CA2227554A1 - Nucleic sequences coding for melatonin receptors, and uses thereof - Google Patents

Abstract

Nucleic sequences coding for MEL1 A-type clawed toad ( DOLLAR iXenopus) melatonin receptors, also known as Mel1C, oligonucleotides included in such sequences, the uses thereof as a probe and for expressing proteins and/or fragments thereof having functional MEL1 A-type melatonin receptor activity, vectors useful for said expression, cellular hosts containing said vectors, and a melatonin receptor study model, are disclosed. A method for screening substances that are agonists or antagonists of the proteins having melatonin receptor activity, and kits for detecting the degree of affinity of various substances for said proteins having melatonin receptor activity, are also disclosed. Said nucleic sequences coding for functional MEL1 A-type melatonin receptors are selected from the following sequences: SEQ ID No 1, SEQ ID No 3, SEQ ID No 5 and SEQ ID No 7.

Description

NUCLEIC SEQUENCES ENCODING MELATONIN RECEPTORS AND THEIR
APPLICATIONS

The present invention relates to nucleic acid sequences encoding for xenopus melatonin receptors type MEL 1 A, also name-més mellr below, to oligonucleotides included in said sequences, to their applications as a probe and for the expression of proteins and / or fragments of these having a functional melatonin receptor activity of the type MEL1 A, to vectors useful for said expression, to cellular hosts containing said vectors as well as a model for studying melatonin receptors.
The present invention also relates to a screening method of substances, with agonist or antagonist action towards proteins having an action melatonin receptor and kits or kits for the detection of degree of affinity of different substances for said proteins with activity of receiver of the melatonin.
A melatonin receptor from Xenopus laevis has been described (EBISAWA T. et al., Proc. Natl. Acad. Sci. USA, 1994, 91, 6133-6137). II
is of a protein of 420 amino acids.
However, primers located in the 3 ′ part of the sequences corresponding nucleic acids did not amplify the coding sequence for this protein.
This is why the Applicant has set itself the goal of seeking nucleic acid sequences capable of encoding the melatonin receptor of the type MEL1 A, which sequences being easily amplifiable in their entirety.
The subject of the present invention is nucleic acid sequences encoding for functional melatonin receptors, type MEL1 A and structure different from that of the receptor described in EBISAWA et al. and presenting owner-Coupling and regulation tees different from those of the receiver previously described, which sequences are selected from the sequences SEQ ID N
1, SEQ
ID N 3, SEQ ID N 5 or SEQ ID N 7, as presented in the list of sequences included in this Request.
These sequences according to the invention have, in 3 'a sequence not longer or shorter coding (long sequences: SEQ ID N 1 and SEQ ID N 5;

2 short sequences: SEQ ID N 3 and SEQ ID N 7), which intervenes in a crucial on the regulation of RNA: '/ a life of RNA, modified compared to sequences of Prior Art.
In particular, SEQ ID N 1 and SEQ ID N 3 code for a protein with 65 fewer amino acids compared to the sequence described in the prior art, the 2 amino acids in the C-terminal position being, in addition, different.
This protein corresponds to the melatonin receptor called MEL1 Aa or Mellc (a) =

SEQ ID N 5 and SEQ ID N 7 code for a protein present also 65 less amino acids, compared to the sequence described in art anterior; in addition, 6 amino acid residues are different, compared to said sequence of the prior art. This protein corresponds to the melatonin called MEL1 Ab or Mellc (Q).

Both the sequence coding for the MEL1 Aa receptor or Mellc (a) as the sequence encoding the MEL1 Ab or Mellc (Q) receptor could lead to changes in RNA regulation, related to sequence non-coding in 3 '(regulation by an agonist ligand, RNA lifespan).

Unexpectedly, only the MEL1 Aa or Mellc () receptor inhibits adenylyl cyclase; indeed, the MELl Ab or Mellc (R) receptor is devoid of this property to inhibit adenylyl cyclase.
In addition, other biological signals are associated with these proteins.
in particular, these two allelic isoforms are capable of modulating cGMP
intra-cellular (dose-dependent modulation) and in particular to inhibit the accumulation of CGMP induced by a phosphodiesterase inhibitor.
The present invention also relates to the fragments of said sequences, useful either for functional expression of the peptide corresponding to melatonin receptor corresponding to the detection of the sequence coding for said receiver.
Among said fragments, the invention includes, among others:

3 - a sequence consisting of a segment of 230 base pairs nu-keys, corresponding to nucleotides 1057-1286 of SEQ ID N 1 or SEQ
ID
N 5;
a const sequence: ituted from a segment of 69 base pairs nu-keys, corresponding to nucleotides 1057-1125 of SEQ ID N 3 or SEQ
ID
# 7.
The present invention also relates to nucleotide probes.
ques, characterized in that they hybridize with the sequences nucleotides such as defined above.
Suitable hybridization conditions include the following:
tes: hybridization is carried out at 42 ° C. in a buffer comprising: 4X SSC, 40 % of formamide, 0.2% SDS and Denhardt 5X buffer.
Such probes have the particular advantage of allowing the character-of the different variants of the functional melatonin receptor of type MEL1 A (1V1EL1 Aa or MEL1 Ab).
The present invention also relates to proteins and / or protein fragments, characterized in that they are coded by a sequence nucleoti-dique as defined above and in that they exhibit an activity of receiver of melatonin of the functional MELI type.
According to the invention, said protein is selected from any of the sequences SEQ ID N 2 (SEQ ID N 4 being identical to the SEQ
ID N 2) or SEQ ID N 6 (SEQ ID N 8 being identical to SEQ ID N 6), such than presented in the sequence list included in this Request.
SEQ ID N 2 and N 4 correspond to the melato-nine called MEL1 Aa or Mell al; SEQ ID N 6 and N 8 correspond to melatonin receptor called MEL1 Ab or Mel1c (R).

These two proteins, whose structure is different from that of protein of the prior art, unexpectedly exhibit reactions and biological signals different from those previously described, in particular in who = 30 concerns coupling to G proteins (signaling).

WO 97/0409

4 PCT / FR96 / 01167 The present invention also relates to a recombinant vector cloning and / or expression, characterized in that it comprises a sequence nucleo-tide according to the invention.
Within the meaning of the present invention, the term “recombinant vector”
both a plasmid, a cosmid and a phage. According to one embodiment advantageous of said vector, it is killed by a recombinant vector in which a sequence is inserted nucleotide such as defined above, which vector is an expression vector of a protein having a functional melatonin receptor activity of the MEL1 A type, in accordance with the invention.
According to an advantageous arrangement of this embodiment, said vector consists of a plasmid pcDNA3 (Invitrogen), comprising a promoter RSV and SEQ ID N 1.
Such a plasmid has been designated X-MEL1a and has been deposited under the n I-1583 dated June 7, 1995 with the National Collection of Cultures of Microorganisms held by the Institut Pasteur.
According to another advantageous arrangement of this embodiment, said vector consists of a plasmid pcDNA3 (Invitrogen), comprising a promo-RSV and SEQ ID N 5.
Such a plasmid was designated X-MEL1b and was deposited under the n I-1584 dated June 7, 1995 with the National Collection of Cultures of Microorganisms held by the Institut Pasteur.
The present invention also relates to a suitable host cell.
prayed, obtained by genetic transformation, characterized in that it is transformed with an expression vector in accordance with the invention.
Such a cell is capable of expressing a protein, having an activity a melatonin functional receptor, of the MELI A type.
According to an advantageous embodiment, the host cell is notably made up of cells of the L line.
The present invention also relates to a process expression of a protein according to the invention, characterized in that the cell host, resulting from transformation with a vector containing a sequence nucleotidi-according to the invention coding for a protein having receptor activity works melatonin type MFLl A, is cultivated so as to produce and to trans-carry said expressed protein to the membrane, so that the sequences transmembrane of said receptor are exposed on the surface of the membrane of

