MXPA97006130A - Use of specific compounds of lck sh2 to treat autoimmune diseases and the rejection of aloinjer - Google Patents

Abstract

A method of treating autoimmune diseases in a subject is described, which comprises administering to the subject a therapeutically effective amount of a compound that binds to a human 1-SH2 domain with a binding affinity that is more than fifty times greater than the binding affinity with which the compound binds to a human SH2 src domain and a human SH2 fyn domain, and binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a SH-PTP2 SH2 domain human and a human p85 SH2 domain with a binding affinity that is more than fifty times less than the binding affinity with which the compound binds to a human SH2 1ck domain

Description

USE OF SPECIFIC COMPOUNDS OF LCK SH2 PRRR TPRTRR RUTOINI1UN DISEASES AND THE RECHRZO OF RL0IN3EPT0S BACKGROUND OF THE INVENTION 5 The prole ina inro c asa is? Ec? .f? Ca of the nfoci + os and related to src,? 5d ck (i ck), is associated fi sicarnente through its unique domain apu no - ermin l with the tail c toplashuea of 01) 4 in the 1 infections T "The associated l, - > CO4 is an essential component in the activation cascade of T cells, and an intact complex of the Ick C-H2 / CD4 domain is required for the immune response to function, from T cells to the antigen. Inhibition of the complex of the Ic SH2 / CD4 domain results in specific suppression of the T cells. A number of hormones and polypeptide growth factors mediate their cellular effects through a signal transduction pathway. transduction of signals to part of the cell surface receptor for these ligands, towards the internal race races, often involves phosphorylation or dephosphorylation of specific protein substrates by tyrosine kinases (PTK) and regulous phosphatases. »The orientation of the tarosma can be the main indicator, or perhaps even the only indicator, of the transduction of signals in the mulcellular organisms.The 5 PTKs m < racelularos and bound to receptors regulate cell proliferation, cell differentiation and processes (ie signaling in the cells of the immune system). The aberrant activity of the protein tyrosine c asa has been implicated or specha that is involved in a number < Such pathologies as diabetes, a-trosclerosis, psoriasis, septic shock, bone loss, anemia, many cancers and other proliferative diseases. Therefore, the different types and transduction pathways of sera that are part of them are potential targets for the design of drugs. For a review, see Lev Tzki et al., In Science 267, 1782-1788 (1995). Many of the proteins that comprise signal transduction pathways are present at low levels and often have opposite activities. The properties of these signaling molecules allow the cell to control transduction by means of the local subcolonal ion and juxtaposition of effecors, as well as by balancing the activation with the? Esion, so that A small change in one way I can achieve a changing effect. The formation of transduction complexes by juxtaposition of the signaling molecules through protein-protein interactions is mediated by specific motifs of coupling domain sequence. Src domains of homology 2 (SH2), which are conserved non-catalytic sequences of about 100 amino acids, present in a variety of signaling molecules such as non-receptor PTKs and target molecules of cmase effectors and oncogenic proteins, play a critical role . The SH2 domains are highly specific for short peptide sequences that contain photophilic DNA present in the autophosphorylated PTK receptors or the 11 internal nuclei. Approximately 60 proteins having different catalytic domains or other functional domains have been identified that share nevertheless conserved SH2 domains, conserved sequences of approximately 100 amino acids. It is not known precisely what physiological responses in the body are controlled by each (ie, these SH2 domains). In addition, the interactions of the ligand / compuest of the SH2 domain are highly specific, so minor modifications in the structure of the ligand / compound will alter significantly the selectivity with which the ligand / compound binds to the different SH2 domains The consequences of non-selective antigenism of the SH2 domains can be quite severe, for example, the src SH2 domain, the lc SH2 domain and the domain fyn SH2 are similarly similar, and have a high degree of conservation between domains. It has been indicated that antagonism of the src SH2 domain effects bone resorption, while antagonism of the lck SH2 domain (discussed in the present invention) or the fyn SH2 domain induces the immunosuppression. Inhibition of bone resorption would be undesirable in long-term therapy, which requires the induction of pressure. Rdernas, it would be ir-real to test the potential antagonists of the lck SH2 domain in union status against the 60 known SH2 domains. At present, there are no known compounds that interact with the SH domain, it would be convenient to provide methods and compounds that allow the treatment of autoimmune diseases and the rejection of alloins by antagonizing the SH2 domain, but that avoid the production of side effects observed in non-selective antagonists of the SH ?. Co domain or described in the present invention, it has been unexpectedly discovered that selective hawgonists of the lei-SH? domain can be identified by binding tests against the subset of SH2 domains consisting of (Je: the src domain SH2, the domain 1 cl-- SH2, the domain fyn SH ?, the SHPTP domain? SH ?, ol domain p85, the domain Grb? SH? And <l domain hcp SH2. From the information about the binding that is described below, it has been unexpectedly discovered that (a) compounds that are specific for a human Ic SH2 domain with an affinity (Je union more than 50 times greater than a binding affinity with which the compound binds to a human src SH2 domain and a human fyn SH2 domain, and that (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SHPTP2 SH2 domain, and a human p85 SH2 domain, with a binding affinity that is more than 50 times smaller-than the binding affinity with which the compound binds to said Ic SH2 domain, are effective in treating autoimmune diseases and rejection to aloi n ert os.

BRIEF DESCRIPTION OF THE INVENTION The present invention provides a method for treating autoimmune disorders in a subject, comprising administering to the subject a therapeutically effective amount of a compound that (a) binds to a human IcU SH2 domain with a binding affinity of 50-fold RNAs. greater than the binding affinity with which the compound binds to a human SH2 src domain and a human SH2 fyn domain, and (b) binds to a hcp SH domain? human, a Grb domain? SH? human, a SHPTP domain? SH? human, and a p85 SH domain? human, with a binding affinity that is more than 50 times less-than the binding affinity with which the compound binds to said lck SH domain ?. The present invention also provides a method for inhibiting rejection of allografts in a subject, which comprises giving the subject an inhibitory amount of rejection to allogens of a compound that (a) binds to a human Ick SH2 domain. with a binding affinity of more than 50 times greater than the binding affinity with which the compound binds to an src SH? human and a human SH2 fyn domain, and (b) binds to a human SH2 hcp domain, a Grt domain > 2 Human SH2, a SHPTP2 SH domain? human, and a human p85 SH2 domain, with a binding affinity that is more than 50 times smaller-than the binding affinity with which the compound binds to said lcl domain. SH ?. The present invention also provides a method for inducing immunosuppression in a subject, which comprises administering to the subject an inducing amount of a compound which (a) is linked to a human lcl domain with a binding purpose. more than 50 times greater than the binding strength with which the compound binds to a human src SH? domain and a human fyn SH? domain, and (b) binds to a human hcp SH? human Grb2 SH domain, a human SHPTP? SH? domain, and a human p85 SH? domain, with a binding affinity that is more than 50 times less than the binding affinity with which the compound binds to said domain 1 c SH ?.

DETAILED DESCRIPTION OF LR INVENTION As used in the present invention, the term "autoimmune diseases" means any disorder characterized by an excessively active immune response or an erroneously rigid immune response against the gene itself. The preferred autoimmune disease is rheumatolde arthritis. Other diseases such as multiple sclerosis, lupus eri ematoso sisternico and diabetes t po I, are also included.

Gomo is used in the present invention, the term "treatment" and derivatives thereof means prophylactic or therapeutic therapy. As used in the present invention, the term "compound" means a non-peptidic chemical compound. As used in the present invention, unless otherwise defined, the term "Ick SH2 domain antagonists" means a compound that (a) binds to a lcl-SH domain? human with an affinity (J binding of more than 50 times greater, preferably more than 100 times greater than, 1 binding affinity with which the compound binds to a human SH2 src domain and a human fyn SH2 domain, and (b) binds human hcp SH2 domain, a human Grb? SH? domain, human SHPTP? SH2 domain, and a human p85 SH2 domain, with an affinity (Je binding that is more than 50 times lower that, preferably more than 100 times less than, the binding affinity with which the compound binds to said Ic SH domain. The present invention provides a method for treating autoimmune diseases in a subject, comprising administering to the subject a Therapeutically effective amount of a compound that (a) binds to a human 1 SH2 domain with a fini (rnas junction Jad 50 times greater than the binding affinity with which the compound binds to an src SH2 domain human and a human SH2 fyn domain, and (b) binds to a human SH2 hcp domain, a Grb2 SH? hu domain hand, a SHPTP domain? SH? human, and a human p85 SH2 domain, with a binding affinity of more than 50 times less than the binding affinity with which the said Ic SH2 domain binds (A preferred aspect of the invention provides a method for treating autoinin diseases in a subject, comprising administering to the subject a therapeutically effective amount of a compound that (a) binds to a human Ick SH2 domain with a binding affinity of more than 50 times greater than the affinity The combination with which the compound binds to a human src SHγ domain and a human fyn SHγ domain A preferred aspect of the invention provides a method for treating arsenic diseases in a subject, which subject a therapeutically effective amount of a compound that (a) binds to a human Ic SH domain with a binding affinity of more than 100 times greater than the binding affinity with which the compound binds to a human src SH2 domain and a human fyn SH2 domain, and (b) s e unites a hcp SH domain? human, a Grb domain? Human SH2, a human SHPTP2 SH2 domain, and a human p85 SH2 domain, with a binding affinity that is 100 fold lower than the affinity (Je binding with which the compound binds to said Ic SH2 domain. A preferred aspect of the invention provides a method for triaging autoimmune diseases in a subject, comprising administering to the subject a therapeutically effective amount of a compound that (a) binds to a human L2 SH2 domain with a binding affinity of more than 100 times greater than the binding affinity with which the compound binds to a human src SH2 domain and a human fyn SH2 domain The invention also provides a method for inhibiting allograft rejection in a subject, which comprises administering to the subject an inhibitory amount of allograft rejection of a compound that (a) binds to a human Ic SH2 domain with a binding affinity of more than 50 times greater than, preferably more than 100 times greater than, binding affinity with L to which the compound binds to a human SH2 src domain and a fyn SH? human, and (b) binds to a hcp SH domain? Human,? Grb domain? Human SH2, a SHPTP domain? Human SH2, and a human? 85 SH2 domain, with a binding affinity that is more than 50 times smaller, preferably more than 100 times less than, the binding affinity with which the compound binds to said 1-cl domain SH ?. A preferred aspect of the invention provides a method for inhibiting rejection to loinjorts in a subject, which comprises administering to the subject an inhibitory amount of rejection to allografts of a compound that (a) binds to a human SH2 lck domain with a Union affinity more than 50 times greater than, preferably more than (100 times greater than, the binding affinity with which the compound binds to a human src SH2 domain and a human fyn SH2 domain.) The invention also provides a method for inducing immunosuppression in a subject, which it comprises administering to the subject an induction amount of in? ns pressure of a compound that (a) binds to a human Ick SH2 domain with a binding affinity of more than 50 times greater than, preferably more than 100 times greater than, the binding affinity with which the compound binds to a human src SH2 domain and a human fyn SH? domain, and (b) binds to a human hcp SH? domain, a human Grb? SH2 domain, a SHPTP2 SH2 domain human, and a human SH2 domain, with a binding affinity that is more than 50 times smaller than, preferably (more than 100 times less than, the binding affinity with which the compound binds together). domain 1 ck SH? A preferred aspect of the invention provides a method for inducing mmun osupression in a subject, which comprises administering to the subject an inducing amount (ie, inhibition of a compound that (a) binds to a human 1 ck SH2 domain with a binding affinity of more than 50 times greater than, preferably more than of J 00 fold greater than, the binding affinity with which the compound binds to a human SH2 src domain and a human SH2 fyn domain. The inhibitory activity of the compounds in the different SH-human domains was determined using SH2 domains expressed with F or coli fusion proteins, as is further described in detail in example 11 above. The data shown in the accompanying tables 1 and 2 indicate the ability of the compounds indicated to antagonize the Ick SH2 domain The compounds indicated as selective antagonists of the J ck SH2 domain from the tests in example 11 are tested in known tests (Jas in terms of its ability to induce activity in a "pressor." Preferred tests include: 1) The production test of TL2 - which measures the production of IL2 in T cells in response to various stimuli The most commonly used T cell is the urkat line of human T cells.The .lurkat line is stimulated with a) lertina mi togena (phytohernagl? tim na or PHO) plus inonoforo of calcium or other esters forbol, ob) antibody receptor r of T cells plus phorbol esters. The measurement of TL2 by FLISA, specific for human IL2, indicates the level of activity and 2) The reaction of three mixed human lymphocyte (MLR) - that simulates the response to the foreign antigen. This test measures the response of lymphocytes in an individual to foreign antigens present in the blood cells of another individual. Blood lymphocytes from three different donors (3-way response) are mixed together and incubated in complete growth medium for 4 to 5 days, determining the cell proliferative response by measuring thymidine incorporation. level of activity. The activity in these tests is recognized in the technique, since it correlates with the effectiveness in the treatment of autoimmune diseases in vivo. The activity in these tests is also recognized in the art, since it correlates with the efficacy in the inhibition of rejection to 1? allografts in vivo. The activity in these tests is also recognized in the art, since it correlates with the efficacy in the induction of i nm? Nos? In vivo pressure. Therefore, the present invention provides a method for inducing immunosuppression, which comprises administering a quantity of antagonists of the Ick domain defined in the present invention as an effective amount to induce immunosuppression. To treat a patient in need of pressure, by any conventional route of administration, including, but not limited to, intravenous, intramuscular, oral, subcutaneous, intradermal, and parenteral administration, the effective amount to induce immunosuppression. It is about 0.001 ing per kg to about 10.0 mg per kg of body weight of the subject.The selected dose will be a nontoxic effective amount selected from about 0.001 g per kg to about 10.0 ng per kg. subject, (JOSLS selected will be administered approximately 1 to 6 times a day.) The method of inducing nnunosuppression described in the present invention or also performed using a pharmaceutical composition comprising antagonists of the Lck SH2 domain defined in the present invention, and a pharmaceutically acceptable carrier. The composition may contain between 0.05 rng and 500 rng of an Ick SH2 domain antagonist, and may be constituted in any form appropriate for the p-mode. selected administration. The appropriate compositions for administration include formal forms, such as pills, capsules, granules, tablets and powders, and liquid forms, such as solutions, syrups, elixirs and suspensions. Useful forms for parenteral administration include sterile solutions, emulsions and suspensions. The present invention further provides a method for inhibiting allograft rejection, which comprises administering an amount of lck SH2 domain antagonists as defined herein in an amount effective to inhibit allograft rejection. The drug can be administered to a patient with an allograft or newly implanted, or before receiving an allograft, by any conventional route of administration including, but not limited to, intravenous, intramuscular, oral, subcutaneous, mtradermal and parenteral. to inhibit allograft rejection is from about 0.001 rn.ng to about 10.0rg per g of body weight of the subject. The selected dose will be a selected non-toxic effective amount of about 0.001 ing per kg to about 10.0 mg per kg of body weight of the subject. The selected dose will be administered approximately 1 to 6 times a day. The method of inhibiting the rejection of allografts described in the present invention can also be carried out using a pharmaceutical composition comprising antagonists of the domain 1 ck SH2 defined in the present invention, and a pharmaceutically acceptable carrier. The composition may contain between 0.05 g and 500 mg of an Ick SH2 domain antagonist, and may be constituted in any form appropriate for the selected mode of administration. Labs suitable for oral administration include solid forms, such as pills, capsules, granules, tablets and powders, and liquid forms, such as solutions, syrups, elixirs and suspensions. Useful forms for parenteral administration include sterile solutions, emulsions and suspensions. The drug can be prepared in another manner as a sterile solid composition which can be dissolved or suspended at the time of administration using sterile water, saline or other suitable sterile injectable medium. The vehicles are intended to include inert and necessary binders, suspending agents, lubricants, flavor-izantes, edulcor ntes, preservative-es, dyes and coatings. The optimum doses to be administered can be easily determined by those skilled in the art., and will vary with the particular antagonist of domain 1 ck SH2 in use, the potency of the preparation, the mode of administration, and the progression of the disease condition. The additional factors that depend on the particular patient being treated will result in the need to adjust the doses, including the age, weight and diet of the patient, and the time of administration.

