with the cDNA or genetic DNA of the species of interest, following standard or conventional Southern blotting procedures, in order to identify and isolate the corresponding haloperoxidase gene therein. A PCR reaction using the degenerate probe mentioned herein and first strand cDNA or cDNA of Curvularia verruculosa species can also provide a specific product of Curvularia verruculosa haloperoxidase which can then be used as a probe to clone the genetic DNA or corresponding cDNA. The identification and isolation of genes for haloperoxidase from a different source from those specifically exemplified herein can be carried out by using the methodology described in the present examples of publicly available strains of Curvularia verruculosa. For purposes of the present invention, the term "obtained from" means that the haloperoxidase is produced by a specific source, for example, a strain of Curvularia verruculosa, or by a cell in which a gene from the source coding has been inserted. for haloperoxidase. The invention also comprises variants of haloperoxidases which are at least about 93%, preferably about 95%, more preferably about 97% and even more preferably 99% homology with the amino acid sequence shown in Figure 10 (SEQ ID NO: 2), and which retains equivalently the activity of the proteins described herein. The invention is also directed to variants of haloperoxidases which have an amino acid sequence which differs by no more than three amino acids, more preferably no more than two amino acids, and much more preferably one amino acid of the sequence of amino acids that is established in the SEC. FROM IDENT. NO: 2 Each difference can be an insertion or deletion of an amino acid or the substitution of an amino acid residue for a different amino acid. Useful substitutions include those in which conservative amino acid substitutions have been made, substitutions which do not significantly alter the activity of the protein. By conservative substitution is meant that in which amino acids of the same class can be substituted by another amino acid of that class. For example, the non-polar aliphatic residues Ala, Val, Leu e lie can be exchanged, as can the basic residues Lys and Arg, or the acid residues Asp and Glu. Similarly, Ser and Thr are conservative substitutions among themselves, as are Asn and Gln. The haloperoxidase of the present invention can be purified by various methods known in the art including, but not limited to, chromatography (eg, ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic methods ( for example preparative isoelectric focusing (IEF)), differential solubility (for example ammonium sulfate precipitation), or extraction (see, for example, Protein Purification, eds J.-C. Janson and Lars Ryden, VCH Publishers, New York , 1989). As defined herein, an "isolated" haloperoxidase is a haloperoxidase which is essentially free of proteins other than haloperoxidase, for example, at least about 20% pure, preferably at least about 40% pure, of most preferably at least about 60% pure, and even more preferably about 80% pure, more preferably about 90% pure, and much more preferably about 95% pure, as determined by SDS-PAGE. gR-M-MENTOS DB -ftfTOO NptT-WTCO and UUtfl'KU'- S The present invention also relates to nucleic acid fragments comprising a nucleic acid sequence which codes for a haloperoxidase of the present invention and to nucleic acid constructs comprising a nucleic acid fragment of the present invention. In a preferred embodiment, the nucleic acid sequence encodes a haloperoxidase obtained from Curvularia verruculosa CBS 147.63, for example, the nucleic acid sequences set forth in SEQ. FROM IDENT. NO: l or CBS 444.70. The present invention also includes nucleic acid sequences which encode a haloperoxidase having the amino acid sequence set forth in SEQ. FROM IDENT. NO: 2, which differs from the SEC. FROM IDENT. NO: l by virtue of the degeneracy of the genetic code. The nucleic acid sequences of the present invention additionally encompass both the genomic sequence described therein as well as the corresponding cDNA and RNA sequences, and the phrase "nucleic acid sequences" as used herein will be understood to encompass the entire of such variations that include synthetic DNA. The present invention also relates to nucleic acid constructs comprising a nucleic acid fragment of the invention. It will be generally understood that "nucleic acid construct" means a nucleic acid molecule, either single or double stranded, which is isolated from a gene that occurs naturally or has been modified to contain segments of nucleic acid which combine and juxtapose in a way which would not otherwise exist in nature. In a preferred embodiment, the nucleic acid conjugates are operably linked to regulatory regions capable of directing the expression of the haloperoxidase in a suitable expression host. The present invention also provides recombinant vectors comprising a nucleic acid construct of the present invention. In a preferred embodiment, the nucleic acid sequence is operably linked to a promoter sequence. In another preferred embodiment, the vectors of the present invention additionally comprise a transcription termination signal and / or a selectable marker. The recombinant vectors of the invention are useful for the expression of the gene for haloperoxidase of Curvularia verruculosa in active form. A useful expression vector contains an element that allows stable integration of the vector into the genome of the host cell or autonomous replication of the vector in a host cell independent of the genome of the host cell, and preferably one or more phenotypic markers. which allow the easy selection of the transformed host cells. The vector may also include control sequences such as a promoter, ribosome binding sites, a translation start site and, optionally, a repressor gene, a selectable marker or other diverse activator genes. To allow secretion of the expressed protein, nucleic acids encoding a signal sequence can be inserted before the coding sequence of the gene. For expression under control or control sequences, a gene for haloperoxidase to be used according to the present invention is operably linked to control sequences in the appropriate reading frame. The vector carrying the nucleic acid construct of the present invention can be any vector which can be conveniently subjected to recombinant DNA methods. The choice of a vector will typically depend on the host cell into which the vector is to be introduced. The vector can be a self-replicating vector, that is, a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a monichromosome or an artificial chromosome. Alternatively, the vector can be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome or chromosomes in which it has been integrated. The vector system can be a single vector or a plasmid, or two or more vectors or plasmids which, together, contain the total DNA to be integrated into the genome. In the vector, the DNA sequence can be operably linked to a suitable promoter sequence. The promoter can be any DNA sequence which shows transcription activity in the host cell of choice and can be obtained from genes coding for proteins homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of nucleic acid constructs of the invention, especially in a bacterial host, are the promoter of the lac operon of E. coli, the dagA promoters of the agarase gene of Streptomyces coelicolor, the promoters of the gene for a-amylase (amyL) of Bacillus lichenifo? mis, promoters of the gene for maltogenic amylase (amyM) of Bacillus steauTOthermophilus, the promoters of a-amylase (amyQ of Bacillus a yloliquefaciens, the promoters of the genes for xylA and xylB of Bacillus subtilis, the prokaryotic promoter for β-lactamase (Villa-Kamaroff et al., 1978, Proceedings of the National Acade and of Sciences USA 75: 3727-3731) or the tac promoter (DeBoer et al, 1983, Proceeding of the National Academy of Sciences USA 80: 21-25) Additional promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242-74-94; and in Sambrook et al., Molecular Cloning, A Laboratory Manual 2d ed., Cold Spring Habor, New York, 1989. In a yeast host, a useful promoter is the eno-1 promoter. For transcription in a fungal host, examples of useful promoters are a? P-ones obtained from a gene encoding the TAKA amylase from Aspergillus oryzae, Rhizcmucor miehei aspartic proteinase, Aspergillus niger neutral a-amylase, stable a-amylase in Aspergillus niger acid, glucoamylase (glaA) from Aspergillus niger or from Aspergillus awamori, Rhizcmucor meehie lipase, Aspergillus oryzae alkaline protease Triosa phosphate isomerase from Aspergillus oryzae or acetamidase from Aspergillus nydulans. The promoters preferred are the promoters for TAKA-amylase and glaA. The vector of the invention may also comprise a suitable transcription terminator and, in eukaryotes, polyadenylation sequences operably linked to a DNA sequence encoding the haloperoxidase of the present invention. The termination and polyadenylation sequences can be obtained from the same sources as the promoter. The vector may further comprise a DNA sequence that allows the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUBUO, pE194, pAMBl, and pIJ702. The vector may also comprise a selectable marker, for example, a gene, the product of which complements a defect in the host cell, such as the genes of Bacillus subtilis or Bacillus lichenif ormis, or one which confers resistance to antibiotics such as resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Examples of selection markers for Aspergillus include dS, pyrG, argB, niaD, sC, trpC and hygB, a marker resulting in hygromycin resistance. The markers that are preferred for use in an Aspergillus host cell are the markers at dS and pyrG of Aspergillus nydulans and Aspergillus oryzae. A commonly used mammalian marker is the dihydrofolate reductase (DHFR) gene. In addition, the selection can be carried out by a cotransformation, for example, as described in WO 91/17243. To avoid the need to break the cell to obtain the expressed haloperoxidase, and to minimize the amount of possible degradation of the haloperoxidase expressed within the cell, it is preferred that the expression of the gene for haloperoxidase from a secreted product out of the cell . For this purpose, the haloperoxidases of the present invention may comprise a pre-regimen that allows secretion of the expressed protein to a fermentation medium. If desirable, this preregion can be native to a haloperoxidase of the invention or can be substituted with a different pre-region or signal sequence, which is conveniently carried out by substitution of the DNA sequences coding for the respective preregions . For example, the preregion can be obtained from a gene for glucoamylase or for amylase from a species of Aspergillus, a gene for amylase from Bacillus species, a gene for lipase or proteinase from Rhizapucor miehie, the gene for the factor a of Saccharcmyces cerevisiae or the gene for bovine preprochymosin. Particularly preferred is the TAKA amylase preregion of Aspergillus oryzae, Aspergillus niger neutral amylase, the Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus α-amylase or Bacillus lichenif ormis subtilisin. An effective signal sequence for fungal hosts is the TAKA amylase signal from Aspezgrillus oryzae, the hizomucor iehie aspartic proteinase signal or the Rhizcmucor miéhie lipase signal. The methods used to join the nucleic acid construct of the invention, the promoter, the terminator and other elements, respectively, and to insert them into a suitable vector which contains the information necessary for replication are well known to those familiar with the art (cf., for example, Sambrook et al., supra). The present invention also relates to host cells comprising a nucleic acid construct or an expression vector of the invention which is advantageously used in the recombinant production of the haloperoxidases of the invention. The cell can be transformed with the nucleic acid construct of the invention, conveniently by integration of the construct into the host chromosome. This integration is generally considered an advantage since the sequence is more likely to be stably maintained in the cell. The integration of the construct into the host chromosome can be carried out according to conventional methods, for example, by homologous or heterologous recombination. Alternatively, the cell can be transformed with an expression vector as described below in relation to different types of host cells. The choice of host cells and vectors will depend to a large extent on the haloperoxidase and its source. The host cell can be selected from prokaryotic cells, such as bacterial cells. Examples of suitable bacteria are gram-positive bacteria such as Bacillus subtili, Bacillus lichenif ormis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus laurus, Bacillus megaterium, Bacillus thuringiensis or Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E. coli. The transformation of the bacteria can be carried out, for example, by protoplast transformation or by the use of competent cells in a manner known per se. Preferably, the host cell is eukaryotic, such as a mammalian cell, an insect cell, a plant cell or preferably a micotic cell, which includes yeasts and filamentous fungi. For example, useful mammalian cells include CHO or COS cells. A yeast host cell can be selected from Saccharomyces or Schizosaccharcmyces species, for example, Saccharcmyces cerevisiae. Useful filamentous fungi can be selected from Aspergillus species, for example, Aspergillus oryzae or Aspergillus. Niger. Alternatively, a strain of Fusarium species, for example Fusarium axysporium or Fusarium graminearxm, can be used as a host cell. Mycotic cells can be transformed by a process that involves protoplast formation, transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se. A suitable method for the transformation of Aspergillus host cells is described in EP 238 023. A suitable method for transformation of JFlisarium species is described by Malardier et al., 1989, Gene 78: 147-156 or the co-pending US application number. series 08 / 269,449. In a particularly preferred embodiment, the expression of the gene for haloperoxidase is carried out in a fungal host cell, such as Aspergillus. The gene for haloperoxidase is ligated to a plasmid that preferably contains the TAKA amylase promoter from Aspergillus oryzae or the neutral amylase promoter NA2 from Aspergillus niger and amdS or pyrG as the selectable marker. Alternatively, the selectable marker can be in a separate plasmid and can be used in cotransformation. The plasmid (or plasmids) are used to transform host cells of Aspergillus species, such as Aspergillus oryzae or Aspergillus niger according to methods described in Yelon et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474.