5 the transformed cellular host.
The present invention also relates to a model for studying melatonin receptors type MEL1 A, characterized in that it is consisting of host cells in accordance with the invention, that is to say expressing a receiver works of melatonin type MEL1 A on the surface of their membrane cellular.
Such a model allows the study, from a pharmacological point of view, melatonin receptors, in particular by allowing the identification of ligands specific for P / IEL1 A type receptors (agonists and antagonists) and so putting of active drugs on the regulation of the biological clock, with of particularly interesting applications, especially in the field cardiovascu-blood (lipolysis) and in oncology (phasing of cells).
The invention also relates to a method for detecting the ability of a substance to act as a ligand towards a protein according to the invention, which method is characterized in that it comprises:
- bringing said substance into contact with a host cell previously completely transformed with an expression vector in accordance with the invention, which host cell expresses said protein (melatonin receptor), and which setting contact is made under conditions allowing the formation of a bond between one at least specific sites and said substance and - detecting the possible formation of a type complex ligand-protein.
The present invention further relates to a method for studying the affinity of a protein according to the invention for one or more ligands deter-mined, which process is characterized in that it comprises:
- transformation of an appropriate host cell with a vector form of invention;
- the culture of the transformed host cell, under per-putting the expression of the melatonin receptor type MEL 1 A, coded by the

6 nucleotide sequence, and the transfer of the expressed melatonin receptor around the membrane of said cell so that the transmembrane sequences of the receiver functional melatonin are exposed on the surface of the host cell transform mée;
- bringing said cell into contact with the determined ligands and - the detection of an affine reaction between said transformed cell and said determined ligands.
The invention further relates to a kit for the detection of the possible affinity of a ligand for a protein in accordance with the invention, which kit is characterized in that it comprises:
- a culture of host cells transformed by a vector expression according to the invention;
- possibly, if necessary, physical or chemical means to induce the expression of a protein (melatonin receptor type MELl A), encoded by a nucleotide sequence according to the invention, contained in a vec-promoter whose promoter is inducible;
- one or more control ligands having determined affinities for said protein; and - physical or chemical means for the characterization of the biological activity of the expressed protein.
Unexpectedly, melatonin-like receptors MEL1 A according to the invention are effectively functional receptors and allow the realization of all the aforementioned applications.
In addition to the foregoing arrangements, the invention also comprises other provisions, which will emerge from the description which follows, which refers to examples of implementation of the process which is the subject of the present invention, with reference to the accompanying drawings, in which:
- Figure 1 shows a diagram of the cloning technique of =
melatonin receptor cDNA from Xenopus laevis;
- Figure 2 illustrates the different cloning fragments used; the localization of the primers sense (S) (~) and antisense (AS) (F-) specific for sequence of cDNA encoding the melatonin receptor, previously identified with go

7 Xenopus dermis melanophores; the location of the primers which do not correspon-tooth not in this sequence (~ =) are also illustrated in this figure;
FIG. 3 illustrates the steps of cloning and sequencing the frag-melatonin receptor cDNA;
= 5 - Figure 4 corresponds to a comparison of the coding sequences respectively for the melatonin receptors Mell a) and Mel1c (R): the sequence of the melatonin receptor Mell a) is illustrated (O) and the substitutions characterizing the melatonin receptor Melir (R) (0) are shown in Figure 4A; the sequences of long and short 3 'untranslated region DNA are shown in Figure Figure 4B. The Mellc () receptors are preferentially associated with the 3 'region not translated short (3: 1, short: long), while the Meli receptors, (R) are preferentially associated with the long 3 'untranslated region (1: 3). In Figure 4B, the cloning sites EcoRI are underlined.
- Figure 5 illustrates the coding part of cDNA sequence coding for the functional melatonin receptor type MEL1 A (a or b) in compare sound with the sequence EBISAWA et al. (reference cited above);
FIG. 6 illustrates the characterization of the DNAs coding for the Mellc receptors (a ~ 1VIe11 R) in different types of Xenopus. Amplification PCR
used in this test provides fragment 3 of FIG. 2. The enzymes of use restriction for digestion of the PCR amplification products obtained are: Afl II (1 site in both in the sequence Mellc (a) and the sequence Mel1c (Q, Bsp120 I (1 site in the Mellc sequence a), no site in the Melic sequence (p, Pmll (1 site in the Me11c (R) sequence, no site in the Mellc sequence (a. Analysis of restriction is made from PCR products. from the following genomic DNAs: 1, X.
tropi-calis; 2, X. ruwenzoriensis; 3, individual X. homozygous laevis (ff); 4, cDNA
of = Miss (a) cloned; 5, cloned MelI ~ (Q) cDNA; 6, X. laevis cDNA amplified at go a skin mRNA pool; 7, individual X. heterozygous laevis (rf); ND, product of Undigested PCR.

8 - Figure 7 illustrates the pharmacological specificity of the 2-(125I) -iodomelatonin / melatonin receptors, in the presence of L cells stable expressing a receptor according to the invention (Mellc (a) or Mel1c (Q; FIG. 7A
watch the isotherm of saturation of the 2- (125I) iodomelatonin bond; the link not specific is measured in the presence of 10 M melatonin; this figure 7A includes in encrusta-tion the Scatchard representation of the data. Figure 7B shows the study links competition sounds of 2- (125I) -iodomelatonin (400pM) at the receptor, performed on L cell membranes expressing either the Mellc (a) receptor or the receiver Melic (R), in the presence of I-melatonin (0), melatonin (M), N-acetyl-5-hydroxy-tryptamine (NAS) (O), S22153 (, &) and S20098 (M).
FIG. 8 illustrates the modulation of the accumulation of cAMP, stimulated linked by forskolin, by the Mellc) and Mel1c (R) receptors. The clones cell stable the L transfected with cDNA coding either for the Melic receptor () (0), either for the receptor Mel1cCR1 (O) are stimulated by forskolin (FK) (10 M) in presence of indicated concentrations of melatonin (on the abscissa); on the ordinate, this figure includes the intracellular cAMP level in%. The value 100% (O) corresponds to the mean cAMP value in the presence of 10 M forskolin; (a) indicates the value cAMP, in the presence of melatonin (10 M) alone (* P <0.05).
FIG. 9 illustrates the modulation of the accumulation of stimulated cAMP
linked by isoproterenol, by melatonin receptors, in trials transfection transitional tion. The Mellc receptor (a) or the Mel1c receptor (R) is co-expressed with the receptor (32 adrenergic ((32-RA), in equal amounts in L cells and stimulated with isoproterenol (ISO, 10 .M), in the presence or absence of melatonin (Mel, 10 M): cAMP levels are measured; NT means non-transfected. The number of 125ICYP and 2-125I-iodomelatonin specific binding sites [represented as follows: (specific ICYP binding sites / specific binding sites iodo-melatonin) and expressed as finol / mg protein], in these cells transfected are respectively: NT (24/0); Mell al (5/77); Melic (R) (13/148); (32-RA
(622/0); (32-RA / Meltc () (386/54), (32-RA / Mel1c (R) (416/151) (* P <0.05).

