CA2225668A1 - Use of stat 6 sh2 domain specific compounds to treat allergic reactions - Google Patents

Abstract

Invented is a method of treating allergic reactions in a subject which comprises administering to the subject a therapectically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain, binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain, and binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

Description

CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 USE OF Stat 6 SH2 DOMAIN SPECIFIC COMPOUNDS TO TREAT ALLERGIC
REACTIONS

BACKGROUND OF THE lNVENTION
S A number of polypeptide growth factors and hormonec m.~ te their cellular effects through a signal tranc~ rtion palllw~y. Transduction of signals from the cell surface receptors for these ligands to intracellular effectors frequently involves phosphorylation or dephosphorylation of specific protein substrates by regulatory protein tyrosine kinases (PTK) and phosph~t~ces. Tyrosine phosphorylation may bethe primary, or possibly even the sole, int1ie~tor of signal tr~ncd~lction in multicellular org~nicm.c. Receptor-bound and intracellular PTKs regulate cell proliferation, cell dir~clcl.liation and .cign~lling processes in immlln~ system cells.
Aberrant protein tyrosine kinase activity has been implic ~ted or is suspected in a llull~ber of pathologies such as diabetes, atherosclerosis, psoriases, septic shock, bone loss, ~nemi~, many cancers and other proliferative ~lice~ces Accordingly, tyrosine kinases and the signal tr~nc-l--rtion palllw~y~ which they are part of are potential targets for drug design. For a review, see Levitzki et al. in Science 267, 1782-1788 (1995).
Many of the proteins comrri-cing signal tr~nccl~ction pdlllW~ are present at low levels and often. have opposing activities. The pl~pcllies of these cign~llin~
mole.cllles allow the cell to control tr~nc~ ction by means of the subcellular location and j u~Laposilion of effectors as well as by b~l~nring activation with l.,~lcssion such that a small change in one palhway can achieve a switching effect.
The formation of tr~nc~ cing complexes by juxtaposition of the cipn~lling molecules through protein-protein interactions are mr~ tP(l by specific ~lorkingdomain seqnenre motifs. Src homology 2 (SH2) clom~inc, which are conserved non-catalytic sequences of approximately 100 amino acids found in a variety of .si~n~lling molecules such as non-rcce~ol PTKs and kinase target effector molecules and in oncogenic proteins, play a critical role. The SH2 dom~in.c are highly specific for short phosphotyrosine-cont~ining peptide sequences found in autophosphorylated PTK receptors or intracellular tyrosine kin~ces CA 0222~668 1997-12-23 W O 97/02023 PCTrUS96/11074 Approximately 60 proteins having distinct catalytic or other functional domains yet sharing conserved SH2 domains, conserved sequences of approximately 100 amino aeids, have been identified. It is not known precisely whieh physiologieal responses in the body are eontrolled by each of these SH2 domains.5 Further, the SH2 domain-ligand/compound interaetions are highly speeifie sueh that minor modifications in the strueture of the ligand/eompound will cignifie~ntly alter the seleetivity with whieh the ligand/eompound binds to the various SH2 domains.The Stat (signal tr~nC~ tion and aetivation of transeription) proteins are SH2cont~ining intraeellular proteins that l~ Sl"il a signal from eytokine reeeptors 10 to the nueleus and aetivate transeription of speeific target genes (Darnell J. et al., Seience 264,1415-1421(1994)). These proteins are recruited to phosphorylation sites on the receptor via their SH2 dom~inc and are th~mcelves phosphorylated ontyrosine residues by receptor-associated Janus (JAK) tyrosine kin~cec Phosphorylation of Stat tyrosine residues provides additional binding ligands for the lS Stat SH2 domains whieh are displaeed from the reec~lol and bind to the Stat phosphotyrosine motifs forming dimers. The dimerie Stats transloeate to the nueleus where they bind to DNA and to other aeeessory proteins and aetivate transeription of target genes. Individual Stats or Stat heterodimers tr~nc-hlee signals from dirre~cllt eytokine reeeptors, for ~Y~mpl~, Stat 6m~ tes interleukin 4 cign~lling while Stat 5 tr~nc~l~lces signals from the e,yLh.~ poietin (EPO) reeeptor (Hou J. et al., Science ~, 1701-1706(1994); Penta K. et al., J. Biol. Chem. 270,31282-31287(1995)).
In disease states involving dysregulation of eytokine aetivity, eompounds that aetivate or inhibit Stat proteins would be useful thel~pculie agents. For 25 example, inhibition of Stat 6 would bloek IL-4 and IL-13-m~ t~ up-regulation of the IgE rcee~lol (Izuhara K.et al., J. Biol. Chem. 271,619-22(1996)) and be useful in the tre~tmPnt of allergic reactions. Conversely, aetivation of Stat S would mimie the effeets of EPO and alleviate ~n~mizl The SH2 domain of Stat proteins provides a means to aetivate or inhibit their function. Activation can be achieved by in~lucing dimer formation by means of a dyad-symm~?trie ligand for the relevant SH2 domain, while a monomerie ligand would inhibit Stat funetion. Diseovery of sueh ligands CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 requires targeting of the SH2 domains of specific Stat proteins to induce or inhibit the desired homo- or heterodimer formation.
The consequences of non selective binding SH2 domains can be quite severe.
~ For example, the Stat 6 SH2 domain and the Stat 5 SH2 domain are structurally 5 similar, pos.sec.cing a high degree of conservation between the domains. Antagonism of the Stat 6 SH2 domain (discussed herein) is intli~t~r~ as treating allergic reactions while activation of the Stat S SH2 domain is in-lic~t~o~l as increasing red blood cell production. Therefore, an activator of Stat 5 with Stat 6 cross-reactivity wouldexacerbate allergic reactions, whereas a Stat 6 inhibitor cross-reacting with Stat 5 10 would inhibit erythrocyte production.
Furthermore, it would be h,l~,d~;lical to assay potential Stat 6 SH2 domain antagonists in binding studies against all 60 known SH2 domains. Presently, there are no known co.,l~ounds which selectively interact with the Stat 6 SH2 domain.
It would be desirable to provide methods and co,llpc.ullds which allow the 15 tre~tm~nt of allergic reactions by antagonizing the Stat 6 SH2 domain but which avoid the pro~ cti- n of side effects observed in non-selective SH2 domain interaction.
As disclosed herein it has unexpectedly been discovered that selective Stat 6 SH2 domain antagonists can be identified by binding assays against the subset of20 SH2 domains con.cicting of; the src SH2 domain, the Stat 6 SH2 clom~in, the lck SH2 domain, the Stat S SH2 domain, the fyn SH2 domain, the ~ 2 SH2 dom~in, the p85 domain, the Grb2 SH2 domain and the hcp SH2 ~lom~in From the info....i-l ion described hereinafter, it has une~cpect~lly been discovered that culllpollllds which are specific for a human Stat 6 SH2 domain with 25 a binding affinity greater than fifty-fold higher than the binding affinity with which the colll~uulld binds to a human Stat S SH2 domain, (b) binds to a human hcp SH2domain, a human Grb2 SH2 domain, a human p85 SH2 domain and a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the colll~ou,ld binds to such Stat 6 SH2 domain, and 30 (c) binds to a human src SH2 ~lom~in~ a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the CA 0222~668 1997-12-23 W O 97/02023 PCTrUS96/11074 binding affinity with which the compound binds to such Stat 6 SH2 domain are effective for treating allergic reactions.

SUMMARY OF THE rNVENTION
S The present invention provides a method of treating allergic re~tinnc in a subject which comprises ~-lminictering to the subject a th~ eul ic~lly effectiveamount of a compound which (a) binds to a human Sat 6 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which thecompound binds to a human Stat S SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

DETAILED DESCRIPI'ION OF THE ~VENTION
As used herein, the term "allergic reaction" means any adverse physical reaction which is exacerbated or caused by IL~, IL-13 or both IL-4 and IL-13 m~ terl up-regulation of the IgE l~cc~or.
Preferred allergic reactions which are treated according to the present invention are asthma, allergic a~thm~ allergic rhinitis and atopic d.-rmzltiti~
Particularly p-~ ,d allergic reactions which are treated according to the present invention are allergic asthma and allergic rhinitis.
As used herein, the term "treating" and d~liv~lives thereof means prophylactic or ~he~ ;ulic therapy.
As used herein, the term "compound" means a nonpeptide ch~-rni~
compound.
As used herein, unless other wise defin~-~l, the term "Stat 6 SH2 domain antagonists" means a compound which (a) binds to a human Stat 6 SH2 domain with a binding affinity greater than fifty-fold higher, preferably greater than one hundred-CA 0222~668 1997-12-23 W O 97/02023 PCTrUS96/11074 fold higher, than the binding affinity with which the compound binds to a human Stat 5 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower, preferably greater than one 5 hundred-fold lower, than the binding affinity with which the compound binds tosuch Stat 6 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower, preferably greater than one hundred-fold lower, than the binding affinity with which the compound binds to such Stat 6 SH2 domain.
The present invention provides a method of treating allergic reactions in a subject which comrrices ~lminicterin~ to the subject a therape--tic~lly effective amount of a co~ o~nd which (a) binds to a human Stat 6 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 ~lom~in, (b) binds to a human hcp SH2 15 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the colll~ound binds to such Stat 6 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fiftv-fold lower than the 20 binding affinity with which the colll~oulld binds to such Stat 6 SH2 c~om~in.A ~l~,rcllcd aspect of the invention provides a method of treating allergic reactions in a subject which cnmrrices ~lmini.ctering to the subject a theldpeu~ically effective amount of a compound which (a) binds to a human Stat 6 SH2 domain witha binding affinit,v greater than fifty-fold higher than the binding affinity with which 25 the compound binds to a human Stat 5 SH2 domain.
A plcfcllcd aspect of the invention provides a method of treating allergic reactions in a subject which comrrices ~-lminict~ring to the subject a Ll~ldl~e~l ic~lly effective amount of a compound which (a) binds to a human Stat 6 SH2 domain witha binding affinity greater than one hundred-fold higher than the binding affinity with 30 which the compound binds to a human Stat 5 SH2 ~lom~in, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a CA 0222~668 1997-12-23 human p85SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.
A ~lcfelled aspect of the invention provides a method of treating allergic reactions in a subject which comrricçc ~lminictering to the subject a L~eldl,euticz311y effective amount of a compound which (a) binds to a human Stat 6 SH2 domain witha binding affinity greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat S SH2 domain.
The inhibitory activity of compounds at the different human SH2 domains is determined in vitro using SH2 domains expressed as fusion proteins either in E. coli or in baculovirus as further described in detail in F.x~mrle 11 below.
The data shown in the ~co.,.~ hlg Tables 1 and 2 indicate the ability of the stated compounds to antagonize various SH2 domains. Coll~poL~nds intli~te~ as selective Stat 6SH2 domain antagonist from assays as tlPm-mctrated in Example 11are tested in known assays for there ability to treat allergic reactions. ~lc~ll~;d assays inrlucle 1) Carba~ido et al., Int. Arch. Aller~ ~nmunol. 107:(1995)304-307, 2) Pestel et al., J. Tmmnn~1.153:(1994)3804, and 3) KilnhhPrr et al., (1993) Cell. Tmmnnol lS 1: (1993)241-256.
Activity in these assays is recognized in the art as correlating with efficacy in treating allergic re~tionc in vivo. Activity in these assays is also recognized in the art as correlating with efficacy in treating asthma in vivo. Activity in these assays is also recognized in the art as correlating with efficacy in treating allergic asthma in vivo. Activity in these assays is also recognized in the art as correlating withefficacy in treating allergic rhinitis in vivo. Activity in these assays is alsorecognized in the art as correlating with efficacy in treating atopic ~lerrn~titic in vivo.
The present invention therefore provides a method of treating allergic reactions, which comp-ices ~minictering a quantity of a Stat 6SH2 domain CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 antagonists defined as herein in a quantity effective to treat allergic reactions. The drug may be ~-lminict~red to a patient in need of tre~tm~nt for allergies by anycol,venlional route of ~lministration, inehl-ling, but not limited to, intravenous, intr~ml-sclll~r, oral, subcutaneous, intrzlclçrm~l, and parenteral. The quantityS effective to induce immuno~u~ ession is from about 0.001 mg per kg to about 10.0 mg per kg of subject body weight. The selected dose will be an efficacious, nontoxic quantity selected from about 0.001 mg per kg to about 10.0 mg per kg ofsubject body weight. The selected dose will be ~-lminict~red from about 1-6 times daily.
The method of treating allergic reactions disclosed in the present invention may also be earried out using a ph~rm~reutieal eomposition e~ mpri.cin~ a Stat 6 SH2 domain antagonists defined herein and a ph~rm~-eutil~lly aeeeptable earrier. Theculll~o~ilion may eontain beLweel 0.05 mg and 500 mg of a Stat 6 SH2 domain antagonist, and may be eonctih~tecl into any form suitable for the mode of ~-lminictration se-l~ete(l ColllposiLions suitable for oral ~lminictration inelude solid forms, sueh as pills, e~rslll~s, granules, tablets, and powders, and liquid forms, sueh as solutions, syrups, elixers, and sllcpencions. Forms useful for ~iu~,nte.dl z~Aminictration inelude sterile solutions, emulsions, and ~us~ellsions.
The drug may otherwise be prepared as a sterile solid c(jlllposiLion whieh may be dissolved or sllepen~e-l at the time of ~-lminictration using sterile water, saline, or other a~lo~liate sterile injeet~hle m~-linm Carriers are int~n-l~cl to inelude n~eçcc~ry and inert binders, sllcpen-ling agents, lubrieants, fl~v~ L~, sweet~nPnc, ~lcselvdLives, dyes and eoatings.
Optimal dosages to be ~-lminictered may be readily ~ç~e~ ...;nP~l by those 25 skilled in the art, and will vary with the partieular Stat 6 SH2 domain antagonist in use, the strength of the plepdldLion, the mode of ~r1~..in;~l~d~ion, and the advaneement of the disease eondition. Additional faetors depending on the partieular patient being treated will result in a need to adjust dosages, ineluding patient age, weight, diet, and time of ~-lminictration.
The invention also provides for the use of a Stat 6 SH2 domain antagonists in the m~nllf~-ture of a m.o-lit ~m~nt for use in treating allergie reaetions.

CA 0222~668 1997-12-23 The invention also provides for a ph~rm~eut~ col..posilion for use in the tre~tmtont of allergic reactions which comprises a Stat 6 SH2 domain antagonists.
No unacceptable toxicological effects are expected when the methods of the invention are utilized in accordance with the present invention.
Without further elaboration, it is believed that one skilled in the art can, using the prece~1ing description, utilize the present invention to its fullest extent.
The following Examples are, therefore, to be construed as merely illustrative and not a limitation of the scope of the present invention in any way.

