CA2225666A1 - Use of stat 5 sh2 domain specific compounds to enhance erythropoiesis - Google Patents

Abstract

Invented is a method of enhancing erythropoiesis in a subject which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

Description

CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/111~8 USE OF Stat 5 SH2 DOMAIN SPECIFIC COMPOUNDS TO ENHANCE
ERYTHROPOIESIS

BACKGROUND OF THE ~VENTION
A number of polypeptide growth factors and hormones m~ t~o their cellular effects through a signal tr~n.e~ ction pathway. Tr~n.cduc tion of signals from the cell surface l~ptCl~ for these ligands to intracellular effectors frequently involvesphosphorylation or dephosphorylation of specific protein substrates by regulatory protein tyrosine kinases (PTK) and phosph~t~ce~e~ Tyrosine phosphorylation may be the primary, or possibly even the sole, in~lif~tor of signal tr~nc-lnction in multicellular org~nicm.c. Receptor-bound and intracellular PTKs regulate cell proliferation, cell differentiation and eign~lling processes in i~ ---..r system cells.
Aberrant protein tyrosine kinase activity has been implicated or is s~l.cpecteclin a number of pathologies such as diabetes, atherosclerosis, psori~ces~ septic shock, 15 bone loss, anemia, many cancers and other proliferative ~lice~ees- Accordingly, tyrosine kinases and the signal transduction pathways which they are part of arepotential targets for drug design. For a review, see Levitzki et al. in Science 267, 1782-1788 (1995).
Many of the proteins comprising signal transduction pathways are present at 20 low levels and often have opposing activities. The ~lupe.Lies of these cignz~llin~
molecules allow the cell to control tr~ne-~nction by means of the su~ce~ r location and juxtaposition of effectors as well as by balancing activation with repression such that a small change in one pathway can achieve a ~wiLching effect.
The formation of tr~n.c~lcing complexes by juxtaposition of the .cign~llin~
25 molecules through protein-protein interactions are mtofli~tt~d by specific docking domain sequence motifs. Src homology 2 (SH2) domains, which are conserved non-catalytic sequences of approximately 100 arnino acids found in a variety of sign~lling molecules such as non-receptor PTKs and kinase target effector molecules and in oncogenic proteins, play a critical role. The SH2 domains are highly specific 30 for short phosphotyrosine-cont~ining peptide sequences found in autophosphorylated PTK receptors or intracellular tyrosine kin~ces Approximately 60 proteins having distinct catalytic or other functional CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/11158 domains yet sharing conserved SH2 domains, conserved sequences of approximately 100 amino acids, have been identified. lt is not known precisely which physiological responses in the body are controlled by each of these SH2 domains.Further, the SH2 domain-ligand/compound interactions are highly specific such that 5 minor modifications in the structure of the ligand/compound will significantly alter the selectivity with which the ligand~compound binds to the various SH2 domains.The Stat (signal transduction and activation of transcription) proteins are SH2cont~ining intracellular proteins that transmit a signal from cytokine receptors to the nucleus and activate transcription of specific target genes (Darnell J. et al., Science 264,1415-1421(1994)). These proteins are recruited to phosphorylation sites on the receptor via their SH2 domains and are themselves phosphorylated ontyrosine residues by receptor-associated Janus (JAK) tyrosine kinases.
Phosphorylation of Stat tyrosine residues provides additional binding ligands for the Stat SH2 domains which are displaced from the ~cce~Lor and bind to the Stat 15 phosphotyrosine motifs forming dimers. The dimeric Stats translocate to the nucleus where they bind to DNA and to other accessory proteins and activate transcription of target genes. Individual Stats or Stat heterodimers tr~nsrl-lce signals from different cytokine receptors, for example, Stat 6 m~ tes interleukin 4 sign~lling while Stat 5 tr~ns~ures signals from the ely~llupoietin (EPO) l~;ce~ur (Hou J. et al., Science ~, 1701-1706(1994); Penta K. et al., J. Biol. Chem. 270, 31282-31287(1995)).
In disease states involving dysregulation of cytokine activity, compounds that activate or inhibit Stat proteins would be useful therapeutic agents. For example, activation of Stat 5 would rnimic the effects of EPO and enhRnre erythropoiesis. Conversely, inhibition of Stat 6 would block IL-4 and IL-13-m.orii~t~d up-regulation of the IgE r~CclJ~Or (Izuhara K.et al., ~T. Biol. Chem. ~:ZL.
619-22(1996)) and be useful in the trearm~nt of allergic reactions. The SH2 domain of Stat proteins provides a means to activate or inhibit their function. Activation can be achieved by inducing dimer formation by means of a dyad-symmetric ligand for 30 the relevant SH2 domain, while a monomeric ligand would inhibit Stat function.
Discovery of such ligands requires targeting of the SH2 domains of specific Stat CA 0222~666 l997-l2-23 WO 97/02024 PCT~US96/11158 proteins to induce or inhibit the desired homo- or heterodimer formation.
The consequences of non selective antagonism of SH2 domains can be quite severe. For example, the Stat 5 SH2 domain and the Stat 6 SH2 domain are structurally similar, posceccing a high degree of conservation between the domains.
5 Activation of the Stat 5 SH2 domain (rliCcucce~ herein) is indicated as increasing red blood cell production while antagonism of the Stat 6 SH2 domain is indicated as treating allergic reactions. Therefore, an activator of Stat 5 with Stat 6 cross-reactivity would exacerbate allergic reactions, whereas a Stat 6 inhibitor cross-reacting with Stat 5 would inhibit erythrocyte production.
Furthermore, it would be impractical to assay potential Stat 5 SH2 domain activators in binding studies against all 60 known SH2 domains. Presently, thereare no known compounds which selectively interact with the Stat 5 SH2 domain.
It would be desirable to provide methods and compounds which allow the enh~n~ement of erythropoiesis by activating the Stat 5 SH2 domain but which avoid the production of side effects observed in non-selective SH2 domain interaction.As disclosed herein it has unexpectedly been discovered that selective activators of the Stat 5 SH2 domain can be identifie~ by binding assays against the subset of SH2 domains concicting of; the src SH2 domain, the Stat 6 SH2 domain, the lck SH2 domain, the Stat 5 SH2 domain, the fyn SH2 domain, the SHPTP2 SH2 domain, the p85 domain, the Grb2 SH2 domain and the hcp SH2 domain.
From the information described hereinafter. it has unexpectedly been discovered that co...poullds which are specific for a human Stat S SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human p85 SH2 domain and a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn ~ SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain are effective for enhancing t~ oiesis.

CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 SUMMARY OF THE INVENTION
The present invention provides a method of enhancing elyLl~. opoiesis in a subject which comprises a-lminictering to the subject a therapeutically effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity. which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat S SH2 ~iom~in The present invention also provides a method of treatin8 anemia in a subject which comprises a~lmini~t~.ring to the subject a therape~ltic~lly effective arnount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-P~P2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 dom~in a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
The present invention also provides a method of enhancing hematopoiesis in a subject which comprises ~rlmini~tering to the subject a ther~pe--ti~lly effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than CA 0222~666 1997-12-23 WO 97/02024 PCT~US96/11158 the binding affinity with which the compound binds to such Stat 5 SH2 domain. and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

DETAILED DESCRIPI'ION OF THE INVENTION
As used herein, the term "enh~ncing erythropoiesis" means increacing the production of erythrocytes.
As used herein, the term "treating" and derivatives thereof means 10 prophylactic or therapeutic therapy.
As used herein, the term "compound" means a nonpeptide chemical compound.
As used herein, when describing compounds which bind to the Stat 5 SH2 ~iom~in, Stat 5 SH2 domain activation is meant.
As used herein, when describing compounds which bind to SH2 domains other than Stat 5, antagonism is meant.
As used herein, unless other wise defined, the term "Stat 5 SH2 domain activator" and derivatives thereof means a bi~ient~fe SH2 ligand which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher, preferably greater than one hundred-fold higher, than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower, preferably greater than one hundred-fold lower, than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower, preferably greater than one hundred-fold lower, than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
As used herein, the term "bidentate SH2 ligand" means a compound having two binding regions in the same molecule.
s CA 0222~666 1997-12-23 W O 97t02024 PCT~US96/11158 The present invention provides a method of enhancing ely~ poiesis in a subject which comprises a~minictering to the subject a therapeutically effectiveamount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which 5 the compound binds to a human Stat 6 SH2 ciom~in~ (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn 10 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
A preferred aspect of the invention provides a method of e~h~nring erythropoiesis in a subject which comprises ~tlminictering to the subject a ther~reutir~lly effective amount of a col~lpou~ld which (a) binds to a human Stat S
15 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.
A preferred aspect of the invention provides a method of enh~nring e,ylhl.,poiesis in a subject which comprices ~lmini~ctering to the subject a therapeutically effective amount of a compound which (a) binds to a human Stat 520 SH2 domain with a binding affinity greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b)binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PI'P2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound 25 binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
A preferred aspect of the invention provides a method of çnh~nring 30 erythropoiesis in a subject which comprises a<lminictering to the subject a therapeutically effective amount of a compound which (a) binds to a human Stat 5 CA 0222~666 l997-l2-23 SH2 domain with a binding affinity greater than one hundred-fold higher than thebinding affinity with which the compound binds to a human Stat 6 SH2 domain.
A preferred aspect of the invention provides a method of treating ane-m-ia in a subject which comprises ~-lmini.ctering to the subject a therapeutically effective 5 amount of a compound which (a) binds to a human Stat 5 SH2 domain with a ~ binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PrP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than 10 the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human ryn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
A p,tre..cid aspect of the invention provides a method of treating anemia in a 15 subject which comprises ~lminictering to the subject a the.~ lly effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.
A preferred aspect of the invention provides a method of treating anemia in a 20 subject which comrrices ~llmini.ctering to the subject a ther~pe--tic~lly effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a 25 human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human lck SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such 30 Stat 5 SH2 domain.