9 - Figure 10 illustrates the modulation of the accumulation of cGMP by melatonin receptors. In FIG. 10A, transfected L cells in a way transient with a cDNA encoding either the Melic receptor (a) (d, (D), or for the Mellc (R) receptor (i, =), are incubated with the concentrations indicated in abscissa of melatonin, in the presence (O, =) or in the absence (^, M) of 1 mM IlVMX. To the Figure 10B, L cells transiently transfected with cDNA
encoding either for the Meltc receptor (a), or the Mellc receptor (p), are preincubated either in one buffer, either with Pertussis toxin (PTX, 100 ng / ml) for 18 hours and then incubated in the presence of 1 mM of ILBMX and in the absence or in the presence of 10 M
of melatonin. The intracellular cGMP levels (on the ordinate) are determined.
It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention, of which they do not constitute in no way a limitation.
EXAMPLE 1: Isolation and identification of the 4 functional sequences of the melatonin receptor type MEL1 A.
a) Amplification of the coding part of the melatonin receptor of Xenopus laevis.
The total RNA of the skin of Xenopus laevis is previously processed with 0.3 U of a DNAse I without RNAse (RQ1 DNase, Promega) for 20 min at 37 C per mg of nucleic acid. The synthesis of the cDNA is carried out by incubation of 200 ng of RNA (heated at 65 ° C. for 5 min before the reaction) with 100 units of Stratagene "Stratacript RNAse H-" reverse MMLV transcriptase for 30 min at 37 C.
After inactivation at 95 C (5 min), the cDNA is amplified by PCR with different pairs of oligonucleotides specific for the melatonin from Xenopus laevis, DNA polymerase lPwo (Boehringer Mannheim) with its own buffer, in the presence of 2 mM MgSO4, in a volume of 50 l. CDNA is denatured for 2 min at 94 ° C., amplified 40 times; an elongation of 3 min at 72 C is then carried out. One cycle corresponds to 15 sec. at 94 C; 30 sec. at temperature specific of oligonucleotide couple and 90 sec. at 72 ° C (GeneAmp PCR System 9600 from Perkin-Elmer Cefus). The oligoniucleotide pairs used to amplify different cDNA fragments encoding the melatonin receptor for X. laevis (figure 2) are the following :
- fragment 1: 5'AGAAATGATGGAGGTGAATAGCA3 '(SEQ ID
N 9) (3S, position 28) and 5'CGGCAATAGACAAACTGACAACA3 '(SEQ ID N 10) 5 (3AS, position 241) (specific hybridization temperature of 54 C); =
- fragment 2: 5'TATTGGTCATTTTGTCTGTC3 '(SEQ ID N 11) (5S, position 183) and 5'CCAGGTGCTTCTTTGATTAT3 '(SEQ ID N 12) (5AS, position 462) (specific hybridization temperature of 50 C);
- fragment 3: 5'CTTCAACATAACAGCCATAGC3 '(SEQ ID

10 N 13) (6S, position 391) and 5'TGCTTGATTGTTGTTGGTTAC3 '(SEQ ID N 14) (6AS, position 764) (hybridization temperature of 50 C);
b) Amplification of the 3 'end of the melatonin receptor of the Xenopus laevis.
Fragment 4, containing the 3 'untranslated region is amplified in use.
reading the Amp1iFINDERTM RACE kit (Clontech) and the following oligonucleotides:
5'TATGGTGTGCTAAATCAA.AACTTCCGCAAGGAGTA3 '(SEQ ID N 15) and 5'TACTGATGTCCTTATTGACTCCAAGACTGTTGTTT3 '(SEQ ID N 16) (hybridization temperature of 58 C).
Furthermore, the cDNA encoding the entire melatonin receptor can be amplified with the following primers: 5'AGAAATGATGGAG
GTGAATAGCA3 '(SEQ ID N 17) (3S) and 5'TTAGAATGAATGGACAGAA3' (SEQ ID N 18) (12AS) (hybridization temperature of 52 C).
Several primers have been tested for their capacity to amplify the melatonin receptor cDNA (Figure 2).
Over 80% of the desired cDNA was amplified using 3 pairs different primers which include overlapping sequences (fragments 1-3), which correspond to the region coding for the fragment up to Ala 349.
All efforts to amplify the last portion of coding region in 3 'and the 3' non-coding region did not succeed.
This remaining part of the melatonin receptor cDNA has been amplified using a modified PCR reaction, using the polyadenylation, to the 3 'end of the cDNA as a primer (principle described in Figure 3).

he Two amplification fragments (estimated at 400 bp (short fragment) and 600 bp (long fragment), respectively) were obtained using this approach. The short fragment of 400 bp contains 250 non-coding bp (3 'short) and 150 bp coding;
the 600 bp fragment contains 450 bp non-coding (3 'long) and 150 bp coding.
Digestion of these fragments with two restriction enzymes show the expected restriction profile.
The amplification products were cloned separately in a vector.
and characterized by enzymatic digestion and by sequencing by method to dideoxy (4-6 clones / fragment).
Fragment 1 corresponds to the sequence 28-241: 3 clones were sequenced, which are identical with the published sequence (EBISAWA et al.).
Among the clones of fragments 2 and 3, some are identical to the published sequence while others show differences in the sequence nucleic acid.
In a variant of fragment 2, two substitutions are observed silent nucleotides (no modification of the sequence in amino acids), while that the variants of fragment 3 contain 26 nucleotide substitutions silent and 6 substitutions leading to a modification of the amino acid sequence corres-laying (see Figures 4 and 5).
Both the short and long forms of the 4 fragments present strong homology to the published melatonin receptor sequence up to the methionine in position 353.
Regarding fragment 4 short (see SEQ ID N 5 and N 7) (fragment C), beyond methionine 353, two different amino acids have been detected tees, i.e. tyrosine in place of leucine (position 354) and valine in place of place of glycine (position 355), followed by a stop codon, causing the loss of 65 amino acids, when compared with the published melatonin receptor sequence of Xenopus laevis (Figure 4A).
The amino acid alignment of said receptor, from Xenopus, of Man and Sheep, shows that the published sequence of the melatonin from Xenopus has a C-terminal tail much longer than the receptor for two other species (REPPERT et al., 1994).