METHODS FOR PRQEOCIR THE HAT-OPEROXT-NASAS OF TA PRBSEWTE J¡ ____ __ The present invention also relates to methods for producing a haloperoxidase of the present invention "comprising: (a) fermenting a strain of Curvularia verruculosa to produce a supernatant comprising the haloperoxidase; and (b) recovering the haloperoxidase. The present invention also relates to methods for recombinantly reproducing a haloperoxidase of the present invention comprising: (a) fermenting a host cell comprising a nucleic acid construct comprising a nucleic acid sequence encoding the haloperoxidase under conditions that lead to the production of the enzyme, and (b) recover the haloperoxidase. If the expression system secretes the haloperoxidase into the fermentation medium, the enzyme can be recovered directly from the medium. If the recombinant haloperoxidase is not secreted, it is recovered from cell lysates. As defined herein, the term "fermentation" is any method of culturing a cell that results in the expression or isolation of haloperoxidase. Therefore, the fermentation can be understood to comprise shake flask culture, small or large scale fermentation (including continuous, batch, batch or solid state fermentation) in the laboratory or in industrial fermenters carried out in a suitable medium and under conditions that allow the haloperoxidase to be expressed or isolated. The fermentation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art (see, for example Bennett JW and LaSure, L. (eds.), More Gene Manipulation in Fungi, Academic Press, CA, 1991). Suitable means are available from commercial suppliers or can be prepared according to published compositions (for example, in the catalogs of the American Type Culture Collection). The resulting haloperoxidases produced by the methods described in the above can be recovered from the fermentation medium by conventional methods including, but not limited to, centrifugation, filtration, lyophilization, evaporation or precipitation. The recovered protein can then be further purified by various chromatographic methods, for example ion exchange chromatography, gel filtration chromatography, affinity chromatography or the like.

APPLICATIONS The present invention is further directed to methods of oxidizing a halide ion or the corresponding hypohalide acid, which comprises reacting the halide ion and a source of hydrogen peroxide in the presence of a haloperoxidase of the invention. The present invention also relates to methods of halogenating a compound which comprises reacting the compound, a halide ion and a source of hydrogen peroxide in the presence of a haloperoxidase of the invention. The present invention also relates to methods for destroying or inhibiting the growth of microbial cells, which comprises contacting the cells with a haloperoxidase of the invention, a source of hydrogen peroxide and a source of thiocyanate in an aqueous solution.

The source of hydrogen peroxide can be hydrogen peroxide itself or a hydrogen peroxide precursor such as a percarbonate, perborate, peroxycarboxylic acid or a salt thereof. In addition, the source can be an enzymatic system that generates hydrogen peroxide such as an oxidase, for example a glucose oxidase, glycerol oxidase or amino acid oxidase, and its substrate. The source of hydrogen peroxide can be added at a concentration corresponding to a concentration of hydrogen peroxide in the range from about 0.001 to about 10 mM, preferably from about 0.01 to about 1 mM. The thiocyanate source can be thiocyanate itself or a salt thereof, for example, sodium or potassium. In addition, if the reaction is carried out orally, the thiocyanate is endogenous to saliva. A thiocyanate source can be added at a concentration corresponding to a thiocyanate concentration in the range from about 0.001 to about 10 mM, preferably from about 0.01 to about 1 mM. Haloperoxidases can be used as preservatives or preservatives and disinfecting agents for example in water-based paints and personal care products, for example, toothpaste, mouthwash, skin care creams and lotions, formulations for hair care and body care, solutions for cleaning contact lenses and dentures. Haloperoxidases can also be used to clean surfaces and kitchen utensils in food processing plants and in any area in which food is prepared or served. Haloperoxidases can also be used in enzymatic bleaching applications, for example, pulp bleaching and bleaching dyeing (in detergent compositions). The concentration of the haloperoxidase in the methods of use of the present invention is preferably in the range of 0.001 HU / ml-10 HU / ml, more preferably in the range of 0.001-1 HU / ml (as defined after) . The present invention is further illustrated in the following examples which in no way are considered as limiting the scope of the invention as claimed.

EXAMPLES Example 1: Culturing of verrucous Curvuleuria CBS 147.63 Curvularia verruculosa CBS 147.63 is grown for 165 hours at 26 ° C and 250 rpm in a 2 1 fermenter having a fermentation medium consisting of the following components: Glucose 15 g / 1 Yeast extract 4 g / 1 K2HP0 «1 g / 1 MgSO4-7H20 0.5 g / 1 V0 S04 167 mg / l The medium is adjusted to pH 7.2 before autoclaving. The fermenter is inoculated directly from agar slants suspended with 10 ml of sterilized H20 containing 0.01% Tween where 2.5 ml of the suspension is used to inoculate each shake flask. The supernatant is recovered by centrifuging the whole broth, and it is washed and concentrated 24 times using a Piltron apparatus with a threshold or limit membrane of 10 kDa.

Ejenplo 2: Tests for haloperoxidase Microtiter tests are performed by mixing 100 μl of haloperoxidase samples (approximately 0.2 μg / ml) and 100 μl of 0.3 M sodium phosphate buffer, pH 7, 0.5 M potassium bromide, 0.08% phenol red, add the solution to 10 μl of 0.3% H202 and measure the absorption at 595 nM, as a function of time. The following tests are carried out as described using monochlorodimedone (Sigma M 4632, e -20000 M ^ cm "1 at 290 nm) as substrate The decrease in absorption at 290 nm is measured as a function of time. in 0.1 M sodium phosphate or 0.1M sodium acetate, 50 μM monochlorodimedone, 10 mM KBr / KCl and 1 M H202 using a halohaloperoxidase concentration of about 1 μg / ml A HU is defined as a micromole of chlorinated monochlorodimedone or Brominated per minute at pH 5 and 30 ° C. The temperature, pH and stability experiments of H202 are carried out by preincubating the haloperoxidase under the indicated conditions and then performing assay of residual activity in the microtiter assay.

Example 3: Purification of Cuxvularia verruculose Holuperoxidase CBS 147.63 30 ml of concentrated supernatant of the complete broth described in Example 1 is loaded onto a 30 ml A-Sepharose column (XK 16/60) equilibrated with potassium phosphate buffer. mM, pH 7.0 and which is eluted with a linear gradient of 300 ml of sodium chloride from 0 to 1 M at a flow of 2 ml / minute. 3 ml fractions are collected, and the fractions containing haloperoxidase activity are accumulated, concentrated (Centricon-10, Amicon) and subjected to gel filtration on a HiLoad Superdex 75 (16/60) column (Pharmacia) equilibrated with buffer of 50 mM sodium phosphate, pH 7.1, and eluted in the same buffer at a rate of 1 ml / minute. 1.5 ml fractions are collected. The haloperoxidase assays are carried out as described in Example 2.

Example 4: Characterization of Haloperoxidase from Curvularia verruculosa CBS 1476.63 The purified haloperoxidase as described in Example 3 is pretreated for 45 minutes with 0.1 M sodium phosphate buffer, pH 7 (control) or in 0.1 M sodium citrate-10 mM EDTA, pH 3.8. After pretreatment, the haloperoxidase is treated for 2 hours with a 10 mM additive in 0.2 M Tris-HCl, pH 7.5, where the additive is Na3V04, FeCl2 or ZnCl2. Figure 1 shows that the haloperoxidase loses activity when treated with EDTA, which indicates the presence of a prosthetic group necessary for activity. The addition of zinc or iron has no effect on the activity of haloperoxidase. However, the addition of vanadate results in recovery of haloperoxidase activity, indicating that it contains a prosthetic vanadium group. The optimum pH and specificity towards Br "and Cl" of the haloperoxidase is determined in a 0.1 M sodium acetate buffer containing 50 M monochlorodimedone, 1 mM H202, 10 mM KBr or KCl and 0.4 μg / ml haloperoxidase (coefficient of extinction - 2.6 l / g * cm), 30 ° C. As shown in Figure 2, the haloperoxidase prefers Br "than Cl" as the substrate and has an optimum pH of about 5.75. The optimum temperature of haloperoxidase in 0.1 M sodium acetate buffer, pH 5.5 containing 50 mM monochlorodimedone, 10 mM KBr, 1 mM H202 and 0.1 μg / ml enzyme, is approximately 60 ° C (Figure 3). The stability of the haloperoxidase as a function of temperature was determined by preincubating the haloperoxidase for 1 hour at a given temperature in 20 mM sodium phosphate buffer, pH 7. The results show that the haloperoxidase remains stable for at least one hour at temperatures up to 60 ° C (figure 4). Haloperoxidase (4 μg / ml) is also stable over a wide pH range, as shown in figure 5, and it retains more than 80% activity after incubation for one hour at 30 ° C in Britter's buffer. Robinson 20 mM at variable pH from 5 to 11 (control at pH 7, 4 ° C). In addition, haloperoxidase (3 μg / ml) is very stable in the presence of H202, and retains 75% residual activity after one hour of incubation at 60 ° C in the presence of 0.1% H202 in 50 mM sodium phosphate, pH 7 (figure 6).