A preferred aspect of the invention provides a method of treating anemia in a CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/111~8 subject which comprises a~iminictering to the subject a therapeutically effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.
A preferred aspect of the invention provides a method of enhancing hamatopoiesis in a subject which comprises ~-imini.ctering to the subject a ther~reutiç~lly effective arnount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds.to a human Stat 6 SH2 domain, (b) binds to a human hcp SH2 domain, a human Grb2 SH2 ~om~in, a human SH-PIP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to suchStat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human Ick SH2 domain and a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to suchStat 5 SH2 domain.
A preferred aspect of the invention provides a method of enh~n.~ing hamatopoiesis in a subject which compri.ces ~f1mini.ctering to the subject a therapeutic~lly effective amount of a co~ oulld which (a) binds to a human Stat S
SH2 domain with a binding affinity greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.
A preferred aspect of the invention provides a method of enhancing hamatopoiesis in a subject which comprises ~lmini.ctering to the subject a thc.d~.l~ lly effective amount of a colllpoLlnd which (a) binds to a human Stat S
SH2 domain with a binding affinity greater than one hundred-fold higher than thebinding affinity with which the compound binds to a human Stat 6 SH2 domain, (b)binds to a human hcp SH2 ~lom~in, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, and (c) binds to a human src SH2 domain, a human Ick SH2 domain and a human fyn SH2 domain with a binding affinity which CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.
A preferred aspect of the invention provides a method of enh~ncing ~ hamatopoiesis in a subject which comprises ~-lnninistering to the subject a 5 therapeutically effective amount of a compound which (a) binds to a human Stat 5 SH2 domain with a binding affinity greater than one hundred-fold higher than thebinding affinity with which the compound binds to a human Stat 6 SH2 domain.
The binding activity of compounds at the different human SH2 domains is determined in vitro using SH2 domains expressed as fusion proteins either in E. coli 10 or in baculovirus as further described in detail in Example 11 below.
The data shown in the accompanying Tables 1 and 2 inrlil-~te the ability of the stated compounds to interact with various SH2 ~orn~inc Compounds indicated as being selective for the Stat S SH2 domain from assays as demon~LIdt~:d in Example 11 are tested in known assays which are recognized in the art as correlating 15 with efficacy in enhancing erythropoiesis in vivo. Preferred assays include:
1) Hayakawa T. et al., Biolo~ic~lc 2Q, (1992) 253, and 2) Hayakawa T. et al., Biolo~icals 20, ( 1992) 243.
Activity in these assays is recognized in the art as correlating with efficacy in enhancing erythropoiesis in vivo. Activity in these assays is also recognized in the 20 art as correlating with efficacy in treating anemia in vivo. Activity in these assays is also recognized in the art as correlating with efficacy in enhancing hematopoiesis ~
vivo.
The present invention therefore provides a method of enh~n~ in~
erythropoiesis, which comprises ~-lminictering a quantity of a Stat 5 SH2 domain25 activator defined as herein in a quantity effective to enh~nre tLyLl~ )oiesis. Tlle drug may be ~-lminictered to a patient in need of enh~n~ed el~Llll~,poiesis by any conventional route of ~Aminictration, inclufling, but not limited to, intravenous, intr~mncc~ r, oral, subcutaneous, intr~c~erm~l, and parenteral. The quantity effective to enhance erythropoiesis is from about 0.001 mg per kg to about 10.0 mg 30 per kg of subject body weight. The selected dose will be an efficacious, nontoxic quantity selected from about 0.001 mg per kg to about 10.0 mg per kg of subject CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 body weight. The selected dose will be ~lminictered from about 1-6 times daily.
The method of enhancing ~ yLhlupoiesis disclosed in the present invention may also be carried out using a pharmaceutical composition comprising a Stat 5 SH2 domain activator defined herein and a ph~rm~reutir~lly acceptable carrier. The composition may contain between 0.05 mg and 500 mg of a Stat 5 SH2 domain activator, and may be constituted into any form suitable for the mode of a~lminictration s~olected Compositions suitable for oral ?~iminictration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixers, and suspensions. Forms useful for parenteral ~lminictration include sterile solutions, emulsions, and suspensions.