E~pe~ tal Details As used herein, unless otherwise in~ t~l, the symbol ~ means ~C.
L-3,5-Dibromotyrosine can be prepared by methods known in the art, for example as described in "Thyoid Hormnn~s and Analogues. I. Synthesis, Physical F~opclLies and Theoretical C~ ti-nc" E. C. Jorgensen, Horrnonal Proteins and Peptides, Vol. VI, 1978, ~ emi-~. Press, N.Y. and lGr~,.cllces cited therein.
L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester (for use in Example 2 (e) and in Fx~mpl~ 2B (b)) can be prepared according to the following pluccdulc.L-3,5-Dibromotyrosine (500 g) was suspended in m.oth~nc~l (5 liters) and dry hydrogen chloride passed through the stirred ~u~ ion for S hours. The reaction mixture was evaporated to dryness, the residue s-lsp~n-le-l in water (4 liters), and the pH adjusted to 6 with 40% sodium hydroxide. The plcci~ildtc was collected and washed with water to give L-3,5-dil~rulllolylosine methyl ester (467 g, 90%), m.p.
201~-203~. The ester (768 g) was sllcpe-n~le~l in chlorofullll (2.7 liters) and ethyl acetate (2.7 liters), then trifluoroacetic anhydride (565 g) was added over 0.5 hour, keeping the telll~ld~ul~ below 35~. The mixture was left overnight, then water (2 liters) was added and the pH adjusted to 7 by the addition of saturated sodium bicarbonate solution. The organic layer was removed, washed with water, dried with anhydrous m~gnl~cium s-llph~t~- and ev~Gldtcd. The residue was recryst~lliced from aqueous m~th~nol to give L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester (786 g, 81 %), m.p. 136~-7~.

W O 97/02023 PCT~US96/11074 Scheme 1 as used in Example 6 below ~C02H ~CO2 Kaiseroxime resin CONHR"
RHN~ J RHN~ J R'COHN~
1: R=H 3: R=Boc 6 2: R=Boc 4: R=H
5: R= COR' The amino group of 4-trans-arnino.llcLhyl-cyclohexyl-carboxylic acid 1 is protected with a standard protective group such as with a Boc group (Boc anhydride, NaOH, H2O, dioxane) to form 2, then is coupled to Kaiser oxime resin (Kaiser, E~T~;
et al J Am Chem Soc 1985, 107, 7087-7092) using a coupling reagent such as DCC
10 to form 3~ The amine is then deprotected under standard conditions (25% TFA, methylene chloride) to form 4, then is acylated with standard conditions (such as with HBTU, NMM in D~F or DCC or DIC in DMF or NMP) to form 5~ The colll~oulld is then cleaved from the resin with various amines to form the finaldesired product 6 Colllpoullds 1 to 10 are plcpaled according to Fx~mrl~s 1 to 10 which follow~

Example 1 Flcpdldlion of 7-rD.L-a-Amino-a-(4-c~lJo~y~hellyl)~ret~mi~ 1-3-r2-(5-methyl-~ 1.3.4-thi~ )lyl)thiomethyll~-cephem-4-carboxylicAcid(Compoundl) HOb~ ~ N;~S~ S

25 a) 4-Hydroxymethylben7~1rlçhyde To a solution of 1,4-ben7~-nç~lir~rboxaldehyde (50~0 g, 0.373 mole) in dry g CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 tetrahy~urul~l (200 mL) under nitrogen in an ice bath was added dropwise lithiumtri(tert-butoxy)~l.. ,.i.. hydride (104.0 g, 0.410 mole) in 500 mL of tetrahydrofuran. After stirring for one half hour in an ice bath, the reaction mixture was poured into 2 L of ice cold 2 N hydrochloric acid. The aqueous solution was S extracted with four 800 mL portions of ether. The combined ether layers were washed with sodium bicarbonate solution, brine and dried. Evaporation of the solvent afforded 46 g of crude material that was purified by chromatography (z~lnmin~ ether elution) to provide the title compound as a crystalline m~t~o.ri~l (17.6 g, 35%): mp 44.546 ~C
b) 5-(4-Hy~u~ylllcLhy~hcllyl)hydantoin To a stirred mixture of 4-hy&u~ylllcLllylbl--n7~lclehyde (10.0 g, 73.5 mmol) and ~mmonillm carbonate (17.1 g, 150 mmol) in 110 mL of 60% aqueous ethanol heated to 50 ~C there was added sodium cyanide (4.0 g, 81 mmol) in 10 mL of water. The mixture was stirred and heated at 50-60 ~C for 3 h and then at 85 ~C for one hour. After cooling in an ice bath, the pH of the solution was adjusted to 6 by addition of concentrated hydrochloric acid. Upon overnight cooling, the solid which had precipit~ed was filtered, washed with water and dried to provide the title compound (11.0 g, 72%): mp 189-196 ~C.

c) 4-Hy~ ylllcLhy~hcllylglycine A mixture of compound of FY~mple l(b) (10.9 g, 53 mmol) and barium hydroxide ocL~lydldle (25.5 g, 81 mmol) in 125 mL of water was stirred under reflux for 18 h. The reaction mixture was cooled and acidificd to pH 1 with 25 concentrated sulfuric acid; the barium sulfate was filtered and the pH of the filtrate brought to 6 with lead c~l.ona~c. After filtration of the lead sulfate, the filtrate was saturated with hy&ogcll sulfide and the lead sulfide filtered. The aqueous solution was then concentrated to 100 mL by azeotluping with ethanol under reduced L/lCS~Ule to provide, after cooling, the title colll~oulld (5.2 g, 54%): mp 230-231 ~C.
d) N-tert-Butoxyc~bullyl4-hydroxymcLlly~ ,.lylglycine To a solution of 4-hyd~o~ylllcLlly~hcllylglycine (8.0 g, 44 mmol) and triethylamine (8.8 g, 87 mmol) in 160 mL of water was added tert-buto~yc~l,ûllylazide (6.95 g, 49 mmol) in 120 mL of tetrally~ùruldul. After stirring overnight at 35 room telllpe~ ulc~ the reaction mixture was washed twice with 200 mL potions of ether. The aqueous layer was covered with ether and ~ci~lified to pH 3-3.5 with 3 N
hydrochloric acid in an ice bath. The acidic solution was extracted with ether and CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 the combined organic extrats washed with brine, dried and evd~vld~cd. The resnltin~
oil was triturated with chloroform-hexane and the solid filtered off to provide the title compound (7.7 g, 63%): mp 139-141.5 ~C.

S ) N-tert-Butoxycalbvllyl4-lly&~v~ylllethyphenylglycine Methyl EsterTo a solution of compound of Example l(e) (5.6 g, 20 mmol) Wds added dimethyl sulfate (3.1 g, 24 mmol) and diisopropyl amine (5.2 g, 40 mmol) in m.oth~nol (10 mL). The mixture was refluxed for 20 min and was then treated with 2 N aqueous hydrochloric acid. The aqueous solutin was extracted with ethyl acetate three times and the combined organic extracts washed with 5% aqueous sodium bicarbonate and brine. Ev~o,dtion of the solvent provided the title compound as an oil (3.2 g, 55%).
f) N-tert-Butoxycarbonyl-4-c~bv~y~hcllylglycine Methyl Ester A solution of the co",~oulld of Example l(e) (0.62 g, 2.1 mmol) in 50 ml of acetone was treated with excess Jones reagent (8N chromic acid) at 25~ C. The reaction llu~LulG was stirred at room tC.ll~cldtulc for 2 hours. The green solid was filtered off and excess CrO3 was decv",poscd by isopropyl ~ ohol The filtrate was dried over anhydrous sodium sulfate and treated with activated charcoal. Solid was fi!te-red off ~nd the f ltrate was eYar. l~tedto rlryness to y:eld 0=38 g of tit e compound as white solid: mp 126-128 ~C.

g) 1,1-DimethylethylN,N'-Bis(1-methylethyl)c~l,s....;...i~1~t.o.
The title compound was ~le~cd by reaction of neat N,N'-diisopropylcarbo-liimi~e (1.0 equiv) with 2-methyl-2-propanol (1.15 equiv) in the presence of CuCl ~0.01 equiv) for 1 day at room lC"~Cldlu~G, according to the procedure of Santini et al. ( J. Org. Chem. 1994, 59, 2261).

h) N-tert-Buto~yc~l~o-lyl-4-(tert-lJulo~yc~bvllyl)phenylglycine Methyl Ester A solution of the cvlll~vulld of Example l(f) (1.0 g, 3.2 mmol) and 1,1-dh~clhylethyl N~N~-bis(l-methylethyl)c~b~ ;mit1~t~ (1.3 mg, 6.5 mmol) of in dry dichloromtoth~n~. was stirred at room telll~ .dlulc over night. Di-isoprv~ylu,ca was filtered off and the excess 1,1-dimethylethyl N,N'-bis(1-methylethyl)c~l,~..;...;rl~te was decomposed with water. Layers were separated and the dichloromf th~nP
solution was washed with 5% aqueous sodium bicarbonate and brine and dried over 35 anhydrous sodium sulfate. Solvent was e~dpoldted off and the residue was treated with diethyl ether. Additional di-isop,u~ylu,ca was filtered off and the organicfiltrate was evaporated to yield the title co",pvulld as an oil (870 mg, 74%).

CA 0222~668 1997-12-23 i) N-tert-Butoxycarbonyl-4-(tert-buLo~ycallJollyl)phenylglycine A solution of the compound of Example l(h) (760 mg, 2.1 mmol) in 18 rnL
of 5% aqueous sodium bicarbonate, 18 mL of 5% aqueous sodium carbonate and 36 mL of methanol was stirred ovenight at room LG111~G1dLU1G for 5 hours. The reaction mixture was diluted with water, washed with ethyl acetate and the aqueous solution was covered with fresh ethyl acetate and acidified to pH 2 with 3N HCl. Layers were separated and the aqueous solution was extraced with ethyl acetate 2 more times. Ethyl acetate solutions were dried over anhydrous sodium sulfate and evaporated to yield title compound as a white solid (600 mg, 82%): mp 77-79 ~C.

j) tert-Butyl 7-Amino-3-[2-(5-methyl-1,3,4-thi~ 7olyl)thiomethyl]~3-cephem-4 carboxylate.
A solution of tert-butyl 7-aminocephalosporanate (ple~ d from 7-aminocephalospo-~,ic acid by reaction with isobutylene and sulfuric acid in 1,2-dimethoxyethane, according to the procedure of Blacklock et al., J. Org. Chem.
1989, 54, 3907), sodium bicarbonate and 2-~ .;~Lo-5-methyl-1,3,4-thi~ 7Ole in phosphate buffer (pH 6.4) is stirred for 6 h at 60 ~C. The reaction llli~Lu~G is worked up by extraction with aqueous hydrochloric acid/ethyl acetate to provide the title co",~ou"d.
k) tert-Butyl 7-tD,L-a-(tert-BuL~l~y-;~l~nylarnino)-a-t4-(tert-buto~ycaLl~llyl)phenyl]]~cet~miclo-3-t2-(S-methyl-1,3,4-thi~ 7.olyl)thiomethyl]~3-cephem-4-carboxylate A mixture of N-tert-lJuL~ ~yc~bollyl-4-(tert-buLo~yc~l ollyl)phenylglycine of Example l(i) (351 mg, 1 mmol), tert-butyl 7-amino-3-t2-(5-methyl-1,3,~
thi~ 7olyl)thiomethyl]A3-cephem 1-carboxylate of F~mple l(j) (368 mg, 1 mmol) and DCC (212 mg, 1 mmol) in dry dichlor~ was stirred at room ~G G~dtUre for 3 hours. The dicyclohe~ylur~a was filtered off and the filtrate was Gv~ JldlGd to dryness. The residue was dissolved in ethyl acetate and the ethyl acetate solution was washed with 5% aqueous sodium bicarbonate, 2.5% sulfuric acid, 5% aqueous sodium bic~L,on~LG, brine and dried over anhydrous sodium sulfate. The solvent was Gv~G,dLGd to yield 0.6 g of crude product. pllrifir~tion by silica gel chromatography (elution with 30:70 ethyl acetate / benzene) provided the title col.. pou,ld (430 mg, 61%): mp 110-112 ~C.

W O 97/02023 PCT~US96/11074 1) 7-[D,L-a-Arnino-a-(4-carbox.y~hG--yl)~ret~mi~10]-3-[2-(S-methyl-1,3,4-thi ~ 7O1yl)thiomethyl]~3-cephem-4-carboxylic Acid A solution of the compound of Example l(k) (400 mg, 0.57 mmol) was stirred in 7.2 mL of trifluoroacetic acid and 0.8 mL of thiophenol. The reaction5 mixture was stirred at 0 ~C for 30 min~ltes and at room te~,lpG.dture for 1 hour. The solvents were Gvd~oldtGd off in a 40~ C water bath and the residue was L i~u,dLed with diethyl ether three times; the solid product was dissolved in small amounts of methanol and the product was precipitated by addition of diethyl ether to afford the title compound (300 mg): mp 170-175 ~C.

Example 2 cydldLion of L-3.5-Dibromo-3'-(6-oxo-3(1H)-pyrid~illyl..lGLl-yl)-lhy.~,nille (Cc,~ ou..d 2) HO ~Br~02H

N~N O
H

(a) o-Metho~y~lle.lyl~.~eto~ . ;le (23.64 g) and 3,6-dichloropyritl~inl-(23.93 g) were dissolved in dry dill.eLl.ylru~ e (50 ml) and sodium hydride 20 (16.23 g of a 50% ~ p~rcion in oil) was slowly added in portions to the stirred solution over 2 hours. The llli~LUlG was poured on to excess crushed ice and G~LIacLed with dichloç~ nP The organic layer was removed and washed with water, dried with anhyd,uus m~n~cillm sulphate, charcoaled and ev~oldLed to dryness. The residue crysf~ eA from dichloio...~ /petroleum spirit to give 1-25 (6-chloro-3-pyridazinyl)-1-(2-methoxyphenyl)-acetoniL ile (35.5 g 85%), m.p~ 91~-- 92~.
(b) This nitrile ~33.5 g) was dissolved in concenL dled hydrochloric acid - (200 ml), acetic acid (100 ml) and water (100 ml) and the solution refluxed with stirring. After 6 hours the solvents were evaporated and the residue recryst~ e-1 CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 from ethyl acetate/petroleum spirit to give 2-(6-oxo-3(1H)-pyridazinylmethyl)-anisole (21.4 g, 77%), m.p. 142~-3~.
(c) This pyridazinone (15.7 g) was dissolved in phosphorous oxychloride (22 ml) and the solution heated with stirring at 55~ (oil bath) for 1 hour. The cooled S mixture was slowly poured onto crushed ice, and extracted with dichlorom~th~n~ .
The organic layer was separated and washed with saturated sodium bicarbonate solution, dried with anhydrous m~gntoei-lm slllrh~te and ev~,.dled. The residue was combined with a smaller batch (from 2.16 g of the pyridazinone) and extracted several times with boiling petroleum spirit (60~-80~). The combined extracts were charcoaled and evaporated to give 2-(6-chloro-3-pyrid~hlylll.~thyl)-anisole (16.95 g, 87%), m.p. 63~.
(d) To a stirred snCpçncion of iodine trictriflllnro~cet~tt- (prepared by tre~tmPnt of iodine (2.54 g) with fuming nitric acid (5 ml) in acetic anhydride and trifluoroacetic acid) in trifluoroacetic anhydride (25 ml) at -15~ was added the above chloropyritl~7in~ (9.39 g) in trifluoroacetic acid (20 ml) and trifluoroacetic anhydride (25 ml), keeping the telllpGldLul~G below -15~. The rl~Ll~LulG was stirred at room tel"~.dLu,G overnight, concenLIdtGd, then a solution of sodium acetate (25 g) and sodium perchlorate (15 g) in water (200 ml) wac added. The l~ Lur~ was extracted with chloroform, the organic solution dried with anhydrous m~gnt~cillmsulphate, then co~-r~ d to 50 ml and poured into stirred ether (250 ml). The precirit~t~ was collected and dried to give crude 4,4'-dimethoxy-3,3'-bis-(6-chloro-3-pyridazinyl-methyl)-diphellyl iodonium perchlorate (14 g). IH NMR ~(DMSO-d6) 3.80 (3H, s, ~CH3), 4.20 (2H, s,--CH2Ar), 7.05 (lH, m, Ar-5~), 7.65 (2H, m, Py~) and 8.00 (2H, m, Ar-2,6H).
(e) The above iodonium salt (12.45 g), L-3,5-dibromo-N-trifluoroacetyl tyrosine methyl ester (8.98 g), triethylamine (4.05 g) and copper bronze (1.0 g) were stirred in dichlc,l~ h~ (50 ml) for 18 hours. The mixture was filtered, washed with aqueous acetic acid, 2N sodium hydroxide, then water, then dried with anhydrous m~ ci~ s-llph~tç and ev~oldted. The residue was combined with a smaller batch (from 0.72 g of the iodonillm salt) and purified by column chromatography on silica gel (400 g). Elution with ethyl acetate/petroleum spirit (60~-80~) [1:3] gave L-3,5-dibromo-3'-(6-chloro-3-pyridazinylmethyl)-O-methyl-N-trifluoroacetyl-l-thyronine methyl ester (4.0 g) as a tan coloured froth. lH NMR~(CDCl3) 3.06 (2H, m, ArCH2CH), 3.84 and 3.93(6H, 2s, ~CH3), 4.19(2H, s, ArCH2Py), 4.75(1H, m, ArCH2CH), 6.62(3H, m, ArH), 7.17(2H, m, Py~) and 7.23(2H, s, ArH).