Example 5: Determination of the amino acid sequence of the haloperoxidase of Curvularia verruculosa CBS 147.63 Haloperoxidase from Currularia verruculose CBS 147.63 reduced and S-carboxylmethylated (= 1 ng) is digested with 10 μg of Achrcmobacter lysyl-specific protease in 20 mM NH4HC03 for 16 hours at 37 ° C. The resulting peptides are separated by reverse phase CLAP using a Vydac C18 column and 0.1% trifluoroacetic acid TFA) as solvent A and 80% 2-propanol containing 0.8% TFA, as solvent B. The column is first equilibrated with 5% solvent B, which is equal to 95% solvent A. Subsequently the column is washed with 5% solvent B for 5 minutes after injection of the peptide mixture. The bound peptides elute finally at a flow rate of 150 μl / minute with a linear gradient of solvent B where the gradient runs for 85 minutes and ends at 95 minutes of total time with 90% solvent B (which is equal to 10% solvent A). The peptides are purified using a linear gradient involving 0.1% TFA as solvent A and 80% acetonitrile containing 0.8% TFA as solvent B at a rate of 250 μl / minute. The determination of the amino acid sequence is carried out on an Applied Biosystems 473A protein sequence determinant, according to the manufacturer's instructions. In the process of direct amino acid sequence determination, it becomes evident that the N-terminal part of the protein is blocked, and therefore is not accessible for its sequence to be determined. However, the sequence of eight internal peptides is determined. The sequences obtained with as follows (SEQ ID NO: 3-10).

Peptide 1: Xaa-Phe-Ala-Thr-Gln-Ser-Glu-His-Ile-Leu-Ala-Asp-Pro-Pro-Gly-Leu-Arg-Ser-Asn-Ala-Asp-Glu-Thr-Ala -Glu-Tyr-Asp-Asp-Ser-Ile-Arg-Val-Ala-lie-Ala-Met-Gly-Gly-Ala-Gln-Asp-Leu-Asn (SEQ ID N0: 3) Peptide 2: Phe-Arg-Gln-Tyr-His-Ala-Pro-Phe-Tyr-Gly-Met-Thr-Thr-Lys (SEQ ID NO: 4) Peptide 3: Asp-Val-Tyr-Ala-Val-Asp-Ser-Asn-Gly-Ala-Thr-Val-Phe-Gln-Asn-Val-Glu-Asp-Val-Arg-Tyr-Ser-Thr-Lys (SEQ ID NO: 5) Peptide 4 Arg-Ser-Pro-Trp-Gln-Thr-Ala-Gln-Gly-Leu-Tyr-Trp-Ala-Tyr-Asp-Gly-Ser-Asn-Leu-Val-Gly-Thr-Pro-Pro- Arg-Phe-Tyr-Asn-Gln-Ile-Val-Arg-Arg-Ile-Ala-Val-Thr-Tyr-Lys-Lys (SEQ ID NO: 6) Peptide 5: Phe-Asp-Asp-Glu-Pro-Thr-His-Pro-Val-Val-Leu-Val-Pro-Val-Asp-Pro-Asn-Asn-Asn-Asn-Gly-Gly-Lys (SEC DE IDENT NO: 7) Peptide 6: Pro-Ala-Asp-Pro-Asn-Thr-Gly-Thr-Asn-Ile-Ser-Asp-Asn-Ala-Tyr-Ala-Gln-Leu-Ala-Leu -Val-Leu-Glu-Arg-Ala-Val-Val-Lys (SEQ ID NO: 8) Peptide 7: Met-Leu-Ser-Ser-Leu-Tyr-Met-Lys (SEQ ID NO: 9) Peptide 8: Met-Pro-Phe-Arg-Gln-Tyr-His-Ala-Pro-Phe-Tyr-Gly-Met-Thr-Thr-Lys (SEQ ID NO: 10) Peptide 8 is identical to peptide 2, except for two additional amino acid residues in the N-terminal part.

Ejespío 6: Analysis of amino acids of havsperaxidase of Curvularia vezxuculosa CBS 147.63 The hydrolysis for amino acid analysis is carried out in duplicate. Freeze-dried samples are hydrolyzed in sealed and purged glass bottles containing 100 μl of 6 N HCl, 0.1% phenol, for 16 hours at 110 ° C. The analysis is carried out using an amino acid analysis system of Applied Biosystems 420A, according to the manufacturer's instructions.

The results of the determination of the amino acid composition are presented in Table 1 (the values are an average of four determinations).

Table 1. Amino acid composition of the haloperoxidase of Curvularia verruculosa. ND = »Not determined ? jespío 7: Analysis by SDS-PAGE and IEF of the haloperoxidase of Curvularia verruculosa CBS 147.63 The SDS-PAGE (Novex) and IEF (Pharmacia) tests are performed according to the manufacturer's instructions. The IEF gel is stained for haloperoxidase activity using the phenol red reagent and H202. The SDS-PAGE test shows that the haloperoxidase has a molecular weight of approximately 68 kDa, while the IEF test indicates that the haloperoxidase has an isoelectric point of approximately 3.8.

Example 8: Analysis of carbohydrate of havsperoxidase of Curvularia verruculosa CBS 147.63 Hydrolysis of protein-bound carbohydrates is performed in duplicate for analysis of monosaccharide composition. Freeze-dried samples are hydrolyzed in sealed and purged glass tubes with 100 μl of 2 M TFA for 1 hour and 4 hours, at 100 ° C. The monosaccharides are separated by high-resolution anion exchange chromatography using a PAI Dions column eluted with 16 mM NaOH and detected by pulse amperometric detection. The analysis of the monosaccharide composition shows «that the haloperoxidase is glycosylated as shown in table 2 (the values are an average of four determinations). The absence of glucosamine in the analysis suggests that the carbohydrate is probably bound to 0. What is interesting is that glucose is not usually found in glycoproteins.

Table 2. Composition of monosaccharides of the haloperoxidase of Curvularia verruculssa Ejepplo 9: Haloperoxidase mass spectrometry of Curvularia verruculosa CBS 147.63 Mass spectrometry was performed using mass spectrometry by laser desorption assisted desorption of time-of-flight matrix in an analytical VO TofSpec. For mass spectrometry, 2 μl of haloperoxidase is mixed with 2 μl of saturated matrix solution (α-cyano-4-hydroxysuccinnamic acid in TFA at 0. 1%: acetonitrile (70:30)) and 2 μl of the mixture placed on the target plate. Before introduction into the mass spectrometer, the solvent is removed by evaporation. The samples are desorbed and ionized by laser pulses of 4 ns (337 nm) at a laser threshold power and accelerated in a free field flight tube by an acceleration voltage of 25 kV. The ions are detected by a microchannel plate that is established at 1850 V. The intact haloperoxidase is analyzed as well as all the initial peptide fractions by mass spectrometry. Mass spectrometry clearly shows that the glycosylation of the haloperoxidase is heterogeneous. The average mass of the haloperoxidase is approximately 64,500 Da, which agrees reasonably with the molecular weight of 68 kDa determined by SDS-PAGE. The haloperoxidase mass varies from 62 kDa to 66 kDa.

Example 10: Determination of haloperoxidase-specific activity of Curvularia verruculosa CBS 147.63 The specific activity of haloperoxidase of Curvularia verruculosa CBS 147.63 was determined under the following conditions: 0.1 M sodium acetate, 50 μM monochlorodimedone, 1 mM H202 and 10 mM KCl, at pH 5 and ° C. A specific activity of 13 HU / Ajgo was determined, «which corresponds to a specific activity of 33.8 U / mg of haloperoxidase, based on the measured extinction coefficient of 2.6 1 / (g * cm). Under similar conditions, the specific activity reported by Simons et al., Supra, for the haloperoxidase of "lirvularia inaequalis" is 7.5 U / mg. Therefore, apparently the enzyme of Curvularia verruculosa has approximately a specific activity four times greater than that of Curvularia inaequalis.

Ejepplo 11: Extraction of genomic AEN Curvularia verruculosa CBS 147.63 is grown in 25 ml of 0.5% yeast extract medium-2% glucose (YEG) for 24 hours at 32 ° C and 250 rpm. The mycelia are then collected by filtration through Miracloth (Calbiochem, La Jolla, CA) and washed once with 25 ml of 10 mM Tris buffer-1 nM EDTA (TE). The excess buffer is drained from the mycelial preparation, which is subsequently frozen in liquid nitrogen. The preparation of frozen mycelium is ground to a fine powder in an electric coffee grinder, and the powder is added to a disposable plastic centrifuge tube containing 20 ml of TE buffer and 5 ml of 20% sodium dodecylsulfate p / v (SDS). The sample is gently inverted several times to ensure mixing, and extracted twice with an equal volume of phenol chloroform: isoamyl alcohol (25: 24: 1 v / v / v). Sodium acetate (3 M solution) is added to the extracted sample, to a final concentration of 0.3 M followed by 2.5 volumes of ice-cold ethanol to precipitate the DNA. The tube is centrifuged at 15,000 x g for 30 minutes to pellet the DNA. The DNA pellet is allowed to air dry for 30 minutes before resuspension in 0.5 ml of TE buffer. DNase-free ribonuclease A is added to the resuspended DNA pellet at a concentration of 100 μg / ml and the mixture is subsequently incubated at 37 ° C for 30 minutes. Proteinase K (200 μg / ml) is added and incubated in tube for an additional hour at 37 ° C. Finally, the sample is extracted twice with phenol: chloroform: isoamyl alcohol and the DNA is precipitated with methanol. The precipitated DNA is washed with 70% ethanol, dried under vacuum, resuspended in TE buffer and stored at 4 ° C.