Unlike the published sequence, the melatonin receptor according to the invention obtained from Xenopus laevis has the same size that the melatonin receptor obtained from humans or sheep.
Regarding fragment 4 long (fragment L) (see SEQ ID
N 1 and N 3): 4 clones were sequenced, one of them corresponds to the published sequence up to methionine 353, 3 of them show the same change as that observed in the short fragment, up to methionine 353. In all clones, the amino acids 354 and 355 are modified from the published sequence and present a stop codon at position 356, as visible in the short fragment.
In addition, the 3 'non-coding region of the long fragment is identical.
with that of the short segment, up to the polyadenylation tail; he includes, in in addition, 160 bp, followed by its own polyadenylation tail (see list of sequences, SEQ ID N 1 and N 3) (see figure 2).
The sequence differences found throughout the sequence are highlighted in Figure 5.
Unexpectedly, the sequencing of the melatonin receptor obtained by PCR-RT therefore reveals two different sequences (MEL1 Aa and MEL1 Ab).
In addition, the cDNA encoding the complete melatonin receptor can be amplified from DNA of xenopus skin, by PCR, using primers 3S and 12AS, located in the non-coding 3 'region (see Figure 2).
Restriction analysis of several clones confirms that 2 mRNAs different for the melatonin receptor are actually present in the samples analyzed.
The 2 mRNAs code for proteins of 354 aniino acids which are very similar to the Melir chicken receptor (78% homology).
Fragment C (short fragment) has therefore also been referred to as Mell, (a) and the L fragment (long fragment) (comprising many substitutions) was named Melic ((3).

EXAMPLE 2 Construction of a vector for the expression of the functional receptor of melatonin type MEL1 A.
The melatonin receptor of Xenopus laevis has been cloned compliant mement to the RT-PCR method (see Figure 1).
RNA is isolated from the skin of Xenopus and transcribed into cDNA using reverse transcriptase.
Selective amplification of the melatonin receptor cDNA
is carried out using PCR primers specific for this receptor.
The amplified receptor is cloned into the expression vector pcDNA3-RSV derived from plasmid pcDNA3 (Invitrogen) and its identity has been verified by sequencing, as follows:
Successive preligations of the fragments between them, thanks to restriction enzymes common two by two, allowed to insert all of the reception melatonin in plasmid pcDNA3 / RSV at HindIII / Bsp120I sites at end frank, under the control of the promoter of the rous sarcoma virus (RSV). The fragments 2 and 3 are first linked to the common enzyme site "HindIII", in position 455 of the coding sequence. The latter is then linked with fragment 1 to site common "Bsu361" in position 202 and with fragment 4 at the common site "Xba1" in position 1016. Each fragment is previously cut by the two enzymes indis-thinkable for successive ligations. This purified fragment, composed of fragments 1, 2, 3 and 4, the 5 'and 3' ends of which are HindIIl and EcoRI respectively.
free kick, is finally inserted in pcDNA3 / RSV '.

EXAMPLE 3 Characterization of the Mell locus in several species of xenopus.
The Meli al (or Mell Aa) and Mellc (p) (or Meli Ab) receptors highly homologous can represent either 2 different alleles at the level of the same genomic locus, i.e. 2 isoforms encoded by different genes.
To be able to answer this question, fragment 3 coding for Mellc receptors (or Mell A) were amplified by PCR, from DNA
geno-mique de 43 Xenopus laevis.
Several of these animals are inbred animals, while other wild animals imported from South Africa.

Amplified DNA fragments of the expected size are digested with suitable restriction enzymes specific for Mellc (a) cDNAs or Mel1, (R) (figure 6).
In an individual X. laevis (ff), homozygous for the major complex histocompatibility and other genetic markers, only the gene encoding for the Mellc (a) receiver is found.

PCR analysis of a second frog X. laevis (rf), known for being heterozygous for the genetic markers mentioned above, reveals the pre-sence of the 2 genes (gene coding for the Mell receptor, () and gene coding for the Mel1c receiver (R (Figure 6).

This observation confirms the hypothesis that the 2 isoforms of the melatonin receptor are encoded by the same genomic locus.
Analysis of 41 other animals show the presence of either 2 genes (40 individuals) or uncomfortable Mellc (a) alone (1 individual). No animal has only the receptor gene Melic (R).

Two other Xenopus species have been studied according to the same approach.
Analysis of the genomic DNA of X. ruwenzoriensis, a species known to be polyploid, reveals the presence of the gene coding for receiver Mellc (a). Two genes encoding the melatonin receptor clearly different from Mell, (a) and Mel1c (R) were revealed by comparing the profiles of digestion enzyme of X tropicalis and X. ruwenzoriensis (Figure 6).
EXAMPLE 4 Pharmacology of the functional melatonin receptor of the type MEL1 A.
a) Stable expression The vector pcDNA3-RSV containing the coding region and the region non-coding 3 'of the melatonin receptor of Xenopus laevis according to the example 2, is transfected into mouse L cells.
The day before, 3x105 cells passed through the 25 cm2 flasks in a DMEM medium 4.5 g / l of glucose; 1 mM glutamax; 1 mM pyruvate; 10% FCS
(DMEM / PCS). On the day of transfection, the medium is changed (6 ml of DMEM / FCS / flask) and the cells are incubated for 3 hours at 37 C.
in parallel a coprecipitation of the DNA and of CaPO4 is prepared as follows:
in a final volume of 500 l, 30 g of carrier DNA (pGEM3Z from Promega) are mixed, 2 g of the pcDNA3-RSV vector containing the coding region and the non-coding region coding 3 ' 5 of the melatonin receptor of Xenopus laevis and CaC12 (250 mM
final) (Solution AT). 450 l of this Solution A are added dropwise, by vortexing, to 450 l of HBS 2x (1.64 g NaCI; 1.19 g Hepes; 0.04 g Na2HPO4-12H20 added to 100 ml H2O) and the pH is adjusted to 7.12. The mixture is left without stirring at temperature room for 45 min. 400 l of coprecipitate are added to a flask containing 10 L cells. After 4 hours incubation at 37 ° C, the cells are washed once with 6 ml of DMEM and then incubated 2: min in 4 ml of 15% glycerol. Then the cells are washed twice with DMEM and left in 6 ml of DMEM / FCS, supplemented with 5 mM nabutyrate at 37 C overnight. The next day, medium is removed, the cells are again washed with DMEM / FCS and then incubated during 15 overnight in DMEM / FCS. On the third day the cells are distributed in 96-well plates at different dilutions (1/2, 1/4, 1/8, 1/16, 1/32) in an environment DMEM supplemented with: 10% FBS (v / v), 4.5 g / l glucose, 100 U / inl penicillin, 100 mg / ml streptomycin, 1 mM glutamine and 400 g / ml (geneticin from Gibco Life Technologies). Geneticin-resistant clones are tested for melatonin receptor expression by binding to the (125) Iodo-melatonin (200 pM) in a final volume of 250 l (buffer: 50 mM Tris / HCI pH
7.4; 5 mM MgC12). Non-specific binding is determined in the presence of 10 mM
of melatonin.
b) Transient expression To obtain a transient expression, the L cells are eta-either on plates with 6 wells (for cAMP tests, 0.5.106 cellu-/ wells), either in boxes 10 cm in diameter (cGMP tests, 2.106 cells / box) and transfected by the DEAE-dextran method (LOPOTA et al., NAR, 1984, 12, 5707-5717), the next day.