The invention also provides for the use of antagonists of domain 1 ck SH? in the manufacture of a medicament to be used in the treatment of a-to-immune diseases. The invention also provides for the use of Ick SH2 domain antagonists in the manufacture of a medicament for use in the inhibition of allograft rejection. The invention also provides for the use of lck SH2 domain antagonists in the manufacture of a medicament for use in the induction of immunosuppression. The invention also provides a pharmaceutical composition for use in the treatment of autoimmune diseases, comprising antagonists of domain 1 ck SH ?. The invention also provides a pharmaceutical composition for use in the inhibition of allograft rejection, which comprises antagonists of the Ick SH2 domain. The invention also provides a pharmaceutical composition for use in the induction of immunosuppression, comprising antagonists of the lcl-SH? Domain. No unacceptable toxicological effect is expected when the methods of the invention are used in accordance with the present invention. Without elaboration, it is believed that those skilled in the art can, using the foregoing description, utilize the present invention to its fullest extent. Therefore, the following examples will be used only as illustrative and in no way as a limitation of the scope of the present invention. EXPERIMENTAL DETAILS As used in the present invention, unless otherwise indicated, the symbol ° signifies ° C. L-3,5-d-brornotines can be prepared by methods known in the art, for example, as described in "Thyroid Hormones and Anaiog." I. Synthesis, Physical Properties and Theoretical Cal c? Lat lons "EC .lorgensen, Hormone Protems and Peptides, Vol. VI, 1978, Academic Press, NY and references cited in the present invention." L-3, 5-d methyl ester can be prepared? b-orno-N-tnfluoroacetyl-tyrosine (to be used in example? (e) and in example? B (b)) in accordance with the following procedure: "L-3, 5-d was suspended? brornot i rosina (500 g) in ethanol (5 liters) and dry hydrogen chloride was passed through the stirred suspension for 5 hours.The reaction mixture was evaporated to dryness, the residue was suspended in water (4 liters) and the pH was adjusted to 6 with 40% sodium hydroxide.The precipitated precipitate was collected and washed with water to give methyl ester of L-3, 5-d-br-ornotrosols (467 g, 90% ), p.Je f of 201s-203 ° Ester (? 68 g) was suspended in chloroform f? .7 liters) and ethyl acetate (? .7 liters), and then t-p luoroacetic anhydride was added (565 g) for 0.5 hours , keeping the temperature below 35 °. The mixture was left standing overnight, then water (2 liters) was added, and the pH was adjusted to 7 by the addition of saturated sodium bicarbonate solution.The organic layer was stirred, washed with water, dried The residue was recirculated with aqueous ethanol to give L-3 methyl ester, 5-d-bromo-N-tri-fluoroacetyl-1-irose (786 g). , 81%), p. (Je f. Of 136 ° -? °, Scheme 1 as used in example 6 onwards The arnino group of the 4-t rans-arna non et ii-cyclohexyl-carboxylic acid co-1 is protected with a protective-patron group such as with a Boc (Boc anhydride), NaOH, H2O, dioxane) group to form 2, and then coupled with Kaiser's oxnna resin (Kaiser-, E..T., Et al., J. Arn Chem Soc 1985, 107, 7087-7092) using a coupling reagent such as DCC to form 3. The amine is then deprotected under standard conditions (25% TFA, metal chloride) to form 4, and then acylated under standard conditions (such with HBTU, NMM in DMF or DCC or DIC in DMF or NMP) to form 5. The compound is then separated from the ream with amines to form the desired end product 6. The compounds are prepared in accordance with Examples 1 to 10 that follow.

EXAMPLE 1 Preparation of 7-L "D, L-or-amino-a- (4-carboxy in l) acelamido] -3-C2- (5-methyl-l, 3,4-thiadiazolyl) liomethyl 3-cephem -4-carboxylic acid (compound 1) a) 4-hydroxynethanebenzaldehyde To a solution of 1, 4-benzene? carbox? To the residue (50.0.0 g, 0.373 mol) in dry tetrahydrofuran (200 mL) under nitrogen in an ice bath was added dropwise lithium hydride tp (tert-butoxy) -aluminium (104.0 g, 0.410 moles). ) in 500 inL of tet rahidrofurano. After stirring for half an hour in an ice bath, the reaction mixture was poured into? L of cold hydrochloric acid to 2N on ice. The aqueous solution was extracted! < •) with four portions of 800 L of ter. The combined ether layers were washed with sodium bicarbonate solution, brine, and dried. Evaporation of the solvent produced 4F > g The crude material was purified by chromatography (aluminum oxide, ether elution) to provide the title compound as a crystalline material (17.6 g, 35%): p. of f. from ? .5-4ñ ° C. (b) 5- (4-hydroxy? fem) h? dan o? na To a stirred mixture of 4-hydroxy noti lbenzaldehyde (10.0 g, 73.5 nmrnols) and ammonium carbonate ( 17.1 g, 150 mmol) in 11.0 L of 60% aqueous ethanol heated to 50 ° C, cyanide (sodium hydroxide (4.0 g, 81 mmol) in 10 mL of water was added. The mixture was stirred and heated to 50 ° C. -60 ° C for 3 hours and then at 85 ° C for one hour After cooling in an ice bath, the pH of the solution was adjusted by the addition of concentrated hydrochloric acid. overnight, the solids that had precipitated were filtered, washed with water and dried to provide the title compound (L1.0 g, 72%): p.f. (Je J.B9-19fi0C_ (c) 4-hydroxyethyl ester A mixture of the compound of Example 1 (b) (10.9 g, 53 mmol) and barium hydroxide oclahí drato (25.5 g, 81 rnrols) in 125 mL of water, stirred under reflux for 18 h.The reaction mixture was cooled and acidified to pH 1 with sulfuric acid. Concentrated ico, the barium sulfate was filtered and the pH of the filtrate was brought to 6 with lead carbonate. After filtration of the sulfate (lead), the filtrate was saturated with hydrogen sulphide and the bromide sulfide was filtered, the aqueous solution was then concentrated to 100 in.l by azeotropia with ethanol under reduced pressure to provide, after cooling ', the title compound (5.2 g, 54%): p.f of 730-? 31 ° C. d) N-tert-butoxycarhonyl-4-hydroxnnet ll phenylglucine To a solution of 4-hydroxymethyl phenylglycine (8.0 g, 44 rnmoles) yt pet i lamina (8.8 g, 87 immoles) in 160 mL (water, tert-butoxycarbom 1 azide (6.95 g, 49 immoles) was added in 1? 0 rnL of tetrahydrofuran. After stirring overnight at room temperature, the reaction mixture was washed twice with 200 mL portions of ether.The aqueous layer was covered with ether and acidified to pH 3-3.5 with 3N hydrochloric acid in a water bath. The ice solution was extracted with ether and the combined organic extracts were washed with brine, dried and evaporated. The resultant was triturated with chloroform-hexane, and the solid was filtered to provide the. composed of the title (7.7 g, 63%): p. of f. of 139-141.5 ° C. e) Methyl ester of N-tert-butoxycarboru 1-k -hydroxirnet 11 f eni 1-glycine To a solution of the compound of Example 1 (e) (5.6 g, 20 mmol) was added di-ethyl sulfate (3.1 g, 24 g). rnrnoles) and dusopropylamine (5.2 g, 40 mmol) in ethanol (10 inL). The mixture was refluxed for 20 minutes and then treated with 2N aqueous hydrochloric acid. The aqueous solution was extracted three times with ethyl acetate and the combined organic extracts were washed with 5% aqueous sodium bicarbonate and brine. Evaporation of the solvent produced the title compound as an oil (3.2 g, 55%). f) N-ter-hutoxj carboni 1 -4 -carboxa phenethyl ester A solution of the compound of example 1 (e) (0.62 g, 2.1 rnrols) in 50 ml of acetone was treated with excess of Jones reagent (chromic acid at 8N) at 25 ° C. The reaction mixture was stirred at room temperature for 2 hours. The solid was filtered and the excess was decomposed by alcohol and the filtrate was dried over anhydrous sodium sulfate and treated with activated charcoal, the filtrate was filtered and the filtrate was evaporated to dryness. dryness to yield 0.38 g of the titre compound as a white solid: mp 126-128 ° C. g) N, N '-b? S (l - netilet j 1) carbam? Rn? data of 1.1 duneta let i lo The title compound was prepared by reaction of N, N '~ d ?? soprop? lcarbod? pure irnide (1.0 equivalents) with 2-? net? l-2-propanol (1.15 equivalents) in the presence of CuCl (0.01 equivalents) per- 1 day at room temperature, in accordance with the procedure of Santini et al. (3. Org) Chem. 1994, 59, 2261). h) Methyl ester of N-tert-butoxycarbon l-4- (ter-b? toxicarboml) phenyl glycine -.

A solution of the compound of example L (f) (1.0 g, 3.2 rnrnoles) and N, N '~ b? S (l-rneti lela 1) carbamyridate of 1,1-dirnet i letiio (1.3 rng, 6.5 mol) in dry chlorine was stirred at room temperature overnight. The di-isopropylurea was filtered, and the excess of N, N'-b? S (1-dimethylethylcarbamidate of 1-dimetilet was decomposed with water) The layers were separated and the dichloroethane solution was washed with sodium bicarbonate. aqueous sodium at 5% and brine, and dried over anhydrous sodium sulfate, the solvent was evaporated and the residue was treated with diethyl ether. The additional diisopropyl urea was filtered and the organic filtrate was evaporated to yield the compound of the title co or an oil (870 ing, 74%) i) N-tert-butoxycarboni 1- (tert-butoxycarbom 1) phenylglycine A solution of the compound of the pLo 1 (h) axis (760 ing, 2. 1 rnrols) in 10 L aqueous sodium bicarbonate at 5%, 18 measured aqueous sodium carbonate at 5% and 3b inL methanol, was stirred overnight at room temperature for 5 hours. I. The reaction mixture was diluted with water, washed with ethyl acetate and the aqueous solution was covered with ethyl acetate (fresh ethyl ether and acidified to pH = 3N with HCl.) The layers were separated and the aqueous solution was extracted. More than twice with ethyl acetate The ethyl acetate solutions were dried over anhydrous sodium sulfate and evaporated to yield the title compound as a white solid (600 g, 82%): mp. 7-79 ° C. j) 7-am? no-3- [2- (5-met? ll, 3,4-t-idol lazole 11 Hioinetii] 3-cef ern-4-carboxyl t (Je te-butyl A (7-amin. nocefalospor-ter-butyl (prepared from 7-arn-nocephalosporamide acid by reaction with isobutyl ether and sulfuric acid in 1, β-dirnetoxyethane, in accordance with the Blacklock procedure and other os, 3. Org, Chern, 1989, 54, 3907), sodium bicarbonate and 2-rner-capto-5-? net ji -i, 3, 4-1 ladiazole in phosphate pH regulator pH 6.4. The mixture is stirred for 6 hours at 60 [deg.] C. The reaction mixture is prepared by extraction with aqueous hydrochloric acid / ethyl acetate to provide the title compound.k) 7 ~ GD, LW- (t er --- but ox i carboni lamino) -w-T4 - ter-butox ic rbon 11) fem 111 ace tarrudo- - T 2 - (5 -me í i- i, 3,4-t adiazole ii) t lornet a 11 3- ce fem- 4 -carboxyl to (Je te -but lo A mixture of N- t-butoxyiearbona 1 -4- (tor butox i carboni 1) fenilgl i ciña of example 1 (i) (351 rng, l mrno 1), 7 - arn? no-3-r? - (5-? net? l -l, 3, 4 -t ladi zoli 1) t lornet i 11 3 -c fern-4-carboxylate Thirteenth of the example i (j) (36R rng, 1 rnrnol) and DCC (? 12 rng, 1 mmol) in dry dichloromethane was stirred < - (room temperature for 3 hours.) The dicyclohexylurea was filtered and the filtrate evaporated to dryness, the residue was dissolved in ethyl acetate and the ethyl acetate solution was washed with 5% aqueous sodium bicarbonate, sulfuric acid. at 2.5%, 5% aqueous sodium bicarbonate and brine, and dried over anhydrous sodium sulfate.The solvent was evaporated to produce 0. 6 g of the crude product. Purification by 2 A gel chromatography (silica gel (elution with ethyl acetate / benzene 30: 70) yielded the title compound (430 rnG, 61%): mp of p? -112 ° C. CD, L- t ~ am? No- (y- (4-c rboxi in l) a cet knot 1-3-C2- (5-rnet? I- ?, 3, 4-t? Ad? Azole? 1 ) t ío et 11] 3 -cefem-4-carbox? l co A solution of the compound of Example 1 (k) (400 mg, 0.57 mmol) was stirred in 7.2 ml of aculo t r? fl uoroacetic ico and 0.8 inL of thiophenol. The stirring reaction mixture at 0 ° C for 30 minutes and at room temperature for one hour. The solvents were evaporated in a 40 ° C water bath and the residue triturated three times with diethyl ether; the solid product was dissolved in small amounts of rnet a 1, and the product was precipitated by the addition of diethyl ether to yield the title compound (300 mg): p (H f of 170-175 ° C.