Example 12: Amplification by PCR of the segments of the gene for haloperoxidase of Curvularia verruculosa CBS 147.63 Based on the amino acid sequence of the curvularia verruculose haloperoxidase CBS 147.63 described above and of the Haloperoxidase of Curvularia inaequalis described by Simón et al., Supra, the oligonucledtide primers or primers shown below are synthesized with a synthetic synthesizer. DNA / AJRN of Applied Biosystems model 394, according to the manufacturer's instructions, for use to PCR amplify the gene fragments for C rvularia verruculosa CBS 147.63 haloperoxidase: Front starter-- dGAAGAGTACAACACCAACTACATA Rear starter; dCCCATCGTAGGCCCAGTATAGGCCCTG Amplification reactions (100 μl) are prepared using approximately 1 μg of genomic DNA from Curvularia verru «rulos CBS 147.63 as the template. Each reaction contains the following components: 1 μg of genomic DNA, 40 pmol of forward primer, 40 pmol of reverse primer, 200 μM of each of dNTP, buffer for Taqpolymerase 1 × (Perkin-Elmer Corp., Branchburg, NJ) and 5 units of Taq polymerase. { Perkin-Elmer Corp., Branchburg, NJ). Sterile mineral oil (100 μl) is placed over each reaction mixture and the reactions are incubated in a Perkin-Elmer Model 480 thermal cycler programmed as follows: cycle 1 »95 ° C for 5 minutes, 45 ° C for 2 minutes and 67 ° C for 5 minutes; Cycles 2-30 »95 ° C for 2 minutes; 45 ° C for 2 minutes and 67 ° C for 2 minutes; and rinsing cycle at 4 ° C. The reaction products are isolated on an agarose gel with a low melting point of 1% (Sigma Chemical Co., St. Louis, MO). The gel product bands are cut and purified using β-agarase (New England Biolabs, Beverly, MA) according to the manufacturer's instructions. The purified PCR products are subsequently cloned into the pCRII vector (Invitrogen, San Diego, CA) and the DNA sequences are determined using the lac front and rear primers (New England BioLabs, Beverly, MA). A gene segment for haloperoxidase consisting of approximately 278 codons is amplified (834 bp) of Curvularia verruculosa CBS 147.63, as shown in Figure 7, with the PCR primers specific for haloperoxidase described above. DNA sequence analysis shows that the amplified gene segments code for a portion of the corresponding haloperoxidase gene of Curvularia verruculosa. The gene segment for haloperoxidase is used to probe a Southern blot of the genomic DNA of Curvularia verruculosa CBS 147.63.

Ejepplo 13: Analysis by hybridization of genetic AEN Samples of total cellular DNA are prepared from Currularia verruculosa CBS 147.63 described in Example 11 and analyzed by Southern hybridization (Maniatis et al., 1982, Mlecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York). Approximately 2-5 μg of DNA are digested with Xbal, BamHl plus HindIII, Ba Hl plus PstI or BamHl plus Xbal and fractionated on 1% agarose gel. The gel is photographed under UV light of short wavelength and wet for 15 minutes in NaOH 0.5 M-NaCl 1.5 M followed by 15 minutes in Tris-HCl 1 M, pH 8-NaCl 1.5 M. The DNA in the gel transferred to a Nytran "* hybridization membrane (Schleicher &Schuell, Keene, NH) by capillary transfer in 20 X SSPE (3 M sodium chloride-0.2 M sodium dibasic phosphate, 0.02 M distal EDTA) according to Davis et al, (1980, Ac? vance Bacterial Genetics, A Manual for Genetic Engineering, Cold Spring Harbor Press, Cold Spring Harbor, New York) The DNA is cross-linked onto the membrane using a Stratalinker UV (Stratagene, La Jolla, CA) , and the membrane is moistened for 2 hours in the following hybridization buffer at 45 ° C with gentle shaking: 5 X SSPE, 50% formamide (v / v), 0.03% SDS and 200 μg / ml testis DNA of salmon is naturalized and subjected to shearing.The gel fragment for haloperoxidase isolated from Curvularia verruculosa CBS 14 7.63 by PCR-clone as described in Example 2 is radiolabelled and used to probe the Southern blot of Curvularia verruculose genomic DNA CBS 147.63. Specifically, the gene fragment is radiolabeled by nick translation (Maniatis et al., supra) with [32P] dCTP (Amersham, Arlington Heights, IL), denatured by adding NaOH to a final concentration of 0.1M and added to the buffer of hybridization to an activity of approximately 1 x 10β cpm per ml of buffer. The mixture is incubated overnight at 45 ° C in a shaking water bath. After incubation, the membranes are washed once in 0.2X SSPE with 0.1% SDS at 45 ° C, followed by two washes in 0.2X SSPE (without SDS) at the same temperature. The membranes are allowed to dry on paper towels for 15 minutes, then wrapped in Saran-Wrap ™ and exposed to an X-ray film overnight at -70 ° C with intensification screens (Kodak, Rochester, NY). Analysis of total cell DNA samples of Curvularia verruculosa CBS 147.63 by Southern blot under conditions of moderate restriction using the segment probe of the haloperoxidase gene derived from Curvularia verruculosa PCR CBS 147.63 shows a single hybridization signal (Figure 8). The unique hybridization signal suggests that there is only one copy of the haloperoxidase gene present in the genome of Curvularia verruculosa CBS 147.63.

Example 14: AEN libraries and identification of haloperoxidase clones A genomic DNA library is constructed in the bacteriophage cloning vector ZipLox (Life Technologies, Gaithersburg, MD). First, the total cellular DNA is partially digested with Tsp509I and fractionated by size on 1% agarose gels. The fragments of DNA that migrate in the size range of 3-7 kb are cut and eluted from the gel using Prep-a-gene reagents (BioRad Laboratories, Hercules, CA). The DNA fragments eluted with EcoRI are ligated and dephosphorylated with vector arms, ZipLox (Life Technologies, Gaithersburg, MD), and the ligation mixtures are packaged using commercial packaging extracts (Stratagene, La Jolla, CA) . The packed DNA libraries are plated and amplified in Escherichia coli Y1090ZL cells (Life Technologies, Gaithersburg, MD). The unamplified genomic DNA library contains 3.1 x 10 5 pfu / ml (background titers without DNA 2.0 x 10 * pfu / ml). Approximately 60,000 plates of the library are examined by plaque hybridization using the Curvularia verruculosa operoxidase-specific PCR fragment CBS 147.63 as a probe (Davis et al., 1980, Advanced Bacterial Genetics, A Manual for Genetic Engineering, Cold Spring Harbor Press, Cold Spring Harbor, New York). Six plaques are purified, which have strong hybridization signals with the probe, twice in E. coli Y1090ZL cells and the genes for haloperoxidase are subsequently separated from the vector? ZipLox as pZLl derivatives (D'Alessio et al., 1992, Focu? * 14:76) using the live ip cut by infecting E. coli DH1090 zip cells (Life Technologies, Gaithersburg, MD). Miniprep DNA is prepared from each of these clones and the sizes of the haloperoxidase inserts are determined by agarose gel electrophoresis, as shown in Figure 9. Several of the clones appear to be consanguineous and include two clones designated 4A1 and 4A2, which house inserts that match the plasmid band (ca. 4.3 kb). Clone 4A of haloperoxidase (E. coli DH10B-pHAP4A.l) is selected for DNA sequence analysis using a Wizard 373 DNA purification kit (Promega, Madison, Wl).

Example 15: DNA sequence analysis of the gene for haloperoxidase of Curvularia verruculosa CBS 147.63 The DNA sequence determination of the haloperoxidase clone 4A (E.coli DH10B-pHAP4A.l) described in Example 14 is carried out with an Applied Biosystem model 373A automated DNA sequence determiner (Applied Biosystems, Inc., Foster City, CA) in both strands using a combination of trigger DNA sequence determination and initiator walking technique with dye terminator chemistry (Giesecke et al., 1992, Journal of Virol. Methods 38: 47-60 ). In addition to the lac forward and lac rear primers, the following primers for oligonucleotide sequence determination used for the determination of the gene sequence in a DNA / RNA synthesizer from Applied Biosystems model 394 are synthesized, according to the manufacturer's instructions : Initiator of sequence determiner - ^ i tninia-inr < = > asmience 951337 dCATGTGGGACGAGCAGGTGCCGTTG (SEQ ID NO: 11) 951338 dGATAGAAAAGTAGGCATCGTGGATA (SEQ ID NO: 12) 951367 dCAGAGCTCTGGCAGAGAGAGGCGGTCC (SEQ ID NO: 13) 951368 dCATTGGGGCTAGGCAGACGGTACGC (SEQ ID NO: 14) 951369 dGAAGACAGCAYCYYGAGAGCAGCTC (SEQ ID NO: 15) 951455 dCAAGCGTAAGCAGCCAAACTGATCT (SEQ ID NO: 16) 951456 dGAGATGTACATACGTCAGACCTGGC (SEQ ID NO: 17) Figure 10 shows the nucleotide sequence of the gene encoding for haloperoxidase from Curvularia verruculosa CBS 147.63. The sequence analysis of the cloned insert named pxl shows a large open reading frame of 1800 nr (which excludes the stop codon) coding for a 600 amino acid protein. They are NOT present in the introns gene. The G + C content of this open reading frame is 57%. The deduced amino acid sequence of the curvularia verruculose CBS 147.63 haloperoxidase as shown in Figure 10 indicates that the calculated molecular weight of the main translation product is 66., 593, which agrees with the estimate of 68 kDa based on the mobility of the purified protein in SDS-PAGE and the amino acid sequences of the peptides derived from the purified haloperoxidase described above. The deduced sequence of amino acids predicts the presence of only two Cys residues in the haloperoxidase of Curvularia verruculosa which are probably present as free thiols in the active enzyme, which is consistent with the haloperoxidase of Curvularia inaequalis (Simons et al., 1995 European Journal of Biochemistry 229: 566-574). There are three potential sites for N glycosylation. The analysis of the monosaccharide composition of the haloperoxidase of Curvularia verruculosa, as described in Example 8, indicates that the haloperoxidase is glycosylated with 1 pmol of galactose, 16 pmol of glucose and 29 pmol of mannose per pmol of haloperoxidase. However, since the observed molecular weight of the haloperoxidase of Curvularia verruculssa (68 kDa) is very close to the calculated size (P.M. = 66.573), the degree of glycosylation is probably very small. In addition, the absence of glucose ina in this analysis suggests that the carbohydrate moieties are attached to 0. This contrasts with the haloperoxidase of Curvularia inaequalis which has been reported to be non-glycosylated (Simons et al., 1995, European Journal of Chemistry 229: 566-574).