The present invention further provides a method of treating ~nemi~ which comprises ~dminictering a quantity of a Stat 5 SH2 domain activator defined as herein in a quantity effective against ~n~- ni~ The drug may be ~-iminictered to a patient in need of Llc~ t for anemia by any conventional route of a~lminictration, including, but not limited to, intravenous, intr~m-lscl~l~r, oral, subcutaneous,intrallerm~l, and parenteral. The quantity effective to treat anemia is from about 0.001 mg per kg to about 10.0 mg per kg of subject body weight. The selected dose will be an effica~:ious, nontoxic quantity selrctecl from about 0.001 mg per kg to about 10.0 mg per kg of subject body weight. The selected dose will be ~riminictered from about 1-6 times daily.
The method of treating anemia disclosed in the present invention may also be carried out using a ph~rm~reutir,~l colllposilion cnmpricing a Stat 5 SH2 domainactivator defined herein and a ph~rm~re-ltir,~lly acceptable carrier. The composition may contain between 0.05 mg and 500 mg of a Stat 5 SH2 domain activator, and may be concfitllted into any form suitable for the mode of a~iminictration selected.
Compositions suitable for oral ~dminictration include solid forms, such as pills.
capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixers, and suspensions. Forms useful for parenteral ~rlminictration include sterile solutions, emulsions, and suspensions.
The present invention further provides a method of enhancing hematopoiesis, which comprises afiminictering a quantity of a Stat 5 SH2 domain activator defined CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/11158 as herein in a quantity effective enh~nre hematopoiesis. The drug may be ~rlminictered to a patient in need of enh~nced hematopoiesis by any conventionalroute of ~lminictration7 including, but not limited to, intravenous, intr~m--scnlslr, oral, subcutaneous, intradermal, and ~a Gntcldl. The quantity effective to enhance hematopoiesis from about 0.001 mg per kg to about 10.0 mg per kg of subject bodyweight. The selected dose will be an efficacious, nontoxic quantity selected from about 0.001 mg per kg to about 10.0 mg per kg of subject body weight. The selected dose will be ~lminictered from about 1-6 times daily.
The method of enhancing hematopoiesis disclosed in the present invention may also be carried out using a ph~rrn~re~-tir,~l composition compricing a Stat 5 SH2 domain activator defined herein and a ph~rm~reutically acceptable carrier. The composition may contain between 0.05 mg and 500 mg of a Stat 5 SH2 domain activator, and may be conctih~ted into any form suitable for the mode of a-lminictration selected. Compositions suitable for oral ~llminictration include solid forms, such as pills, capsules, granules, tablets, and powd~ , and liquid forms, such as solutions, syrups, elixers, and ~u~nsions. Forms useful for parenteral ~lminictration include sterile solutions, emulsions, and suspensions.
The drug may otherwise be prepared as a sterile solid composition which may be dissolved or suspended at the time of ~iminictration using sterile water,20 saline, or other ~plu~iate sterile injectable .~-e~;u~ C~rrierc are intrn~led to include ~rceC~s~ry and inert binders, suspending agents, lubricants, flavorants,sweeteners, preservatives, dyes and coatings.
Optimal dQS~geS to be ~-lminict.Qred may be readily ~ietermine~l by those skilled in the art, and will vary with the particular Stat 5 SH2 domain activator in use, the strength of the preparation, the mode of ~-iminictration, and the advancement of the disease condition. Additional factors depending on the particular patient being treated will result in a need to adjust dos~ges, including patient age, weight, diet, and time of ~-iminictration.
The invention also provides for the use of a Stat 5 SH2 domain activator in the m~nnf~ct--re of a medicament for use in the tre~tment of anemia.
The invention also provides for the use of a Stat 5 SH2 domain activator in CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 the m~nuf~cture of a m~-lic~m~nt for use in enhancing hematopoiesis.
The invention also provides for the use of a Stat SH2 domain activator in the m~n~lf~ctll~e of a medicament for use in enhancing erythropoiesis.
The invention also provides for a ph~ n~reutical composition for use in the S treatmt?nt anemia which comprises an Stat SH2 domain activator.
The invention also provides for a ph~-m~relltir~l composition for use in enhancing hematopoiesis which comprises an Stat SH2 domain activator.
The invention also provides for a ph~rm~relltic~l composition for use in e lh~ncing ervthropoiesis which comprises an Stat SH2 domain activator.
No unacceptable toxicological effects are expected when the methods of the invention are utilized in accordance with the present invention.
No unacceptable toxicological effects are expected when the methods of the invention are utilized in accordance with the present invention.
Without further elaboration, it is believed that one skilled in the art can, using the precefling description, utilize the present invention to its fullest extent.
The following Examples are, therefore, to be construed as merely illustrative and not a limitation of the scope of the present invention in any way.