After washing with PBS, DMEM without serum, containing Hepes 50 mM, DEAE-dextran at 200 g / ml and 1 g / ml of plasmid DNA
mide pcDNA3-RSV), is added.
After incubation for 8 h at 37 ° C., the medium is replaced with 10% DMSO in serum-free DMEM for 1.5 min. The cells are washed with PBS and incubated in DMEM medium containing fetal calf serum at %. The tests are carried out three days after the transfection.
at. Radioligand binding test.
* Method The monolayers of sub-confluent cells are washed with PBS, incubated for 5 min at 37 C with 20% trypsin, 2 mM EDTA
and resuspended in DMEM supplemented with fetal beef serum at 10% (v / v).
After centrifugation at 450 xg for 5 min at 4 ° C., the pellets laires are resuspended in PBS pH 7.4.
Cell suspensions are incubated with 400 pM 2- (125I) -iodomelatonin (for melatonin receptor binding assays) or 200 pM (1251) -CYP (for adrenergic receptor binding tests (32) in the absence or in the presence of 10 M of cold ligands (melatonin or D / L-propranolol, respecti-vement).
The link tests are carried out under the following conditions 60 min at 25 C in a final reaction volume of 0.25 ml. Reactions tions are stopped using rapid filtration through a filter fiberglass Whatman GF / C, previously soaked for 30 min in a PBS buffer containing 0.3% polyethylene imine (to reduce non-specific bonds).
Protein concentrations are measured on the homogenates of cells by the Bradford method (Analytical Biochem., 1976, 72, 248-254), in using the Bio-Rad protein testing system. Bovine serum albumin is used as standard.

* Results Among the different clones expressing the (luI) binding sites -iodomelatonin, a Mellc (a) clone expressing 200 receptor finol / mg of protein total and a Mel1C (R) clone expressing 150 receptor finol / mg protein total were more particularly characterized.
The dissociation constants KD of the radiolabelled agonist 2- (125 I) -iodomelatonin are 160 32 and 143 25 pM respectively (FIG. 7A), values which are in agreement with those determined for other receptors of the melatonin from strong affinity, including those previously cloned, from melanophores of X.
laevis. Competitive experiences have shown that the affinity for different ligands is characteristic of melatonin receptors (Figure 7B and Table I).
Table I

Ki (nn Ligand Mel lc (a,) Mel1c (R) Xenopus (Ebisawa et al.) Melatonin-I 0.26: E 0.25 0.24 0.11 0.11 S20098 0.66 t 0.10 0.41 f 0.14 Melatonin 1.28 f 0.12 2.10 f 0.56 1.30 6-OH-melatonin 35.70 f 4.04 46.90 f 1.88 20.00 S22153 195.00 t 6.64 359.00 f 140 SIN 1,425.00 327 1,771.00 ~ 670 2,000.00 No significant difference is found between the receptors Mellc a) and Mellc (p) in the linkage tests.
b. Determination of intracellular levels of cyclic AMP.
* Method Cells grown in plates containing 6 wells are washed twice with DMEM without serum, preincubated for 15 min at 37 ° C., then incubated for 15 min at 37 ° C. in a DMEM medium containing 1 mM of IBMX
(3-isobutyl-1-methylxanthine) with or without isoproterenol (10 pM) (tests on the transient transfected cells), or 10 M forskolin (tests on clones stable) and increasing amounts of melatonin.

The incubation buffer is removed and the cells are lysed in 1 M soda for 20 min at 37 C. After neutralizing the pH with acid ace-1 M tick, cell lysates are centrifuged in a microcentrifuge at 17,000 x g for 5 min. The supernatants are tested for their content in cyclic AMP
at using the 3H cyclic AMP system (Amersham). Alternatively, the tests for measured cyclic AMP can be performed in plates containing 24 wells (0.5 x 106 cells in 300 l). The cells are then incubated for 15 min and the reaction is stopped by the addition of 100 l of 20% trichloroacetic acid and the 'supernatants are tested for their content in cyclic AMP.
* Results - Melatonin receptors, with a strong affinity, are known to participate in the inhibition of the activity of adenylyl cyclase.

In L cells expressing the Mell al receptor, melatonin inhibits the accumulation of cAMP stimulated by forskolin (figure 8).
The IC5o value of this effect is around 6.10-10M, which is agree with the values obtained previously with the receptors of the melatonin with a strong affinity.
Surprisingly, in cells expressing the receptor Mellc (p), such an effect cannot be observed even at concentrations of melatonin greater than 0.1 mM.
However, baseline cAMP levels are not affected by melato-nine in none of the cell lines studied, even in the presence of IBMX.
Inhibition of accumulation of cAMP by melamine receptors tonin is coupled to G proteins;., through their subunits oc.

- To verify that the signal produced with the Me11c (R) receiver is not not due to a quantitative change in Gia subunits, L cells controls and clones expressing either the MellC () or MeliC (R) receptors are compared for what concerns their content in Gia subunits, in accordance with the following protocol:

The cells are solubilized in a Laemmli buffer containing 2%
of SDS and 40 mM of dithiothreitol and sonicated at 4 C. After centrifugation in a microcentrifuge at 17,000 xg, 50 l of supernatant is separated into components in 1.2% SDS / polyacrylamide gel. Immunoblot analysis is performed as described in SELZER E. et al. (Proc. Natl. Acad. Sci. USA, 1993, 90, 1609-1613), with 84 antisera which correspond to the 3 subtypes of Gia =

Western blot analysis with a specific antibody recognizing the 3 subtypes of Gi, does not detect differences quantitative significant.
- Study of the transduction signal (signaling) It was studied after transient transfection of the 2 cDNA isoforms of Mellc in L cells so as to exclude a potential artifact associated with the selection of clones. L cells are co-transfected with cDNA from receiver adrenergic 02 human and with either the cDNA of the Mellc receptor (a) or receiver Me11, _ (R); the co-expression of these different receptors makes it possible to study selectively the subpopulation of cells that actually internalized exogenous DNA.
Three days after transfection, the cells are studied for their inhibition of accumulation of cyclic AMP-melatonin dependent, in response at isoproterenol, agonist (32-RA and for the number of binding sites (3 adrenergic and melatonin (Figure 9).
No binding site, for any of the receptors, can be measured in wild control cells. In cells transfected with the cDNA of adrenergic receptor (32 alone, incubation with isoproterenol results in an increase cAMP factor 5. In cells co-transfected with quanti-identical tees (1 g of plasmid DNA) of cDNA encoding the receptors Mellc (a) and P2 adrenergic, simultaneous incubation with isoproterenol and melatonin leads to a significant decrease in the accumulation of cAMP (65t5% of the control, p <0.05) (Figure 9).

Under the same conditions, the Mel1c (R) receptors are not capable of to inhibit the accumulation of cAMP induced by isoproterenol, despite the expression an equivalent number of receptor binding sites.

Similar results are obtained when the cDNA encoding the Mellc- (R) receptor is 10-fold in excess of coding cDNA
for the adrenergic receptor (32.

Mellc () receptors inhibit the accumulation of cAMP stimulated by 5 forskolin in a dose-dependent manner with an IC50 value of approximately 6.10-10M, a value consistent with that reported for melatonin receptors previous-as described.
In contrast to these results, the binding of melatonin to receptors Mell, :( R) does not stimulate any modulation of cAMP levels although the forskolin 10 stimulates accumulation of similar A.MPc in cell lines expressing either Melic receptors (a), i.e. Mell R receptors).
The inhibition of adenylyl cyclase function is mainly coupled to activated Gi proteins.