EXAMPLE 2 Preparation of L-3,5-di-romo-3 '- (6-oxo-3 (lH) -pyridazylmethyl) -ironron (compound 2) • > ? (a) o ~ rnet oxyphenylacetamide p (? 3.64 g) and 3,6-d? chlor-o? r? Jaz? na (? 3.93 g) were dissolved in dirnet i formaní (dry ja (50 ml) and slowly added in portions sodium hydride (16.23 g of a 50% dispersion in oil) to the stirred solution. The mixture was poured on to excess ice and extracted with dichloromethane, the organic layer was stirred and washed with water, dried with anhydrous magnesium sulfate, passed through charcoal and dried. Evaporated to dryness The residue was crystallized from the chlor-ornetane / pet RP spirit to give 1- (6-chloro-3-p-pdazinyl) -1- (2-inetexyphenyl) -acetonitp (35.5 g. , 85%), p.f of 91 ° -92 °. (B) This filler (33.5 g) was dissolved in concentrated hydrochloric acid (200 i), acetic acid (100 ml) and water (100 nl). ), and the solution was refluxed by stirring, then (6 hours, the solvents were evaporated and the residue was recited from the spirit of ethyl acetate / petrelated paper 2- (6-). oxo-3 (lH) - ?? ri aza n lr net il) -am sol (21.4 g, 77%), p. of f. of 142 ° -3 °. (c) F ta p n da nona (I5.7 g) was dissolved in phosphorus oxychloride (22 rnl), and the solution was clenched by stirring at 55 ° (oil bath) for one hour. The cooled mixture was poured slowly into crushed ice, and extracted with chloromethane. The organic layer was separated and washed with saturated bicarbonate solution (Na sodium, dried over anhydrous magnesium sulfate and evaporated) The residue was combined with a smaller batch (2.16 g of the pipdazmone) and extracted several times. times with the spirit of harrowing oil (60o-80o) .The combined extracts were passed through * vegetable carbon and evaporated to give 2- (6-chloro-3-pn idazinilrnet.il) -ani sol (16.95 g). , 87%), p »de f. (Je 63" .5 (d) To a stirred suspension of iodine-treated iodine (prepared by the treatment of iodine (2.54 g) with nitric acid Filling (5 ml) in acetic anhydride and trifluoroacetic acid) in trifluoroacetic anhydride (25 ml) at -15 ° was added to the above chloropyridine (9.39 g) in hydrochloric acid (20). mi) and anhydride tpf 1? oroacetic co (25 ml), maintaining the temperature below -15 ° C. The mixture was stirred at room temperature overnight, concentrated, and (x) a solution of ethyl acetate (25 g) and sodium perchlorate (15 g) in water (200 ml).

After extracting with chloroform, the organic solution was dried with anhydrous magnesium sulfate and then concentrated to 50 ml and viewed in stirred ether (250 ml). The precipitate was collected and dried to give crude 4'-dimethoxane, 3'-ba s- (- chloro-3-β-dazane-1-neta-1) -diphenyl-iodonium crude (14 g). RMN i H 6 (DMSO-dß) 3.30 (3H, s, --- OCH3), 4.20 (2H, s, --CH2Ar), 7.05 (1H, n, Ar-5H), f.65 (2H, m, PyH) and 8.00 (? H, m, Ar - ?, 6H) "(e) The iodine salt above (12.45 g), methyl ester of L - 3,5-d? bromo-N-tp fl uoroacetiitirose na (8.98 g), traethylarnine (4.05 g) and copper-bronze (1.0 g) were stirred in 5 dichloromethane (50 ml) for 18 hours. The mixture was stirred, washed with aqueous acetic acid, 2N sodium hydroxide and then with water, and then dried with anhydrous magnesium sulfate and evaporated. The residue was combined with a smaller batch (0.72 g of iodine salt) and purified by column chromatography on silica gel (400 g). Elution with ethyl acetate / petroleum spirit (60 ° -80 ° C) [1: 3] gave sterile L-3, 5-di-bromo-3 '- (d-chloro-3-ridazini-l-ll) -0-? Neti.l-N- p 1-uoroacet-il-1-t-ironone (4.0 g) like cinnamon foam. 1H NMR (CDC13) 3.06 (2H, m, Ar CH2CH), 3.84 and 3.93 (6M,? S, -OCH3), 4.19 (? H, s, ArCH2Py), 4.75 (1H,, Ar CH2CH), 6.6 ? (3H, rn, Ar H), 7.17 (? H,, PyH) and 7"? 3 (? H, s, rH). (f) The above bromine compound (3.27 g) was dissolved in acetic acid (20 ml) containing sodium acetate (0.79 g). The solution was refluxed for 1.25 hours, enough water (approximately 2 ml) was added to dissolve the precipitated sodium chloride, and the solution was evaporated to dryness. The residue was partitioned between water and ethyl acetate, the organic layer was removed and washed with water. saturated sodium bicarbonate, then dried with sulfate (anhydrous magnesium and evaporated to dryness). The residue was recrystallized from the spirit of elyl acetate / pelleium (60 ° -80 °) to give the methyl ester of L -3,5-d-bromo-0-met 11 -3 '- (6-oxo-3 (1H) -pyridazylmethi) -N-tr? F-1-acetyl-thironin (2.52 g, 79%), p. of 176 ° -B °. (g) This 1-niter pi (2.45 g) was dissolved in dry di-chloromethane (40 ml) and cooled with stirring to 0 ° C. Boron bromide (6.46) was added. g) in di chloromethane (3 ml) A reddish precipitate formed, the mixture was stirred at room temperature for 1.5 hours, and then ice was added. The mixture was filtered, the precipitate was collected and dissolved in hi drox gone from sodium to N (30 rnl). The solution was heated on a bath (steam for 15 minutes, then acetic acid pH 5 was added, and the mixture was cooled, the resulting precipitate was collected, washed and dried to remove the precipitate.; \ a r l. - 9, 5-di bromo-3 '- (6 -oxo- (IH) -p i p dazi ni lmet.il) -t i ron ina (1. I g, 88%), p. of f. of? 78 ° - o (decanted). Alternatively, instead of using the perchlorodate salt prepared in (d) for reaction with step (e), the iodonium rifl ioacetate salt prepared as follows: Iodine suspended (159 g) ) in anhydride t ri f luoroacet i co (1 liter) and stirred under nitrogen while adding smoking nitric acid (350 ml) for 1.5 hours, maintaining the temperature between 36 ° and 40 °. Tffluoroacetic anhydride (300 mL) was then added, and the mixture was kept at 40 ° under a stream of nitrogen until all the oxides of nitrogen were removed, and then left to stand at room temperature overnight. . The solvent was then removed under reduced pressure and the residual solvent was removed by azeotropy with tp fluoroacetic anhydride (? X 300 rni). The pale yellow residual solid was then suspended in trifluoroacetic anhydride (1.2 liters) by stirring and cooled to -20 °. A solution of 2- (6-chloro-3-) was then added dropwise. p dazin lrnelii) ana sol (600 g) in p-fluoroacetic acid (1.2 liters), maintaining the emperature between -10 ° and -20 °. The mixture was stirred at -10 ° for 1 hour and at room temperature overnight, then the solvent was removed under reduced pressure and the residue was poured into a solution of sodium sulfate (3.5 kg) in water (20 liters) under agitation. The pH of this mixture was adjusted to approximately pH 2 using dilute aqueous sodium hydroxide, then the mixture was extracted with dichloromethane (2 X 3 liters, 1 x 2 liters), the organic extracts were combined, dried (MgSO.sub.0 < I), they were filtered and reduced in volume up to? After the mixture was added to vigorously stirred diethyl ether (1 liter), the dark gray precipitated solid was filtered, ether-dried and dried in a furnace (Vacuum at 40 ° for 6 hours to give the 4,4 '-d? etox? -, 3' -bis- (ñ-chloro-3-p? r?) fluoroacetate Jaza ni linet ii) di feni lyodonium (8.14 g, 90%), p. of f » 145 ° ~ L47 ° C. The additional reaction of salt using procedures analogous to those described in 2 (e), (f) and (g), gives l L ~ 3,5-d? bromo-3 '- (6 -oxo-3 (1H) -pyridazinyl-rnet il) t? ron? na required.

EXAMPLE 2fl Preparation of L-3,5-dibromo-3 - (6-oxo-3 (lH) -pyridazinyl-roetidinothyronine (compound 2) (a) Dissolved 2- (6 - eloro-3-p? R? Daz? N? Lrnet i) aru sol (prepared as described in Example 2 (c) (2.35 g) in dry dichlor-ornetane (20 inl)), and cooled while stirring at -50 °. Boron bromide (3 mL) was then added dropwise, and the solution was allowed to warm to room temperature.

After 0.5 hours, the orange reaction mixture was poured into ice / water (200 ml) and acetone was added to dissolve the precipitated solid. The mixture was extracted with d chloronetane, the organic extracts were separated, washed with water, dried and evaporated. The residue was recollected from Ethyl acetate and spirit (Oil for Jar 2- (6-chloro-3-pipdazyl-D-phenol (1.75 g, 80%), p.of 132 ° -132.5 °.

Analysis found: C, 59.nl; H, 4.13; N, 12.47; Cl, 16.09; C11H9CIN2O; requires: C, 59.87; H, 4.11; N, 12.70; Cl, 16.07%. (b) To a stirred solution of this phenol (2.4 g) and 2 * 0 urea (14 g) in aqueous sulphuric acid (100 i) at 75%, was added Slowly t-butanol (17 ml). The mixture was stirred well and additional amounts of t-butanol were added after 4 hours (18 ml), 24 hours (5 ml) and? 8 hours (20 nl). After 120 hours, the mixture was poured into water, the organic phase was separated and discarded and the aqueous phase was extracted completely with ether. The combined ether extracts were washed with saturated brine, then dried and evaporated, the residue was recited from ether and petroleum spirit to give 2, 4-d-1-butyl. -6- (d-chloro-3-p? Pdaza or 1 met ll) phenol (3.43 g, 94%), p.of f of 143.0 ° -143.5o Analysis found: C, 68.32; H, 7.51; N, 8.36; Cl, 10.89; C19H25CIN2O.

C, 68.56; H, 7.57; N, 8.41; Cl, LO., 65%). (c) A solution of this phenol (1.95 g) and methyl ester of L - 3, 5 ~ d? Bromo-N-trifluoroacet l t-lyosine (3"24 g) in 1-ether diethyl ether (100 ml) was stirred under argon < _ room temperature and then treated with active manganese dioxide (1 X 5 g). After 4 hours, the mixture was filtered, and titanium tetrachloride (5 nl) was added. After 2 minutes, the dark solution was treated with water and extracted well with acetate (ethyl ether). The organic extracts were combined, washed with brine, dried and evaporated. The residue was chromatographed on silica gel with the spirit of petroleum and ether or eluent to give-methyl-methyl-I-3,5-oxo-5'-t-butal-3 '- (6-chloro-3-p) dazi 1 useful) -N-trifluoroacetyl roman (2.31 g, 55%), p.of 84 ° -06r > "(d) A solution of this dibrornot ironin (2.76 g) and anhydrous sodium acetate ( 0.78 g) in acetic acid (25 ml) was heated to reflux for 10 hours, then cooled and poured into ice-water.The precipitated solid was filtered, dissolved in ethyl acetate, dried and evaporated to give S-methyl ester of L-, 5- i bromo-5'-t-butyl-3 '- (6 -oxo-3 (1H) -pin dazi or Irnet ai) - N-tr? fluoroacet? lt? ronna (2.4g, 55%), p.f., 112 ° -115 °. (e) A solution of this pa ri aza none (0.200 g) and Hbr (1 ml) in glacial acetic acid (20 ml) was heated to reflux for 3 days. Then, the solution was cooled, diluted with water, basified with aqueous sodium hydroxide solution to 2N and brought to pH 6 by the addition of acetic acid. The precipitated solid was filtered, washed and dried to give 1.-3,5-ibomo-3 '- (6 -oxo-3 (1H) -pydale / lyridinyl) (iromna) (0. LOO g, 65%), p. of f. of 245 ° -247 ° (decanted), spectacle roscopicarnent and identical with that previously isolated (example? (g)).

EXAMPLE 2B Preparation of L-3,5-dibromo-3 '- (6-oxo-3 (lH) -pyridazinylmethyl) -ironron (compound 2) (a) To a solution of t ri »p iodo luoroacetate (prepared by treatment of iodine (10.0 g) with fuming nitric acid (? G "95 rnl) in acetic anhydride and acid f 1-uoroacetic acid) in acetic anhydride (50 ml), cooled to -10 °, was added dropwise a solution of 2-methoxy-benzylcyanate (30.0 g) in t-fluoroacetic acid (60 rnL) and acetic acid-acetic acid (30 ml). The temperature of the mixture was kept below 0 ° to the addition, and then the mixture was allowed to stand at room temperature overnight. The mixture was then poured into an ice-cold, well-stirred solution of sodium acetate (100 g) and sodium perchlorate (13.0 g) in water (600 ml). The solid which was precipitated was filtered and washed with water and diethyl ether to give 3, 3'-d? C? Ano? Net? L-4,4'-dimethoxy-di-phenyl yodon per-chlorate or as a fine suede-colored solid (23.6 g, 57%), p. (Je f. Of 183 ° -4o (from inet anol / diotyl ether). (B) A solution of this iodone salt (? 2"6 g), L-3, 5-d-methyl ester? Bro? no-Nt? 1-chloroacetyl t-irosine, tpeti lamina (6.1 g) in di-chloromethane (300 ml) was treated with copper-bronze (1 g), and the mixture was stirred at room temperature for -20 hours, the mixture was then filtered and the nitrate was washed with aqueous N-chlorohydric acid (2 X 200 mL), water (X 100 mL) and aqueous sodium hydroxide solution at 2N (3 X 200 mL), and then the non-aqueous solution was dried over magnesium sulfate and evaporated under reduced pressure.The oily residue was dissolved in dichloromethane (30 ml) and poured into petroleum spirit. The solid precipitate which was filtered and recrystallized from the spirit of di chloro-methane / oil gave rnet-l ico ester of L-3, 5- d? brorno-3 '-cianornet ji -0-? net 11 -N-tp f luoroaceti lt ironina as a solid colorless crystal, p of f "¡Je 148 ° -149 °. The mother was chromatographed on silica gel to obtain more quantities of this compound (total = 8.05 g, 31%). (c) To a solution of this d brornotironin (120 rng) and 3, 6 ~ d? chloro? pdazin (31 rn.ng) in dry irnetylforrnarnide (2 ml), sodium hydride (30 mg of 50% suspension in oil), and the reaction mixture was allowed to stand at room temperature for 50 minutes. Then it was washed with ice, and the aqueous mixture was extracted with diclorornet, and the organic solution was washed with saturated brine, then dried and evaporated. The residue was cured on a preparative silica gel chromatography plate from which 3,5-d-brorno-3 '- (1, - (6-chloro-3 -pa) methyl ester was isolated. ri dazmil) -1-cyanomethyl) - -me i 1 -Nt ri f luoroacet? l ti rom na (5 mg). NMR * H d (CDCl3) 3.12 (1H, rn), 3.27 (1H, rn), 3.79 (3H, s), 3.86 (3H, s), 4.86 (1H, m), 5.80 (IH, s), 6.7 ? (IH, dd), 6.83 (1H, d), 7.04 (1H, d), 7.15 UH, in broad), 7.37 (? H, s), 7.50 (? H, dd). The elaboration of this intermediate by standard methods gives the title compound.