E~ye~ ental Details As used herein, unless otherwise intli~tt?~l the symbol ~ means ~C.
L-3,5-Dibromotyrosine can be ~Gpa~cd by methods known in the art, for example as described in "Thyoid Ho., . ,olles and Analogues. I. Synthesis, Physical Properties and Theoretical .'~~lrlll~tions" E. C. Jol~,nscll, Hormon~l Proteins and Peptides, Vol. VI, 1978, ~c~d~mir Press, N.Y. and references cited therein.
L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester (for use in Example 2 (e) and in Example 2B (b)) can be p~cp~.,d according to the following procedure.L-3,5-Dibromotyrosine (500 g) was suspended in methanol (5 liters) and dry hydrogen chloride passed through the stirred suspension for 5 hours. The reaction mixture was evaporated to dryness, the residue suspended in water (4 liters), and the pH adjusted to 6 with 40% sodium hydroxide. The ~re.,i~itatG was collected and washed with water to give L-3,5-dibromotyrosine methyl ester (467 g, 90%), m.p.

CA 02225666 l997-l2-23 W O 97/02024 PCT~US96/11158 201~-203~. The ester (768 g) was suspended in chloroform (2.7 liters) and ethyl acetate (2.7 liters), then trifluoroacetic anhydride (565 g) was added over 0.5 hour, keeping the te~ dLule below 35~. The rnixture was left overnight, then water (2 liters) was added and the pH adjusted to 7 by the addition of saturated sodium 5 bicarbonate solution. The organic layer was removed, washed with water, dried with - anhydrous m~gn~sium sulphate and evaporated. The residue was recryst~lli.ce~l from aqueous methanol to give L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester (786 g, 81%), m.p. 136~-7~.

Scheme 1 as used in Example 6 below 3~CO2H ~CO, Kaiser oxime resin ~CONHR"
RHN~ RHN~ R'COHN~
1: R=H 3: R=Boc 6 2: R=Boc 4: R=H
5: R= COR' The amino group of 4-trans-aminollletllyl~yclohexyl-carboxylic acid 1 is protected with a standard protective group such as with a Boc group (Boc anhydride, NaOH, H2O, dioxane) to forrn 2, then is coupled to Kaiser oxime resin (Kaiser, E.T.;
et al J Am Chem Soc 1985, 107, 7087-7092) using a coupling reagent such as DCC
to form 3. The amine is then deprotected under standard cnn~itionc (25% TFA, 20 methylene chloride) to form 4, then is acylated with standard conditions (such as with HBTU, NMM in DMF or DCC or DIC in DMF or NMP) to form 5. The compound is then cleaved from the resin with various amines to form the final desired product 6.

Compounds 1 to 10 are prepared according to Examples 1 to 10 which follow.