Western blot analysis shows the presence of similar quantities 15 of Gil-3 subunits at a time in both cell lines transfected and in non-transfected control L cells, excluding potential selection of cell clones milk expressing small quantities of Gi proteins. Furthermore, the absence of modulation of cAMP is also observed in transfection trials transient, confirming that the Meli receiver, :( R) itself is unable to activate this track 20 organic.

The difference between the Mellr, () and Mellc (R) receptors, namely essentially the substitution of 5 amino acids, localized in the fields intracellu-laires, constitutes the molecular basis of this phenomenon; in receivers belonging to the fan-flfl of receptors including 7 transmembrane domains, these intra-cells are known to be involved in protein coupling G. In appropriate experimental conditions, melatonin can stimulate the accumulation of cAMP in cells expressing adenylyl cyclase type H. Such an effect is not observable with stable clones expressing the Meltc receptor (a) or the receiver Melic (13), nor in L cells transiently transfected with CDNA
correspondents.
vs. Determination of intracellular levels of clinical GMP.
* Method Transiently transfected cells, grown in dishes with a diameter of 10 cm are incubated at 37 C for 15 min in one DMEM medium without serum, in the presence or absence of 1 mM IBMX and quanti-growing melatonin tees. The medium is then replaced by 1 ml 65% ethanol frozen and the cell extracts are cen, trifugged at 2000 xg for 15 min at 4 C. The supernatants are dried; the pellets are resuspended in 250 l of a buffer acetylated.
The cyclic GMP is dosed in accordance with the EIA kit (Amersham).
Additional channels such as modulation of content in CGMP has been proposed for the melatonin receptor (VANECEK J. et al., Brain Res., 1989, 505, 157-159).

L cells expressing either the Mel1c (a) receptors or the receptors Mellc (p), are incubated with melatonin and the effects on cGMP
intracellu-area are analyzed. Melatonin (up to 10 M) has no effect on basic rate of cGMP in any of the cell lines.
The intracellular cGMP content depends on the opposite activity of guanylyl cyclases, which synthesize cGMP and phosphodiesterases (PDE), who degrade cGMP.
The PDE inhibitor, IBMX when added to the middle, blocks the degradation of cGMP by PDE. Under these conditions, the cGMP level increases by a factor of 3, indicating the presence of basal PDE activity in the L cells no stimulated.
Incubation with melatonin inhibits cGMP accumulation PDE-stimulated, dose-dependent in L cells expressing be the Mellc receptor (a), i.e. the Mel1c receptor (13) (Figure 10A).

The ICso value of this effect (about 10-9 M) corresponds to the values of melatonin Ki obtained in competition trials and is close of the IC50 value obtained during the inhibition of adenylyl cyclase by the Mel1c receiver (a) =
Melatonin stimulation of control cells does not affect increased production of cGMP by IBMX. '' Pertussis toxin, which catalyzes the inactivating ribosylation of ADP
a G; / o subunits of G proteins, blocks the inhibition of accumulation cAMP
linked to Gi protein and stimulated by melatonin receptors. The preincubation of cells with Pertussis toxin completely abolishes the effect of melatonin on accumulation of cGMP, suggesting that this pathway is also dependent on the protein Gi / o.

The 2 melatonin receptor cDNAs Mellc () and Melic (R) are are found either in long form or in short form. Receptor cDNA
Melic (a) is mostly in the short form (3: 1, short: long), while the Mellc (R) receptor cDNA is more abundant in the long (1: 3) form. The 3 'untranslated regions of several receptors of the same family, such as that the adrenergic receptor (32 or the muscarinic receptor contains determinants molecules involved in regulating the stability of mRNA. This suggests that the short and long mRNAs encoding the Mell, () and Mell, (R) receptors are subject to different regulations.
Insofar as the receptor isoforms have similar affinities melatonin but different biological signals, such regulation could modulate the cellular response to stimulation by melatonin.
The role of cGMP as second messenger in the biological pathway of the melatonin receptor is still controversial. Pigment aggregation in the Xenopus melanocytes are regulated by melatonin and by cAMP while of contradictory results exist regarding its regulation by the CGMP. The role of cGMP in stimulating biological signals related to melatonin in others cellular systems has not been thorough. A second argument in favor of the modulation of cGMP by melatonin receptors emerged from trials made on the neonatal rat pituitary tissue in which an inhibitory effect on melatonin on the cGMP production is observed. In the tests as reported above, the melatonin-activated Mellc (a) and Mel1c (R) receptors inhibit effectively accumulation of cGMP in a dose-dependent manner with an IC50 value approximately 10-9 M. This inhibition is only evident when the inhibitor of PDE
IBMX is included in the incubation environment, presumably due to a basal activity Significant PDE in L cells.
The data reported above confirms that the high affinity melatonin can modulate cGMP in concentration physiological melatonin and show that the MeII receptors ,, (R) are functional in term of signal transduction.
The effect of receptors on cGMP is completely abolished by Pertussis toxin, indicating that the G; / o proteins are involved in the transducer-tion of this signal.
As is apparent from the above, the invention is not limited to in addition to those of its methods of implementation, implementation and application who comes do not need to be described more explicitly; on the contrary, she embraces all the variations that may come to mind of the technician in the field, without deviate from framework, or scope, of the present invention.

SEOUENÇES LIST

(1) GENERAL INFORMATION
(i) DEPOSITOR:

(A) NAME: ADIR and CIE
(B) STREET: 1 rue Carle Hebert (C) CITY: COURBEVOIE
(E) COUNTRY: FRANCE
(F) POSTAL CODE: 92415 CEDEX
(A) NAME: JOCKERS Ralf (B) STREET: 24 rue Lazare Hoche (C) CITY: PALAISEAU
(E) COUNTRY: FRANCE
(F) POSTAL CODE: 91120 (A) NAME: MARULLO Stefano (B) STREET: 3 Place de l'escadrille Normandie Niemen (C) CITY: PARIS
(E) COUNTRY: FRANCE
(F) POSTAL CODE: 75013 (A) NAME: STROSBERG Arthur Donny (B) STREET: 66 rue de Javel (C) CITY: PARIS
(E) COUNTRY: FRANCE
(F) POSTAL CODE: 75015 (ii) TITLE OF THE INVENTION: NUCLEIC SEQUENCES ENCODING FOR
MELATONIN RECEPTORS AND THEIR APPLICATIONS.
(iii) NUMBER OF SEQUENCES: 18 (iv) COMPUTER-DETACHABLE FORM:
(A) TYPE OF SUPPORT: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) SOFTWARE: Patentln Release # 1.0, Version # 1.30 (EPO) (vi) DATA FROM THE PREVIOUS APPLICATION:
(A) REQUEST NUMBER: FR 95 08 947 (B) DEPOSIT DATE: 24-JUL-1995 (2) INFORMATION FOR SEQ ID NO: 1:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1311 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA for mRNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 1..1065 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr I1e Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gin Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr I1e Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn GGG TGG ACG CTT GGA AAT ATC CA7 'TGT CAG ATC AGT GGC TTC CTG ATG 336 Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Tyr Asn Gln Arg Ser Thr Trp Cys Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr ACC ATA ACA GTA GTG GTG GTG CAT TT'.C ATA GTC CCT CTT AGT GTT GTG 624 Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Gln Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Phe His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Val Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Leu Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