EXAMPLE 3 Preparation of B, 8-ethylenedioxy-2,3,7,8,9,10-hexahydro-4-elylylH-benzo [b] thieno [2,3-b3pyrazolo [3,4-d] pyridine- 3-one (compound 3) (a) 2 ~ c? ano- 2 - (4, -eta 1 end IOX ícicl ohex il i den) cet ato de e ilo To a mixture of rnonoctivity to 1,4-cyclohexanedione (? 5 g, 0.160 mol) and ethyl cyanoacetate (18 g, 0.160 moles) in toluene (400 rnt.), diethylamine (? 5 g, 0.337 moles) was added dropwise at room temperature. The reaction mixture was refluxed overnight (using a De n Starl apparatus. The mixture was cooled and partitioned with ethyl acetate and saturated aqueous sodium bicarbonate (3 x). dried over sodium sulfate, filtered, concentrated in vacuo and dried from ethanol to yield the title compound as a white solid (15.3 g, 45%): p. 8l ° C; NMR Ul (400 MHz, CDCI3) or 4.28 (q, 3 = 7.2 Hz, 2H), 4.00 (s, 4 H), 3.18 (t, 3 .-. 6.5 Hz., 2 H), 7.85 (t, 3 - ~ - 6.5 H,? H), 1. 39 (t, 3 = 6.5 HZ, 2 H), L.8? (t, 3 = 6.5 Hz,? H), 1.35 (t, 3 = 7.1 Hz, 1 H). (b)? -a? n? no-6, 6-et? lend? ox? - 4, 5, 6, 7- et al., P-benzoCb] t? Ofeno-3-carboxyethyl ethyl acetate To a suspension of the compound of Example 3 (a) (10 g, 45.6 mmoles), sulfur (1.6 g, 50 .molms) in ethanol (164 rnL) at 0 ° C, a solution of diet 1-Lamine (3"6 g, 50.2 mmol) in ethanol (26 mL) was added dropwise. The resulting solution was stirred at 0 ° C for 1 hour, and then at room temperature for 3.5 hours. The reaction mixture was quenched with ethyl acetate and separated with a saturated solution of aqueous ammonium chloride. The aqueous phase was extracted with ethyl acetate and the organic extracts were washed with brine. The ext. * -The organics were dried over sodium sulfate, filtered, concentrated in vacuo and chromatographed on silica gel (gradient from 5 to 10% CH 2 Cl 2, EtOAc) to yield the title compound as an oil (11.3 g. , 87%). 1 H NMR (400 MHz, CDCl 3) 6 4.25 (q, 3 = 6.6 Hz, 2H), 4.02 (s, 4 H), 2.92 (t, 3 ^ .5 Hz,? H), 2.74 (s, 2H), 1.90 (t, 3 = 6.6 Hz, 2H), 1.33 (1, .3 = 7.1, 3H). c) 7, 7-Ft 1 l nedioxi - 4 h drox? -2 - rnet l -5,6,7, 8-t e <; ra-h? dr-obenzoCb.1 t? enormous2, 3- b]? r-? dma- 2-carboxylic acid ethyl ester To a solution of compound of Fjernplo 3 (b) (11.2 g, 39.5 mol) in toluene (307 ml) at room temperature were added 12.4 g (39.5 moles) of 3-ethoxylated crotonate and 0.78 g (3.4 moles) of caustic acid. The reaction mixture was heated to reflux for 3.5 hrs using a Dean StarL trap.

The mixture was then cooled and added dropwise to a freshly prepared solution of 1 M sodium diet (49 rnl). Once the addition was complete, the reaction mixture was refluxed for 3 hr. The mixture is cooled and the precipitate is filtered. The salt was dissolved in 60 ml of methanol, 500 ml of water and 2 ml of acetic acid were added thereto to produce a solid title compound (10.4 g, 76%): mp 94-94 ° C; H NMR (400 MHz, CDCL3) d 4.4825 (q, 3 = 7.1 Hz, 2H), 4.06 (s, 4 H), 3.26 (t, 3 = 6.5 H, 2H), 3.02 (s, 2H), 2.81 ( s, 3h), 2.02 (1, 3 = 6.5 H, 2H), 1.47 (t, 3 = 7.1, 3H); MS (EST) m / z 350 L "M + H1 +; Anal Caled. For C17H19NO5S; C, 58.44; H, 5.48; N, 4.01; Found: C, 58.34; H. 5.46; N, 3.86. 7, 7 -Ft? Le Ox? -4 -tr 1 f luorornet 11 sul fon 1 loxi -2 -methyl 1 -5,6,7, 8-tetrahydrobenzoCblt? EnoC2, 3 -bl pin di na -3 Ethylcarboxylate To a solution of compound of example 3 (c) (5.0g, 14.3 moles) in 50 ml of pipdine 4.0, 14.2 moles of tpflic anhydride are added dropwise. The sulfate elution (aqueous copper (3x) followed by water (2x) and saline (? x) The organic layer evaporated, dried over anhydrous sodium sulfate and concentrated in vacuo Purification by c ro? na tog Intermittent light (silica gel, 1: 1 hexane: ethyl acetate) yielded the title compound as a light yellow solid (3.7 g, 54%): p 133-134 ° C; 1 H NMR (400 MHz, CDCI3) &4.43 (q, 3 = 7.2 H, 2H), 4.06 (s, 4H), 3.16 (t, 3 = 6.5 Hz, 2H), 3.10 (s,? H),? .77 (s, 3H), 2.03 (t, 3 = 6.8 Hz, 2H), L.41 (t, 3 = 7.1, 3H); MS (FST) rn / z 482 TM + H] +; Anal. Caled, for C18H18F3NO7 2; C, 44.90; H, 3.77; N, 2.91; Fncont: R, C, 45.03; H. 3.62; N, 2.89. e) 8,8-Et? leox? -2,3,7,8,9, 10 ~ hexaha dro-4-? nef to 1-lH-benzo [b] f? enoC2,3-bl? r- azolor3,4-dipi p din-3 -one To a solution of the compound of example 3 (d) (2.4 g, 5.0 mmol) in 40 ml of methanol at room temperature was added 4.1 g (8? .3 mol) of monohadrate of hydrazine. The reaction mixture was heated to reflux for 3 hrs. It was cooled. The mixture was then partitiobetween the aqueous buffer 30. of pH 7 and ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered, concentrated in vacuo and recrystallized from ethanol / ethyl acetate to yield the title compound as a light yellow solid (0.99 g, 60%). 1 H NMR (400 MHz, U MeOH) 6 4.05 (s, 4 H), 3.15 (t 3 - B.5 Hz, 2 H), 3.04 (s, 2 H), 2.82 (s, 3 H), 2.06 (1, 3 = 6.5 Hz, 2H); MS (EST) m / z 318 [M + H1 +; Anal. Caled, for Cis His N3 O3 S.0.25H20: C, 55.9 ?; H, 4.85; N, 13.05; Found: C, 55.85; H. 4.75; N, 1 .30.

EXAMPLE 4 Preparation of 4-L "4- (4-methylbenzoyl) benzoyl-3-enylacetaldehyde (Compound 4) a) Benzoate of rnet 114 - (-mel 11 benz or 11) A solution of 6.2 g, 31 mol of chloride of melil tere ft aloi lo in 250 ml of toluene was treated with 8.0 g, 60 mol of aluminum chloride at 0 ° C under an argon atmosphere. The stirring mixture was heated at 35 ° C for 0.5 hr and then added slowly to 100 g of ice, followed by 150 ml of ethyl acetate, 50 i of conc. HCl was extracted twice with 100 ml of ethyl acetate. The combiorganic portions were washed with 2 x 75 ml water and L x 75 ml saline, dried over magnesium sulfate, filtered, and concentrated to give a white solid. Recrystallization from ethyl acetate and hexane afforded 6.0 g (79%) of the title compound as white needles, mp. 117-U8 ° C; iH NMR (400 MHz, CDC13) 6 8.15 (d, 3 = 8.35 Hz, 2H), 7.83 (d, .3 = 8.30 H, 2H), 7.73 (d, 3 = 8.18 Hz, 2H), 7.31 (d, 3 = 8.04, 2H), 3.98 (s, 3H), 2.46 (s, 3H); MS (ESI) Ifl / Z 255 L "M + H] +" b) 4- (4-Met? Lbenz.o? L) benzoic acid A stirring solution of 5.00 g, 20.0 moles of benzoate < -ie rnetil 4 - (4-rnet II benzoyl) in 150 rnl of 2: 1 THF: water at 65 ° C was treated with 2.0 g, 48 mol of lithium hydroxide rnonohi drate, then the nebulous reaction mixture was allowed to settle. The mixture was cooled for 0.5 h at room temperature and treated with 300 i of 10% ethyl acetate (HCl HCl (aq)., washed with 2 x 50 ml of water and 1 x 50 ml of saline, dried over sulfate (magnesium), filtered and concentrated to give a white foam, NMR (400 MHz, CDCl 3) d 8.22 (d, 3 = 8.34 Hz, 2H), 7.81 (d, 3 = 8.31 Hz, 2H), 7. 73 (d, J = 8.15 Hz, 2H), 7.31 (d, 3 = 8.00, 2H), 2.46, c) 4 - [4- (4-Met-il-benzoyl-1) -benzol-1 alone A solution of the compound of example 4 (b) in 250 ml of toluene was treated with? 1.8 g, 0.17 moles of oxalyl chloride.

The resulting mixture was refluxed for 2 hrs., Then concentrated and allowed to stand overnight with 0.5 mrn Hg and at? 5 ° C. This solid was then dissolved in 100 ml of anion and treated with 11.2 g, 34 moles of aluminum chloride at 0 ° C. The mixture was heated at 70 ° C for 1 hr. and then slowly added to 100 g of ice, followed by 150 i of ethyl acetate, 50 ml of conc. HCl and 50 l of water. The phases were separated and the aqueous portion was extracted with 100 rnl of ethyl acetate. The combined organic extracts were washed with? x 75 ml of water and 1 75 ml of saline, dried over magnesium sulfate, filtered and concentrated to a white solid. Replantation of ethyl acetate and hexane yielded 4.6 g (70%) of the title compound, mp. . 167-169 ° C; 1 H NMR (400 MHz, CDCl 3) 6 7.8-7.9 (rn, 6H), 7.77 (d, 3 = 8.06 Hz, 2H), 7.32 (d, 3 = 8.01 Hz, 2H), 7.0 (d, 3 = 8.74 Hz , 2H), 3.92 (s, 3H), 2.47 (s, 3H); MS (FSI) m / z 331 (MH-t) + "d) 4-C4- (4 -Met ilbenz.oil) benzo? 1] phenol 700 g, 2.1? moles of a solution of the compound of example 4 (c) with 1.Og, 7.5 moles of aluminum chloride and 7.0 rnl of 1.0 M boron trichloride solution in dichloromethane were heated to reflux for 1 hr. Then the mixture was diluted with 100 ml of di-chloromethane and washed with 1 x 5 ml of 10% HCl (aq) and 1 x 25 ml of saline solution. Magnesium sulfate, filtered and concentrated to a dark residue which was subjected to intermittent chromatography (silica gel, elution with 1: 1 ethyl acetate: hexane) to yield 550 g (82%) of the title compound. NMR (400 MHz, CDCl 3) 6 7.8-7.9 (rn, 6H), 7.77 (d, 3 = 8.05 Hz, 2H), 7.32 (d, 3 = 8.01 Hz, 2H), 6.93 (d, 3 = 8.6 Hz, 2H), 2.47 (s, 3H) o) tp fluoromethoisulphonate-4 - (4-methylbenzoyl) benzoli] phenol 1 A solution of 3.0 mg, 1.0 mol of the compound of example 4 was added. (d) in? 0 ml of THF with 40 rng, 1.67 moles of sodium hydride and 500 rng, 1.40 moles of N-phene Itp f1? orometanosul fo mi da at 0 ° C. The reaction mixture then it was allowed to warm to room temperature and then it was stirred for 18 hours. at room temperature. The reaction was then partitioned between ethyl acetate and saline; the layers were separated and the organic extract was dried over magnesium sulfate and evaporated. Purification by means of intermittent chromatography (silica gel, 80:20 hexane: ethyl acetate) afforded 300 mg, 66% of the title compound, rnp. 180-181"C; 1 H NMR (400 MHz, CDCl 3) 7.96 (d, _J = 8.fi Hz,? H), 7.89 (s, 4H), 7.76 (d, 3 = 8.1 Hz,? H), 7.45 (d, 3 = 8.6 HZ, 2H), 7.33 (d, 3 = 8.1 Hz, 2H), 2.47 (s, 3H) 20 f) Fen lacetaldeh do 4-r4 ~ (4-Met? lbenzo l) benzo l ] A solution of the compound of example 4 (e) in 10 ml of DMF 0.35 ml, 1.12 moles of tin to the lotpbuta, 55 ng, 0.077 moles of palladium (II) bisitphenyl phine chloride were added to 445 mg, 1.0 moles of a solution of the compound of example 4 (e). ) and 125 mg, 2.95 moles of ? 5 lithium chloride. The reaction mixture is heated at 90 ° C for 1 hr. , and then it was allowed to cool to room temperature 4? before dividing it between ethyl acetate and saline. The organic layer was dried over magnesium sulfate and concentrated to a residue consisting of the desired product, propene 3-L * 4-K- (4-meth i l-benzoi 1) benzo-11-phenyl 11-1 and derivatives that contain tin. This material was subjected to intermediate chromatography (silica gel, elution with 95: 5 hexane: ethyl acetate) which removes most, but not all, the impurities. A second chromatography (gradient 5% to 10% (hexa acetate and IOL in hexane) yielded 100 mg (30%) (pure olefin, which was then dissolved in 3: 1.16 mmol dichloromethane / methanol at -7 ° C. 0 Ozone was bubbled through this solution for 5 minutes, the reaction was quenched with five drops of dimethylsulphide and continued stirring for 30 minutes at -78 ° C. The solvent was evaporated and the resulting material was purified. by means of intermittent chromatography (silica gel, elution with gradient 85:15 to 75: hexane: ethyl acetate) to produce 40 mg, 40% of the title component, rnp. 188-190 ° C; 1 H NMR (400 MHz, CDC13) 6 9"83 fs, 1 H), 7.88 (s, 4 H), 7.86 (d, 3 = 8.1 Hz, 2 H), 4.03 (s, 4 H), 3.73 (s, 3 H), 3.76 (t, J = 6.0 H, 2H), 3.00 (s, 2H), 2.80 (s, 3H), 2.03 (t, 3 = 6.0 Hz, 2H); MS (ESI). / z 343 (M + H) +. 4 - . 4 -J EXAMPLE 5 Preparation of 1,4-dimethyl-8,8-elylenedioxy-2,3,7,8,9,10-hexahydro-lh-benzoCb] thienoC2,3-b] pyrazoloC3,4-d3piri in-3-one (Compound 5) 1, 4 - Di inelil -8, 8-et? Iemed? Ox 1-2,3,7,8,9,10- hexahydro-lH-benzorbll? EnoC2, 3-hTp? Razol oT3, 4-dlp? Pd ? n-3-one A solution of 0.4 g, 0.83 mol (Jel compound (Jel example 3 (d) in 6.7 ml of ethanol at room temperature with 0.16 g, 3.45 moles of meph i idrazine was added and the mixture was stirred. The mixture was cooled to reflux and the precipitate containing 150 mg of the crude residue was filtered, the filtrate was evaporated and purified by means of intermittent chromatography (silica gel, elution with 80:20: 5-Acetate (ethyl acetate, acetic acid) to provide the title compound as a yellow solid (22 mg) iH NMR (400 MHz, CDC.I3) d 4.03 (s, 4H), 3.73 (e, 3H) , 3.76 (t, 3 = 6.0 Hz, 2H), 3.00 (s, 2H), 2.80 (s, 3H), 2.03 (1, 3 = 6.0 Hz,? H), MS (ESI). / Z 33? ( M + H) +.