Example 1 W O 97/02024 PCTrUS96/11158 Preparation of 7-rD.L-a-Amino-a-(4-carboxyphenvl)a~et~mi~iQl-3-r2-(5-methyl-1.3.4-~hi~ 7olyl)thiomethyll~-cephem-4-carboxylic Acid (Compound 1) HO~o~N;~ Me a) 4-Hydroxymethyl~n7~lclehyde To a solution of 1,4-ben7~one~1ir~rboxaldehyde (50.0 g, 0.373 mole) in dry tetrahydrofuran (200 mL) under nitrogen in an ice bath was added dropwise lithium tri(tert-butoxy)~ min-lm hydride (104.0 g, 0.410 mole) in 500 mL of tetrahydrofuran. After stirring for one half hour in an ice bath, the reaction mixture was poured into 2 L of ice cold 2 N hydrochloric acid. The aqueous solution was extracted with four 800 mL portions of ether. The combined ether layers were washed with sodium bicarbonate solution, brine and dried. Evdyold~ion of the solvent afforded 46 g of crude m~t~.ri~l that was purified by chromatography (iqhlmin~, ether elution) to provide the title co.llyound as a crystalline m~ttqri~l tl7.6 g, 35%): mp 44.546 ~C

b) 5-(4-Hydroxymethyphenyl)hydantoin To a stirred ll~i~lulc of 4-hydroxymethylb~n7~1~1ehyde (10.0 g, 73.5 mmol) and ammonium carbonate (17.1 g, 150 mmol) in 110 mL of 60% aqueous ethanol heated to 50 ~C there was added sodium cyanide (4.0 g, 81 mmol) in 10 mL of water. The mixture was stirred and heated at 50-60 ~C for 3 h and then at 85 ~C for one hour. After cooling in an ice bath, the pH of the solution was adjusted to 6 by addition of conccllLIdted hydrochloric acid. Upon overnight cooling, the solid which had precipitated was fiItered, washed with water and dried to provide the title compound (11.0 g, 72%): mp 189-196 ~C.

c) 4-Hydroxymethyphenylglycine A mixture of compound of Example l(b) (10.9 g, 53 mmol) and barium hydroxide octahydrate (25.5 g, 81 mmol) in 125 rnL of water was stirred under 30 reflux for 18 h. The reaction mixture was cooled and acidified to pH 1 with concentrated sulfuric acid; the barium sulfate was filtered and the pH of the filtrate brought to 6 with lead carbonate. After filtration of the lead sulfate, the filtrate was CA 0222~666 1997-12-23 W O g7/02024 PCTrUS96/11158 saturated with hydrogen sulfide and the lead sulfide filtered. The aqueous solution was then concentrated to 100 mL by azeotroping with ethanol under reduced pressure to provide, after cooling, the title compound (5.2 g, 54%): mp 230-231 ~C.

d) N-~ert-B utoxycarbonyl-4-hydroxymethyphenylglycine To a solution of 4-hydroxymethyphenylglycine (8.0 g,44 mmol) and triethylamine (8.8 g, 87 mmol) in 160 mL of water was added tert-butoxycarbonyl azide (6.95 g, 49 mmol) in 120 mL of tetrahydrofuran. After stirring overnight at room temperature, the reaction mixture was washed twice with 200 mL potions of ether. The aqueous layer was covered with ether and acidified to pH 3-3.5 with 3 N
hydrochloric acid in an ice bath. The acidic solution was extracted with ether and the combined organic extrats washed with brine, dried and evaporated. The resulting oil was triturated with chloroform-hexane and the solid filtered off to provide the title compound (7.7 g, 63%): mp 139-141.5 ~C.
) N-tert-Butoxycarbonyl-4-hydroxymethyphenylglycine Methyl Ester To a solution of compound of Example l(e) (5.6 g, 20 mmol) was added dimethyl sulfate (3.1 g, 24 mrnol) and diisopropyl amine (5.2 g, 40 mmol) in methanol (10 mL). The mixture was refluxed for 20 min and was then treated with 2 N aqueous hydrochloric acid. The aqueous solutin was extracted with ethyl acetate three times and the combined organic extracts washed with 5% aqueous sodium bicarbonate and brine. Evaporation of the solvent provided the title compound as an oil (3.2 g, 55%).
f) N-tert-Butoxycarbonyl-4-carboxyphenylglycine Methyl Ester A solution of the compound of Example l(e) (0.62 g, 2.1 mmol) in 50 ml of acetone was treated with excess lones reagent (8N chromic acid) at 25~ C. The reaction rnixture was stirred at room temperature for 2 hours. The green solid was filtered off and excess CrO3 was decomposed by isopropyl alcohol. The filtrate was dried over anhydrous sodium sulfate and treated with activated charcoal. Solid was filtered off and the filtrate was evaporated to dryness to yield 0.38 g of titlecompound as white solid: mp 126-128 ~C.

g) 1,1-Dimethylethyl N,N'-Bis(1-methylethyl)car~mimi~ ç
The ti~le compound was prepared by reaction of neat N,N'-diisopropylcarbodiirnide (1.0 equiv) with 2-methyl-2-propanol (1.15 equiv) in the presence of CuCl (0.01 equiv) for 1 day at room temperature, 'according to the procedure of Santini et al. ( J. Org. Chem. 1994, 59, 2261).