(2) INFORMATION FOR SEQ ID NO: 2:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gin Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gin Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Tyr Asn Gln Arg Ser Thr Trp Cys Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Gln Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Phe His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser 275 280 Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn A] .a Val Ile Tyr Gly Val Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Leu Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

(2) INFORMATION FOR SEQ ID NO: 3:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1147 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA for mRNA
(ix) CHARACTERISTIC:
. (A) NAME / KEY: CDS
(B) LOCATION: 1..1065 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Tyr Asn Gln Arg Ser Thr Trp Cys Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Gln Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Phe His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Val Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Leu Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

ATACAAGTTT CTTTTATGGC A.AAAAAAA.AA AAAAAAGAAT TC 1147 (2) INFORMATION FOR SEQ ID NO: 4:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gin Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Tyr Asn Gln Arg Ser Thr Trp Cys Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Gln Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Phe His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Val Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Leu Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

(2) INFORMATION FOR SEQ ID NO: 5:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1312 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA for mRNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 1-.1065 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser, Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Phe Asn Gln Arg Ser Thr Trp Phe Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gin Lys Leu Thr Pro Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Leu His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Leu Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Trp Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

TTAAAAAAAA P.AAAAAAAAA AGAATTC 1312 (2) INFORMATION FOR SEQ ID NO: 6:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Phe Asn Gln Arg Ser Thr Trp Phe Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Pro Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Leu His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Leu Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Trp Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val * -(2) INFORMATION FOR SEQ ID NO: 7:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1147 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA for mRNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 1 ... 1065 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gin Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gin Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gin Ile Ser Giy Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Phe Asn Gln Arg Ser Thr Trp Phe Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val Ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Pro Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Leu His Val Ala Pro Lys Ile Pro Glu Trp Leû Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Leu Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Trp Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

(2) INFORMATION FOR SEQ ID NO: 8:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8:

Met Met Glu Val Asn Ser Thr Cys Leu Asp Cys Arg Thr Pro Gly Thr Ile Arg Thr Glu Gln Asp Ala Gln Asp Ser Ala Ser Gln Gly Leu Thr Ser Ala Leu Ala Val Val Leu Ile Phe Thr Ile Val Val Asp Val Leu Gly Asn Ile Leu Val Ile Leu Ser Val Leu Arg Asn Lys Lys Leu Gln Asn Ala Gly Asn Leu Phe Val Val Ser Leu Ser Ile Ala Asp Leu Val Val Ala Val Tyr Pro Tyr Pro Val Ile Leu Ile Ala Ile Phe Gln Asn Gly Trp Thr Leu Gly Asn Ile His Cys Gln Ile Ser Gly Phe Leu Met Gly Leu Ser Val Ile Gly Ser Val Phe Asn Ile Thr Ala Ile Ala Ile Asn Arg Tyr Cys Tyr Ile Cys His Ser Leu Arg Tyr Asp Lys Leu Phe Asn Gln Arg Ser Thr Trp Phe Tyr Leu Gly Leu Thr Trp Ile Leu Thr Ile Ile Ala Ile Val Pro Asn Phe Phe Val Gly Ser Leu Gln Tyr Asp Pro Arg Ile Phe Ser Cys Thr Phe Ala Gln Thr Val Ser Ser Ser Tyr Thr Ile Thr Val Val Val Val His Phe Ile Val Pro Leu Ser Val Val Thr Phe Cys Tyr Leu Arg Ile Trp Val Leu Val ile Gln Val Lys His Arg Val Arg Gln Asp Phe Lys Gln Lys Leu Thr Pro Thr Asp Leu Arg Asn Phe Leu Thr Met Phe Val Val Phe Val Leu Phe Ala Val Cys Trp Ala Pro Leu Asn Phe Ile Gly Leu Ala Val Ala Ile Asn Pro Leu His Val Ala Pro Lys Ile Pro Glu Trp Leu Phe Val Leu Ser Tyr Phe Met Ala Tyr Phe Asn Ser Cys Leu Asn Ala Val Ile Tyr Gly Leu Leu Asn Gln Asn Phe Arg Lys Glu Tyr Lys Arg Ile Leu Met Ser Leu Trp Thr Pro Arg Leu Leu Phe Leu Asp Thr Ser Arg Gly Gly Thr Glu Gly Leu Lys Ser Lys Pro Ser Pro Ala Val Thr Asn Asn Asn Gln Ala Asp Met Tyr Val *

(2) INFORMATION FOR SEQ ID NO: 9:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 23 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"
(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9:

(2) INFORMATION FOR SEQ ID NO: 10:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 23 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10:

(2) INFORMATION FOR SEQ ID NO: 11:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 20 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11:

(2) INFORMATION FOR SEQ ID NO: 12:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 20 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12:

(2) INFORMATION FOR SEQ ID NO: 13:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 21 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13:

(2) INFORMATION FOR SEQ ID NO: 14:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 21 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14:

(2) INFORMATION FOR SEQ ID NO: 15:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 35 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15:

(2) INFORMATION FOR SEQ ID NO: 16:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 35 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 16:

(2) INFORMATION FOR SEQ ID NO: 17:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 23 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 17:

(2) INFORMATION FOR SEQ ID NO: 18:

(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 19 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 18:

Domand number = Interntttonale: PCT /

MICRO.ORGANISMS

Fauil4 facuMattre rNaU.s at micro-orpanlsme m .. + Uonn1 .n ~ o - 4-- -. Mn ..

da la d.scnptfon t A. IDENTIFICATION OF THE DâPOT +
Other dlpdta have -d.ntMls on one. hultta supplln euakm Nww de t'InaUtutlon I. d, 60Ot ~ National Collection of Cultures of Microorganisms AdrvssN d. 19nsUlutfon ds ddpOt (including I. cod. Oostal .t I. paya) 4 28 rue du Docteur Roux, 75724 PARIS CEDEX 15 oate du Dépet = June 7, 1995 I N- d 'fdfe 6 I-1 5 8 3 S. INDICATIONS 3U / pLEMENTA1REf r (ln = r.mpllr au4 al nac.aaus). A = f.ullle separla = tt faraway = for the fool of cs r.nsNon.m.nts n "With regard to designations in which a European patent is requested, a sample of the micro-registered body will not be accessible until publication the mention of the grant of the European patent or until the date the request will be rejected, withdrawn or deemed withdrawn, only by the delivery of a sample to a expert appointed by the applicant. (Rule 28.4) of the EPC) 'r.