EXAMPLE 6 Preparation of 4-carboxy-benzophenone-4-carboxamido-trans-4-methyl-cyclohexyl-N-hexylcarboxamide (Compound 6) a) Acid N-t-but ilox i carhon l -t rans- 4-a? n? N-1-cyclohexy-c-boxylic acid, 100 nl, 100 moles of aqueous sodium hydroxide were added to a solution of 9.0 g, 60 moles of 4-trans-arninonet-1-cyclohexyl acid. carboxylic, in 100 ml of dioxane, 100 ml of water at 0 degrees C. 15.9 g, 66 moles of Boc anhydride were added and the reaction was heated and stirred overnight. The solution was concentrated to 50 rnl, then diluted with 100 ml EtOAc and acidified to pH 2 with aqueous KHSO. (IN). The organic layer was later extracted with 100 mL of water, and the organic was concentrated in vacuo.The solid was recrystallized from FtOAc / hexane to yield 9.2 g + 3.4 g (second crop) of a white solid. 80% yield) MS (ES) m / e 242 TM + H1 +. b) Carboxylate N-t-b? tiloxy carboml-t rans-4-a inomet ii cyclohexyl (ream oxirna Kaiser ') 20 g were added. 0.7 rnoles / g charge, Advanced Chern Tech, Kaiser oxime resin to a solution of 5.0 g, 20 moles of N-t-but-lox acid? carboni 1 - trans-4-arn? nornet i L cyclohexyl carboxylic acid and 4.4, 20 moles of DCC in 200 ml of metalliferous chloride and mixed gently to rt dur-ante overnight. The solid was filtered and collected, then washed with 5 x 100 i of full met chloride. The ream was then resuspended in 200 ml of ethylene chloride, and 5.0 g, 20 moles of Ntb-tyloxycarbonyl-trans -4 -aminoneti-o-cyclohexyl carboxyl-CLC acid and 4-4 g, 20 moles of CUC were added and the reaction was I mix gently overnight at rt. The solid was filtered and collected, then washed with 5 x 100 mL of methylene chloride, then dried overnight under vacuum. TR (KBr, crn-l) = 1820, 1771, 1520. c) Carboxylate t rans- 4-ami nornet? I cyclohexyl (resin oxnna Kaiser) 200 mg of carboxylate trans-4-aninornetyl cyclohexyl (resin oxime Kaiser) were suspended in 3.0 ml of DMF and 0.2 ml of morpholine N-methyl and 190 mg, 0.7 mols (benzophenone dicarboxylic acid and 265 rng, 0.7 mol) were added and the reaction was mixed gently for 3 hrs. The solid was filtered and collected, then it was washed with 3 x 20rnl of DMF, then 3 x 20 rnl of water, then res? spendio in 3.0 ml of DMF and 0. 1 ml of morpholine N-methyl and 0.35 moles of benzophenone dicarboxylic acid and 0.35 moles of HBTU were added and the reaction was mixed gently for 3 hrs. The solid was filtered and collected, then washed with 3 x 20 ml of DMF, then 3 x 20 ml of water, then 5 x 20 ml of magnesium chloride, and then dried under vacuum. e) Carboxamide -carboxybenzophenone- 4- c rboxi ama. or ™ trans-4-rnethyl-cyclohexyl-N-hexyl 200 mg of carboxanide 4-carboxy-benzophenone-4-carboxyia (Jo-t r-ans-4-meth? i - i ciohexyl-N-hex) was suspended. The reaction was mixed gently for 3 h after it was filtered, and the filtrate was concentrated in vacuo to yield the title compound: MS in 3.0 nl of full metal chloride and 0.3 moles of hexylamin was added. ÍES) rn / e 493 TM + Hl +.

EXAMPLE 7 Preparation of 4-nitro-benzamido-lrans-4-methyl-cyclohexyl-N-hexylcarboxamide (Compound 7) Carboxarnide 4-nitro-benzarm do-t rans-4-rnet? L -ci clohex l-N ~ hex? L The title compound was prepared following the procedure of Example 6 (a) - (e), except that 4-nitrobenzoic acid is replaced by 4,4'-benzophenone dicarboxylic acid: MS (ES) rn / e 390 CM + H1 + EXAMPLE 8 Preparation of 4-Acetamido-benzamido-trans-4-methyl-cyclohexyl- Nl- (amino-R-2- (methoxy Methyl) -pyrrolidine) carboxamide (Compound 8) The title compound was prepared following the procedure of example 6 (as) - (e), except that 4-acetarn? Jo-bezo? Co is replaced by 4,4 '-benzophenone di carboxylic acid and R- 1 -arn? No-2- (etoxi rneti l) -pi rrol id? Na (RAMP) per hexilarnina: MS (FS) rn / e 331 CM'H] + » EXAMPLE 9 Preparation of 4-formyl-E-cinnamido-lrans-4-methyl-cyclohexyl-N- (propyl) carboxamide (Compound 9) The title compound was prepared following the procedure of example 6 (a) - (e), except that 4-formyl cinnamic acid was replaced by 4,4'-benzophenone acid (Jicarboxili co and propí lamina by hexi lamina: MS (ES) rn / e 357 CM + H1 +.

EXAMPLE 10 Preparation of 2,3,7,8,9-hexahydro-4-methyl-1H-benzo [b3-tienoC2,3-b] pyrazoloC3,4-d3-pyridin-3-one (Compound 10) THE L5 a) Ethyl-4-hydroxy-2-methyl-5,6,7,8-tef-rahydrobenzole "b] i ene [2, 3-b 1-pin-d-carboxylate] A solution of 8.9 g, 39 moles of et il? -? 0 apuno-4,5,6, 7-tetrahydrobenzo? "B3t? Ofeno-3-carboxylate and 12.4 g, 78 moles of the 1-3-etox? Crotonate in 300 ml of toluene with 0.i ~ 8 g, 3.4 moles of canposul-fomic acid and the reaction mixture was heated to reflux for 3 hrs using a N-Starl trap. -. The mixture was then cooled to room temperature and Subsequently, it was treated with a freshly prepared IM solution of 48 ml, 48 moles of sodium ethoxide. After the mixture was cooled, concentrated and the residue was dissolved in ethyl acetate, were added? ml of acetic acid, the solvent was evaporated and the resulting sole was triturated with methane 1 to yield 8.4 g, 74% of the title compound as an off-white solid: rnp 140 ° C; 1 H NMR (400 MHz, CÜCI3) d 4.48 (q, 3 = 7.2 Hz, 2H), 3.04 (br s, 2 H), 2.81 (s, 3H), 2.80 (brs, 2H), 1.87 (brs, 4H), 1.47 (1, 3 = 7.2 Hz, 3H); Anal. Caled, for C1SH17NO3S: C, 61.83; H, 5.88; N, 4.81; Found: C, 61.69; H. 5.81; N, 4.73. b) Ft? i-4-Chloro-2-rnet? l-5,6,7,8-tetr-ahKJrobenzorb] t? enoC2, 3-bl? r? d? na-2-carbox? lato Reflux a solution of 8.0 g, 27.4 moles of the title compound (Example 10 (a) in 100 ml of phosphorous oxychloride for 3.5 hrs. Phosphorous oxychloride was removed under vacuum and the residual oil was dissolved in ethyl acetate, washed with 5% sodium bicarbonate and dried over anhydrous sodium sulfate The evaporation of the solvent afforded the title compound with 8.5 g, 95% crystalline solid: mp 65-66 ° C; 1 H NMR (400 MHz, CDCI3) 6 4.47 (q, 3-7.1 Hz, 2H), 3.10 (br s, 2 H), 2.85 (hr s, 2H), 2.60 (s, 3H), 1.89 (br s, 4H), 1.43 (1, 3 = 7.1 Hz, 3H); Anal. Caled, for C? 5H? 6ClN02S.0.125H2 ?: C, 57.73; H, 5.25; N, 4.49; Found: C, 57.69; H. 5.08; N, 4.30. c) 2,3,7,8,9, 10 -Hexahí d ro- -mi 1 - 1H - benzo í b] 11 eno [2, 3 - b] p 1 razolo3, 4 - d] p 1 r 1 di n-3 -one A solution of 2.0 g, 6.4 moles of the compound of Example 10 (b) in 50 ml of inerthanol was treated with 10 ml of hydrazine monohydrate and the resulting mixture was heated at reflux for 16 hrs. The reaction was poured into dilute aqueous hydrochloric acid and the title compound was precipitated as 1.8 g of yellow solid? 1 H NMR (400 MHz, d-4-MeOH) d 3.01 (br s, 2 H), 3.00 (s, 3H), 2.9? (Br s,? H), 2.00 (br s, 4H), Anal.Called, for C13H13N3OS.HCI .0.25H20: C, 52.00; H, 4.87; N, 13.99; Found: C, 51.92; H. 5.01; N, 13.70.

EXAMPLE 11 PROTOCOL PflRfl Lfl DETERMINATION OF THE POWER OF DOMAIN ANTAGONISTS SH2 The inhibitory activity of the compounds in the different human SH2 domains was determined vi. using SH2 domains expressed as fusion proteins in E. co 11 The SH2 domains used in the present were the human forms of the SH2 src domain, SH domain? Grb2, domain SH2 lck, domain SH2 fyn, domain SH-PTP2, domain SH2 pB5 and domain SH2 hcp. The fusion proteins containing the src, Lck and hcp domains were expressed as the general sequence: DETl -DET2-spacer-the .-- SH2, where DFT1, DET2, spacer, ek and SH? They described below. DETl ("definite epi stop tag") (SEQ ID NO: 1) is an amino acid sequence found in the Human Immunodeficiency Virus Type 1 (VTH-1) enveloping protein gp 120 (or gp 160). monoclonal antibodies for vain epitopes of V1H-1 gp 120 gp 160) are known in the art, for example in the US patent "5,166,050." A preferred example is the monoclonal antibody 178. 1 (see, e.g., Thiparl et al., 3. Immunol., 143: 1832-1836 (1989), which was prepared by immunizing mice with a yeast molecule expressed HIV-1 gp 160 strain BH10 (Ratner et al., Nat u re, 313: 277-234 (1985)) This label -.e use for the detection of expression (by Uestern blot), for the purification of the protein (by means of of affinity chromatography), and for confirmatory tests in which the fusion protein is captured or immobilized using the 178.1 antibody .. DET2 is a hexahistidine sequence tag (SEQ ID NO: 2) that binds the Resins containing nickel and used for purification purposes The spacer (TC SEC NO1; 3) -, I use to di- alary BamHl restriction site in the indicated position of the structure. I refer to a sequence of recognition (SEC ID N0: 4) for enteroquase protease that is provided for optical removal (ie the tags of the SH2 domain, thus producing a SH2 domain that does not contain foreign amino acids. SH2 domains that do not contain foreign amino acids are preferable par-to the protein labeled for studies (He crystallography.SH2 refers to the SH? Domains of different proteins.The DNA sequence encoding each DET1-DET2- r :. n spacer-el- '-SH2 was designed so that the restriction sites (BarnHl and Xbal) are located on the sides of the spacer-ek-SH2 region, thus allowing the different structures to be? ek-SH2 are easily substituted in any of the vectors described in Procedures 2 or 3 below to create a protein labeled DET L -DET2 ~ spacer-the '~ SH2. The DNA sequence encoding each of the structures DETl ~ DET2-es? Ac? Ador-the -SH2 is also designed so that the entire tagged SH2 domain can move as an Ndei-Xbal fragment in any expression vector containing a Ndel site at an appropriate distance downstream of the E. coli transcript and the transition regulatory sequences and a downstream cloning site compatible with Xbal, although any suitable vector would produce similar results (eg, pET- lla, Novagen, Tnc), the vector used in the present experiments was the expression vector F. coli? EAlKnRBS9 This vector is a derivative (ie the vector series described in Shatzinan, A, Gross, M, and Rosenberg, M, 1990, "Espression? Sing vectors wi h phage lambda regulatory sequences", In: Current Protocol in Molecular Biology (FA Ausubel et al., Eds.), Pp. 16.3.1-16.3.11, Green Publishing and Ui law- Tnterscience, NY (hereinafter FA Ausubel and others). "EA" KnRBS3 is described in Bergs, et al., 1991, J. Biol. Chem. 266: 23204-23214. The procedures described below describe the expression of SH2 domains of chicken src, human src, human lck and human hcp. First, the src domain of chicken SH2 was expressed as DETl-I) FT2-is? Ac? Ador-SH2. Then, the others were inserted into this vector in place of the chicken src to express proteins in the form of DET1-0FT2-spacer-ek-spacer-SH2.

Procedure 1: Cloning and expression of SH2 domain of chicken src containing DETi and DFT2 tags (DET 1 -DET? ~ Espac? Ador-SH?). A DNA sequence encoding the protein labeled DETl-DET2-spacer-SH2 was amplified by PCR from a cDNA clone containing the chicken src gene (p% H, Levy et al 1986. Proc. Nati. Acad. Sci. USA _83: 4228) by means of method b known to those skilled in the art using the following primers: TTCCATATGAAAAGTATTCGTATTCAGCGTGGCCCGGGCCGTCACCACCACCACCACCACGGG ATCCCCGCTGAAGAGTGGTACTTT 3 '(II) SEC NO: 17) The underlined sites are an Ndel recognition site (5') and a recognition site (3 ').

'GGAATTC AGATTACTAGGACGTGGGGCAGACGTT 3' (SEC ID NO: 18) The underlined region is a recognition site Xbal.

The PCR product was digested with Ndel and Xbal, followed by isolation of the digested fragment on an agarose gel. The fragment was taken in the vector - PEA! KnRBS3 Ndel-Xbal-di gen (Bergs et al., supra) which was purified by agarose gel as a fragment 6.5 l-bp. The ligation reaction was used to transform E. col MM294eT + (F.A. Ausubel et al., Supra). A plasmid containing an insertion of the corr-ecto fragment was identified and confirmed by DNA sequence. The resulting plasmid encodes DETl ~ DET2-SE? Ac? Ador? SH2 under the control of the phage lambda promoter PL and the regulatory system. Fl DNA plasmid was purified from MM2 4cT +? was used to transform E. coli strain AR120. In this host strain, expression of the phage promoter can be induced by adding nalidixic acid to the growing culture as described in F.A. Ausubel and others supra. The induction of nalidixic acid of AR120 containing this plasmid, followed by the analysis of the cellular proteins on an SDS-polyapyl lamida gel cultivated with Coomassie Bl? E (FA Ausubel and others supra), resulted in the appearance of a protein band. with an average vintage weight of 15,000; this band was not seen in uninduced cells or in induced cells containing? EAlKnRBS3 which lack the amplified PCR fragment. Western blotting confirmed that the induced protein band reacted with the rnonoclonl antibody ant i-DETl 178.1. üü Pr-oced? M? Ento 2: Cloning, expression and purification of the SH2 domain of human src containing labels and a proteolytic decomposition site enteroquinone (DET1-DETS-spacer-ek-src SH?) »A DNA sequence that encodes eL-src SH protein? was amplified with PCR of a cDNA clone containing the human gene (SH? c-sre with DNA sequence identical to that described in Takeya, T. and Hanafusa, H, 1983 Cell 32: 881-890) using the si Initiating parents: 'CGGGATCCTGGACGACGACGACAAAGCTGAGGAGTGG1 TTTT 3' (TD SEC NO: 1) The underlined site is a Barnl-IT recognition site.