The deduced amino acid sequence of the haloperoxidase of Curvularia verruculosa is 90.9% identical to that of the haloperoxidase of Curvularia inaequalis, as shown in figure 11. Interestingly, the haloperoxidase of Curvularia inaequalis is nine residues larger than the haloperoxidase of Curvularia verruculose and is present as two groups, one near the N-terminal part and the other in the C-terminal part of the haloperoxidase of Curvularia inaequalis.

Example 16: Production of Haloperoxidase from Curvularia verruculosa CBS 444.70 A seed or seed culture of Curvularia verruculosa CBS 444.70 is produced in a 500 ml shake flask containing 100 ml of medium with the following composition: Corn infusion liquor (dry) 1.2 g Glucose 2.4 g CaC03 0.5 g Soybean oil 0.5 ml The pH is adjusted to 5.5 before autoclaving.

After 3 days of growth at 26 ° C and 250 rpm, a 10 liter laboratory fermenter is inoculated with the seed culture described above. The composition of the medium in the fermenter is: Yeast extract (Difco 0127) 8 g / 1 K2HP04 (Merck 5101) 2 g / 1 MgSO4.7H20 (Merck 5886) 1 g / 1 Dextrose (Roquelle 101-0441) 30 g / 1 Na3V04 1 mg / l The pH is not adjusted, but it is measured and it is 6.2. The fermentation takes place at 26 ° C, 550 rpm, for 7 days.

Ejepplo 17: Purification of the Haloperoxidase of Curvularia verruculosa CBS 444.70 The culture broth prepared as described in Example 16 is centrifuged, filtered (GF / F Whatman), and is further concentrated approximately 80 times in a Filtron apparatus (membrane limit: 10000 Da), and is further concentrated in a Amicon cell (PM 10). The concentrated broth is loaded onto a Q-Sepharose FF column (100 ml, XK26, Pharmacia) previously equilibrated in 10 mM potassium phosphate, pH 7 (buffer A) at a rate of 5 ml / min. The column is washed with 200 mol of 10 mM potassium phosphate, pH 7 and then eluted with a gradient of 0-> 0 NaCl. 1 M of the same shock absorber for 200 minutes. 10 ml fractions are collected and accumulated according to the presence of haloperoxidase activity, as described in Example 2. Fractions 36-45 are accumulated and concentrated in an Amicon (PM 10) and Cennicon-10 cell. 1.5 ml samples of the concentrate are loaded onto a HiLoad Superdex 75 column (Pharmacia) equilibrated with 50 mM sodium phosphate, pH 7.1, the haloperoxidase is eluted at a flow rate of 1 ml / min. 1.5 ml fractions are collected and tested for haloperoxidase activity, as described in Example 2. Fractions containing haloperoxidase activity are accumulated.

Example 18: Curbularia verruculose anti-bacterial antibacterial activity CBS 444.70 The antibacterial activity of Curbularia verruculose CBS 444.70, prepared as described in Example 17, is tested against the following four different non-pathogenic bacteria: Gram-negative bacteria Pseudamapas-fluorescens (ATCC 13525) Vibrio alginolyticus (ATCC 17749) Gram-positive bacteria Listeria innocua (ATCC 33090) Micrococcus luteus (ATCC 10240).

The test organisms are grown in TY medium (adjusted to pH 7.3 with potassium hydroxide) comprising the following components: Tripticase 20 g / liter Yeast extract 5 g / liter FeCl2.4H20 6 mg / liter MnCl2.7H20 1 mg / l liter MgS047H20 15 mg / liter Antibacterial activity Test organisms are incubated (107-108 CFU / ml, where CFU = colony forming units) in TY medium, at 30 ° C with one of the following solutions (haloperoxidase solutions that are filtered on a 0.2 μ membrane): (1) benzalkonium chloride, 10 ppm; (2) glucose oxidase obtained from Aspergillus niger having an activity of 0.2 GODU / ml (Sigma) + 10 mM glucose; (3) a glucose oxidase that is obtained from Aspergillus niger that has an activity of 0.2 GODU / ml (Sigma) + 10 mM glucose + 1 mM SCN; (4) a glucose oxidase obtained from Aspergillus niger «having an activity of 0.2 GODU / ml (Sigma) + 10 mM glucose + 0.1 HU / ml of C. verruculosa haloperoxidase; and (5) a glucose oxidase obtained from Aspergillus niger having an activity of 0.2 GODU / ml (Sigma) + 10 mM glucose + 1 mM SCN + 0.1 HU / ml C. verruculose haloperoxidase. The activity of glucose oxidase was determined by oxidation of D-glucose by oxygen to glucurdanic acid and hydrogen peroxide. The hydrogen peroxide produced in this way is reduced by peroxidase and 2,2'-azinobis (3-ethylbenzothiazolin-6-sulfonate) to water. The greenish-blue color produced is measured at 418 nm. The analytical conditions are: 0.1 M sodium acetate, 90 mM β-D-glucose, pH 5.6, 30"C and 20 minutes of reaction One glucose oxidase unit (GODU) is defined as the amount of glucose oxidase that catalyses the conversion of 1 μmol of hydrogen peroxide per minute, under these conditions The inhibition of growth of Listeria and Micrococcus is followed at 30 ° C and the turbidity is measured at 490 nm.

The results presented in Table 3 show that the growth of Listeria is inhibited or Micrococcus after treatment with solution 5, although the growth of Microccus is sensitive to solution 2.

Table 3: Growth of gram-positive bacteria, expressed in% in relation to the control; The increase in turbidity at 490 nm after 24 hours of incubation is measured.

They incubate a smaller amount of cells from the test organisms (105-106 CFU / ml) with the above solutions in 50 mM sodium phosphate buffer, pH 7 for 1 hour and place on TY agar. When solution 5 is used, gram-negative bacteria. { Pseu amapas and Vijbrio) are severely affected, whereas gram-positive bacteria survive under the given conditions, as shown in Table 4. The survival of gram-positive bacteria may be due to the limited incubation time (1 hour).

Table 4: Antibacterial activity of purified haloperoxidase, as% survival, based on the UFC count: Example 19: Construction of an Aspa-rgillus oryzae (hpxl) expression plasmid for Curvularia verruculosa halspßroxidase CBS 147.63 The coding region of the curvularia verruculose haloperoxidase gene CBS 147.63 (px) is amplified and the resulting fragment is cloned into pBANed for expression in Aspergillus oryzae. pBANeß provides the TAKA / NA2-tpi promoter, the 3 'AMG terminator and the selectable anuas marker gene (Figure 12). Specifically, the fragment is amplified by PCR using a sense primer (aHaPl) designed for the ATG primer in frame extending 20 bp downstream, and an antisense primer (aHaPlA) designed for a 14 bp region downstream of the stop codon transcript and extending 19 bp downstream. To facilitate the cloning of the amplified fragment the sense and antisense primers contain a Swal and Pací restriction site, respectively. The oligonucleotide primers shown below are synthesized by displaying an ABI mode 394 DNA / RNA synthesizer (Applied Biosystems, Inc., Foster City, CA). Swal aHaP: 5 »GCATATTTAAATGATGGGGTCCGTTACACCAAT (SEQ ID NO: 18) PacA aHaPlA 5 'ATATTAATTAATCACTGGTAAACTCTGCCG (SEQ ID NO: 19) The 50 μl solution of PCR (10 mM Tris-HCl, pH 8.3, KCl 50 mM, 1.5 mM MgCl2, 0.01% w / v gelatin) contains approximately 200 ng of hpxl DNA, 200 μM of each dATP, dCTP, dGTP and dTTP, and 50 pmol of each PCR primer described above. Five units of PWO polymerase (Boehringer Mannheim, Indianapolis, IN) are added and the region is incubated at 95 ° C for 3 minutes and cooled to 80 ° C. The reaction is then cycled 30 times each cycle at 95 ° C for 30 seconds, 57 ° C for 1 minute and 72 ° C for 1 minute, in a Perkin-Elmer 9600 thermal cycler. After the last cycle, the reaction is incubated for 5 minutes at 72 ß C. A 1.8 kb predicted fragment was isolated by digestion with Swal and Pací and cloned in pBANed digested with the same restriction endonucleases to generate pAJ014-1 (Figure 13) .For the purpose of verifying the fidelity of the fragment of Cloned PCR, the fragment sequence is determined according to the method of Hattori and Sakaki (1986, Analytical Biochemistry 152: 232-237) using an Applied Biosystems Model 373A automated sequencer (Applied Biosystems, Inc., Foster City, CA) The determination of the cloned hapxl amplified insert sequence of pAJ014-l confirms that there are no differences in the sequence described in SEQ ID NO: 1.

Ejepplo 20: Transformation of Aspergillus oryzae strain JaL142 with Aspergillus oryzae strain JaL142 is transformed with pAJ014-l, according to the following procedure. The transformation is carried out with protoplasts at a concentration of 2 x 10 7 protoplasts per ml. 100 μl of protoplasts are incubated at 34 βC with 10 μg of DNA and 200 μl of a 60% PEG 4000 solution - 10 mM HEPES - 10 mM CaCl 2 for 30 minutes. 3 ml of SPTC (40% PEG 4000) are added, sorbitol 0.8 M, Tris 0.05 M, pH 8.0, CaCl2 0.05) and the protoplasts are placed on plates directly on COVE transformation plates (342.3 g of sucrose, 25 g of Noble agar, 10 ml of 1 M acetamide, 20 ml of solution of COVE salts and 10 ml of 3 M CsCl per liter) for amdS transformations. The copper salt solution (50X) consists of 26 g of KCl, 26 g of MgSO4-7H20, 76 g of KH2P04, and 50 ml of trace metal solution COVE. The trace metal solution COVE is made up of 0.04 g of NaB407-10 H20 0.04 g of CuS04-5H20, 0.70 g of FeS04H20, 0.80 of Na2Mo02-2H20 and 10 g of ZnS04 per liter. The plates are incubated at 5-7 days at 34 ° C. Transformants are transferred to plates of the same medium and incubated 3-5 days at 34 ° C. Subsequently, the transformants are purified by seeding in line of spores and by taking colonies isolated using the same plates under the same conditions.