CA 0222~668 l997-l2-23 W O 97/02023 PCTnUS96/11074 (f) The above dibromo compound (3.27 g) was dissolved in acetic acid (20 ml) cont~ining sodium acetate (0.79 g). The solution was refluxed for 1.25 hours, snfficient water (approximately 2 ml) added to dissolve the precipitated sodium chloride, and the solution evaporated to dryness. The residue was 5 partitioned between water and ethyl acetate, the organic layer removed and washed with saturated sodium bicarbonate, then dried with anhydrous m~gn~cillm sulphateand evaporated to dryness. The residue was cryst~llice~l from ethyl acetate/petroleum spirit (60~-80~) to give L-3,5-dibromo-O-methyl-3'-(6-oxo-3(1H)-pyrida~ yhllethyl)-N-trifluoro-acelylLllylonille methyl ester (2.52 g, 79%), m.p. 176~-8~.
(g) This pyrit1~7.inone (2.45 g) was dissolved in dry dichlorom~ thSlnP (40 ml) and cooled with stirring at 0~. Boron tribromide (6.46 g) in dichloromPth~n~ (3 ml) was added. A red-brown precipitate formed. The mixture was stirred at room telll~eldLule for 1.5 hours, then crushed ice was added. The llli~Lul~ was filtered, the pl~cilJ;L~ c~ cte~ and dissolved in 2N sodium hydroxide (30 ml). The solution was heated on a steam bath for 15 Illilllll~s, acetic acid was then added to pH5, and the Illi~Lule cooled. The reslllting pl'~Ci~iLdL~ was c~llect~l, washed and dried to give L-3,5-dibromo-3'-(6-oxo-3(1H)-pyridazinylmethyl)-Lhylvlline (1.74 g, 88%), m.p. 278~-9~ (dec.).
~lt~rn~tively, instead of using the perchlorate salt plcp~d in (d) for reaction step (e), the iodonium trifluoro~cet~t~ salt can be used which is plG~ ~d as follows:
Iodine (159 g) was s-lcpen~ in trifluoroacetic anhydride (1 liter) and stirred under nitrogen whilst fuming nitric acid (350 ml) was added over 1.5 hours, keeping the telll~eldture belwee~l 36~ and 40~; Trifluoroacetic anhydride (300 ml) was then added and the ~ lule m~int~in--~ at 40~ under a stream of nitrogen until all nitrogen oxides were removed, then allowed to stand at room telllp~ldlul~, overnight. Thesolvent was then removed under reduced pl~,S:iUle and the residual solvent removed by a7eotroping with trifluoroacetic anhydride (2 X 300 ml). The pale yellow residual solid was then sucpPnrl~-~l in trifluoroacetic anhydride (1.2 liters) with 30 stirring and was cooled to -20~. A sollltion of 2-(6-chloro-3-pyridazinylmethyl)anisole (600 g) in triflouoracetic acid (1.2 liters) was then added dropwise, ~ ing the telllp~ldlult bc;L~,en -10~ and -20~. The llli~lUle was stirred at -10~ for 1 hour and at room ttlll~ldture ovçrnight then the solvent removed under reduced pressure and the residue poured into a solution of sodium 35 sulphate (3.5 kg) in water (20 liters) with stirring. The pH of this mixture was ~ adjusted to approximately pH 2 using dilute aqueous sodium hydroxide, then extracted with dichlc lc ~ - -~ n~ (2 X 3 liters, 1 x 2 liters), the organic extracts CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 combined, dried (MgSO,), filtered, and reduced in volume to 2 liters, then added to vigorously stirred diethyl ether (12 liters). The dark grey precipitated solid was filtered off, washed with ether, and dried in a vacuum oven at 40~ for 6 hours to give 4,4'-dimethoxy-3,3'-bis-(6-chloro-3-pyrida~hlyl.llethyl) diphenyl iodonium trifluoro~ et~te (8.14 g, 90%), m.p. 145~-147~.
Further reaction of this salt using procedures analogous to those described in 2(e), (f) and (g) above gives the required L-3,5-dibromo-3'-(6-oxo-3(1H)-pyridazinyl-methyl)thyronine .
Example 2A

cp~dlion of L-3.5-Dibromo-3'-(6-oxo-3(1H)-pyridazinylmethyl)thyronine (C(J~ ulld 2) (a) 2-(6-Chloro-3-pyridazi~lyLIlclllyl)anisole (pl~cd as described in Example 2(c)(2.35 g) was dissolved in dry diChlo~ n~ (20 ml) and cooled with stirring to -50~. Boron tribromide (3 ml) was then added dropwise, and the solution was allowed to warm to room ~el ~ c. After 0.5 hours the orange reaction Illi~Lulc was poured into ice/water (200 ml) and acetone added to dissolve the ~I~,ci~ lcd solid. The ~ lulc was extracted with dichlor m~th~ne, the organic extracts were sepdldled~ washed with water, dried, and cv~oldtcd. The residue was le.,ly~u111icerl from ethyl acetate and petroleum spirit to give 2-(6-chloro-3-pyridazinyllllethyl)-phenol (1.75 g, 80%), m.p. 132~-132.5~. Anal. Found: C, 59.61;
H, 4.13; N, 12.47; Cl, 16.09; CIlH9ClN2O Re.lui Gs. C, 59.87; H, 4.11; N, 12.70; Cl, 16.07%.
(b) To a stirred solution of this phenol (2.4 g) and urea (14 g) in 75%
aqueous sulphuric acid (100 ml) t-butanol (17 ml) was added slowly. The mixture was stirred well and further qll~ntiti~s of t-butanol were added after 4 hours (18 ml), 24 hours (5 ml), and 28 hours (20 ml). After 120 hours the Il~Ll~Lul'G was poured into water, the organic phase sepalaled and discarded and the aqueous phase extractedthoroughly with ether. The colllbi.led ether extracts were washed with saturatedbrine, then dried and GvapoldlGd. The residue was recryst~ e~l from ether and petroleum spirit to give 2,4-di-t-butyl-6-(6-chloro-3-pyridazillyllllGlllyl)phenol (3.43 g, 94%), m.p. 143.0~-143.5~. Anal. Found: C, 68.32; H, 7.51; N, 8.36; Cl, 10.89;C,9H25ClN20. Requires: C, 68.56; H, 7.57; N, 8.41; Cl, 10.65%).
(c) A solution of this phenol (1.95 g), L-3,5-dibromo-N-trifluoroacetyl tyrosine methyl ester (3.24 g) in dietheyl ether (100 ml) was stirred under argon at CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS9~/11074 room telllpcldLur~ and then treated with active m~ng~nese dioxide (3 X 5 g). After 4 hours the mixture was filtered, and tit~nil~m tetrachloride (5 ml) added. After 2 minutes the dark solution was treated with water and extracted well with ethyl acetate. The organic extracts were combined, washed with saturated brine, dried and evaporated. The residue was chromatographed on silica gel with petroleum spirit and ether as eluant to give L-3,5-dibromo-5'-t-butyl-3'-(6-chloro-3-- pyridazinylmethyl)-N-trifluoroacetyl thyronine methyl ester (2.31 g, 55%), m.p. 84~-86~.
(d) A solution of this dibromothyronine (2.76 g) and anhydrous sodium acetate (0.78 g) in acetic acid (25 ml) was heated at reflux for 10 hours, then cooled and poured into ice-water. The precipitated solid was filtered off, dissolved in ethyl acetate, dried, and cv~o-dted to give L-3,5-dibromo-5'-t-butyl-3'-(6-oxo-3(1H)-pyridazinylmethyl)-N-trifluoroacclylLllylonine methyl ester, (2.4 g, 55%), m.p. 112~-115~.
(e) A solution of this pyridazinone (0.200 g) and Hbr (1 ml) in glacial acetic acid (20 ml) was heated at reflux for three days. The solution was then cooled, diluted with water, basified with aqueous 2N sodium hydroxide solution and brought to pH 6 by addition of acetic acid. The plccipildLed solid was filtered,washed, and dried to give L-3,5-dibromo-3'-(6-oxo-3(1H)-pyrid~illyhllethyl)Lllylol~ e (0.100 g, 65%), m.p. 245~-247~ (dec.), spectroscopically identic~l with that previously isolated (Example 2(g)).

Exa~nple 2B

~le~a dlion of L-3.5-Dibromo-3'-(6-oxo-3(1H-pyridazinylmethyl)-thyronine (Col,l~ulld 2) (a) To a solution of iodine tri~trifll oro~et~te (prepared by tre~tmf nt of iodine (10.0 g) with fuming nitric acid (20.95 ml) in acetic anhydride and trifluoroacetic acid) in acetic anhydride (50 ml), cooled to -10~, was added dropwise a solution of 2-metho~yl,cnzyl cyanide (30.0 g) in trifluoroacetic acid (60 ml) and acetic anhydride (30 ml). The te.ll~,.dlulc of the llli~Lulc was m~int~in~d below 0~
during the addition then allowed to stand at room telll~>cldlul~c overnight. ThellliX~UlC was then poured into a well-stirred ice-cold solution of sodium acetate (100 g) and sodium perchlorate (13.0 g) in water (600 ml). The solid which ~iecil~ildted was filtered off, washed with water and diethyl ether to give 3,3'-dicy~nnm~thyl-4,4'-~lim~-th~xy-diphenyl iocloni--m perchlorate as a fine buff solid (23.6 g, 57%), m.p. 183~-4~ (from methanol/diethyl ether).

CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 (b) A solution of this iodonium salt (22.6 g), L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester, triethylamine (6.1 g) in dichloromt th~ne (300 ml) was treated with copper bronze (1 g) and the mixture stirred at room te~ ,ldture for 20 hours. The mixture was then filtered and the filtrate washed with 2N aqueous hydrochloric acid ( 2 X 200 ml), water (2 X 200 ml), and 2N aqueous sodium hydroxide solution (3 X 200 ml), then the organic solution was dried over m~gn~ci~lm sulphate and evaporated under reduced pressure. The oily residue was dissolved in dichlor~ l. r~ (30 ml) and poured into petroleum spirit. A solid precipitated which was filtered off and lcc-y~lallised from dichlorom~th~nlo/petroleum spirit to giv$ L-3,5-dibromo-3'-cyanomethyl-O-methyl-N-trifluoroaceLyllllylunine methyl ester as a colourless crystalline solid, m.p. 148~-149~. The mother liquors were chromatographed on silica gel to give further q~ ntiti.-s of this colllpo~ d (total = 8.05 g, 31%).
(c) To a solution of this dibromothyronine (120 mg) and 3,6-dichloropyri~7ine (31 mg) in dry dimelhylr(~. ."i.. "i~le (2 ml), sodium hydride (30 mg of a 50% suspension in oil) was added and the reaction mixture allowed to stand at room lc,l,l~clalulc for 50 min. It was then treated with ice, and the aqueousmixture e~i-d;led with dichlol~ rl~ , the organic solution washed with saturatedbrine, then dried and ev~oldlcd. The residue was chromatogr~rhP~1 on a ~r,paldlive silica gel clll~ ldl?hy plate from which 3,5-dibromo-3'-(1-(6-chloro-3-pyrida_inyl)-1-cy~n-....~lhyl)-O-methyl-N-trifluoroacclyllllylulline methyl ester (5 mg) was isolated. IH NMR ~i(CDCl3) 3.12 (lH, m), 3.27 (lH, m), 3.79 (3H, s), 3.86 (3H,s),4.86(1H,m),5.80(1H,s),6.72(1H,dd),6.83(1H,d),7.04(1H,d),7.15 (lH, broad m), 7.37 (2H, s), 7.50 (2H, dd).
Elaboration of this int~rm~ f-o by standard methods gives the title cc,ll~poulld.