SUBS I 11 UTE SHEE~ (RULE Z6) P50323-2Q2 CA 0222~666 1997-12-23 ~NS 9 6 / 1 1 1 5 8 ? ~R~j~3~ JANt997 h) N-tert-Butoxycarbonyl-4-(tert-butoxycarbonyl)phenylglycine Methyl Ester A solution of the compound of Example l(f) (1.0 g, 3.2 mmol) and 1,1-dirnethylethyl N,N'-bis(l-methylethyl)carbamimidate (1.3 mg, 6.5 mmol) of in drydichloromethane was stirred at room tempera~ure over night. Di-isopropylurea wasfiltered off and the ex~çess 1,1 -dimethylethyl N,N'-bis( l -methylethyl)carbamimidate was decomposed with water. Layers were separated and the dichloromethane solution was washed with 5% aqueous sodium bicarbonate and brine and dried over anhydrous sodium sulfate. Solvent was evaporated off and the residue was treatedwith diethyl ether. Additional di-isopropylurea was filtered off and the organicfiltrate was evaporated to yield the title compound as an oil (870 mg, 74%).

i) N-tert-Butoxycarbonyl-4-(tert-butoxycarbonyl)phenylglycine A solution of the compound of Example l(h) (760 mg, 2.1 mmol) in 18 mL
of 5% aqueous sodium bicarbonate, 18 mL of 5% aqueous sodium carbonate and 36 mL of methanol was stirred ovenight at room temperature for 5 hours. The reaction mixture was diluted with water, washed with ethyl acetate and the aqueous solution was covered with fresh ethyl acetate and acidified to pH 2 with 3N HCl. Layers were separated and the aqueous solution was extraced with ethyl acetate 2 more times. Ethyl acetate solutions were dried over anhydrous sodium sulfate and evaporated to yield title compound as a white solid (600 mg, 82%): mp 77-79 ~C.

j) tert-Butyl 7-Amino-3-[2-(5-methyl-1,3,4-thi~ 7olyl)thiomethyl]~3-cephem-4-carboxylate.
A solution of tert-butyl 7-aminocephalosporanate (E~repared from 7-aminocephalosporanic acid by reaction with isobutylene and sulfuric acid in 1,2-dimethoxyethane, according to the procedure of Blacklock et al., J. Org. Chem.
1989, 54, 3907), sodium bicarbonate and 2-mercapto-5-methyl- 1,3,4-thiadiazole in phosphate buffer (pH 6.4) is stirred for 6 h at 60 ~C. The reaction mixture is worked up by extraction with aqueous hydrochloric acid/ethyl acetate to provide the title compound.

k) fert-Butyl 7-[D,L-a-(tert-Butoxycarbonylamino)-a-[4-(tert-butoxycarbonyl)phenyl]]acetamido-3-[2-(5-methyl- l ,3,4-thiadiazolyl)thiomethyl]~3-cephem-4-carboxylate A mixture of N-tert-butoxycarbonyl-4-(tert-butoxycarbonyl)phenylglycine of Example l(i)(351 mg, I mmol), tert-butyl7-amino-3-[2-(5-methyl-1,3,4-I ~ C~

A~ED S~Er W O 97/02024 PCT~US96/11158 th~ 7olyl)thiomethyl]~3-cephem-4-carboxylate of Example l(j) (368 mg, 1 mmol) and DCC (212 mg, 1 mmol) in dry dichlorom~th~ne was stirred at room te~ eldture for 3 hours. The dicyclohexylurea was filtered off and the filtrate was evaporated to dryness. The residue was dissolved in ethyl acetate and the ethyl acetate solution S was washed with 5% aqueous sodium bicarbonate, 2.5% sulfuric acid, 5% aqueous sodium bicarbonate, brine and dried over anhydrous sodium sulfate. The solvent was evaporated to yield 0.6 g of crude product. Purifi~tion by silica gel ch~omatography (elution with 30:70 ethyl acetate / benzene) provided the title compound (430 mg, 61~o): mp 110-112 ~C.