TGGflflT rCTAGACTAT AGGACGTGGGGCACACGT 3 '(ID SFC NO: 20) The underlined region is an Xbar recognition site. The product was digested with BarnH1 and Xbal, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into the BamHT-Xbal expression vector containing the gene labeled chicken src DFT1-DET-spacer-SH2 described in Procedure 1 above. In that vector, the BarnHT site is located between the coding regions for DET? and SH ?, and the Xbal site is located after the 3 'end of the SH2 coding region. The ligation reaction was used to transform F-col MM294cI + "The structure DET1-DFT2-ospaciador-ek-src SH? it was confirmed by making the DNA sequence (SEQ ID NO: 5) and was induced in the E. coli strain AR120 as described in procedure l above. A Coomassie-Blue staining of the band was observed, which was induced by western blot positive with an apparent molecular weight of 16,000 after the induction of nalidixiid acid.The cells were lysed in neutral pH by means of cation in the presence After the centrifugation, the soluble extract is chro- mated to a column of N? ++ NTA After washing the column with equilibrium regulators (pH regulator 8 Trisque contains 0.5 M NaCl) and the same regulator It is found that the SH2 domain, purified in this way, binds with high affinity in a specific way, saturable with the appropriate peptide and in the Link Pipes "described below, showing that the label does not interfere with the function.This fusion protein expressed, DET1-DET? -is? Ac? Ador-ek-src SH ?, was used in the" Link tests "described below to determine the specific of the compounds to selectively inhibit the human src SH2 domain.

Procedure 3: Cloning and expression of SH2 domain of human lck containing tags and a site of proteolytic decomposition enteroquasa (DETl-DET2-spacer-ek-l ck SH2).

A DNA sequence encoding the SH2 ek-Ick protein was amplified by PCR from a cDNA clone containing the human lck gene (accession number to Genbank M36881) using the following signers (Jores: 'CGGGATCCTGGACGACGACGACAAAGAGCCCGAACCCTGGTTCTT 3' (SEC ID NO: 21) The underlined site is a Ba Hl recognition site » 'GCTCTAGACTATTACTGGGGCTTCTGGGTCTG 3' (TD SFC NO: ??) The underlined region is an XbaT recognition site. The PCR product was digested with BarnH1 and XbaT, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into a BarnHT-XbaT digested expression vector containing the chicken src gene labeled DET1-DET2-spacer-SH2 described in procedure 1 above. In that vector, the Ba HI site is located between the coding regions for DET2 and SH2, and the Xbal site is located after the 3 'end of the SH2 coding region. Therefore, the sequence SH2 ek-lck replaced the sequence SH2 src in the previous vector. The ligation reaction was used to transform E. coli MM294cI +. The structure containing DET1-DET2-spacer-ek-lck SH2 was confirmed by making the sequence of AUN (TD SEQ NO: 6) and was induced in the E. coil strain AR120 as described in the above procedure. A spotted Coornassie was observed. Bl ee of the protein band induced by west-ern blot with an apparent molecular weight (Je 17,000 after the induction of nalidic acid) The cells lysed at a neutral pH by somatization in the presence of lysozyme. The centrifugation, the soluble extract was cronatografio in a column of N? ++ NTA "After washing the column with regulator (Je equilibrium (regulator- of pH 8 Tris containing 0.5 M NaCl) and the pH regulating ism contains 15 M rnidazole, the protein was eluted in a highly purified form with 25 mM irnidazole in the equilibrium regulator.The SH? Domain, purified from this amino acid, was found to bind with high affinity in a specific way, saturable with the pep gone pY appropriate in the "Link Testing" described below, showing that the tag does not interfere with the function.This expressed fusion protein, DET 1 -DE l "2 -spacer-ek- 1 cl- SH ?, was used in the "Link Testing" described to continue We determined the specificity of the compounds to selectively inhibit the human SH2 delck domain.

Procedure 4: Cloning and expression of SH2 domain of human hcp containing tags and a proteolytic decomposition site enterokinase (DETi-DET-2-spacer-ek-hc? SH2). A DNA sequence encoding the SH2 protein ek-hcp (hcp DNA sequence identical to that described in Shen, S-H, Nature (1991) 352: 736-739) was inverted by the amplified mnscpptase PCR of human fetal liver RNA. The RNA isolation use Tp-Reagent (Molecular Research Centr Tnc.) And the Reverse Transcppt ase system (GIBCO-BRL) in accordance with the manufacturer's instructions. The PCR was carried out using the following primers: 'GAAGATCT TGGACGACGACGACAAATCCCGTGGGÍGGT TTCAC 3' (SEC ID NO: 3) The underlined site is a BglTT recognition site.

'GCTCTAGACTA TAACTAGTGGGATCGGAGCA 3' (SEC ID NO: 24) The underlined region is an Xbal recognition site. The PCR product was digested with BglIT and Xbal, followed by isolation of the digested fragment on an agarose gel. The fragment is ligated into the digested expression vector BarnHT- / bal "containing the human src gene labeled DET1-DET? -spacator-ek- src SH? Described in procedure 2 above» In that vector, the BarnHl site is located between the coding regions for DET2 and -, and the Xbal site is located after the 3 'end of the SH2 coding region.Sin this way, the SH2 sequence ek-hcp replaced the SH2 sequence ek-src in the vector The ligation reaction was used to transform E. coil MM294cI + The structure containing DFT1-DET2-es? ac? ador-ek-hcp was confirmed by sequencing the DNA (TD SEC NO: 7) and used to transform E. coli GI690 (Tnvitrogen Corporation, San Diego, CA). The induction of the phage promoter. Lambda was induced by adding t-ptophane to culture medium z 10 mg / ml, according to the manufacturer's instructions. A Coomassie-Blue spotting was observed in the protein band induced by positive wectern blot after the induction of tp-ptofan with an apparent molecular weight of 15,000 »The cells stained in? Neutral pH by sorucaca n in the presence of lasoza a. After centrifugation, the insoluble pellet was solubilized with 8 M urea in a regulator of pH 8 Tris and bound in the column of N + + NIA. The ream was washed with an equilibrium regulator (R-8 buffer Tris containing 0.5 M NaCl, 8 M urea and 5 nM BMF) and the same pH regulator contains 15 inM irnidazole. The protein was duplicated again in the column during the removal of urea in the presence of 5 inM BMF and the purified protein that was doubled was eluted with 300 M imidazole in the pH regulator 8 Tris. The SH2 domain, pupified in this manner, was found to bind with high affinity, saturable with the appropriate pY peptide in the Linkage "described below, demonstrating that the tag does not interfere with function and that the protein was duplicated, and this protein (expressed fusion, DET1-ÜET2-spacer-ek-hcp SH2, was used in the Link "described below to determine the specificity of the compounds to selectively inhibit the SH2 domain of human hcp Fusion proteins having the GST-X-SH2 structure were prepared as described in the 6ST gene fusion system. available from Pharmacia (New, 3ersey.) GST is the sequence that labels epitope gl? tatione s-transferase (SEQ ID NO: 8) to order, Grb2 and SH-PTP2 and the sequence that labels epitope gluta ione s-fransferase ( SEQ ID NO: 9) for p85 SH2 refers to the SH2 domains of fi n, Grb2,? 85 and SHPTP? That were expressed and purified using Sepharose glut has 4B (Pharmacia) in accordance with "Current Protocol s Molecular Biology" , ed. FM Ausubel et al., pub 3ohn Wiley and Sons, Inc., (1995), p 16.71. X is an appropriate linker, preferably from 6 to 21 base pairs, used to maintain the SH structure? in frame- and cloning complement. So, the sequence of X is not critical. One skilled in the art can easily construct the appropriate linker. The DNA sequence encoding each GST-X-SH2 fusion protein was designed so that the indicated restriction sites (BainHT and EcoRT) are located on the sides of the SH2 region. The vector used in the present experiments was the expression vector E. col i PGEX.3X (Pharmacia) for p85. Each of these vectors (as result of SH structures having terminal C of amino acids described below) The sequence encoding the human-like SHα domain (amino acids 143-252) (Yana oto, T. and others Proc. i.

Acad. Sel. USA 83, 5459-5463 (1986) was cloned in sites 6? BarnHT and EcoRI (Jel expression vector? GEX-2T. Fl SH domain which includes the additional C-terminal amino acids leucine-threonine-asparagus na-serine-sep (TC SEQ NO: 10) was cloned by means of techniques PCR known to all those skilled in the art to produce the expressed GST-X-end fusion protein.This fusion protein expressed later was used in the "Link Tests" described above to determine the specificity (Je compounds for selectively inhibiting the SH? domain (human end) SH? domains of? 85 human: the coding sequence of the SH2 domain of? 85 human (ami oacids 321-440) (Skolnik, E. et al., Cell 65 , 83-90 (1991) was cloned into the Ba HI and EcoRI sites of the expression vectors "GEX-3X." The SH2 domain that includes the C-terminal amino acids aspargine-serma-sera na (TJ) SEC N0: 11) was cloned by means of PCR techniques known to those skilled in the art to produce the fusion protein xpr-ted GST ~ X-? 85"This expressed fusion protein was then used in the" Linkage Tests "described below to determine the specificity of the compounds to selectively inhibit the p85 SH2 domain. The SH2 domain of human SH-PTP2: The sequence encoding the SH2 domain of human SH-PTP2 (amino acids 1-106) (Bastien, L. et al., Biochem. Biophys., Res. Comrn., 196.1 -133 (1993)) was cloned into the BamHl and EcoRI sites of the vector- (Je expression pGEX-2T. Fl SH2 domain that includes the C-terminal amino acids glutamine- feni lalam na-i sol euc a-vali na -treon a-aspar tata (TD SFC NO: 12) was cloned by means of PCR techniques known to those exported in the art to produce the expressed fusion protein G5T-X-SH-PTP2.Fsta expressed fusion protein was then used in the "Tests" Linkers "described below to determine the specificity of the compounds to selectively inhibit the SH2 domain of human SH-PTP2 The SH2 domain of human Grb2: The sequence encoding the human Grb2 domain (amino acids 58-159) (Lowenste, E. et al., Cell 70, 431-442 (1992)) was cloned into the Ba HI and EcoRI sites of the pGEX-2T expression vector. Fl SH domain? which includes the C-terminal amino acid α-histidine-arginma-aspartate amino acids (SEQ ID NO: 25) was cloned by PCR techniques known to those skilled in the art to produce the expressed fusion protein GST-X-Grb2. A 'nucleotide linker was used and resulted in amino acids glisina and serine between the GST and SH2 domain. This expressed fusion protein was then used in the "Linkage Tests" described below to determine the specificity of the compounds to selectively inhibit the SH2 domain of Grb2.

Linkage Tests: The potency of the compounds in the SH2 domains was determined based on the ability of such compounds to selectively inhibit such SH2 domain from binding to their respective specific pY pep. The binding tests for SH domains? and the pY peptides were performed in a plaque test (Je 96 depressions based on the ELISA test) on Millipore filter plates of 96 depressions, DuraporeR hydrophilic (pore size 0.65 urn Cat. No. MADVN6550), 2 ul (50% suspension) of Protein n Sepharose (available (Je Pharmacia of N.3 Cat. No. 17-0618-01) and either 2 ul of? Mg / ml were added. of MAB178.1 (for gp 1? 0 / SH? domain fusion proteins of src, Ick and hcp) or D.? 5 ul of anti-GST polyclonal antigen (available from Pharmacia of N.3.) (Pair-a fusion proteins domain GST / SH? Do end, Grb ?, p85 and SH-PTP2). The volume was brought to 100 μl with TBS-T (tris saline regulator plus 0.05% tween-20), incubated and stirred at room temperature for 1 hr '. then it was washed with TBS-T (4 ° C). Then 90 ul of TBS-T was added to each depression. The biotylated peptides were diluted to a concentration of 1.0 uM in TBS-T (these peptides can be obtained from Baehem Bioscience of Pennsylvama, Genosys Biot echnologies of Texas and California Peptide Research of California), 10 ul were aliquoted for depression to produce a final concentration of 0.1 uM (approximately K for each domain / pair peptide) and? n final volume of 100 ul. These test plates were incubated until equilibrium binding was achieved (3 hrs at 4 ° C with agitation). The test plates were washed? X for depression TBS-T (4"C), then 100? L for SABC (Biotylated horseradish peroxidase-streptavidin complex, available from Zymed Corporation of California cat. No. 93-0043, was added one drop of reagent A (sp repavidm) and one drop of reagent B (peroxidase conjugated with radish-biot in AH) ) per 10 ml of TBS-T, incubated at 37 ° C for 30 minutes, then cooled to 4 ° C) by depression, after incubating them at 4 ° C for 30-60 minutes. The plates were then washed 4X with TBS-T (4 ° C) (250 ul / depression / wash). Depression was added by 100 ul of 1 mg / ml OPD (o-femldiamine, S'igrna Chemical Corporation, St. Louis Missouri) in citrate buffer. . To stop the development, they were added by depression LOO ul of 10% sulfuric acid. Then 150 μl of each depression was removed (ie the test plate and placed on an FLTSO plate.) Then the 490 of each ELISA test plate was determined.

Determination (Je (IC50) for Table I "Each control or compound was tested in duplicate" The duplicates were averaged and the antecedent subtracted and the maximum values without inhibition were returned from the plate, then all the other information points were expressed As a percentage of the maximum-value (or% control), these% control information values are plotted in Macintosh (Synergy Software) .The curves in these graphs were non-linear curves fitted with the following equation F (x) - ~ Emax / (l + kd / conc) slope), where the term < represents the IC50 for each of the curves.

Determination of (Ki) for Table 1T The Ki for the respective compounds is calculated by means of the following equation (see reference). This expanded equation should be used under the conditions of this test, due to the fact that the pep biot or side is not in vast excess concentration (100X) over the SH2 domain fusion protein. The TC50 is a value-extrapolated from a non-linear curve fitting using kinidagra fo. Rtot and * D are known values for the entry of reagents in the test. KD generally must be determined expep mentally for each combination of SH2 domain fusion peptide and pY biot 1 peptide or side.

KI = (IC50 -Rtot + Rtot / 2 ((* D / (KD + * D)) * (KD / (KD + * D «-Rto + / 2))) / (1 + * D / KD * Rtot / KD ( (KD < - * D / 2) / (KD + * D))) KI- (uM) KD of competitor * ICso (uM) ICso a to inhibitor, derived by non-linear curve fitting of the competition selectivity test information for each SH2 domain. Rtof = (uM) total SH2 domain concentration within a test depression (title plate) * D = (uM) concentration of specific pY and biotylated peptide for each do nio SH2 IC50 is the concentration of inhibitor in which the response or signal is inhibited by 50%. KD is the dissociation constant for a ligand in a receptor / ligand interaction, usually equaling the concentration of ligand that is in Vrnax _ in a curve >; Joining (he saturation) The 1 pY peptide ligands used in the above binding assays are the following: pY biot i peptide ligand or side containing a linker (im achaproic acid) used for domes SH? Src, ick and end.