Ejespío 21: Expression of halosperoxidase of Curvularia verruculosa CBS 147.63 in Aspergillus oryzae 24 transformants of Example 20 are inoculated, each in 1 ml of MY50N medium with 1/4 strength supplemented with 1 mM V205 in a 24-well plate. The medium MY50N is constituted by liter of 62.5 of nutrient, 2 g of MgSO4-7H20, 2 g of KH2P04, 4 g of citric acid, 8 g of yeast extract, 2 g of urea, 0.2 g of CaCl2 and 0.5 ml of metals in traces. The trace metal solution consists of 22 g of ZnS04-7H20, 11 g of H3B03, 5 g of FeS04-7H20, 1.6 g of CoCl2-5H20, 1.6 g of (NH4) sMo7024, and 50 g of Na4EDTA per liter . The cultures are grown for 5 days at 34 ° C with shaking at 150 rpm and then assays are performed to determine the haloperoxidase activity looking for the procedure described in Example 2, except that the assay buffer also contains 1.25 mM V205 for activation of the enzyme. The assays are initiated by the addition of 10 μl of 0.3% H202 and the absorption at 600 nm is verified as a function of time during incubation at 30 βC. The activity is expressed as the change in absorbance at 600 nm per minute, per ml (mOD600 / minute-ml). All of the transforming antibodies exhibit detectable haloperoxidase activity, ranging from 250 to 8, 390mOD600 / minute-ml. The SDS-PAGE analysis of the 24-well plate samples easily demonstrates the presence of a 66 kDa band corresponding to the haloperoxidase whose abundance correlates well with the test results. The eight best transformants are purified by spores and inoculated in shake flasks with 125 ml baffles, containing 25 ml of MY50N medium supplemented with 1 mM V205, and grown for 5 days at 34 ° C with shaking at 250 rpm. . These cultures are tested after 5 days of growth and the best isolate, HaP14, is tested in a fermentor. HaP14 is fermented in a tank medium consisting of 30 g of Nutriosa, 10 g of yeast extract, 2 g of MgSO4-7H20, 2 g of K2S04, 2 g of citric acid, 3 g of CaCl2 and 0.5 ml of solution of trace metals (described above) per liter and fed during the course of fermentation with a medium consisting of 400 g of nutrient, 20 g of urea and 1 g of citric acid per liter. The fermentation is allowed to take place for 7 days at 34 ° C, pH 7.2, at which time approximately 1.2 liters of calcium are collected. The tests carried out in both samples during the days of fermentation suggest that the production of haloperoxidase reaches a maximum on day 4 and declines later, although production seems to recover slightly on day 7 (Figure 14).

DEPOSIT OF MICROORGANISMS The following strain has been deposited according to the Budapest Treaty at the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Laboratory, 1815 University Street, Peoria, Illinois 61604, United States.

Q_V_ NÚ rQ de aCCeSQ Date * diapósit-r-E. coli DH10B (pHAP4A.l) NRRL B-21519 January 18, 1996 The strain has been deposited under the conditions that ensure access to the crop will be available during the trend of this patent application to a person determined by the commissioner of the Patent and Trademark Office appointed by him under 37 C.F.R. §1.14 and 35 U.S.C. §122. The deposit represents a substantially pure culture of each deposited strain. The deposit is available upon request for laws for foreign patents in countries in which their counterparts of the present application, or their dependencies, are presented. However, it should be understood that the availability of the deposit does not constitute a license to carry out the present invention in derogation of the patent rights granted by the governmental action. The invention described and claimed herein is not limited in scope by the specific embodiments and described herein, since these modalities are considered as illustrations of various aspects of the invention. It is considered that any equivalent embodiment is within the scope of this invention. In fact, various modifications of the invention, in addition to those shown and described herein, will become apparent to a person familiar with the art from the foregoing description. It is considered that such modifications are within the scope of the appended claims. Various references are mentioned herein, the description of which is incorporated as a reference in its entirety.

LIST OF SEQUENCES (1. GENERAL INFORMATION (i) APPLICANT: (A) NAME: Novo Nordisk A / S (B) STREET: NOVO Alié (C) CITY: Bagsvaerd (D) STATE: (E) COUNTRY: Denmark (F) C.P. : DK-2880 (G) TELEPHONE: 45-4444-8888 (H) TELEFAX: 45-4449-0555 (i) APPLICANT: (A) NAME: Novo Nordisk Biotech, Inc. (B) STREET: 1445 Drew Avenue (C) ) CITY: Davis (D) STATE: California (E) COUNTRY: United States (F) ZIP : 95616-4880 (G) TELEPHONE: (916) 757-8100 (H) TELEFAX: (916) 758-0317 (; i) TITLE OF THE INVENTION Haloperoxidases of Curvularia varruculosa and (i: i) NUMBER OF SEQUENCES: 10 (; v) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: Novo Nordisk of North America, Inc. (B) STREET: 405 Lexington Avenue, Suite 6400 (C) CITY: New York (D) STATE: New York (E) COUNTRY : United States (F) CP : 10174 v) LEGIBLE FORM IN COMPUTER: (A) TYPE OF MEDIUM: Flexible Disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAMMING ELEMENT: PatentIn Relay # 1.0, Version # 1.30 (vi) CURRENT APPLICATION DATE: (A) APPLICATION NUMBER: 10 (B) DEPOSIT DATE: 9-JUL-1996 (C) CLASSIFICATION: (v. i) DATE OF APPLICATION (A) APPLICATION NUMBER: 60 / 001,194 15 (B) DEPOSIT DATE: JULY 14, 1995 (v. i) DATE OF APPLICATION (A) APPLICATION NUMBER: 08 / 603,534 20 (B) DEPOSIT DATE: FEB 21, 1996 (vi) i) INFORMATION FROM THE LAWYER / AGENT: (A) NAME: Lambiris, Elias J. (B) REGISTRY NUMBER: 33,728 25 (OR REFERENCE / NUMBER OF FILE: 4441.204- OR (.x) INFORMATION BY TELECOMMUNICATION: (A) TELEPHONE: (212) 867-0123 (B) TELEFAX: (212) 878-9655 (2) INFORMATION FOR SEC. FROM IDENT. DO NOT.: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 2822 Pairs of bases (B) TYPE: Nucleic acid (C) TYPE OF HEBRA: Simple (D) TOPOLOGY: Linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 477..2276 (xi) DESCRIPTION OF j (SEQUENCE: SEQ ID NO.