Exarnple 3 Preparation of 8~8-Ethylenedioxy-2.3.7.8.9.10-hexahyd~o-4-methyl- 1 H-ben~orb~thienor2.3-blpyra7olor3.4-dlpyridin-3-one (Colll~oulld 3) CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 a) Ethyl 2-Cyano-2-(4,4,-ethylenedioxycyclohexylidene)acetate To a llU~lulc of 1,4 cyclohexanedione monoethylene ketal (25 g, 0.160 mol) and ethyl cyano~cet~te (18 g, 0.160 mol) in toluene (400 mL) was added dropwise diethylamine (25 g, 0.337 mol) at room telllp~,ldlulG. The reaction ll~lulc was heated at reflux overnight (using a Dean Stark appa dlus). The mixture was cooled and partitioned with ethyl acetate and saturated aqueous sodium bicarbonate (3x).
The organic extracts were dried over sodium sulfate, filtered, concentrated in vacuo and recryst~lli7e~1 from ethanol to yield the title co~ oulld as an white solid (15.8 g, 45%): mp 80-81 ~C; lH NMR (400 MHz, CDC13) ~ 4.28 (q, J = 7.2 Hz, 2 H), 4.00 (s,4H),3.18(t,J=6.5Hz,2H),2.85(t,J=6.5Hz,2H), 1.89(t,J=6.5Hz,2H), 1.82(t,J=6.5Hz,2H), 1.35(t,J=7.1 Hz,3H).

b) Ethyl 2-Arnino-6,6-ethylenedioxy-4,5,6,7-tetrahydrobenzo[b]thiophene-3-carboxylate To a suspension of colll~oulld of Example 3(a) (10 g, 45.6 mmol), sulfur (1.6 g, 50.2 mmol) in ethanol (164 rnL) at 0 ~C, was added dropwise a solution of diethylamine (3.6 g, 50.2 mmol) in ethanol (26 rnL). The resulting solution stirred at 0 ~C for 1 h, then at room tclnpcldlulc for 3.5 h. The reaction llu~lulc was q~len~h~d with ethyl acetate and partitioned with saturated aqueous ammonium chloride solution. The aqueous phase was extracted with ethyl acetate, and the organic e~d;L~ were washed with brine. The combined organic extracts were dried over sodium sulfate, filtered, conce~ dled in vacuo and chromatographed (silica gel, gradient 5 to 10% CH2C12:EtOAc) to yield the title colll~oulld as an oil (11.3 g, 87%). lH NMR (400 MHz, CDC13) ~ 4.25 (q, J = 7.1 Hz, 2 H), 4.02(s, 4 H), 2.92 (t, J = 6.5 Hz, 2 H), 2.74 (s, 2 H), 1.90 (t, J = 6.6 Hz, 2 H), 1.33 (t, J = 7.1, 3 H).

c) Ethyl 7,7-Ethylenedioxy-4-hydroxy-2-methyl-5,6,7,8-tetrahy&~,bel~o[b]thieno[2,3--b]pyridine-2-carboxylate To a solution of colllpound of F.l~mple 3(b) ( 11.2 g, 39.5 mmol) in toluene (307 mL) at room lclllpeldture was added ethyl 3-etho~ycrotonate (12.4 g, 78.6 CA 0222~668 l997-l2-23 W O 97/02023 PCTnUS96/11074 mmol) and camphorsulfonic acid (0.78 g, 3.4 mmol). The reaction mixture was heated at reflux for 3.5 h using a Dean Stark trap. The mixture was then cooled, and to it was added dropwise a freshly prepared solution of 1 M sodium ethoxide (49 mL). Once the addition was complete the reaction mixture was heated at reflux for 3 5 h. The ~ LLurc was cooled and the precipitate was filtered. The salt was dissolved in m~th~nol (60 mL), to it was added water (500 mL) and acetic acid (2 mL) to yield the title compound as a yellow solid (10.4 g, 76%): mp 94-95 ~C; lH NMR (400 MHz, CDC13) o 4.48 (q, J = 7.1 Hz, 2 H), 4.06(s, 4 H), 3.26 (t, J = 6.5 Hz, 2 H), 3.02 (s, 2 H), 2.81 (s, 3 H), 2.02 (t, J = 6.5, 2 H), 1.47(t, J = 7.1 Hz, 3 H); MS (ESI) m/z 350 [M + H]+; Anal. Calcd. for C17H1gNOsS; C, 58.44; H, 5.48; N, 4.01; Found: C,58.34; H, 5.46; N, 3.86.

d) Ethyl 7,7-Ethylenedioxy-4-tAfluoromethylsulfonyloxy-2-methyl-5,6,7,8-tetrahydl~,bellzo[b]thieno[2,3--b]pyAdine-3-carboxylate To a solution of compo~n-l of Example 3(c) (5.0 g, 14.3 mmol) in pyridine (50 mL) was added dropwise tAflic anhydAde (4.0 g, 14.2 mmol). The reaction mixture stirred at 0 ~C for 4 h until complete. The reaction mixture was washed with aqueous copper sulfate solution (3x) followed by water (2x), and brine (2x).
The organic layer evaporated, dAed over anhydl~us sodium sulfate and concentrated in vacuo. p--rifi~tion by flash chromatography (silica gel, 1:1 hexane: ethyl acetate) yielded the title compound as a light yellow solid (3.7 g, 54%): mp 133-134 ~C; lH
NMR (400 MHz, CDC13) ~ 4.43 (q, J = 7.2 Hz, 2 H), 4.06(s, 4 H), 3.16 (t, J = 6.5Hz, 2 H), 3.10 (s, 2 H), 2.77 (s, 3 H), 2.03 (t, J= 6.8 Hz, 2 H), 1.41 (t, J= 7.1 Hz, 3 H); MS (ESI) rn/z 482 [M + H]+; Anal. Calcd. for Cl8Hl8F3NO7S2; C, 44.90; H, 3.77; N, 2.91; Found: C, 45.03; H, 3.62; N, 2.89.

e) 8,8-Ethylenedioxy-2,3,7,8,9,10-hexahydro-4-methyl- lH-benzo[b]thieno[2,3-b]pyr~olo[3,4-d]wAdin-3-one To a solution of co~ oulld of Example 3(d) (2.4 g, 5.0 mmol) in m.oth~nol (40 mL) at room tclllpcldlulc was added hydr~ine monohydrate (4.1 g, 82.3 mmol).The reaction mixture was heated at reflux for 3 h. The llli~UlC was cooled then partitioned between pH 7 aqueous buffer and ethyl acetate. The organic layer wasdried over anhydrous sodium sulfate, filtered, concellL,dled in vacuo and recyst~lli7e~1 from methanol/ethyl acetate to yield the title compound as a light yellow solid (0.99 g, 60%). lH NMR (400 MHz, d4-MeOH) o 4.05 (s, 4 H), 3.15 (t, J=6.5Hz,2H),3.04(s,2H),2.82(s,3H),2.06(t,J=6.5Hz,2H); MS(ESI)m/z CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 318 [M + H]+; Anal. Calcd. for ClsHl5N3O3SØ25 H2O: C, 55.97; H, 4.85; N, 13.05; Found: C, 55.85; H, 4.75; N, 13.30.

Example 4 Preparation of 4-r4-(4-Methylbenzoyl)benzoyllphenyl~ret~l~l.ohyde ~ (Compound 4) o OHC ~ ~ ~ CH3 a) Methyl 4-(4-methylbenzoyl)~en7o~t.-A solution of methyl terephthaloyl chloride (6.2 g, 31 mmol) in 250 mL oftoluene was treated with ~ minllm chloride (8.0 g, 60 mmol) at 0~C under an argon ~tmosph~re. The stirring llu~lulG was warmed to 35~C for 0.5 h. and then added slowly to 100 g of ice, followed by 150 mL of ethyl acetate, 50 mL of conc. HCl,and 50 mL of water. The phases were sc~ted, and the aqueous portion was extracted twice with 100 mL of ethyl acetate. The combined organic portion~wclG
washed with water (2 x 75 ml) and brine (1 x 75 mL), dried over m~g..~cil.."
sulfate, filtered, and conccllL.d~ed to a white solid. Recryst~11i7~tion from ethyl acetate and hexane afforded 6.0 g (79%) of the title colll~oulld as white n~e~lles mp. 117- 118~C; lH NMR (400 MH_, CDC13) o 8.15 (d, J = 8.35 Hz, 2H), 7.83 (d, J
= 8.30 Hz, 2H), 7.73 (d, J=.8.18 Hz, 2H), 7.31 (d, J= 8.04 Hz, 2H), 3.98 (s, 3H), 2.46 (s, 3H); MS (ESI) m/z 255 (M+H)+.

b) 4-(4-Methylbel~oyl)ben_oic acid A stirring solution of methyl 4-(4-methylbenzoyl)ben7O~te (5.00 g, 20.0 mmol in 150 mL of 2: 1 THF: water at 65~C was treated with lithium hydroxide monohydrate (2.0 g, 48 mmol). After a period of 0.5 h the cloudy re~tion ~ lc was allowed to cool to room ~ClllpCld~UlG and treated with ethyl ~etate (300 mL)and 10% HCl (aq.). The organic phase was sc~alated, washed with water (2 x 50 mL) and brine (1 x 50 mL), dried over m~gn~sillm sulfate, filtered, and concc~ dlcd to a white foam. lH NMR (400 MHz, CDCl3) ~ 8.22(d, J = 8.34 Hz, 2H), 7.81 (d, J
= 8.31 Hz, 2H), 7.73 (d, J=.8.15 Hz, 2H), 7.31 (d, J= 8.00 Hz, 2H), 2.46 (s, 3H).

CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 c) 4-[4-(4-Methylbenzoyl)benzoyl]anisole A solution of compound of Example 4(b) in 250 rnL of toluene was treated with oxalyl chloride (21.8 g, 0.17 mol). The resulting mixture was heated to reflux 5 for 2 h, then concentrated and allowed to stand overnight at 0.5 mm Hg and 25~C.
This solid was then dissolved in 100 mL of anisole and treated with ~ min~lm chloride (11.2 g, 84 mmol) at 0~C. The mixture was heated to 70~C for 1 h and then added slowly to 100 g of ice, followed by 150 mL of ethyl acetate, 50 mL of conc.
HCl, and 50 mL of water. The phases were separated and the aqueous portion was 10 extracted with 100 mL of ethyl acetate. The combined organic extracts were washed with water (2 x 75 mL) and brine (1 x 75 mL), dried over m~gn.~ m sulfate, filtered, and concentrated to a white solid. Recryst~11i7~tinn from ethyl acetate and hexane yielded 4.6 g (70%) of the title compound. mp. 167-169~C; IH NMR (400 MHz, CDC13) ~ .7.8-7.9 (m, 6H), 7.77 (d, J= 8.06 Hz, 2H), 7.32 (d, J= 8.01 Hz, 2H), 7.0 (d, J = 8.74 Hz, 2H), 3.92 (s, 3H), 2.47 (s, 3H); MS (ESI) m/z 331 (M+H)+.

d) 4-[4-(4-Methylbenzoyl)benzoyl]phenol A solution of co~ ollnd of Example 4(c) (700 mg, 2.12 mmol) in 20 mL of dichlor .. ~LI.~ne was treated with ~11.. ;.. " chloride (1.0 g, 7.5 mmol) and 7.0 mL
20 of 1.0 M boron trichloride solution in dichlolu~Li.~n~ and heated to reflux for 1 h.
The l~ Lulc was then diluted with 100 mL of dichlol~lllp~ nlo and washed with 10% HCI (aq) (1 x 25 mL), water (1 x 25 mT.), and brine (1 x 25 mL). The organicphase was dried over m~ --- sulfate, filtered, and concentrated to a dark residue which was subjected to flash chromatography (silica gel, elution with 1: 1 ethylacetate: hexane) to yield 550 mg (82%) of the title col~lpound. IH NMR (400 MHz,CDC13) o .7.8-7.9 (m, 6H), 7.77 (d, J = 8.05 Hz, 2H), 7.32 (d, J = 8.01 Hz, 2H), 6.93 (d, J = 8.6 Hz, 2H), 2.47 (s, 3H).

e) 4-[4-(4-Methylbenzoyl)benzuyl]phenyl trifluo,u",cLhylsulfonate A solution of compound of Fx~mple 4(d) (320 mg, 1.0 mmol) in THF (20 mL) was treated with sodium hydride (40 mg, 1.67 mmol) and N-phellylLLinuolull.~ A.~ Ilf )nimi~le (500 mg, 1.40 mmol) at 0 ~C. The reaction mixture was allowed to warm up to room te",~e,dLurc and was then stirred for 18 h.
room L~",pclature. The reaction was then partitioned between ethyl acetate and brine; layers were sep~r~t~l and the organic extract was dried over m~gn.o~ m sulfate and e~/d~uldLcd. Purificati~n by flash chrom~tc gr~phy (silica gel, 80:20 hexane: ethyl acetate) afforded the title compound (300 mg, 66%). mp. 180-CA 0222~668 l997-l2-23 W O 97102023 PCT~US96/11074 181~C; lH NMR (400 MHz, CDC13) 8 7.96 (d, J= 8.6 Hz, 2 H), 7.89 (s, 4 H), 7.76 (d,J=8.1Hz,2H),7.45(d,J=8.6Hz,2H),7.33(d,J=8.1Hz,2H),2.47(s,3 H).

S f) 4-[4-(4-Methylbenzoyl)benzoyl]phenyl~ et~ Phyde To a solution of compound of Example 4(e) (445 mg, 1.0 mmol) in DMF (10 mL) was added allyltributyltin (0.35 mL, 1.12 mmol), bis(triphenylphosphine)p~ m(II) chloride (55 mg, 0.077 mmol) and lithium chlori(1e (125 mg, 2.95 mmol). The reaction mixture was heated to 90 ~C for 1 h, and then allowed to cool to room telllpeldlul~ before being partitioned between ethyl acetate and brine. The organic layer was dried over m~gnPci~lm sulfate and concentrated to a residue co~ ting of the desired product, 3-[4-[4-(4-methylbenzoyl)benzoyl]phenyl]-1-yrû~lle~ and tin-cont~ by-products. This m~tPri~l was subjected to flash chromatography (silica gel, elution with 95:5 hexane : ethyl acetate) which removed most, but not all, of the tin illl~u~ilies. A second chromatography (gradient 5% to 10% ethyl acetate in hexane) yielded 100 mg (30%)of clean olefin, which was then dissolved in dichlo.u~ nP/methanol (3: 1, 16 ml)at -78 ~C. Ozone was bubbled through this solution for 5 min. The reaction was qUpnr~hp~l with five Lrops of dimethyl sulfde and stirring continllPrl for 30 min at -78 ~C. The solvent was ev~L)c"ated and the res~llting m~tPri~l purified by flash cl"~ &lography (silica gel, elution with gradient 85:15 to 75:25 hexane: ethyl acetate) to yield the title co"~pou,ld (40 mg, 40%). mp. 188-190~C; IH NMR (400 MHz, CDCl3) 8 9.83 (s, 1 H), 7.88 (s, 4 H), 7.86 (d, J = 8.1 Hz, 2 H), 4.03 (s, 4 H), 3.73(s,3H),3.76(t,J=6.0Hz,2H),3.00(s,2H),2.80(s,3H),2.03(t,J=6.0 Hz, 2 H); MS (ESI) m/z 343 (M+H)+.

Example S

Pr~dLion of 1.4-Dimethyl-8.8-ethylenedioxy-2.3.7.8.9.10-hexahydro-lH-benzorblthienor2.3-blpyrazolor3.4-dlpyddin-3-one (Colllyuul~d 5) H3C~ r ~CH

CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 1,4-Dimethyl-8,8-ethylenedioxy-2,3,7,8,9,10-hexahydro-lH-benzo[b]thieno[2,3-b]pyrazolo[3,4-d]pyridin-3-one A solution of compound of Example 3(d) (0.4 g, 0.83 mmol) in methanol (6.7 mL) at room telllp~ld~ulG was treated with methylhydrazine (0.16 g, 3.45 mmol) and the mixture is heated at reflux for 2 h. The mixture was cooled and the precipitate, cont~ining 150 mg of the 2,4-dimethyl regioisomer, filtered. The filtrate was evaporatewd and purified by flash chromatography (silica gel, elution with 80:20:5 ethyl acetate m.-th~nol:acetic acid) to provide the title compound as a yellow solid (22 mg). IH NMR (400 MHz, CDC13) ~ 4.03 (s, 4 H), 3.73 (s, 3 H), 3.76 (t, J
= 6.0 Hz, 2 H), 3.00 (s, 2 H), 2.80 (s, 3 H), 2.03 (t, J = 6.0 Hz, 2 H); MS (ESI) m/z 332 (M+H)+.