Glu-Pro-Gl -pTi r-Glu-Glu-Ll e-Pro -Lie- T ir-Leu (SEQ ID NO: 13) Fl ligand (Je pepti or pY biot? To side that contains a linker of aric nocaproic acid (Acá) used for SH2? B5" A '-. P-Gli-Gl -pTi r -Me -Asf) ~ Met-Ser ~ l ís-Asp-Glu flD SEC N0: 14) The peptide or biotinylated ligand that contains an am ocaproic acid linker (Ac) used for SH2 SH-PTP2 Glu-Asn-Gl? -Leu ~ Asn-? T? r-Lle-Asp-Leu-Asp.Leu (TD SEC NO: 15) The peptide ligand pY biofin side containing an amy nocaproic acid linker (Ac) used for SH2 hcp Thr-Pro-PrO-H sl.eu-L i s-pT r-Fe-T ir-Fe-Val -Val - Ser- sp-Gl i (SEC ID NO: 16) The biotylated pY peptide ligand containing a linker-from i-caproic acid (Ac) used for SH? Grb? l.e? -Pro-Val-Pro-Glu-pTir-Lle-Asn-Gln-Ser-Val (TD SEQ NO: 26) Results of Linkage Tests: Tables T and II illustrate the cross-reactivity of SH2 antagonists in the indicated SH2 domains. From the results described in these panel compounds it can be easily identified that they have binding affinities / inhibitory concentrations that are more than fifty times higher in the SH2 domain of Ick than the binding affinities / inhibitory concentrations in other SH2 domains. .

CROSS REACTIVITY DF SH2 Src DOMAIN ANTAGONISTS IN SH2 HUMAN CLONED DOMAINS (CTC50) Compound, cr .ck End S SHH-pp8855 Grb2 Hcp PTP? 1 6? M 6UH NEITHER NOR I X 2 NOR NOR I NI NOR 0..9 uM 3 16.IUM 22.9uM NI NI I NI 1.2 uM 4 40 uM 163 uM NI X I NI 30 a 63 uM 100 uM NOR NOR NOR 0.1 ull 6 20 UM NI NI X NI NI X 7 7.4 uM 383? M NOR NOR NOR NOR 16 16? M 126 uM NEITHER NOR NOR NI>> 100uM 9 131 uM 200 uM NI NI NI I 12? M X X NI NI NI NI NI 1.2 uM NT- No inhibition was observed outside 300uM X- without testing SH2 DOMAINS HUMAN CLONDS (Kl) Compound Scr Lck F n SHp85 Grb? HCP PTP2 X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X 50? M NI X NT NI X 7 20 uM 320? MI NT NT NI X 8 12? M 360 uM NI NOR NI 330 X 9 55 uM 146 uM NI NT NOR X 10 XX XX NT NOR NT NT X NI- No inhibition was observed below lOOOuM X- without calculating XX- without stealing While the preferred embodiments of the invention are illustrated by the foregoing, it is to be understood that the invention is not limited to the precise instructions described herein and that it reserves the right to all modifications within the scope ( He has the following reivifications.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: ÜUNNINGTON, DAMIFN (ll) TITLE DF THE INVENTION: USE DF SPECIFIC COMPOUNDS OF I CK SH2 TO DEAL WITH AUTOINMUNFS ENFFRMFICIS AND REJECTION OF AL OIN JET RTOS (lll) NUMBER OF SEQUENCES:? 6 (IV) ADS TO SEND CORRESPONDENCE (TO) RECIPIENT: S ith Klino Beecharn Corpora ion (B) STREET: 709 Swedeland Road (C) CITIZEN: King of Prussia (D) STATUS: PA (E) ) COUNTRY: USA (F) POSTAL CODTGO: 19406 (v) COMPUTER LEADABLE FORM: (A): TYPE OF MEDIUM: Flexible DiSCOPE (B) COMPUTER: IBM COMPATTBIF (C) OPERATING SYSTEM: TWO (D) SOFTWARE: FaetSEQ Version 1.5 (Vi) DATA OF THE CURRENT APPLICATION: (A) APPLICATION NUMBER: (B) DATE OF PRESENTATION; (C) CLASSIFICATION (vile) (A) ANTFRTOR APPLICATION DATA: (A) NUMBER DF APPLICATION: 08 / 386,301 (B) DATE DATE PRESENTATION: 10-FFB-1995 (A) APPLICATION NUMBER: 08 / 400,220 (B) PRESENTATION DATE: 07-MAR-1995 (A) APPLICATION NUMBER: 08 / 497,357 (B) PRESENTATION DATE: 30-3UN-1995 (vm) TNFORMATION ON THE APPORTER / AGENT (A) NAME: üustman, Uayne 3. (B) REGISTRATION NUMBER: 33,870 (C) REFERENCE NUMBER / CASE: P50323-2L1 (ix) INFORMATION ABOUT TELECOMMUNICATIONS (A) TELEPHONE: 610-770-5023 (B) TELFFAX: 908-594-4720 (C) TELEX: (2) SEQUENCE IDENTIFICATION INFORMATION NO. 1 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1 1 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual (ü) TOPOLOGY: linear (II) MOLECULE TTPO: peptide (II) HYPOTHETICAL: NO (iv) ANTI ENTDO: NO (v) TYPE OF FRAGMENT: internal () SOURCE ORIGINAI: (IX) TRAIT: (ix) SEQUENCE DFSCRTPCTON: TD. OF SEQUENCE NO: 1 Lys Ser- Tie Arg lie Gln Arg Gly. Pro Gly Arg 1 5 10 (?) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO »?: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 6 amino acids (B) TTPO: amino acid (C) CHAIN TTPO: i dividual (ü) TOPOLOGY: linear (ii) MOLECULE TTPO: pepti do (ni) HYPOTHETIC: NO dv) ANGI IN G T D: NO (v) TYPE OF FRAGMENT: internal (v) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 2: is His His His His His H1 s 1 5 (2) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO »3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 3 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ll) MOLECULE TTPO: peptide (ill) HrPOTETTCO: NO (iv) ANTICIPATION: NO (v) TYPE OF FRAGMENT: i tern (v) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: Gly He Leu l (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. 4 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 5 to inocids (B) TTPO: amino acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (li) MOLECULE TTPO: peptide (ill) HYPOTHETIC: NO (iv) ANT-SENSE: NO (v) TYPE DF FRAGMENT: internal (Vi) SOURCE ORIGINAL: dx) DESCRIPCTON DF SEQUENCE: ID. OF SEQUENCE NO: 4 sp Asp Asp Asp Lys 1 5 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 5: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 130 amino acids (B) TYPE: am no acid (C) TYPE OF CHAIN :: individual (D) TOPOLOGY: linear (n) TYPE DF MOLECULE: pept i do (lli) HYPOTHETIC: NO (iv) ANTI ENTITY: NO (v) TYPE DF FRAGMENT: i tern (vi) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTIONS: SEQUENCE ID 'NO: 5: Met Lys Ser He Arg He Gln Arg Gly Pro Gly Arg His His His His 1 5 10 15 His His Gly He Leu Asp Asp Asp Asp Lys Wing Glu Glu Trp Tyr Phe 20 25 30 Gly Lys He Thr Arg Arg Glu Ser Glu Arg Leu Leu Leu Asn Ala Glu 35 40 45 Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu Thr Thr Lys Gly 50 55 60 Wing Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Wing Lys Gly Leu Asn 65 70 75 80 Val Lys His Tyr Lys He Arg Lys Leu Asp Ser Gly Gly Phe Tyr He 85 90 95 Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu Val Wing Tyr Tyr 100 105 110 LO Ser Lys His Wing Asp Gly Leu Cys His Arg Leu Thr Thr Val Cys Pro 115 120 125 Thr Ser 130 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 6: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 134 amino acids (II) TYPE: aini noaea do? 0 (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE: peptide? 5 (ill) HYPOTHETIC: NO (iv) ANTI ENTDO: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (i x) SEQUENCE DESCRITION: ID. OF SEQUENCE NO: 6: Met Lys Ser He Arg He Gln Arg Gly Pro Gly Arg His His His His 1 5 10 15 His His Gly He Leu Asp Asp Asp Asp Lys Glu Pro Glu Pro Trp Phe 25 30 Phe Lys Asn Leu Ser Arg Lys Asp Wing Glu Arg Gln Leu Leu Wing Pro 35 40 45 Gly Asn Thr His Gly Ser Phe Leu He Arg Glu Ser Glu Ser Thr Ala 50 55 60 Gly Ser Phe Ser Leu Ser Val Arg Asp Phe Asp Gln Asn Gln Gly Glu 65 70 75 80 Val Val Lys His Tyr Lys He Arg Asn Leu Asp Asn Gly Gly Phe Tyr 85 90 95 lie Ser Pro Arg He Thr Phe Pro Gly Leu His Glu Leu Val Arg His 100 105 110 Tyr Thr Asn Wing Ser Asp Gly Leu Cys Thr Arg Leu Be Arg Pro Cys 115 120 125 Gln Thr Gln Lys Pro Gln 130 INFORMATION FOR SEQUENCE IDENTIFICATION MO. 7: CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 133 amino acids (B) TYPE r. arni no cido (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (il) TYPE OF MOLECULE: peptide (III) HYPOTHETIC: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) SOURCE? RIGTNAL: (lx) SEQUENCE DESCRIPTION: TT). OF SEQUENCE NO: 7-.