GAGA GTACA TACGTCAGAC CTGGCCATCC AACATTTATC CCAGTCGGAC ACCGGCTCCT 6 TTCG CACCA GTTGGTCACC GAGTTTTAAT ATCACATGTG GTTCACGCCA AGCGTAAGCA 12 GCCA ACTGA TCTCCCTAGA TCCGTCTTGG TTACCGCCTC AGGACAATTT CCATTTGACG 18 GCAG GGTCT GCCACACCGC TGCAATGCGG CTGTGGCTTC ACGTCTGCCT TGCGCCCTTG 24 CATG GAATA GCAGTTCCCC GTAACTTTGT GGCTTGACTA TGGTTCACCT GATAGCGACG 30 AGTG ACCAT TCTAAGAGTC TTCAAGGGTC TTTTGAACGG AACAGAGTGG ATGTGTGTGT 360 GTGT CTGAT ATCCTTGAAG AATTGACTAT AAAGTCTGTG AGCTCTCGCA TTCTTTGTTG 420 CAAT TCACA ATTCATCTAC TCATTCTGTG CACCACATAT CATCATCACA CCTACT 476 ATG GG TCC GTT ACA CCA ATT CCG TTG CCT ACG ATC GAT GAA CCC GAA 524 Met Gly Ser Val Thr Pro lie Pro Leu Pro Thr lie Asp Glu Pro Glu 1 5 10 15 GAG AT AAC AAC AAC TAC ATA TCT TTC TGG AAT AAT GTC GGG CTG GAA 572 Glu Tyr Asn Asn Asn Tyr lie Leu Phe Trp Asn Asn Val Gly Leu Glu 20 25 30 CTG AC CGC CTA ACT CAC ACT GTG GGA GGC CCC TTG ACG GGA CCG CGT 620 Leu Asn Arg Leu Thr His Thr Val Gly Gly Pro Leu Thr Gly Pro Pro 35 40 45 CTC CT GCC AGA GCT CTG GGC ATG CTG CAC TTG GCT ATC CAC GAT GCC 668 Leu er Ala Arg Ala Leu Gly Met Leu His Leu Ala lie His Asp Ala 50 55 60 TAC TT TCT ATC TGT CCT CCT ACT GAG TTT ACC ACC TTT CTC TCC CCT 716 Tyr Phe Ser lie Cys Pro Pro Thr Glu Phe Thr Thr Phe Leu Ser Pro 65 70 75 80 GAT CT GAG AAT CCC CGG TAC CGT CTG CCT AGC CCC AAT GGG GCA GAC 764 Asp the Glu Asn Pro Wing Tyr Arg Leu Pro Ser Pro Asn Gly Wing Asp 85 90 95 GAT CC CGC CAA GCA GTC GCT GGA GCT GCT CTC AAG ATG CTG TCT TCG 812 Asp the Arg Gln Ala Val Ala Gly Ala Ala Leu Lys Met Leu Ser Ser 100 105 110 CTA AC ATG AAG CCT GCC GAC CCC AAT ACC GGC ACC AAC ATC TCC GAC 860 Leu yr Met Lys Pro Wing Asp Pro Asn Thr Gly Thr Asn He Ser Asp 115 120 125 AAT CC TAT GCT CAG CTT GCC CTG GTT CTC GAA CGA GCA GTC GTA AAG 908 Asn the Tyr Ala Gln Leu Ala Leu Val Leu Glu Arg Ala Val Val Lys 130 135 140 GTA CG GGT GGT GTT GAT CGA GAG TCA GTC AGC TTC ATG TTT GGT GAG 956 Val Pro Gly Gly Val Asp Arg Glu Ser Val Ser Phe Met Phe Gly Glu 145 150 155 160 GCT TC GCC GTC GTC TTC TTT GCA TCT CTC AAC GAT CCT CGA GGT GCT 100 Wing Val Wing Asp Val Phe Phe Wing Leu Leu Asn Asp Pro Arg Gly Wing 165 170 175TCA CAG GAG GGC TAC CAG CCT ACC CCC GGT CGT TAT AAA TTC GAC GAT 105 Ser Gln Glu Gly Tyr Gln Pro Thr Pro Gly Arg Tyr Lys Phe Asp Asp 180 185 190 GAG CGT ACT CAC CCA GTC GTC CTA GTC CCC GTA GAC CCC AAC AAC CCC 1100 Glu Pro Thr His Pro Val Val Leu Val Pro Val Asp Pro Asn Asn Pro 195 200 205 AAC GGC CCC AAG ATG CCT TTC CGC CAG TAT CAT GCC CCA TTC TAC GGC 1148 Asn Gly Pro Lys Met Pro Phe Arg Gin Tyr His Wing Pro Phe Tyr Gly 210 215 220 ATG ACA ACG AAG CGT TTT GCC ACG CAG TCC GAG CAC ATC CTT GCA GAC 1196 Met Thr Thr Lys Arg Phe Wing Thr Gln Ser Glu His He Leu Wing Asp 225 230 235 240 CCA CCG GGT CTC CGT TCT AAT GCG GAT GAG ACT GCT TAG GAC GAC GAC 1244 Pro Pro Gly Leu Arg Ser Asn Wing Asp Glu Thr Wing Glu Tyr Asp Asp 245 250 255 TCT ATC CGC GTG GCC ATC GCC ATG GGA GGT GCC CAG GAT TCT AAC TCC 1292 Ser He Arg Val Wing He Wing Met Gly Gly Wing Gln Asp Leu Asn Ser 260 265 270 ACC AAG CGT AGC CCA TGG CAG ACG GCA CAG GGT CTG TAC TGG GCC TAT 1340 Thr Lys Arg Ser Pro Trp Gln Thr Wing Gln Gly Leu Tyr Trp Wing Tyr 275 280 285 GAT GGG TCA AAC CTT GTT GGA ACC CCA CCG CGA TTC TAC AAT CAG ATT 1388 Asp Gly Ser Asn Leu Val Gly Thr Pro Pro Arg Phe Tyr Asn Gln He 290 295 300 GTG CGT CGC ATC GCA GTG ACT TAC AAG AAG GAA GAT GAC CTT GCC AAC 1436 Val Arg Arg He Wing Val Thr Tyr Lys Lys Glu Asp Asp Leu Wing Asn 305 310 315 320 AGC GAA GTC AAC AAT GCT GAT TTT GCC CGC CTC TTC GCC CTC GTC AAC 1484 Ser Glu Val Asn Asn Wing Asp Phe Wing Arg Leu Phe Wing Leu Val Asn 325 330 335 GTC GCC TGC ACA GAC GCC GGC ATC TTT TCC TGG AAG GAA AAA TGG GAG 1532 Val Wing Cys Thr Asp Wing Gly He Phe Ser Trp Lys Glu Lys Trp Glu 340 345 350 TTT GAA TTC TGG CGC CCT TTG TCT GGT GTG AGA GAC GAT GGC CGT CCA 1580 Phe Glu Phe Trp Arg Pro Leu Ser Gly Val Arg Asp Asp Gly Arg Pro 355 360 365 GAC CAC GGA GAT CCT TTC TGG CTT ACC CTC GGT GCC CCA GCT ACA AAC 1628 Asp His Gly Asp Pro Phe Trp Leu Thr Leu Gly Ala Pro Wing Thr Asn 370 375 380 ACA AGC GAC ATA CCC TTC AAG CCT CCT TTC CCC GCC TAC CCA TCT GGC 1676 Thr Asn Asp He Pro Phe Lys Pro Pro Phe Pro Wing Tyr Pro Ser Gly 385 390 395 400 CAC GCC ACC TTT GGC GGT GCT GTA TTC CAG ATG GTC GCG GCG TAC TAC 1724 His Wing Thr Phe Gly Gly Wing Val Phe Gln Met Val Arg Arg Tyr Tyr 405 410 415 AAC GGG CGC GTA GGC ACC TGG AAG GAC GAC GAA CCA GAC AAC ATT GCC 1772 Asn Gly Arg Val Gly Thr Trp Lys Asp Asp Glu Pro Asp Asn He Wing 420 425 430 ATT GAC ATG ATG ATA TCC GAG GAG CTC AAC GGC GTG AAC CGC GAC CTG 1820 He Asp Met Met He Ser Glu Glu Leu Asn Gly Val Asn Arg Asp Leu 435 440 445 CGC CAG CCC TAC GAC CCG ACT GCC CCC ATC GAA GAC CAA CCA GGT ATC 1868 Arg Gln Pro Tyr Asp Pro Thr Wing Pro He Glu Asp Gln Pro Gly He 450 455 460 GTC CGC ACC CGC ATC GTG CGC CAC TTT GAC TCA GCC TGG GAA ATG ATG 1916 Val Arg Thr Arg He Val Arg His Phe Asp Ser Wing Trp Glu Met Met 465 470 475 480 TTC GAA AAC GCC ATT TCT GCG ATC TTC CTC GGC GTC CAC TGG CGC TTC 1964 Phe Glu Asn Wing He Ser Arg He Phe Leu Gly Val His Trp Arg Phe 485 490 495 GAT GCC GCC GCC GCT CGC GAC ATT CTG ATC CCC ACC AAC ACA AAG GAT 2012 Asp Wing Wing Wing Wing Arg Asp He Leu He Pro Thr Asn Thr Lys Asp 500 505 510 GTG TAT GCC GTC GAC AGC AAC GGC GCG ACA GTG TTC CAG AAT GTA GAG 2060 Val Tyr Wing Val Asp Ser Asn Gly Wing Thr Val Phe Gln Asn Val Glu 515 520 525 GAT GTC AGG TAC TCG ACC AAG GGC ACG CGT GAG GGC CGC GAG GGC CTC 2108 Asp Val Arg Tyr Ser Thr Lys Gly Thr Arg slu Gly Arg Glu Gly Leu 530 535 540 TTC CCT ATC GGT GGT GTG CCG CTG GGT ATC GAG ATT GCC GAT GAG ATT 2156 Phe Pro He Gly Gly Val Pro Leu Gly He Glu He Wing Asp Glu He 545 550 555 560 TTT AAT AAT GGA CTT AGG CCC ACG CCG CCG GAG CTT CAG CCT ATG CCG 2204 Phe Asn Asn Gly Leu Arg Pro Thr Pro Pro Glu Leu Gln Pro Met Pro 565 570 575 CAG GAT ACC CCG GTG CAG AAG CCG GTT CAG GGC ATG TGG GAC GAG CAG 2252 Gln Asp Thr Pro Val Gln Lys Pro Val Gln Gly Met Trp Asp Glu Gln 580 585 590 GTG CCG TTG GTT AAG GAG GCG CCG TAGATGGAGA GGTTTTTCGGC AGAGTTTACC 23 Val Pro Leu Val Lys Glu Ala Pro 595 600 AGTGACGCTG ATGGGCGGTG GAAGGATGTC TGATTTGGCT GAATGTCTTA ATTTGTCAAA 23 ATTTGGGGTT TGGTTTAGGA TGCTTGCTTG ATACTCTGCG ATTAATACTC CTATTTTGAT 24 ATTACATAAA TAGAATGCTT TCGGTAGCTG GAATCTGCTG GTTCACTTAT CTTTGTGTCC 24 GCGT GCAT GCTATGAGTG GTTTGCATGT GAGGCTCGAA TTGATATCTG ACCAATTATT 25 GTTCAGTAAG GCTTGCTTAA ACCTTTTTGG TTTCGCAGGA GGGATGGAAA CTGATATATT 26 TGAC CAGTA GCTAGACACA TAGCAAATGA AATTAAAAAA AAAAAAACTC TATCCTTAAA 26 GAAAAATTAA ACAAACAAAA ATCAGGACAT ATACCATGCG TCTTTCCAGC TCCAAAACAC 27 CTACCACGTT TTATCTTCTG AAACTTTCAC AATGACAGCA CCCACACCCG GCCCCTTCGC 2786 CCACATGCAA GCGCCTCCGG GACCTCCTCA AGCGTC 2822 (2) INFORMATION FOR SEC. FROM IDENT. NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 600 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein . { iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: Met Gly Ser Val Thr Pro He Pro Pro Leu Pro Thr He Asp Glu Pro Glu 1 5 10 15 Glu Tyr Asn Asn Asn Tyr He Leu Phe Trp Asn Asn Val Gly Leu Glu 20 25 30 Leu Asn Arg Leu Thr His Thr Val Gly Gly Pro Leu Thr Gly Pro Pro 35 40 45 Leu Be Wing Arg Wing Leu Gly Met Leu His Leu Wing He His Asp Wing 50 55 60 Tyr Phe Ser He Cys Pro Pro Thr Glu Phe Thr Thr Phe Leu Ser Pro 65 70 75 80 Asp Wing Glu Asn Pro Wing Tyr Arg Leu Pro Ser Pro Asn Gly Wing Asp 85 90 95 Asp Ala Arg Gln Ala Val Ala Gly Ala Ala Leu Lys Met Leu Ser Ser 100 105 110 Leu Tyr Met Lys Pro Wing Asp Pro Asn Thr Gly Thr Asn He Ser Asp 115 120 125 Asn Ala Tyr Ala Gln Leu Ala Leu Val Leu Glu Arg Ala Val Val Lys 130 135 140 Val Pro Gly Gly Val Asp Arg Glu Ser Val Ser Phe Met Phe Gly Glu 145 150 155 160 Wing Val Wing Asp Val Phe Phe Wing Leu Leu Asn Asp Pro Arg Gly Wing 165 170 175 Ser Gln Glu Gly Tyr Gln Pro Thr Pro Gly Arg Tyr Lys Phe Asp Asp 180 185 190 Glu Pro Thr His Pro Val Val Leu Val Val Pro Asp As Asn Asn Pro 195 200 205 Asn Gly Pro Lys Met Pro Phe Arg Gln Tyr His Wing Pro Phe Tyr Gly 210 215 220 Met Tyr Thr Lys Arg Phe Wing Thr Gln Ser Glu His He Leu Wing Asp 225 230 235 240 Pro Pro Gly Leu Arg Ser Asn Wing Asp Glu Thr Wing Glu Tyr Asp Asp 245 250 255 Be He Arg Val Wing He Wing Met Gly Gly Wing Gln Asp Leu Asn Ser 260 265 270 Thr Lys Arg Ser Pro Trp Gln Thr Wing Gln Gly Leu Tyr Trp Wing Tyr 275 280 285 Asp Gly Ser Asn Leu Val Gly Thr Pro Pro Arg Phe Tyr Asn Gln He 290 295 300 Val Arg Arg He Wing Val Thr Tyr Lys Lys Glu Asp Asp Leu Wing Asn 305 310 315 320 Ser Glu Val Asn Asn Wing Asp Phe Wing Arg Leu Phe Wing Leu Val Asn 325 330 335 Val Ala Cys Thr Asp Wing Gly He Phe Ser Trp Lys Glu Lys Trp Glu 340 345 350 Phe Glu Phe Trp Arg Pro Leu Ser Gly Val Arg Asp Asp Gly Arg Pro 355 360 365 Asp His Gly Asp Pro Phe Trp Leu Thr Leu Gly Ala Pro Wing Thr Asn 370 375 380 Thr Asn Asp He Pro Phe Lys Pro Pro Phe Pro Wing Tyr Pro Ser Gly 385 390 395 400 His Wing Thr Phe Gly Gly Wing Val Phe Gln Met Val Arg Arg Tyr Tyr 405 410 415 Asn Gly Arg Val Gly Thr Trp Lys Asp Asp Glu Pro Asp Asn He Wing 420 425 430 He Asp met Met He Ser Glu Glu Leu Asn Gly Val Asn Arg Asp Leu 435 440 445 Arg Gln Pro Tyr Asp Pro Thr Wing Pro He Glu Asp Gln Pro Gly He 450 455 460 Val Arg Thr Arg He Val Arg His Phe Asp Ser Wing Trp Glu Met Met 465 470 475 480 Phe Glu Asn Wing He Be Arg He Phe Leu Gly Val His Trp Arg Phe 485 490 495 Asp Wing Wing Wing Wing Arg Asp He Leu He Pro Thr Asn Thr Lys Asp 500 505 510 Val Tyr Ala Val Asp Ser Asn Gly Ala Thr Val Phe Gln Asn Val Glu 515 520 525 Asp Val Arg Tyr Ser Thr Lys Gly Thr Arg Glu Gly Arg Glu Gly Leu 530 535 540 Phe Pro He Gly Gly Val Pro Leu Gly He Glu He Wing Asp Glu He 545 550 555 560 Phe Asn Asn Gly Leu Arg Pro Thr Pro Pro Glu Leu Gln Pro Met Pro 565 570 575 Gln Asp Thr Pro Val Gln Lys Pro Val Gln Gly Met Trp Asp Glu Gln 580 585 590 Val Pro Leu Val Lys Glu Ala Pro 595 600 (2) INFORMATION FOR SEC. FROM IDENT. NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 43 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (Üi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3: Xaa Phe Ala Thr Gln Ser Glu His He Leu Ala Asp Pro Pro Gly Leu 1 5 10 15 Arg Ser Asn Wing Asp Glu Thr Wing Glu Tyr Asp Asp Ser He Arg Val 25 30 Wing He Wing Met Gly Gly Wing Gln Asp Leu Asn 35 40 (2) INFORMATION FOR SEC. FROM IDENT. NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4 Phe Arg Gln Tyr His Wing Pro Phe Tyr Gly Met Thr Thr Lys 1 5 10 (2) INFORMATION FOR SEC. FROM IDENT. NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. N0: 5: Asp Val Tyr Ala Val Asp Ser Asn Gly Ala Thr Val Phe Gln Asn Val 1 5 10 15 Glu Asp Val Arg Tyr Ser Thr Lys 20 (2) INFORMATION FOR SEC. FROM IDENT. NO 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (Üi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO 6: Arg Ser Pro Trp Gln Thr Wing Gln Gly Leu Tyr Trp Wing Tyr Asp Gly 1 5 10 15 Be Asn Leu Val Gly Thr Pro Pro Arg Phe Tyr Asn Gln He Val Arg 20 25 30 Arg He Ala Val Thr Tyr Lys Lys 35 40 (2) INFORMATION FOR SEC. FROM IDENT. NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7! Phe Asp Asp Glu Pro Thr His Pro Val Val Val Leu Val Pro Asp Pro 1 5 10 15 Asn Asn Asn Asn Gly Gly Lys 20 (2) INFORMATION FOR SEC. FROM IDENT. NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 8: Pro Wing Asp Pro Asn Thr Gly Thr Asn He Ser Asp Asn Wing Tyr Wing 1 5 10 15 Gln Leu Ala Leu Val Leu Glu Arg Ala Val Val Lys 20 25 (2) INFORMATION FOR SEC. FROM IDENT. NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9: Met Leu Ser Ser Leu Tyr Met Lys 1 5 (2) INFORMATION FOR SEC. FROM IDENT. NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 amino acids. (B) TYPE: amino acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear '(ii) TYPE OF MOLECULE: DNA (genomic) (iii) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO-.10: Met Pro Phe Arg Gln Tyr His Wing Pro Phe Tyr Gly Met Thr Thr Lys 1 5 10 15 It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is the one that results clear of the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (36)