Ex~rnple 6 ~IGp~aLion of 4-carboxy-benzophenone4-carboxamido-trans-4-methyl-cyclohexyl-N-hexyl carboxamide (Compound 6) HO2C ~ ~HN--~ ' H~

a) N-t-butyloxy c~bullyl-trans-4-~minom~-thyl cyclohexyl carboxylic acid Aqueous sodium hydroxide (lN, 100 rnl, 100 mmol) was added to a solution of 4-trans-~minnm~-thyl-cyclohexyl-carboxylic acid (9.0g, 60 mmol), in dioxane (100 ml), water (100 ml) at 0 degrees C. Boc anhydride (15.9 g, 66 mmol) was added and the reaction was warmed to rt and stirred overnight. The solution was concenL~dted to 50 ml, then was diluted with EtOAc (100 ml) and ~ ifi~(l to pH 2with adqueous KHSO4 (lN). The organic layer was then extracted with water (100 ml) two times, and the organics were concentrated in vacuo. The solid was ,ly~ li7ecl from EtOAc/ h-oY~nPs to yield 9.2g + 3.4g (second crop) of a white solid. (80% yield). MS (ES) m/e 242 [M+H]'.
b) N-t-butyloxy carbonyl-trans4-aminolllGlhyl cyclohexyl (Kaiser oxime resin) c~bo~ylate Kaiser oxime resin (20 g, 0.7 mmol/g loading, Advanced Chem Tech) was added to a solution of N-t-butyloxy carbonyl-trans4-aminomethyl cyclohexyl CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 carboxylic acid (5.0 g, 20 mmol) and DCC (4.4 g, 20 mmol) in methylene chloride (200 ml) and was gentle mixed at rt overnight. The solid was filtered and collected, then washed with methylene chloride (5 x 100 ml). Then the resin was resuspendedin methylene chloride (200 ml), and N-t-butyloxy carbonyl-trans-4-aminomethyl - 5 cyclohexyl carboxylic acid (5.0 g, 20 mmol) and DCC (4.4 g, 20 mmol) were added and the reaction was gently mixed overnight at rt. The solid was filtered and collected, then washed with methylene chloride (5 x 100 ml), then was dried overnight under vacuum. IR (KBr, cm~')=1820, 1771, 1520.

c) trans4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate N-t-butyloxy c~l,ullyl-trans-4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate (20 g) was sllsperllle~l in methylene chloride (100 ml) and TFA (25 ml) was added. The reaction was gently mixed for 0.5 h, then the solid was filtered and collected, then was washed with with methylene chloride (5 x 100 ml), then was dried overnight under Vd~;UUlll. IR (KBr, cm~')=3150, 1770, 1526 d) 4-carboxy-bell~ophellolle-4-carboxamido-trans-4-methyl-cyclohexyl-(Kaiser oxime resin) c~l,o~ylate Trans-4-aminolllc;lllyl cyclohexyl (Kaiser oxime resin) carboxylate (200 mg) 20 was suspended in DMF (3.0 ml) and N-methyl morpholine (0.2 ml) and 4, 4'-b~nzu~henone dic~l,o~ylic acid (190 mg, 0.7 mmol) and HBTU (265 rng, 0.7 mmol) was added and the reaction was gently mixed for 3 h. The solid was filtered and collected, then was washed with with DMF (3 x 20 ml), then water (3 x 20 ml), then was l~;~u~ellded in DMF (3.0 n~l) and N-methyl morpholine (0.1 ml) and 4,4'-25 benzophe,lone dicarboxylic acid (0.35 mmol) and HBTU (0.35 mmol) was added and the reaction was gently mixed for 3 h. The solid was filtered and collected, then was washed with with DMF (3 x 20 ml), then water (3 x 20 ml), then methylene chloride (5 x 20 ml), then was dried under vacuum.

30 e) 4-carboxy-benzo~hellone-4-carboxamido-trans-4-methyl-cyclohexyl-N-hexyl carb-~x~mi~l~
4-carboxy-~nzophe,lune-4-carboY~mi~1o-trans-4-methyl-cyclohexyl-(Kaiser oxime resin) carboxylate (200 mg) was suspended in methylene chloride (3.0 ml) and hexyl amine (0.3 mmol) was added. The reaction was gently mixed for 3 h then35 was filtered, and the filtrate was collce"lldted in vacuo to yield the title colllpoulld:
MS (ES) m/e 493 [M+H]'.

Example 7 ion of 4-nitro-ben7~miclQ-trans-4-methyl-cyclohexyl-N-hexyl carboxamide (Compound 7) O~N~

S O

4-nitro-bçn~mic1n-trans4-methyl-cyclohexyl-N-hexyl carboxamide Following the procedure of Example 6(a)-(e), except sub:,Li~uLing 4-nitro benzoic acid for and 4, 4'-benzophenone dicarboxylic acid, the title colllpoulld was 10prepared: MS (ES) m/e 390 tM+H]'.

Ex~mple 8 PlGyaldtion of 4-~et~mi~lQ-benzamido-trans4-methyl-cyclohexyl-N-l-(amino-R-2-(methoxy methyl)-pyrrolidine) carboxamide (Colllpoulld 8) Me~N~ N,N~2 Following the procedure of F~mple 6(a)-(e), except snh~ g 4-~cet~mi-lo- benzoic acid for and 4, 4'-bellzo~henone dic~l~o~ylic acid and R-l-20amino-2-(methoxy methyl)- pyrrolidine (RAMP) for hexyl amine, the title colll~u~ld was prepared: MS (ES) m/e 331 [M+H]'.

Example 9 E~c~Lion of 4-formyl-E-cinn~mic1O-trans4-methyl-cyclohexyl-N-(propyl) 25carboxamide (Compound 9) OHC~ N O~ P~N~

Following the procedure of F.Y~mple 6(a)-(e), except ~I,slil~ g 4-formyl -CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 cinn~mic acid for and 4, 4'-benzophenone dicarboxylic acid and propyl amine for hexyl amine, the title compound was prepared: MS (ES) m/e 357 [M+H]+.

Example 10 Preparation of 2~3.7.8.9.10-Hexahydro-4-methyl-lH-benzo~blthienor2.3-blpyrazolor3~4-dlpyridin-3-one (Co~ ound 10) ~0 a) Ethyl 4-Hy&~o~y-2-methyl-5,6,7,8-tetrahydrobenzo[b]thienot2,3--b]pyridine-2-carboxylate A solution of ethyl 2-amino-4,5,6,7-tetrahydrobenzo[b]thiophene-3-carboxylate (8.9 g, 39 mmol) and ethyl 3-etho~ycrotol-alc (12.4 g, 78 mmol) in toluene (300 rnL) was treated with c~.. phol~lfonic acid (0.78 g, 3.4 mmol) and the reaction mixture was heated at reflux for 3 h using a Dean Stark trap. The llli~Lulc was then cooled to room lClll~CldlUlC and was subsequently treatedwith a freshly pl~cpalcd 1 M solution of sodium ethoxide (48 mL, 48 mmol). After ~ itic)n was complete the reaction llli~-tUlC was heated at reflux for 3 h. The llli;~lUl'C was cooled, 20 conce"L dted and the residue dissolved in ethyl acetate. Acetic acid (2 mL) was added, solvent cv~oldled and resulting solid l ilu dted with m-oth~nol to yield the title cc,lll~uund as an off-white solid (8.4 g, 74%): mp 140 ~C; IH NMR (400 MHz, CDC13) ~ 4.48 (q, J = 7.2 Hz, 2 H), 3.04 (br s, 2 H), 2.81 (s, 3 H), 2.80 (br s, 2 H), 1.87 (br s, 4 H), 1.47 (t, J = 7.2 Hz, 3 H);; Anal. Calcd. for C15Hl7NO3S: C, 61.83;

25 H, 5.88; N, 4.81; Found: C, 61.69; H, 5.81; N, 4.73.

b) Ethyl 4-Chloro-2-methyl-5,6,7,8-tetrahydrobenzotb]thienot2,3--b]pyridine-2-carboxylate A solution of compound of F~mrle lO(a) (8.0 g, 27.4 mmol) in phosphorus 30 oxychloride (100 mL) was refluxed for 3.5 hours. The phnsphorus oxychloride was removed under vacuum and the residual oil was dissolved in ethyl acetate, washed - with 5% aqueous sodium bicarbonate and dried over anhydrous sodium sulfate.

Evaporation of the solvent provided the title compound as a crystalline solid (8.5 g, CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 95%): mp 65-66 ~C; IH NMR (400 MHz, CDC13) o 4.47 (q, J = 7.1 Hz, 2 H), 3.10 (br s, 2 H), 2.85 (brs, 2 H), 2.60 (s, 3 H), 1.89 (br s, 4 H), 1.43 (t, J= 7.1 Hz, 3 H);
Anal. Calcd. for C15H16ClNO2SØ125 H2O: C, 57.73; H, 5.25; N, 4.49; Found: C, 57.69; H, 5.08; N, 4.30.

c) 2,3,7,8,9,10-Hexahydro-4-methyl-lH-benzotb]thieno[2,3-b]pyrazolo[3,4-d]pyridin-3-one A solution of compound of Example 10(b) (2.0 g, 6.4 mmol) in methanol (50 ml) was treated with hydrazine monohydrate (10 mL) and the resulting mixture was heated at re~ux for 16 h. The reaction was poured over diluted aqueous hydrochloric acid and the title compound precipitated as a yellow solid (1.8 g). lH NMR (400 MHz, d4-MeOH) o 3.01 (br s, 2 H), 3.00 (s, 3 H), 2.92 (br s, 2 H), 2.00 (br s, 4 H); Anal. Calcd. for C13H13N3OS.HClØ25 H2O: C, 52.00; H, 4.87; N, 13.99; Found: C, 51.92; H, 5.01; N, 13.70.

Example l l-Protocol for the Determination of Activity of C~ ounds at Human SH2 Domains The activity of co~ oullds at the dirrGIGnt human SH2 domains is cletermine~l in vitro using SH2 domains expressed as fusion proteins either in E çoli or baculovirus. The SH2 ~om~inc used herein were the human forms of the Stat 6 SH2 domain, src SH2 domain, Grb2 SH2 clom~in, lck SH2 ~iom~in, Stat 5 SH2 domain, fyn SH2 domain, SH-PTP2 SH2 ~iom~in, p85 SH2 domain and hcp SH2 domain.
The fusion ~l~.tehls cont~inin~ the src, Stat 6,1ck, Stat S and hcp SH2 domains were e~p,essed as the general sequence: DETl-DET2-spacer-ek-SH2, where DETl, DET2, spacer, ek and SH2 are as described below. DETl ("defined epitope tag 1") (SEQ ID NO: 1) is an 11 amino acid sequence found in the Human Tmmnn~ Pfi-~iPn-y Virus Type 1 (HIV-l) envelope protein gpl20 (or gpl60).
Monoclonal antibodies to various epitopes of HIV-l gpl20 (or gpl60) are known inthe art, see, for example U.S. Patent 5,166,050. One plcr~llcd example is monoclonal antibody 178.1 (see, e.g., Thiriart et al., J. knmunol.. 143: 1832- 1836 (1989)), which was prepared by i,.,,,,l.,,;~tion of mice with a yeast-expressed HIV-l gpl60 molecule from strain BH10 (Ratner et al., Nature, 313:277-284 (1985)). This CA 0222~668 1997-12-23 W O 97/02023 PCTrUS96/11074 tag was used for detection of expression (by Western blot), for pnrific ~tion of the protein (by affinity chromatography), and for configuring assays in which the fusion protein is captured or immobilized using the 178.1 antibody. DET2 is a hexa-hi~ti~line sequence tag (SEQ ID NO: 2) which binds to nickel-co~ -g resins and was used for purification purposes. Spacer (SEQ ID NO: 3) was utilized to design a BamHl restriction site at the intli~terl position of the construct. The term -ek-refers to a recognition sequence (SEQ ID NO: 4) for the enterokinase protease which provides for the optional removal of the tags from the SH2 domain, thus producing an SH2 domain that contains no extraneous amino acids. SH2 domains which contain no extraneous amino acids are preferable to tagged protein for crystallography studies. SH2 refers to the SH2 domains of dirrele.lt proteins.
The DNA sequence encoding each DETl-DET2-spacer-ek-SH2 was decign~d such that the in-lic~t~d restriction sites (BamH1 and XbaI) flank the spacer-ek-SH2 region, thereby allowing difr~l~;nt spacer-ek-SH2 contructs to be readily~ .led into any one of the vectors described in Procedures 2, 3, 5 or 6 below tocreate a DET 1 -DET2-spacer-ek-SH2 tagged protein. The DNA sequence encoding each DETl-DET2-spacer-ek-SH2 construct was also decign~rl such that the entire tagged SH2 domain can be moved as an NdeI-XbaI fragment into any expression vector conli-;--i--g an NdeI site at an a~p~ iate ~ re dow~l~L~ of E. coli or baculovirus transcription and translation regulatory sequences and a do~,vl-sL,.,alll cloning site colllpalible with XbaI. Although any suitable vector would yield similar results (e.g., pET-l la; Novagen, Inc.), the vector used in the instant eA~e.illl~nts are the E. coli expression vector pEAlKnRBS3. This vector is a derivative ~f the series of vectors described in Sh~t7m~n, A, Gross, M, and Rosenberg, M, 1990, "Expression using vectors with phage lambda regulatory sequences", In: Current Protocols in M()l~c~ r Biology (F.A. Ausubel et al, eds.), pp. 16.3.1-16.3.11, Greene Publishing and Wiley-Interscience, N.Y. (hereinafter F.A. Ausubel et al.).
The specific vector pEAlKnRBS3 is tl.osrrihecl in Bergsma et al, 1991, J. Biol.
Chem. 266:23204-23214.
The procedures below describe the expression of chicken src, human src, human Stat 6, human lck, human Stat 5 and human hcp SH2 domains. First, the CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 chicken src SH2 domain was expressed as DETl-DET2-spacer-SH2. Then, the others were inserted into this vector in place of chicken src to express proteins in the form DETl-DET2-spacer-ek-spacer-SH2 as described in procedures 1 to 6 below.

5 Procedure 1: Cloning and Expression of chicken src SH2 domain contzlining tags DETl and DET2 (DETl-DET2-spacer-SH2).
A DNA sequence encoding the tagged protein DETl-DET2-spacer-SH2 was PCR ~mplified from a cDNA clone cont~ining the chicken src gene (p5H; Levy et al1986. Proc. Natl. Acad. Sci. USA 83:4228) by methods well known to those skilled10 in the art by using the following primers:

TTCCATATGAAAAGTATTCGTATTCAGCGTGGCCCGGGCCGTCACCACCA
CCACCACCACGGGATCCCCGCTGAAGAGTGGTACTTT 3' (SEQ ID NO: 17) The un~1Prlin~ sites are an NdeI recognition site (5') and a BamHI
recognition site (3').

5' GGAATTCTAGATTACTAGGACGTGGGGCAGACGTT 3' (SE~2 ID NO: 18) The un-l~rlin~cl region is an XbaI recognition site.
The PCR product was digested with NdeI and XbaI, followed by isolation of the digested fr~gment on an agarose gel. The fragment was ligated into NdeI-XbaI-digested pEAlKnRBS3 vector (Bergsma et al, supra) that had been agarose gel 25 purified as a 6.5 kbp fr~gm~ont The ligation reaction was used to transform E coli MM294cI+ (F.A. Ausubel et al., supra). A pl~cmid cont~ining an insertion of the correct fragment was identifi~l and col, l i . " .~1 by DNA seqll~n~ing The res--lt~nt plasmid encodes DETl-DET2-spacer-SH2 under the control of the phage lamda PL
promoter and regulatory system. Plasmid DNA was purified from MM294cI+ and 30 used to transform E coli strain AR120. In this host strain, expression of the phage promoter can be in~l~lce-l by addition of nalidixic acid to the growing culture as CA 0222~668 l997-l2-23 W O 97/02023 P ~ ~US96/11074 described in F.A. Ausubel et al, supra. Nalidixic acid induction of AR120 col-t~ i ng this pl~cmi~, followed by analysis of the cellular proteins on an SDS-polyacrylamide gel stained with Coomassie Blue (F.A. Ausubel et al., supra), resulted in appealdl ce of a protein band with an ~L~'ellL molecular weight of 15,000; this band was not seen in nnin~ ecl cells or in induce~l cells cont:~ining pEAlKnRBS3 lacking the PCR ~mplified fr~gmPnt Western blotting confirmt~cl that the incluce-l protein band reacted with the anti-DET1 monoclonal antibody 178.1.