Met Lys Ser He Arg He Gln Arg Gly Pro Gly Arg His His His His 1 5 10 15 His His Gly He Leu Asp Asp Asp Asp Lys Ser Arg Gly Trp Phe His 20 25 30 Arg Asp Leu Ser Gly Leu Asp Ala Glu Thr Leu Leu Lys Gly Arg Gly 35 40 45 Val His Gly Ser Phe L * »n Ala Arg Pro Ser Arg Lys Asn Gln Gly Asp 50 55 60 Phe Ser Leu Ser Val Arg Val Gly Asp Gln Val Thr His He Arg He 65 70 75 80 L5 Gln Asn Ser Gly Asp Phe Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Wing 85 90 95 Thr Leu Thr Glu Leu Val Glu Tyr Tyr Thr Gln Gln Gln Gly Val Leu 100 105 HO Gln Asp Arg Asp Gly Thr He He His Leu Lys Tyr Pro Leu Asn Cys 115 120 125 Ser Asp Pro Thr Ser? 0 130 (?) INFORMATION FOR SEQUENCE IDENTIFICATION NO. B (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 224 amino acids (B) TYPE: am no acid (C) TYPE OF CHAIN: individual 7 < 3 (D) TOPOLOGY: linear (11) TYPE OF MOLECULE: peptide (m) HYPOTHETIC: NO (LV) ANT I MEANING: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (IX) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: B: Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Wing He He Arg Tyr He Wing Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Glu Wing He Met Met Leu Glu 85 90 95 Gly Ala Val Leu Asp He Arg Tyr Gly Val Ser Arg He Ala Tyr Ser 100 105 no Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 ao Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg lie Glu Ala He Pro Gln He Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Wing 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Aßp Leu Val Pro Arg 5 210 215 220 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO »< 3 : (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 5 amino acids (B) TYPE: ain noac do (C) TYPE OF CADFNA: individual (D) TOPOLOGY: linear L5 (11) TYPE OF MOLFCULA: peptide (ill) HYPOTHETIC: NO (i) ANT I SEN U DO: NO? 0 (v) TYPE OF FRAGMENT: internal (v) ORIGIN SOURCE! : (ix) SEQUENCE DESCRIPTION: ID. SEQUENCE NO: 9: Met Ser Pro He Leu Gly Tyr Trp Lys He Lys Gly Leu Val Gln Pro 1 5 10 15: > ? ~ Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr He Asp Gly Asp Val Lys 50 55 60 Bl Leu Thr Gln Ser Met Wing He He Arg Tyr He Wing Aßp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Wing Glu He Ser Met Leu Glu 85 90 95 Gly Wing Val Leu Asp He Arg Tyr Gly Val Ser Arg He Wing Tyr Ser 100 105 no Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Wing Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg He Glu Wing He Pro Gln He Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr He Wing Trp Pro Leu Gln Gly Trp Gln Wing 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu He Glu Gly 210 215 220 Arg 225 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 117 amino acids (B) TYPE: a i noa c do (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) MOLECULE TTPO: peptido (lil) HYPOTHETIC: NO 8? (iv) ANTI SENTÍ DO: NO (v) TYPE OF FRAGMENT: internal (Vi) ORIGINAL SOURCE: dx) SEQUENCE DESCRIPTION: TD. OF SFCUFNCIA NC): 10 Ser He Gln Wing Glu Glu Trp Tyr Phe Gly Lys Leu Gly Arg Lys Asp 1 5 10 15 Wing Glu Arg Gln Leu Leu Ser Phe Gly Asn Pro Arg Gly Thr Phe Leu 20 25 30 He Arg Glu Ser Glu Thr Thr Lys Gly Wing Tyr Ser Leu Ser He Arg 40 45 Asp Trp Asp Asp Met Lys Gly Asp His Val Lys His Tyr Lys He Arg 50 55 60 Lys Leu Asp Asn Gly Gly Tyr Tyr He Thr Thr Arg Wing Gln Phe Glu 65 70 75 80 Thr Leu Gln Gln Leu Val Gln His Tyr Ser Glu Arg Glu Arg Wing Ala 85 90 95 Gly Leu Cys Cys Arg Leu Val Val Pro Cys His Lys Gly Met Pro Arg 100 105 110 Leu Thr Asn Ser Ser 115 (2) SEQUENCE IDENTIFICATION INFORMATION NO. eleven: (i) CHARACTERISTICS DF THE SEQUENCE: (A) LENGTH: 123 a i o cids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual (ü) TOPOLOGY: l ineal in (11) TYPE OF MOLECULE: peptido (ni.) HYPOTHETIC: NO (iv) ANTT ENTIDO: NO (V) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTION:? D. OF SEQUENCE NO: 11 Gly Met Asn Asn Asn Met Ser Leu Gln Asn Wing Glu Trp Tyr Trp Gly 1 5 10 15 Asp He Ser Arg Glu Glu Val Asn Glu Lys Leu Arg Asp Thr Wing Asp 20 25 30 Gly Thr Phe Leu Val Arg Asp Wing Ser Thr Lys Met His Gly Asp Tyr 40 45 Thr Leu Thr Leu Arg Lys Gly Gly Asn Asn Lys Leu He Lys He Phe 50 55 60 His Arg Asp Gly Lys Tyr Gly Phe Ser Asp Pro Leu Thr Phe Ser Ser 65 70 75 80 Val Val Glu Leu He Asn His Tyr Arg Asn Glu Ser Leu Ala Gln Tyr 85 90 95 Asn Pro Lys Leu Asp Val Lys Leu Leu Tyr Pro Val Ser Lys Tyr Gln 100 105 110 Gln Asp Gln Val Val Lys Glu Asp Asn Ser Ser 115 120 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 12: (t) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 112 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual 04 (D) TOPOLOGY: Linear (11) TYPE OF MOLECULE: pept i do (ll i) HYPOTHETIC: NO (IV) ANT I SENTÍ DO: NO (v) TYPE OF FRAGMENT- intei no (vi) ORTGINAL RUNE: (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 12: Met Thr Ser Arg Arg Trp Phe His Pro Asn He Thr Gly Val Glu Ala 1 5 10 15 Glu Asn Leu Leu Leu Thr Arg Gly Val Asp Gly Be Phe Leu Wing Arg 20 25 30 Pro Ser Lys Ser Asn Pro Gly Asp Phe Thr Leu Ser Val Arg Arg Asn 35 40 45 Gly Wing Val Thr His He Lys He Gln Asn Thr Gly Asp Tyr Tyr Asp 50 55 60 Leu Tyr Gly Gly Glu Lys Phe Wing Thr Leu Wing Glu Leu Val Gln Tyr 65 70 75 80 Tyr Met Glu His His Gly Gln Leu Lys Glu Lys Asn Gly Asp Val He 85 90 95 Glu Leu Lys Tyr Pro Leu Asn Cys Wing Asp Gln Phe He Val Thr Asp 100 105 110 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO »13: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 amino acids (B) TYPE: aroi noac do (C) TYPE OF CHAIN: individual (D) TOPOLOGY: l ineal (l) TYPE OF MOLECULE: peptide (m) HYPOTHETIC: NO (IV) ANTI FNTTDO: NO (v) TYPE OF FRAGMENT: internal (vi) SOURCE ORTGTNAL: (ix) TRAIT: (A) NAME / KEY: OR * or (B) LOCATION: 4 ... (d) OTHER INFORMATION: phosphorylated tyrosine residue (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 13: Glu Pro Gln Tyr Glu Gl? lie Pro He Tyr Leu 1 5 10 15 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. 14 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE: pßp + io (lii) HYPOTHETIC: NO (IV) ANTI SEN IDIO: NO (v) TYPE OF FRAGMENT: internal (v) SOURCE ORIGINAL: (x) TRAIT: (A) NAME / KEY : Other (B) LOCATION:. ".4 (d) OTHER INFORMATION: tyrosine phosphorus residue lacla (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 14: sp Gly Gly Tyr M t Asp Met. Ser Lys Asp Gl? 1 5 10 15 (2) SEQUENCE IDENTIFICATION INFORMATION NO. fifteen: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 amino acids (B) TYPE: am i noacid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: peptide (III) HYPOTHETIC: NO (IV) ANI I ENTHY: NO (v) TYPE OF FRAGMENT: internal (v) SOURCE ORTG1NAI: (ix) TRAIT: (A) NAME / KEY: Other (B) LOCATION: 6 ... 6 (d) OTHER INFORMATION: tyrosine fos fon residue Lacla (IX) DESCRIPTION OF SFCUENCE: TD. OF SEQUENCE NO: 15: Gl? Asn Gly Leu Asn Tyr He Asp Leu Asp Leu 1 5 10 15 (2) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO »16: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 amino acids (B) TYPE: amino ci or (C) TYPE OF CHAIN: indiviual (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE: pept i (Jo (ll) HYPOTHETIC: NO (iv) ANTI-SENSE: NO (v) FRAGMENT TTPO: internal (vi) ORIGINAL SOURCE: (IX) TRAIT: (A) NAME / CL VE: Ot.ro (B) LOCATION: 7 ... 7 (d) OTHER INFORMATION: residue of -tirosma phosfon Lacla H8 (IX) DESCRIPTION DF SFCUFNCTA: TD. FROM SECUENCTA NO: 16: Thr- Pro Pro His Leu Lys Tyr * Phe Tyr Phe Val Val Ser 'Asp Ser 1 5 10 15 Gly 20 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. 1 (i) CHARACTERISTICS OF THE SFCUFNCTA: (A) LENGTH: R7 base pairs- *, (B) TTPO: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGT: 1 i nea L (i i) MOLECULE TTPO: cDNA (lLL) HYPOTHETIC: NO (? v) ANI'I ENTÍ DO: NC) (v) TYPE OF FRAGMF.N10: (Vi) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 17 TTCCATATGA AAAGTATTCG TATTCAGCGT GGCCCGGGCC GTCACCACCA CCACCACCAC 60 GGGATCCCCG CTGAAGAGTG GTACTTT 87 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 18: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) TYPE OF CADFNA: individual (D) TOPOLOGY: linear (I) TYPE OF MOLECULE: cDNA (III) HYPOTHETIC: NO (IV) ANTI ENTÍDO DO: NO (v) TYPE OF FRAGMENT: (v) ORIGINAL SOURCE: (X) SEQUENCE DESCRIPTION: TD. OF SEQUENCE NO: 18 GGAATTCTAG ATTACTAGGA CGTGGGGCAG ACGTT 8 (2) INFORMATION FOR SEQUENCE IDENTIFYING NO. 19: () CHARACTERISTICS OF THE SEQUENCE: (A) LONGTTUT): 46 pairs (base Je <&) (B) TYPE: nucleic acid (C) CHAIN TTPO: individual (D) TOPOLOGY linear (Ll) TYPE OF MOLECULE: cDNA (III) HYPOTHETIC: NO (iv) ANTI ENTDO: NO (v) TYPE OF FRAGMENT: (vi) ORIGINAL SOURCE: (? X) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 19 CGGGATCCTG GACGACGACG ACAAAGCTGA GGAGTGGTAT TTT 5 (2) SEQUENCE IDENTIFICATION INFORMATION NO. twenty: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) CHAIN TTPO: INDIVIDUAL (D) TOPOLOGT: linear (ll) TYPE OF MOLECULE: cDNA (li) HTPOTETIC: NO (ív) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: (vi) ORIGIN SOURCE! : (ix) SEQUENCE DESCRIPTION: TD. OF SEQUENCE NO: 20 GGAATTCTAG ACTATTAGGA CGTGGGGCAC ACGGT 8 (2) SEQUENCE IDENTIFICATION INFORMATION NO. ?1: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear 9L (l) TYPE OF MOLECULE: cDNA (l) HYPOTHETIC: NO (LV) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: (v) ORIGINAL SOURCE: (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 21 CGGGATCCTG GACGACGACG ACAAAGAGCC CGAACCC TGG TTCTT 48 (2) INFORMATION FOR IDENTIFICATION DF SEQUENCE NO »22: () CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 35 pair of bases (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGT: line l (ll) TYPE OF MOLECULE: cDNA (ill) HYPOTETTCO: NO (iv) ANTI ENTDO: NO (v) TYPE OF FRAGMENT: (Vi) ORTGINAL SOURCE: (x) SECUENCTA DFSCRTPCTON: ID. OF SEQUENCE NO: 2? GCTCTAGACT ATTACTGGGG CTTCTGGGTC TG (2) SEQUENCE IDENTIFICATION INFORMATION NO. 2. 3: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 46 base pairs' (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE .: cDNA (Ul) HYPOTHETIC: NO (IV) ANT ISENSE: NO (v) TYPE OF FRAGMENT: (v) SOURCE ORIGGNAI: (X) DESCRIPTION DF SEQUENCE: ID. OF SEQUENCE NO:? 3: GAAGATCTTG GACGACGACG ACAAATCCCG TGGGTGGTTT CAC 46 15 (?) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO. 24: (l) CHARACTERISTICS DF THE SEQUENCE: (A) LENGTH: 35 pairs of Ijases? 0 (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (ü) TOPOLOGY: linear ? 5 (ll) TYPE OF MOLECULE: cDNA (m) HYPOTHETIC: NO dv) ANTI FNTIDO: NO (v) TYPE OF FRAGMENT: (vi) ORIGINAL SOURCE. 30 (x) SEQUENCE DESCRIPTION: TD. OF SEQUENCE NO: 24 GCTCTAGACT ATTAACTAGT GGGATCGGAG CA 5 (2) SEQUENCE IDENTIFICATION INFORMATION NO. ^ 5 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 106 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: individual (ü) TOPOLOGY: l ineal (ll) TYPE OF MOLECULE: pep ido (ll i) HYPOTHETIC: NO (iv) ANT I SENTÍ DO: NO (v) TYPE OF FRAGMENT: internal (v) SOURCE ORIGINAL: (ix) SEQUENCE DFSCRTPCTON: ID. OF SEQUENCE NO: 25: His Pro Trp Phe Phe Gly Lys He Pro Arg Ala Lys Wing Glu Glu Met 1 5 10 15 Leu Ser Lys Gln Arg His Asp Gly Wing Phe Leu He Arg Glu Ser Glu 20 25 30 Ser Wing Pro Gly Asp Phe Ser Leu Ser Val Lys Phe Gly Asn Asp Val 35 40 45 Gln His Phe Lys Val Leu Arg Asp Gly Ala Gly Lys Tyr Phe Leu Trp 50 55 60 Val Val Lys Phe Asn Ser Leu Asn Glu Leu Val Asp Tyr His Arg Ser 65 70 75 80 Thr Ser Val Ser Arg Asn Gln Gln He Phe Leu Arg Asp He Glu Gln 85 90 95 Val Pro Gln Gln Pro Thr He His Arg Asp 100 105 (2) INFORMACTON FOR IDENTIFICATION OF SEQUENCE NO. 26: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 11 arnmoaei dos (B) TYPE: amino acid (C) TYPE OF CHAIN: INDIVIDUAL (D) TOPOLOGY: l neal (ll) MOLECULE TTPO: peptido (i ll) HYPOTHETIC: NO (v) ANTESTENT: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (ix) TRAIT: (A) NAME / KEY: Other ( B) LOCATION: 6 .... 6 (d) ANOTHER TNFORMATION: phosphorylated t-irosma residue (ix) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 26: Leu Pro Val Pro Glu Tyr He Asn Gln Ser Val 1 5 LO

Claims (9)

NOVELTY OF THE INVENTION CLAIMS

1. - The use of a compound that: a) binds to a human SH2 lck domain with a binding affinity that is more than fifty times greater than the binding affinity with which the compound binds to a src domain Human SH2 and a human SH2 fyn domain; b. a domain (Je hcp SH? human with an affinity (Je? nion that is more than fifty times smaller than the affinity of? nion with which the compound binds to a human Ick SH2 domain; to a human SH-PTP2 SH2 domain with a binding affinity that is more than fifty times less than the binding affinity with which the compound binds to a human SH2 lck domain; of human p85 SH2 with a? nion affinity that is more than fifty times smaller than the affinity (Je? nion with which the compound binds to a human SH2 lck domain, and e. Human GRb2 SH2 with a binding affinity that is more than fifty times smaller than the binding affinity with which the compound binds to a human SH2 lck domain, in the manufacture of a medicament for use in the treatment of autoimmune diseases

2. Use according to claim 1, further characterized in that the compound is attached to a domini. or of human SH2 ick with a binding affinity that is more than fifty v / eces greater than the binding affinity with which the compound binds to a domain (Je src SH? human and to a sun of f-yn SH? human.

3. A use according to claim 1, characterized in that the compound: a) binds to a human SH2 lck domain with a binding affinity that is more than c at times greater than the binding affinity with which the compound binds to a domain of human SH2 src and a domain (Je fyn SH? human; b) joins a? n domain (Je hcp SH? human with What is an affinity of union that is more than c times less than the binding affinity with which the compound joins a domain of lck SH? human; c. binds to a human SH-PTP2 SH2 domain with a binding affinity that is (Je more than one hundred times less than the binding affinity with which the compound binds to a 15 domain of human SH2 lck; d. binds to a human p85 SH2 domain with a binding affinity that is more than c at times less than the binding affinity with which the compound binds to an Ick SH domain? human; and e. Joins a Grb Domain? SH? human with a union affinity that is of rnas (Je one hundred 0 times less than the binding affinity with which the compound binds to an Ick SH domain? human.

4. A use according to claim 3, further characterized in that the compound binds to a domain of lck SH? human with a union affinity that is over one hundred ? 5 times greater than the binding affinity with which the compound binds to a human SH2 src domain and to a human SH2 fyn domain.

5. The use of a compound that: a) binds to a human Ick SH2 domain with a binding affinity that is more than fifty times greater than the binding affinity with which the compound binds to a domain of human SH2 src and a human SH2 fyn domain; b. binds to a human SH2 hcp domain with a binding affinity that is more than fifty times less than the binding affinity with which the compound binds to a human 1 ck SH2 domain; c. it binds to a human SH-PTP2 SH2 domain with a binding affinity that is (Je ns of fifty times less than the binding affinity with which the compound binds to a human SH2 lck domain; to a human f35? H2 domain with a binding affinity that is more than fifty times less than the binding affinity with which the compound binds to a human Ick SH2 domain, and e. of human Grb2 SH2 with a binding affinity that is more than fifty times less than the affinity of uruon with which the compound binds to a human SH2 lck domain, in the manufacture of a medicament for use in the inhibition of rejection of allografts

6. A use according to claim 5, further characterized in that the compound binds to a human SH2 lck domain with a binding affinity that is more than fifty times greater than the binding affinity with the which the compound binds to a domain (Je src human SH2 and a domain of fy n Human SH2.

7. - A use according to claim 6, further characterized in that the compound: a) binds to a domain of human Ick SH2 with a binding affinity that is more than one hundred fold higher than the binding affinity with which the compound binds to a human SH2 src domain and a human SH2 fyn domain; b. it binds to a human SH2 hcp domain with a binding end that is more than one hundred times smaller than the binding affinity with which the compound binds to a human SH2 lck domain; c. binds to a human SH-PTP2 SH2 domain with a? nion affinity that is more than one hundred times less than the binding affinity with which the compound binds to a human SH2 lck domain; d. binds to a human p85 SH2 domain with a binding affinity that is more than c at times less than the binding affinity with which the compound binds to a human SH2 lck domain; and e. Joins a Grb Domain? SH? human with a? nion affinity that is more than one hundred times less than the? nion affinity with which the compound binds to a human SH2 lck domain.

8. A use in conjunction with claim 7, further characterized in that the compound binds to a human SH2 lck domain with a? Nion affinity that is more than one hundred times greater than the affinity of? Nion with the which compound binds to a human SH2 src domain and a human SH2 fyn domain.

9. The use of a compound that: a) binds to a human Ick SH2 domain with a binding affinity that is more than fifty times greater than the binding affinity with which the compound binds to a human SH2 src domain and a human SH2 fyn domain; b. it binds to a human hcp SH2 domain with an affinity (Je binding that is more than fifty times smaller than the affinity of nion with which the compound binds to a domain (Je lck SH2 human; it binds to a human SH-PTP2 SH2 domain with a? nion affinity that is more than fifty times smaller than the binding affinity with which the compound binds to a human Ick SH? domain; unites a human? 85 SH? domain with a binding affinity that is more than fifty times smaller than the binding affinity with which the compound binds to a human SHI? domain, and e. to a Grt > 2 human SH2 domain with a binding affinity that is more than fifty times less than the binding affinity with which the compound binds to a human SH2 lck domain; in the manufacture of a medicament for to be used in the induction of "pressure" 10"- A use in accordance with the rei indication 9, further characterized because the compound is bound to a Child of human SH2 with a binding affinity that is more than fifty times greater than the binding affinity with which the compound binds to a domain (Je src SH? human and to a domain of human SH2 fyn. 11. A use according to claim, further characterized in that the compound: a) binds to a human Ick SH2 domain with a binding affinity that is more than one hundred times greater than the binding affinity with which the compound binds to a src SH domain? human and a domain of fyn SH? human; b. binds to a human hcp SH2 domain with a finida *! deion which is more than one hundred times smaller than the binding affinity with which the compound binds to a human SH2 lck domain; c. binds to a human SH-PTP2 SH2 domain with a? nion affinity that is more than one hundred times less than the binding affinity with which the compound binds to? Ick SH domain? human; d. binds to a human? 85 SH2 domain with a binding affinity that is more than one hundred times less than the binding affinity with which the compound binds to a human Ick SH2 domain; and e. binds to a human Grb2 SH2 domain with a binding affinity that is more than one hundred times less than the binding affinity with which the compound binds to a human SH2 ick domain »12.- A compliance use with Claim 11, characterized in that the compound binds to a domain (human L2 SH2 with a binding affinity that is more than one hundred times greater than the affinity (Je binding to which the compound binds to a human SH2 src domain and a human SH2 fyn domain.