C. tTATi 0 [fItSN [S FOR LIIOUELS LE:) MDICATION3 ARE DONNLE = s (sl Na induce us n. are not given for all the States dlslpMS) EUROPE JAPAN
AUSTRALIA NORWAY
CANADA NEW ZEALAND
CHINA UNITED STATES OF AMERICA

0. INOICATION = SUPPLIED 99PARAMENT s (à na nenpMr au. Fl nlc.ssaln) The Inumiri.a cl-apNs indlcations s.ront aoumisas uitérNurnm.nt au Cursau Intsrnatlonal + (spocln.r 14 nsturt pdndralt da rndl- catlons p. +.,. No orare or deposit) E. C La prla.nts laurlls a / ti rKu. arK the international application at the time c-tls-cl aét1 daposN (iv {rr OFRce rft.pt.ur) (Autorl4 function) Oate of reception (.n pfo.snance of the depositor) by iN Sur.au Intarnatfonal t = P
L
V

(Autodal function) C
Form. PCTlRO / 134 (Janrl.r 1Mt) No d4 la domand = Intern4tiondlt: PCT /

MICRO.ORGANIS MES

FWiifd 1iCY1 [aUPtl rWtl ~ a 1Y mICrV-0rpanllm0 mMUpnrti pn ppM .- = = ^ __. L ~ M 21 N Id d ~ atrtprl0n t A. IOENTIf'1CATION OF THE DIPOT t O'avtraa ddp6ü are dantMia sw una hultla suppldmo..taks s U
Name of the instRUSf "from 06p0t 4 National Collection of Cultures of Microorganisms Adrsssa de Iinst) tvtlon de dipOt (including lo codi roostai N Is pays) 4 28 rue du Docteur Roux, 75724 PARIS CEDEX 15 Datd du dlp0t a N. d'ordra a June 7, 1995 I-1584 t. (NDICATIONs 3UPPLEM [NTAIR [i (in = rampilr que d nicassain). Une laui) h Npari = dat) oinl = for the autt = da cia ranaNpnamenta CD

"With regard to designations in which a European patent is applied for, a sample of the micro-organization deposited will not be accessible until publication the mention of the grant of the European patent or until the date the request will be rejected, withdrawn or deemed withdrawn, only by the delivery of a sample to a expert appointed by the applicant. (Rule 28.4) of the EPC) ".

C. âTATi DgalliNilf FOR LIiOU [Lf L [f INDICA7IONi: HAVE GIVEN [Es s (if INa indlutlona are not donnias pow all laa States dldpMa) EUROPE JAPAN
AUSTRALIA NORWAY
CANADA. NEW ZEALAND
CHINA UNITED STATES OF AMERICA

D. INDICATION = SUPPLIED [sf ~ PAREM [NT s (~ M rsmpAr t, u ~ s ~ ndc-ssaln) Laa indlcationa inum {Nss eI.apris st = ront aovmisn ulthNwamdnt au Oursau intarnational r (spdelflar ta nature qdniralo dN indi =
CatiOn = p. = i., a Order number of d1p01 s) . E. C La prtaanta laudlr a dti r. <ua arec la damanda ~ ntarnattonala IoraOVa Calla-cl a il / dipoaN (! T rinn by the office = ricaptaur) = (Sutoriad official) N_-~ Dato de rlctrpIJon (an plorananco du diposant) p4r N ffiuraau InldrMtloMl t =
O ~
t ~
(Function) ra autorisl) c O
Form = PCTIRO1134 (January 1941)

Claims (17)

Claims 1~) Nucleic sequences coding for functional receptors of melatonin of the MEL1 A or Mel1c type, characterized in that they are selected from the following sequences: SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 or SEQ
ID
No.7. 2 ~) Fragments of the sequences according to claim 1, characterized in that they are selected from the group which includes:
- a sequence consisting of a segment of 230 base pairs nu-cleotids, corresponding to nucleotides 1057-1286 of SEQ ID No. 1 or SEQ
ID
No.5;
- a sequence consisting of a segment of 69 base pairs nu-cleotids, corresponding to nucleotides 1057-1125 of SEQ ID No 3 or SEQ
ID
No.7. 3~) Nucleotide probes, characterized in that they hybridize with the nucleotide sequences according to claim 1 or claim 2. 4 ~) Protein and / or protein fragments, characterized in that they are encoded by a nucleotide sequence according to claim 1 or claim 2 and in that they exhibit melatonin receptor activity of type MEL1A
functional. 5 ~) protein according to claim 4, characterized in that it pre-feels any one of the following sequences: SEQ ID No. 2 or SEQ ID No. 6. 6 ~) Recombinant cloning and / or expression vector, characterized in that it comprises a nucleotide sequence according to claim 1 or income-indication 2. 7 ~) vector according to claim 6, characterized in that it is cons-tituated by a plasmid comprising an RSV promoter and SEQ ID No. 1. 8 ~) vector according to claim 7, characterized in that it has been filed under no. I-1583 dated June 7, 1995 with the Collection National of Cultures of Microorganisms held by the Institut Pasteur. 9 ~) vector according to claim 6, characterized in that it is cons-tituated by a plasmid comprising an RSV promoter and SEQ ID No. 5. 10 ~) vector according to claim 9, characterized in that it has been filed under no. I-1584 dated June 7, 1995 with the Collection National of Cultures of Microorganisms held by the Institut Pasteur. 11~) Suitable host cell, obtained by genetic transformation, characterized in that it is transformed with an expression vector according to one any-conch of claims 6 to 10. 12 ~) host cell according to claim 11, characterized in that it consists of cells of the L line. 13 ~) Process for expressing a protein according to claim 4 or claim 5, characterized in that the host cell, resulting from the transformed-tion by a vector containing a nucleotide sequence according to the claim 1 or claim 2 encoding a protein having receptor activity functional of melatonin type MEL1 A, is cultivated in such a way as to produce and carry said protein expressed to the membrane, such that the sequences trans-membranes of said receptor are exposed to the surface of the membrane of the host transformed cell. 14~) Study model of type melatonin receptors MEL1 A, characterized in that it consists of host cells according to the claim-tion 11 or claim 12, i.e. expressing a receptor functional of the melatonin type MEL1 A on the surface of their cell membrane. 15 ~) Method for detecting the ability of a substance to comprise as a ligand vis-à-vis a protein according to claim 4 or income-dication 5, which method is characterized in that it comprises:
- bringing said substance into contact with a prior host cell ably transformed with an expression vector according to any one of claim-cations 6 to 10, which host cell expresses said protein (receptor of melato-nine), and which contacting is carried out under conditions allowing the form-tion of a bond between at least one of the specific sites and said substance and - the detection of the possible formation of a complex of the type ligand-protein. 16 ~) Method for studying the affinity of a protein according to the revenue dication 4 or claim 5 for one or more specific ligands, which pro-transferred is characterized in that it comprises:
- the transformation of an appropriate host cell by a vector according to any one of claims 6 to 10;
- the culture of the transformed host cell, under per-putting the expression of the melatonin receptor type MEL1 A, encoded by the nucleotide sequence, and transfer of the expressed melatonin receptor around the membrane of said cell so that the transmembrane sequences of the receiver functional melatonin are exposed on the surface of the host cell transform-me;
- bringing said cell into contact with the determined ligands and - the detection of an affine reaction between said transformed cell and said determined ligands. 17 ~) Kit for the detection of the possible affinity of a ligand for a protein according to claim 4 or claim 5, which kit is characterized in what it includes:
- a culture of host cells transformed by a vector expression according to any one of claims 6 to 10;
- optionally, if necessary, physical or chemical means to induce the expression of a protein (type melatonin receptor MEL1 A), encoded by a nucleotide sequence according to claim 1 or claim 2, contained in a vector whose promoter is inducible;
- one or more control ligands having determined affinities for said protein; and - physical or chemical means for the characterization of the biological activity of the expressed protein.