Procedure 2: Cloning, expression and pllrific~tion of human src SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-src SH2).
A DNA sequence encoding protein ek-src SH2 was PCR amplified from a cDNA clone cont~inin~ the human src gene (c-src SH2 DNA sequence i(lentic~l to that described in Takeya,T. and Hanafusa, H, 1983 Cell 32:881-890) using the following primers:

5' CGGGATCCTGGACGACGACGACAAAGCTGAGGAGTGGTATTTT 3' (SEQ ID NO: 19) The llnt1erlinPrl site is a BamHI recognition site.

5' GGAATTCTAGACTATTAGGACGTGGGGCACACGGT 3' (SEQ ID NO: 20) The lln-lerlin~ region is an XbaI recognition site.

The PCR product was digested with BamHI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~ining the tagged çhisk~n src gene DET1-30 DET2-spacer-SH2 described in Procedure 1 above. In that vector, the BamHI site is located between the coding regions for DET2 and SH2, and the XbaI site is located CA 02225668 l997-l2-23 W O 97/02023 PCT~US96/11074 after the 3' end of the SH2 coding region. The ligation reaction was used to transform E. coli MM294cI+. The construct DET1-DET2-spacer-ek-src SH2 was confirm~d by DNA sequencing (SEQ ID NO: 5) and indllced in E. coli strain AR120 as described in Procedure 1 above. A Coom~ccie-Blue-stained, Western-blot-S positive in~ ced protein band with an apparent molecular weight of 16,000 wasobserved after n~lidixic acid induction.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni++NTA
column. After washing the colurnn with equilibration buffer (Tris buffer pH 8 10 cnnt~ining 0.5 M NaCl) and the same buffer cont~ining 15 mM imidazole, the protein was eluted in highly purified form with 25 mM imidazole in equilibrationbuffer. The SH2 dom~in, purified in this fashion, was found to bind with high affinity in a specific, saturable fashion to the a~plo~liate pY peptide in the "Binding Assays" described below, ~eml~ncfrating that the tag did not i ltelr~,.c with function.
15 This expressed fusion protein, DET1-DET2-spacer-ek-src SH2, was utilized in the "Binding Assays" clP-s~ribe~l below in order to d~te~ the ~pecificity of compounds to selectively inhibit the human src SH2 domain.

Procedure 3: Cloning and e~ ;,sion of human lck SH2 domain c~ g tags and 20 an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-lck SH2).
A DNA sequence encoding protein ek-lck SH2 was PCR ~mplifi~d from a cDNA clone cnnf~inin~ the human lck gene (Genbank accession number M36881) using the following ~

25 5' CGGGATCCTGGACGACGACGACAAAGAGCCCGAACCCTGGTT~l:l 3' (SEQ ID NO: 21) The lln~.orlinecl site is a BamHI recognition site.

30 5' GCTCTAGACTATTACTGGGGCTTCTGGGTCTG 3' (SEQ ID NO: 22) CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 The lln-lerlinlod region is an XbaI recognition site.
The PCR product was digested with BamHI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~ining the tagged chicken src gene DETl-5 DET2-spacer-SH2 described in Procedure 1 above. In that vector, the BamHI site is located in between the coding regions for DET2 and SH2, and the XbaI site is located after the 3' end of the SH2 coding region. The ligation reaction was used to transform E. coli MM294cI'. The construct cont~ining DETl-DET2-spacer-ek-lck SH2 was confirmed by DNA sequencing (SEQ ID NO: 6) and in~ çed in E. ~
10 strain AR120 as described in Procedure 1 above. A Coomassie-Blue-st~inf~rl.
Western-blot-positive int1~1cecl protein band with an ~pare.lt molecular weight of 17,000 was observed after n~ ixic acid induction.
Cells were lysed at neutral pH by sonication in the piesallce of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~NTA
15 column. After washing the column with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCl) and the same buffer c~ i.li..g 15 mM imi~701~,, the protein was eluted in highly purified form with 25 mM imidazole in equilibrationbuffer. The SH2 domain, purified in this fashion, was found to bind with high affinity in a specifir, saturable fashion to the a~lupliate pY peptide in the "Binding 20 Assays" described below, ~lÇmol~ dlillg that the tag did not interfere with function.
This expressed fusion protein, DETl-DET2-spacer-ek-lck SH2, was utilized in the "Binding Assays" dçsçrihed below in order to dçtçrmine the specificity of compounds to selectively inhibit the human lck SH2 domain.

25 Procedure 4: Cloning and expression of human hcp SH2 domain col.l~i..i.-~ tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-hcp SH2).
A DNA sequence encoding protein ek-hcp SH2 (hcp SH2 DNA sequence identical to that described in Shen, S-H. Nature (1991) 352: 736-739) was reverse transcriptase-PCR amplified from human fetal liver RNA. RNA isolation used Tri-30 Reagent (Molecular Research Center Inc.) and the Reverse Transcriptase system- (GIBCO-BRL) according to the mz~nllf~rture's instructions. PCR was carried out CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 using the following primers:

5' GAAGATCTTGGACGACGACGACAAATCCCGTGGGTGGTTTCAC
3'(SEQ ID NO: 23) s The nn~lerlin~l site is a BglII recognition site.

5' GCTCTAGACTATTAACTAGTGGGATCGGAGCA 3' (SEQ ID NO: 24) The Im-lerlin-od region is an XbaI recognition site.
The PCR product was digested with BglII and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~inin~ the tagged human src gene DETl-DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the 15 BamHI site is located in between the coding regions for DET2 and ek, and the XbaI
site is located after the 3' end of the SH2 coding region. Thus, the ek-hcp SH2 sequence replaced the ek-src SH2 sequence in the above vector. The ligation reaction was used to transforrn 1~. coli MM294cI'. The construct cnnt~inin~ DETl-DET2-spacer-ek-hcp SH2 was confirmed by DNA seql~Pncin~ (SEQ ID NO: 7) and 20 used to transforrn E. coli GI698 (Invitrogen Corporation, San Diego, CA). Induction of the phage lambda promoter was in~l~lcecl by addition of L.y~to~hall to the culture m~ lm to 10 mg/ml, per the m~nllfa~tllre's instructions. A Co~-m~csie-Blue-stained, Western-blot-positive induced protein band with an apparent moleculzlr weight of 15,000 was observed after tly~lophan induction of cells growing at 30~ C.
Cells were lysed at neutral pH by sonication in the presance of ly~ozyllle.
After centrifugation, the insoluble pellet was solllbili7e~ with 8 M urea in Tris buffer pH 8 and bound onto a Ni~NTA column. The resin was washed with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCl, 8 M urea and 5 mM BME) and the same buffer cont~inin~ 15 mM imiA~7O1e. The protein was refolded on the column during the removal of urea in the presence of 5 mM BME and the purified refoldedprotein eluted with 300 mM imi~l~7O1e in Tris buffer pH 8. The SH2 domain, CA 0222~668 l997-l2-23 purified in this fashion, was found to bind with high affinity in a specific, saturable fashion to the ap~-opiiate pY peptide in the "Binding Assays" described below, demonstrating that the tag did not interfere with function and that the protein was refolded suçcec~fully. This expressed fusion protein, DET1-DET2-spacer-ek-hcp 5 SH2, was utilized in the "Binding Assays" described below in order to ~i~terTnine the ~ specificity of compounds to selectively inhibit the human hcp SH2 domain.

Procedure 5: Cloning, expression and purific~tion of human Stat 6 SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DETl-DET2-spacer-10 ek-Stat 6 SH2).
A DNA sequence encoding protein ek-Stat 6-SH2 was PCR amplified from a cDNA clone cont~ining the human Stat 6 gene (Stat 6 SH2 DNA sequence identical to that described in Science 265, (1994) 1701) using the following prim.-rc 15 5' CGGGATCCTGGACGACGACGACAAACTCCGGAGCTAC-3' (SEQ ID NO:
27) The un~lerlinp~l site is a BamHI recognition site.

20 5' GGAATTCTAGACTACTTGATGGTAGC-3' (SEQ ID NO: 28) The underlined region is an XbaI recognition site.

The PCR product was tiig~st~ with BamHI and XbaI, followed by isolation 25 of the tli~este~l fragment on an agarose gel. The fragment was ligated with the vector fragment derived from BamHI-XbaI digestion of the eA~.cssion vector cont~ining the tagged human src gene DET1-DET2-spacer-ek-src SH2 clesçriheri in Procedure 2 above. In that vector, the BamHI site is located between the coding regions for DET2 and SH2, and the XbaI site is located after the 3' end of the SH2 30 coding region. The ligation reaction was used to transform E. coli MM294cI+. The construct DET1-DET2-spacer-ek-Stat 6 SH2 was confirm~d by DNA sequencing CA 0222~668 1997-12-23 W O 97/02023 PCTfUS96/11074 (SEQ ID NO: 29) and inrl~-ced in r~. coli strain GI698 (Invitrogen Corporation, San Diego, CA). Tn~l~-rtiQn of the phage lambda promoter was in~cecl by addition of tryptophan to the culture medium to 10 mg/ml, per the m:lnl-f~rhlre'5 instructions, also as described in procedure 4. A Coomassie-Blue-stained, Western-blot-positive S intll-ce-l protein band with an a~p~ellt mnl-~clll~r weight of 15,000 was observed after tryptophan induction of cells growing at 27~ C.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~+NTA
column. After washing the column with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCl) and the same buffer co.~ i,.g 15 mM imi~l~7Qle, the protein was eluted in highly purified form with 25 mM imill~7Ole in equilibration buffer. This expressed fusion protein, DET1-DET2-spacer-ek-STAT 6 SH2, is utilized in the "Binding Assays" described below in order to ~7etP-rrninto the specificity of compounds to selectively inhibit the human Stat 6 SH2 domain.
Procedure 6: Cloning, expression and pl-rifir~tjon of human Stat 5 SH2 domain contzlining tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-Stat 5 SH2).
A DNA sequence encoding protein ek-Stat 5-SH2 (Stat 5 SH2 DNA
sequence i~llonti~l to that r1~scrihed in Hou, J. et al., Tmml-nity 2, (1995) 321-329) (SEQ ID NO: 30)) was synthP-ci7e~1 according to well known procedures as described in Rosen et al., Bio. Techniques 2, (1990) 298-300. The r~cllltin~ DNA sequence of the coding strand of the gene is as follows:

TTGCTTGGATCCTGGACGACGACGAC AAAATGGAAG TTCTGAAAAA
ACACCACAAA CCGCACTGGA ACGACGGTGC TATCCTGGGT
TTCGTTAACA TCACGACCTG CTGATCAACA AACCGGACGG
TACCTTCCTG CCGACTCCGA AATCGGTGGT ATCACCATCG
CTTGGAAATT GAACGTAACC TGTGGAACCT GAAACCGTTC
ACCACCCGTG CCGTTCCCTG GCTGACCGTC TGGGTGACCT
GTCCTACCTG TCCCGGACCG TCCGAAAGAC GAA~l-l-l-lCT

CA 0222~668 1997-12-23 W O 97/02023 ~CTrUS96/11074 CCAAATACTA CACCCCGTAATAGTCTAGAACGAA (SEQ ID NO: 31) Restriction sites for BamHI and XbaI are underlined in the sequence above.
The ek-Stat 5-SH2 gene sequence was digested with BamHI and XbaI, 5 followed by isolation of the digested fragment on an agarose gel. The fr~gmPnt was ligated with the vector fragment derived from BamHI-XbaI digestion of the expression vector cont~ining the tagged human src gene DET1-DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the BamHI site is located between the coding regions for DET2 and SH2, and the XbaI site is located after the 10 3' end of the SH2 coding region. The ligation reaction was used to Ll~l~r~ E. coli MM294cI+. The construct DETl-DET2-spacer-ek-Stat S SH2 was confirm~(l by DNA sequencing (SEQ ID NO: 32) and in~lce~l in E. coli strain GI698 (Invitrogen Col~oldLion, San Diego, CA). Induction of the phage lambda promoter was inlluce~by addition of tl~lo~han to the culture r~ llll to 10 mg/ml, per the m~nllf~ctllre's 15 instructions, also as described in procedure 4. A Co~ m~ccie-Blue-st~inP~l Western-blot-positive inrluce~l protein band with an a~pa,~nt molec~ r weight of 15,000 was observed after Lly~lo~hall induction of cells growing at 27~ C.
Cells were lysed at neutral pH by sonif ~tion in the presance of lysozyme.
After cel.LIirugation, the soluble extract is chromatographed on a Ni~NTA column.
20 After washing the column with equilibration buffer (Tris buffer pH 8 cc~ g 0.5 M NaCl) and the same buffer CG~ h~h~ 15 mM im~ 7ole~ the protein is eluted in highly purified form with 25 mM irnidazole in equilibration buffer. This expressed fusion protein, DETl-DET2-spacer-ek-STAT 5 SH2, is utilized in the "Binding Assays" described below in order to ~letlormin~ the specificity of colll~oullds to 25 selectively inhibit the human Stat 5 SH2 domain.

Fusion proteins having the structure GST-X-SH2 are prepared as described in the GST gene fusion kit system available from ph~rm~ (New Jersey). GST is the tagging sequence glutathione s-transferase epitope (SEQ ID NO: 8) for fyn, Grb2 30 and SH-PTP2 and is the tagging sequence glutathione s-transferase epitope (SEQ ID
- NO: 9) for p85. SH2 refers to the SH2 domains of fyn, Grb2, p85 and SH-~P2 CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 which were expressed and purified using glutathione Sepharose 4B (Ph~rm~ri~) according to "Current Protocols in Molecular Biology", ed. FM Ausubel et al., pub.
John Wiley and Sons, Inc., (1995), p 16.7.1. X is an ~plup~iate linker, preferably of 6 to 21 base pairs, used to keep the SH2 construct in frame and complement cloning.
As such, the sequence of X is not critical. One skilled in the art can readily construct the ap~lupliate linker. The DNA sequence encoding each GST-X-SH2 fusion protein was decignrrl such that the in~ te~l restriction sites (BamHl and EcoRI)flank the SH2 region. The vector used in the instant experiments was the E. coliexpression vector pGEX-2T (Pharmacia) for fyn, Grb2 and SH-PTP2, and pGEX-3X
(Ph~rrn~ri~) for p85. Each of these vectors result in SH2 constructs having additional C-termin~l amino acids as described below.
The sequence encoding the SH2 domain of human fyn (amino acids 143-252) (Yamamoto, T. et al. Proc. Natl. Acad. Sci. USA 83, 5459-5463 (1986)) was cloned into the BamHI and EcoRI sites of the expression vector pGEX-2T. The SH2 domain inrl~lrling the ~ liti~-n~l C-trrrnin, l amino acids leucine-threonine-asparagine-serine-serine (SEQ ID NO: 10) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-fyn. This expressed fusion protein was then utilized in the "Binding Assays" ~esrrihed below in order to ~lett~rrninP. the specificity of compounds to selectively inhibit the human fyn SH2 domain.
Human p85 SH2 domain: The sequence encoding the SH2 domain of human p85 (amino acids 321440) (Skolnik, E. et al., Cell 65, 83-90 (1991)) was cloned into the BamHI and EcoRI sites of the e,-~lc;ssion vector pGEX-3X. The SH2 domain inrlu-ling the additional C-terTT in~l amino acids asparagine-serine-serine (SEQ ID NO: l l)was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-p85. This expressed fusion protein was then utilized in the "Binding Assays" described below in order to ~leterrninr the specificity of c~ ou.lds to selectively inhibit the human p85 SH2 domain.
Human SH-PTP2 SH2 domain: The sequence encoding the SH2 domain of human SH-~l'P2 (amino acids 1-106))(Bastien, L. et al., Biochem. Biophys. Res.
Commun. 196, 124-133 (1993)) was cloned into the BamHI and EcoRI sites of the CA 0222~668 1997-12-23 W O 97/02023 ~CTrUS96/11074 ~,cssion vector pGEX-2T. The SH2 domain including the additional C-terminal amino acids ghlt~mine-pheny~ nine-isoleucine-valine-threonine-aspartate (SEQ ID
NO: 12) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-SH-PTP2. This expressed fusion protein was then S utilized in the "Binding Assays" described below in order to ~letrrmine the specificity of compounds to selectively inhibit the human SH-PTP2 SH2 (lom~in HumOEl Grb2 SH2 domain: The sequence encoding the SH2 domain of human Grb2 (amino acids 58-159) (Lowenstein, E. et al., Cell 70, 431-442 (1992))was cloned into the BarnHI and EcoRI sites of the expression vector pGEX-2T. TheSH2 domain inclll~ling the additional C-te-min~l amino acids isoleucine-hicti-linr-arginine-a~p~late (SEQ ID NO: 25) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-Grb2. A six nucleotide linker was used and resulted in the amino acids glycine OEnd serine between the GST and SH2 domain. This expressed fusion protein was then utilized in the "Binding Assays" described below in order to ~etrrmine the specificity ofcompounds to selectively inhibit the humOEn Grb2 SH2 domain.