1. An isolated haloperoxidase obtained from a strain of Curvularia verruculosa.

2 . The haloperoxidase according to claim 1, characterized in that it is obtained from Curvularia verruculosa CBS 147.63 or a mutant strain thereof.

3. The haloperoxidase according to claim 1, characterized in that it is obtained from Curvularia verruculosa CBS 444.70 or a mutant strain thereof.

4. The haloperoxidase according to claim 1, characterized in that it retains at least 50% activity after one hour of incubation at pH 7.0 and 60 ° C in the presence of 0.1% H202.

5. The haloperoxidase according to claim 1, characterized in that it retains at least 75% activity after one hour of incubation at pH 7.0 and 60 ° C in the presence of 0.1% H202.

6. The haloperoxidase according to claim 1, characterized in that it requires at least 50% activity at 30 ° C over a pH range between about 4 and about 11.

7. The haloperoxidase according to claim 1, characterized in that it requires at least 80% activity at 30 ° C over a pH range between about 4 and about 11.

8. The haloperoxidase according to claim 1, characterized in that it has an optimum temperature in the range of 50-70 ° C.

9. The haloperoxidase according to claim 1, characterized in that it has an optimum temperature in the range of 55-65"C.

10. The haloperoxidase according to claim 9, characterized in that it has an optimum temperature of about 60 ° C at pH 5.5.

11. The haloperoxidase according to claim 1, characterized in that it has an optimum pH in the range from about 5.25 to about 6.25.

12. The haloperoxidase according to claim 11, characterized in that it has an optimum pH of about 5.75 at 30 ° C.

13. The haloperoxidase according to claim 1, characterized in that it prefers Br "on Cl * as a substrate.

14. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 3.

15. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 4.

16. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 5.

17. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 6

18. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 7

19. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 8

20. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence established in SEQ. FROM IDENT. DO NOT. : 9

21. The haloperoxidase according to claim 1, characterized in that it contains the partial peptide sequence that is established in SEQ. FROM IDENT. DO NOT. : 10

22. An isolated haloperoxidase, characterized in that it has an amino acid sequence which is at least 93% homologous with the amino acid sequence established in the SEC. FROM IDENT. NO .: 2.

23. The haloperoxidase according to claim 22, characterized in that it has an amino acid sequence that is established in SEQ. FROM IDENT. DO NOT. : 2.

24. An isolated haloperoxidase, characterized in that it is encoded by the coding region of the nucleic acid sequence contained in the E. coli plasmid pHAP4A.l DH10B, NRRL B-21519.

25. An isolated nucleic acid fragment, characterized in that it comprises a nucleic acid sequence which codes for a haloperoxidase according to claim 1.

26. A nucleic acid fragment according to claim 25, characterized in that the nucleic acid sequence codes for a haloperoxidase obtained from Curvularia verruculosa CBS 147.63.

27. A nucleic acid fragment according to claim 25, characterized in that the nucleic acid sequence codes for a haloperoxidase obtained from Curvularia verruculosa CBS 444.70.

28. A fragment of nucleic acid according to claim 25, characterized in that the nucleic acid sequence is established in SEQ. FROM IDENT. NO .: 1.

29. A nucleic acid construct, characterized in that it comprises a nucleic acid fragment according to claim 25, operably linked to regulatory regions capable of directing the expression of the haloperoxidase in a suitable expression host.

30. A recombinant vector, characterized in that it comprises a nucleic acid construct according to claim 29.

31. A recombinant host cell, characterized in that it comprises the nucleic acid construct according to claim 29.

32. A method for producing the haloperoxidase according to claim 1, characterized in that it comprises: (a) fermenting a Verruculose Curvularia strain to produce a supernatant having peroperoxidase; and (b) recovering the haloperoxidase.

33. A method for producing the haloperoxidase according to claim 1, characterized in that it comprises: (a) fermenting a host cell comprising a nucleic acid construct comprising the nucleic acid sequence encoding the haloperoxidase under conditions that lead to the expression of the haloperoxidase; and (b) recovering the haloperoxidase.

34. A method for oxidizing a halide ion, characterized in that it comprises reacting the halide ion and a source of hydrogen peroxide in the presence of a haloperoxidase in accordance with the claim 1.

35. A method for halogenating a compound, characterized in that it comprises reacting the compound, a halide ion and a source of hydrogen peroxide in the presence of a haloperoxidase according to claim 1.

36. A method for destroying microbial cells or for inhibiting the growth of microbial cells, the method is characterized in that it comprises contacting the cells with a haloperoxidase according to claim 1, a source of hydrogen peroxide and a source of thiocyanate in a solution watery