Binding Assays: The potency of compounds at the SH2 domains is ~ietçrmined basedon the ability of such colllpoul,ds to selectively inhibit such SH2 domain from binding to its respective specific pY peptide.
The binding assays for the SH2 clom~in~ and pY peptides OEe pelro"l~ed in an ELISA-based 96 well plate assay. In Millipore 96 well filter plates, hydrophilicDurapore~) (pore size 0.65um Cat. No. MADVN6550), OEe added 2 ul (50%
suspension) of Protein-G Sepharose (available from Ph~rm~ri~ of N.J. Cat. No. 17-0618-01) and either 2 ul of 2 mg/ml of MAB178.1 (for gpl20/SH2 domain fusion proteins src, lck, Stat 5, Stat 6 and hcp) or 0.25 ul of anti-GST polyclonal antisera (available from Ph~rm~rizl of N.J.) (for GST/SH2 domain fusion proteins fyn, Grb2, p85 and SH-PTP2). 10 pmol of the subject SH2 domain fusion protein are added to their respective wells. The volume is brought to 100 ul with TBS-T (tris buffered saline plus 0.05% tween-20), inc~lb~te~1 and shaken at room telll~cldlulc for 1 hr.
then washed lx with TBS-T (4~C). 90 ul of TBS-T is then added to each well.

CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 Specific pY biotinylated peptides are diluted to a concentration of 1.0 uM in TBS-T
(these peptides can be obtained from Bachem Bioscience of Pennsylvania, C.enosysBiotechnologies of Texas and California Peptide Research of California). 10 ul is aliquoted per well to yield a final concentration of 0.1 uM (approx. the Kd for each 5 SH2 domain/peptide pair) and a final volume of 100 ul. The assay plates are incub~t~l until equilibrium binding was ~tt~ined (3 hr at 4~C with ch~kin~). Theassay plates are washed 2 X per well TBS-T (4~C), then 100 ul of SABC
(Strepavidin biotinylated horseradish peroxidase complex, available from the Zymed corporation of California cat. no. 93-0043, 1 drop reagent A (~LLe~l~vidin) and 1 10 drop of reagent B (AH-biotin conjugated-horseradish peroxidase) per 10 ml of TBS-T, inrub~t~l at 37~C for 30 minlltes, then cooled to 4~C) is added per well, then in~llb?tecl at 4~C for 30-60 ~ u~es. The plates are then washed 4 X with TBS-T
(4~C) (250 uVwell)/wash). 100 ul of 1 mg/ml OPD (o-phenyl~ min.-, Sigma Ch.-.mir~l Corporation, St. Louis Missouri) in Citrate Buffer is added per well. To stop development, 100 ul of 10% sulfuric acid is added per well. 150 ul from each well is then removed from the assay plate and placed in an ELISA plate. The A490 of each ELISA plate is then tl~
Dele. ..~ tion of (IC5,) for Table I
Each control or co.l.poulld is assayed in clllrlir~to- The r1llplir~t~s are 20 averaged and the background subtracted and the m~xim~l values with no inhibition are taken from the plate, then all other data points are expressed as a percent of the maximal value (or as % control). These % control data values are gr~ph~d in K~lei<l~graph for Macintosh (Synergy Software). The curves on these graphs are nonlinear curve fitted with the following equation F(x)---Emax/(l+(kd/conc)~slope), 25 wherein the kd term represents the IC50 for each of the curves.
De~e,...i~-~tion of (Ki) for Table II
The Ki for respective co",pou,lds is ç~lçnl~tec~ via the following equation (see below). This ~r~n~ equation must be used under the conditions of this assay, due to the fact that the pY biotinylated peptide is not in vast excess 30 concentration (lOOX) over the SH2 domain fusion protein. The ICso is an extrapolated value from a nonlinear curve fit using K~ graph. Rtot and *D are CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 known values for reagents input into the assay. KD generally must be experimentally deter nined for each combination of SH2 domain fusion protein andpY biotinylated peptide.

5 KI=(ICso-Rtot+Rtot/2((*D/(KD+*D))+(KD/(KD+*D+Rtotl2)))/(l+*D/KD+Rtot/KD((KD+*D
/2)/(KD+*D))) KI=(uM)KDof competitor 10 IC50=~uM) ICso for inhibitor, derived via nonlin~r curve fit of competition selectivity assay data for each SH2 domain Rtot=(uM)total SH2 domain concentration within 1 assay (microtitre plate) well *D=(uM)concentration of specific pY and biotinylated peptide for each SH2 domainKD=(uM)KD value for the specific pY and biotinylated peptide for each SH2 15 domain IC50 is the concentration of inhibitor at which the response or signal is inhibited by 50%

KD is the dissociation constant for a ligand in a lGce~o~/ligand interaction, normally 20 equaling the concentration of ligand which is at 1/2 Vmax on a saturation binding curve>

The pY peptide ligands used in the above Binding Assays are as follows:

25 Biotinylated pY peptide ligand c~ nt~ining an arninocaproic acid (Aca) linker used for src, lck, and fyn SH2 ~lom~in~

Glu-Pro-Gln-pTyr-Glu-Glu-Ile-Pro-Ile-Tyr-Leu (SEQ ID NO: 13) 30 Biotinylated pY peptide ligand cont:~ining an a,ninocaproic acid (Aca) linker used for p85 SH2 CA 0222~668 1997-12-23 Asp-Gly-Gly-pTyr-Met-Asp-Met-Ser-Lys-Asp-Glu (SEQ ID NO: 14) Biotinylated pY peptide ligand co~ ir~ g an arninocaproic acid (Aca) linker used5 for SH-PTP2 SH2 Glu-Asn-Gly-Leu-Asn-pTyr-Ile-Asp-Leu-Asp-Leu (SEQ ID NO: 15) Biotinylated pY peptide ligand coill;1illing an arninocaproic acid (Aca) linker used 10 for hcp SH2 Thr-Pro-Pro-His-Leu-Lys-pTyr-Phe-Tyr-Phe-Val-Val-Ser-Asp-Ser-Gly (SEQ
NO: 16) 15 Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used for Grb2 SH2 Leu-Pro-Val-Pro-Glu-pTyr-Ile-Asn-Gln-Ser-Val (SEQ ID NO: 26) 20 Biotinylated pY peptide ligand confz~ining an arninocaproic acid (Aca) linker used for Stat 6:

Ser-Gly-Glu-Glu-Gly-pTyr-Lys-Pro-Phe-Gln-Asp-Leu-Ile (SEQ ID NO: 33) 25 Biotinylated pY peptide ligand cont~inin~ an ~minoç~proic acid (Aca) linker used for Stat 5:

Ala-Val-Asp-Gly-pTyr-Val-Lys-Pro-Gln-lle-Lys (SEQ ID NO: 34) 30 Results of Binding Assays:
Tables I and II illustrate the cross reactivity of SH2 antagonists at the in~1ic~tt-.~1 SH2 W O 97/02023 PCT~US96/11074 domains. From the results disclosed in these tables compounds which have binding~ffiniti~c/inhibitory concentrations which are greater than fifty-fold higher at the Stat 6 SH2 domain than the binding affinities/inhibitory concentrations at other SH2 domains can be readily iclentified.

CA 02225668 l997-l2-23 W O 97/02023 PCT~US96/11074 _ ~o X X X X X X X X X X
-- V~

o ~
X X X X X X X X X X
z ~ C X ~ o a x z g ~3 ~

~ ~ Z Z Z Z Z Z Z Z ~ z E-o ~,~ Z Z Z Z Z Z Z Z Z Z
E- ~
3 ~: ~ z z z x z x z z z z , _ _ _ _ _ _ _ _ _ _ C~ ~, Z Z Z Z Z Z Z Z Z Z
~ , o ~ ~, ~o 8 Z oo o g x o ' ~ ~ ' X ~
~Q ~ Z~ ~t ~o ~~ ~ ~D ~ O
o c C o _ ~ ~,, ~ ~ ~o t - oo ~; o C,~ Z X

W O 97/02023 PCTfUS96/11074 X X X X X X X X X X
X X X X X X X X X X
'C
X X X X X X X X X X
X X X X X X X X X X
z ~ ~ X X X X X X X X X X

~ ~ _ _ _ _ ~ _ ~ o _ _ O ~ Z Z Z Z Z Z ~ Z Z

~ ~& --Z Z --Z Z Z Z Z Z Z Z

D O . Z Z Z X Z Z Z Z Z Z
E- ~ ~
3 L~ ~ z z -z -z z z -z z- z o ~ ~ X ~ X
Z -- ~ ~' o ,~~ X g o O D

~_ Z O oo ~ ~ ~ ~ X
C ~o C ~ ~ ~ O ~ ~

CA 02225668 l997-l2-23 W O 97102023 PCTrUS96/11074 While the ~cfell~,d emborlim~nt.c of the invention are illustrated by the above, it is to be understood that the invention is not limited to the precise instructions herein disclosed and that the right to all modifications coming within the S scope of the following claims is reserved.

=--CA 0222~668 l997-l2-23 W O 97l02023 PCTnUS96/11074 ~Qu~N~ LISTING

(1) GENERAL INFORMATION

(i) APPLICANT: ~uNNlN~lON, DAMIEN

(ii) TITLE OF THE lNV~N'l'lON: USE OF Stat 6 SH2 DOMAIN
S~ lC COMPOUNDS TO TREAT ALLERGIC REACTIONS

(iii) NUMBER OF ~Qu~N~S: 34 (iv) CORRESPON~ nDR~.~S:
(A) ADDRESSEE: SmithKline Beecham Corporation (B) STREET: 709 Swe~ n~ Road (C) CITY: King of Prussia (D) STATE: PA
(E) C~UN~1~KY: USA
(F) ZIP: 19406 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COMPUTER: IBM Compatible (C) OPERATING SYSTEM: DOS
(D) SOFTWARE: FastSEQ Version 1.5 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/598,716 (B) FILING DATE: 08-FEB-1996 (viii) ATTORNEY/AGENT INFORMATION:

CA 0222~668 l997-l2-23 (A) NAME: Dustman, Wayne J
(B) REGISTRATION NUMBER: 33,870 (C) REFERENCE/DOCKET NUMBER: P50323-2P2 ( ix ) TFr~FcoMMuNIcATIoN INFORMATION:
(A) TELEPHONE: 610-270-5023 (B) TELEFAX:
(C) TELEX:

(2) INFORMATION FOR SEQ ID NO:1:

(i) ~Qu~ CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STR~NnFnNF..~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ( iii ) ~Y~o~ cAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(xi) ~yu~ DESCRIPTION: SEQ ID NO:1:

Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg (2) INFORMATION FOR SEQ ID NO:2:

(i) ~yu~N~ CHARACTERISTICS:
(A) LENGTH: 6 amino acids ( B) TYPE: amino acid (C) STRANnFnNF~: single (D) TOPOLOGY: linear CA 0222~668 1997-12-23 W O 97/02023 PCTrUS96/11074 (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

10 His His His His His His l 5 (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3 amino acids (B) TYPE: amino acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (ii).MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi ) ORIGINAL SOURCE:

(xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:3:

Gly Ile Leu (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STR~NnFnN~S: single CA 0222~668 1997-12-23 W O 97l02023 PCTrUS96/11074 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~yu~N~ DESCRIPTION: SEQ ID NO:4:

Asp Asp Asp Asp Lys l 5 (2) INFORMATION FOR SEQ ID NO:5:
(i) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 130 amino acids (B) TYPE: amino acid (C) STRAN~N~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~yu~N~ DESCRIPTION: SEQ ID NO:5:

30 Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His l 5 l0 15 His His Gly Ile Leu Asp Asp Asp Asp Lys Ala Glu Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu Ser Glu Arg Leu Leu Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu Thr Thr Lys Gly CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 Ala Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Ala Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg Lys Leu Asp Ser Gly Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu Val Ala Tyr Tyr ~ Ser Lys His Ala Asp Gly Leu Cys His Arg Leu Thr Thr Val Cys Pro Thr Ser (2) INFORMATION FOR SEQ ID No:6:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 134 amino acids (B) TYPE: amino acid (C) STR ANn~nN~-~ S: S ingle (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(xi) ~Q~N~ DESCRIPTION: SEQ ID NO:6:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His Gly Ile Leu Asp Asp Asp Asp Lys Glu Pro Glu Pro Trp Phe Phe Lys Asn Leu Ser Arg Lys Asp Ala Glu Arg Gln Leu Leu Ala Pro Gly Asn Thr His Gly Ser Phe Leu Ile Arg Glu Ser Glu Ser Thr Ala Gly Ser Phe Ser Leu Ser Val Arg Asp Phe Asp Gln Asn Gln Gly Glu CA 0222~668 l997-l2-23 W O 97/02023 PCTrUS96/11074 Val Val Lys His Tyr Lys Ile Arg Asn Leu Asp Asn Gly Gly Phe Tyr Ile Ser Pro Arg Ile Thr Phe Pro Gly Leu His Glu Leu Val Arg His 5 Tyr Thr Asn Ala Ser Asp Gly Leu Cys Thr Arg Leu Ser Arg Pro Cys Gln Thr Gln Lys Pro Gln (2) INFORMATION FOR SEQ ID NO:7:

(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 133 amino acids (B) TYPE: amino acid (C) STRANT)Rn~F':S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
( iv) ANTISENSE: NO
(v) ER~GMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~U~N~ DESCRIPTION: SEQ ID NO:7:
Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His l 5 10 15 His His Gly Ile Leu Asp Asp Asp Asp Lys Ser Arg Gly Trp Phe His Arg Asp Leu Ser Gly Leu Asp Ala Glu Thr Leu Leu Lys Gly Arg Gly Val His Gly Ser Phe Leu Ala Arg Pro Ser Arg Lys Asn Gln Gly Asp Phe Ser Leu Ser Val Arg Val Gly Asp Gln Val Thr His Ile Arg Ile Gln Asn Ser Gly Asp Phe Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Ala CA 0222~668 l997-l2-23 W O 97/02023 PCTnUS96/11074 Thr Leu Thr Glu Leu Val Glu Tyr Tyr Thr Gln Gln Gln Gly Val Leu Gln Asp Arg Asp Gly Thr Ile Ile His Leu Lys Tyr Pro Leu Asn Cys Ser Asp Pro Thr Ser -(2) INFORMATION FOR SEQ ID NO:8:

(i) ~:yu~N~: CHARACTERISTICS:
(A) LENGTH: 224 amino acids (B) TYPE: amino acid (C) sTR~NnF~nNF~s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:

(xi) ~yu~N~ DESCRIPTION: SEQ ID NO:8:

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser CA 0222~668 l997-l2-23 W O 97/02023 ~ U~ 1074 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 0 180 185 : 190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids 2U (B) TYPE- amino acid (C) STRAN~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ( iii ) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

3U (xi) ~u~ DESCRIPTION: SEQ ID NO:9:

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu CA 0222~668 l997-l2-23 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Ile Glu Gly Arg (2) INFORMATION FOR SEQ ID NO:10:

(i) ~Qu~-~ CHARACTERISTICS:
(A) LENGTH: 117 amino acids ( B) TYPE: amino acid ( C ) STR A N ~ I )N ~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ( iii ) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal CA 0222~668 l997-l2-23 WO 97t02023 PCTtUS96/11074 (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys Leu Gly Arg Lys Asp Ala Glu Arg Gln Leu Leu Ser Phe Gly Asn Pro Arg Gly Thr Phe Leu Ile Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr Ser Leu Ser Ile Arg Asp Trp Asp Asp Met Lys Gly Asp His Val Lys His Tyr Lys Ile Arg Lys Leu Asp Asn Gly Gly Tyr Tyr Ile Thr Thr Arg Ala Gln Phe Glu Thr Leu Gln Gln Leu Val Gln His Tyr Ser Glu Arg Glu Arg Ala Ala Gly Leu Cys Cys Arg Leu Val Val Pro Cys His Lys Gly Met Pro Arg Leu Thr Asn Ser Ser (2) INFORMATION FOR SEQ ID NO:ll:

(i) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 123 amino acids (B) TYPE: amino acid (C) sTR~Nn~nN~cs single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~U~N~: DESCRIPTION: SEQ ID NO:ll:

CA 0222~668 l997-l2-23 WO 97/02023 ' PCTrUS96/11074 Gly Met Asn Asn Asn Met Ser Leu Gln Asn Ala Glu Trp Tyr Trp Gly Asp Ile Ser Arg Glu Glu Val Asn Glu Lys Leu Arg Asp Thr Ala Asp ~ 5 Gly Thr Phe Leu Val Arg Asp Ala Ser Thr Lys Met His Gly Asp Tyr Thr Leu Thr Leu Arg Lys Gly Gly Asn Asn Lys Leu Ile Lys Ile Phe His Arg Asp Gly Lys Tyr Gly Phe Ser Asp Pro Leu Thr Phe Ser Ser Val Val Glu Leu Ile Asn His Tyr Arg Asn Glu Ser Leu Ala Gln Tyr Asn Pro Lys Leu Asp Val Lys Leu Leu Tyr Pro Val Ser Lys Tyr Gln 15 Gln Asp Gln Val Val Lys Glu Asp Asn Ser Ser (2) INFORMATION FOR SEQ ID NO:12:

( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 112 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~QU~N~'~' DESCRIPTION: SEQ ID NO:12:

Met Thr Ser Arg Arg Trp Phe His Pro Asn Ile Thr Gly Val Glu Ala Glu Asn Leu Leu Leu Thr Arg Gly Val Asp Gly Ser Phe Leu Ala Arg CA 0222~668 l997-l2-23 WO 97/02023 PCT/US96/l1074 Pro Ser Lys Ser Asn Pro Gly Asp Phe Thr Leu Ser Val Arg Arg Asn Gly Ala Val Thr His Ile Lys Ile Gln Asn Thr Gly Asp Tyr Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Ala Thr Leu Ala Glu Leu Val Gln Tyr Tyr Met Glu His His Gly Gln Leu Lys Glu Lys Asn Gly Asp Val Ile Glu Leu Lys Tyr Pro Leu Asn Cys Ala Asp Gln Phe Ile Val Thr Asp t2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) sTR~NnFnNF~:s single (D) TOPOLOGY: linear 20 ( ii ) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
25 (ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 4...4 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Glu Pro Gln Tyr Glu Glu Ile Pro Ile Tyr Leu CA 0222~668 l997-l2-23 WO 97/02023 PCT~US9~ 074 (2) INFORMATION FOR SEQ ID NO:14:

( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids - (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 4...4 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) ~QU~N~ DESCRIPTION: SEQ ID NO:14:

25 Asp Gly Gly Tyr Met Asp Met Ser Lys Asp Glu (2) INFORMATION FOR SEQ ID NO:15:

(i) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) sTR~Nn~nN~s: single (D) TOPOLOGY: linear CA 0222~668 l997-l2-23 WO 97/02023 PCT~US96/11074 (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 6.. 6 (D) OTHER INFORMA~TION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:lS:

Glu Asn Gly Leu Asn Tyr Ile Asp Leu Asp Leu l 5 l0 15 (2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 amino acids (B) TYPE: amino acid tC) STRANDEDNESS: single (D) TOPOLOGY: linear tii) NOLECULE TYPE: peptide tiii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal tvi) ORIGINAL SOURCE:
t ix ) FEATURE:

(A) NAME/KEY: Other CA 0222~668 l997-l2-23 (B) LOCATION: 7...7 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Thr Pro Pro His Leu Lys Tyr Phe Tyr Phe Val Val Ser Asp Ser Gly (2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) ~Qu~ DESCRIPTION: SEQ ID NO:17:

TTCCATATGA AAAGTATTCG TATTCAGCGT GGCCCGGGCC GTCACCACCA CCACCACCAC

GGGATCCCCG CTGAAGAGTG GTACTTT

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs CA 0222~668 l997-l2-23 (B) TYPE: nucleic acid (C) STRANDEDNESS: singIe (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GGAATTCTAG ATTACTAGGA CGTGGGGCAG ACGTT

(2) INFORMATION FOR SEQ ID NO:l9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
( i i i ) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:

CGGGATCCTG GACGACGACG ACAAAGCTGA GGAGTGGTAT TTT

( 2) INFORMATION FOR SEQ ID NO:20:

(i) ~Qu~N~ CHARACTERISTICS:

CA 0222~668 l997-l2-23 WO 97/02023 PCT~US96/11074 (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

GGAATTCTAG ACTATTAGGA CGTGGGGCAC ACGGT

(2) INFORMATION FOR SEQ ID NO:2l:

(i) ~OU~N~ CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STR~Mn~n~S single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:21:

CGGGATCCTG GACGACGACG ACAAAGAGCC CGAACCCTGG TTCTT

(2) INFORMATION FOR SEQ ID NO:22:

CA 0222~668 l997-l2-23 WO 97/02023 PCT~us96/11074 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs tB) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

GCTCTAGACT ATTACTGGGG ~~ GGGTC TG

(2) INFOPMATION FOR SEQ ID NO:23:

( i ) ~:Qu~ CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

GAAGATCTTG GACGACGACG ACAAATCCCG TGGGTGGTTT CAC

(2) INFORMATION FOR SEQ ID NO:24:

CA 0222~668 1997-12-23 W O 97/02023 PCT~US96/11074 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) sTRANn~nN~-~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) ~:Qu~ DESCRIPTION: SEQ ID NO:24:

GCTCTAGACT ATTAACTAGT GGGATCGGAG CA

(2) INFORMATION FOR SEQ ID NO:25:

(i) ~QU~ CHARACTERISTICS:
(A) LENGTH: 106 amino acids (B) TYPE: amino acid (C) sTRANn~nN~s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

His Pro Trp Phe Phe Gly Lys Ile Pro Arg Ala Lys Ala Glu Glu Met 1 . 5 10 15 Leu Ser Lys Gln Arg His Asp Gly Ala Phe Leu Ile Arg Glu Ser Glu CA 0222~668 1997-12-23 W O 97/02023 PCT~us96/11074 Ser Ala Pro Gly Asp Phe Ser Leu Ser Val Lys Phe Gly Asn Asp Val Gln His Phe Lys Val Leu Arg Asp Gly Ala Gly Lys Tyr Phe Leu Trp Val Val Lys Phe Asn Ser Leu Asn Glu Leu Val Asp Tyr His Arg Ser Thr Ser Val Ser Arg Asn Gln Gln Ile Phe Leu Arg Asp Ile Glu Gln Val Pro Gln Gln Pro Thr Ile His Arg Asp l00 105 (2) INFORMATION FOR SEQ ID NO:26:

( i ) ~QU~N~'~ CHARACTERISTICS:
(A) LENGTH: ll amino acids (B) TYPE: amino acid (C) STRA~n~nNF~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 6...6 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) ~QU~N~ DESCRIPTION: SEQ ID NO:26:

Leu Pro Val Pro Glu Tyr Ile Asn Gln Ser Val l 5 l0 CA 0222~668 l997-l2-23 W O 97/02023 PCT~US96/11074 (2) INFORMATION FOR SEQ ID NO:27:

QU~ CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

CGGGATCCTG GACGACGACG ACAAACTCCG GAGCTAC

( 2) INFORMATION FOR SEQ ID NO:28:

( i ) ~hQU~N~: CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) ~QU~ DESCRIPTION: SEQ ID NO:28:
GGAATTCTAG ACTACTTGAT GGTAGC

CA 0222~668 l997-l2-23 WO 97/02023 PCT~US96/11074 (2) INFORMATION FOR SEQ ID NO:29:

(i) SEQUENCE CHARACTERISTICS:
S (A) LENGTH: 145 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His ~0 His His Gly Ile Leu Asp Asp Asp Asp Lys Leu Arg Ser Tyr Trp Ser Asp Arg Leu Ile Ile Gly Phe Ile Ser Lys Gln Tyr Val Thr Ser Leu Leu Leu Asn Glu Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala His Val Ile Arg Gly Gln Asp Gly Ser Pro Gln Ile Glu Asn Ile Gln Pro Phe Ser Ala Lys Asp Leu Ser Ile Arg Ser Leu Gly Asp Arg Ile Arg Asp Leu Ala Gln Leu Lys Asn Leu Tyr Pro Lys Lys Pro Lys Asp Glu Ala Phe Arg Ser His Tyr Lys Pro Glu Gln Met Gly Lys Asp Gly Arg Gly Tyr Val Pro Ala Thr Ile Lys CA 0222~668 1997-12-23 (2) INFORMATION FOR SEQ ID NO:30:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 108 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL. NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~Q~ DESCRIPTION: SEQ ID NO:30:

Met Glu Val Leu Lys Lys His His Lys Pro His Trp Asn Asp Gly Ala Ile Leu Gly Phe Val Asn Lys Gln Gln Ala His Asp Leu Leu Ile Asn Lys Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala Trp Lys Phe Asp Ser Pro Glu Arg Asn Leu Trp Asn Leu Lys Pro Phe Thr Thr Arg Asp Phe Ser Ile Arg Ser Leu Ala Asp Arg Leu Gly Asp Leu Ser Tyr Leu Ile Tyr Val Phe Pro Asp Arg Pro Lys Asp Glu Val Phe Ser Lys Tyr Tyr Thr Pro (2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 320 base pairs (B) TYPE: nucleic acid CA 0222~668 l997-l2-23 W 0 97/02023 PCT~US96/11074 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~O~ lCAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

TTGCTTGGAT CCTGGACGAC GACGACAAAA TGGAAGTTCT GAAAAAACAC CACAAACCGC
ACTGGAACGA CGGTGCTATC CTGGGTTTCG TTAACATCAC GACCTGCTGA TCAACAAACC

GGACGGTACC TTCCTGCCGA CTCCGAAATC GGTGGTATCA CCAl~CG~l~lG GAAATTGAAC

GTAACCTGTG GAACCTGAAA CCGTTCACCA CCCGTGCCGT TCCCTGGCTG ACC~ GGG

TGACCTGTCC TAC~ lCCC GGACC~l~CCG AAAGACGAAG ~ C~AA ATACTACACC

CCGTAATAGT CTAGAACGAA

( 2) INFORMATION FOR SEQ ID NO:32:

(i) ~Qu~N~ CHARACTERISTICS:
(A) LENGTH: 134 amino acids (P) TYPE: amino acid (c) STRA~nF.n~.~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O'l'~'l'lCAL: NO
( iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

CA 0222~668 l997-l2-23 WO 97/02023 PCT~us96/11074 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His Gly Ile Leu Asp Asp Asp Asp Lys Met Glu Val Leu Lys Lys His His Lys Pro His Trp Asn Asp Gly Ala Ile Leu Gly Phe Val Asn 35 ~0 45 Lys Gln Gln Ala His Asp Leu Leu Ile Asn Lys Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala Trp Lys Phe Asp Ser Pro Glu Arg Asn Leu Trp Asn Leu Lys Pro Phe Thr Thr Arg Asp Phe Ser Ile Arg Ser Leu Ala Asp Arg Leu Gly Asp Leu Ser Tyr Leu Ile Tyr Val Phe Pro Asp Arg Pro Lys Asp Glu Val Phe Ser Lys Tyr Tyr Thr Pro (2) INFORMATION FOR SEQ ID NO:33:

( i ) ~:Qu~-~: CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~S single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:
, (ix) Feature:

CA 0222~668 1997-12-23 WO 97/02023 PCT~US96/11074 (A) NAME/KEY: Other (B) LOCATION: 6 6 (C) OTHER INFORMATION: phosphorylated tyrosine residue S
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:

Ser Gly Glu Glu Gly Tyr Lys Pro Phe Gln Asp Leu Ile (2) INFORMATION FOR SEQ ID NO:34:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ( iii ) ~Y~o~ cAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) Feature:
(A) NAME/KEY: Other (B) LOCATION: 5 5 (C) OTHER INFORMATION: phosphorylated tyrosine residue (xi) ~Qu~ DESCRIPTION: SEQ ID NO:34:

Ala Val Asp Gly Tyr Val Lys Pro Gln Ile Lys l 5 l0

Claims (24)

What is claimed is:

1. A method of treating allergic reactions in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

2. The method of claim 1 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

3. The method of claim 1 which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

4. The method of claim 3 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

5. A method of treating asthma in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

6. The method of claim 5 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

7. The method of claim 5 which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

8. The method of claim 7 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

9. A method of treating allergic rhinitis in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;

g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

10. The method of claim 9 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

11. The method of claim 9 which comprices administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

12. The method of claim 11 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

13. Use of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; in the manufacture of a medicament for use in treating allergic reactions.

14. A use according to claim 13 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

15. A use according to claim 13 wherein the compound:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;

f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

16. A use according to claim 15 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 5SH2 domain.

17. Use of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;

f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; in the manufacture of a medicament for use in treating asthma.

18. A use according to claim 17 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

19. A use according to claim 17 wherein the compound:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

20. A use according to claim 19 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 5SH2 domain.

21. Use of a compound which:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; in the manufacture of a medicament for use in treating allergic rhinitis.

22. A use according to claim 21 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain.

23. A use according to claim 21 wherein the compound:
a. binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 5 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 6 SH2 domain.

24. A use according to claim 23 wherein the compound binds to a human Stat 6 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 5SH2 domain.