1) 7-[D,L-a-Amino-lx-(4-carbo~y~henyl)~cet~mitlo]-3-[2-(S-methyl-1,3,4-thi~ 7Olyl)thiomethyl]A3-cephem-4-carboxylic Acid A solution of the compound of Example l(k) (400 mg, 0.57 mmol) was stirred in 7.2 mL of trifluoroacetic acid and 0.8 mL of thiophenol. The reaction15 mixture was stirred at 0 ~C for 30 min~ c and at room te~ dture for 1 hour. The solvents were ~v~oldL~d off in a 40~ C water bath and the residue was trituratedwith diethyl ether three times; the solid product was dissolved in small amounts of methanol and the product was ~leci~ildted by addition of diethyl ether to afford the title compound (300 mg): mp 170-175 ~C.

Exam~le 2 Preparation of L-3.5-Dibromo-3'-(6-oxo-3(1H)-pyridazinylmçthyl)-thyronine (Co~ >uulld 2) Br ~ ~ 2 HO ~ Br CO2H

N~N O
H

(a) o-Metho~y~h~llylacetonitrile (23.64 g) and 3,6-dichloropyrid~7inP
(23.93 g) were dissolved in dry dimethylform~mi~1e (50 rnl) and sodium hydride 1(o CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/11158 (16.23 g of a 50% dispersion in oil) was slowly added in portions to the stirredsolution over 2 hours. The mixture was poured on to excess crushed ice and extracted with dichlorom~-th~ne. The organic layer was removed and washed with water, dried with anhydrous magnesium sulphate, charcoaled and evaporated to 5 dryness. The residue crystallised from dichloromt~th~nt?/petroleum spirit to give 1-(6-chloro-3-pyridazinyl)-1-(2-methoxyphenyl)-acetonitrile (35.5 g 85%), m.p. 91~-~ 92~.
(b) This nitrile (33.5 g) was dissolved in concentrated hydrochloric acid (200 ml), acetic acid (100 ml) and water (100 ml) and the solution refluxed withstirring. After 6 hours the solvents were evaporated and the residue recrystallised from ethyl acetate/petroleum spirit to give 2-(6-oxo-3(1H)-pyrid~inylmethyl)-anisole (21.4 g, 77%), m.p. 142~-3~.
(c) This pyridazinone (15.7 g) was dissolved in phosphorous oxychloride (22 ml) and the solution heated with stirring at 55~ (oil bath) for 1 hour. The cooled mixture was slowly poured onto crushed ice, and extracted with dichlorom~th~ne.
The organic layer was separated and washed with saturated sodium bicarbonate solution, dried with anhydrous magnesium sulphate and e~/apoldled. The residue was combined with a smaller batch (from 2.16 g of the pyridazinone) and extracted several times with boiling petroleum spirit (60~-80~). The combined extracts were charcoaled and evaporated to give 2-(6-chloro-3-pyridazinylmethyl)-anisole (16.95 g, 87%), m.p. 63~.
(d) To a stirred suspension of iodine tristrifluoro~t~et~t~ (prepared by treatment of iodine (2.54 g) with fuming nitric acid (5 ml) in acetic anhydride and trifluoroacetic acid) in trifluoroacetic anhydride (25 ml) at -15~ was added the above chloropyridazine (9.39 g) in trifluoroacetic acid (20 ml) and trifluoroacetic anhydride (25 ml), keeping the te.ll~ldture below -15~. The mixture was stirred at room tempcld~ul~ ovç~night concentrated, then a solution of sodium acetate (25 g) and sodium perchlorate (15 g) in water (200 ml) was added. The mixture was extracted with chloroform, the organic solution dried with anhydrous m~gnt~ium sulphate, then concentrated to 50 ml and poured into stirred ether (250 ml). Theprecipitate was collected and dried to give crude 4,4'-~imethoxy-3~3~-bis-(6-cllloro-3-pyridazinyl-methyl)-diphenyl iodonium perchlorate (14 g). IH NMR o(DMSO-d6) 3.80 (3H; s, ~C_ 3), 4.20 (2H, s,--CHzAr), 7.05 (lH, m, Ar-5H), 7.65 (2H, m, PyH) and 8.00 (2H, m, Ar-2,6H).
(e) The above iodonium salt (12.45 g), L-3,5-dibromo-N-trifluoroacetyl tyrosine methyl ester (8.98 g), triethylamine (4.05 g) and copper bronze (1.0 g) were stirred in dichlorom~th~n~ (50 ml) for 18 hours. The mixture was filtered, washed 1~

CA 0222~666 l997-l2-23 W 097/02024 PCT~US96/111~8 with aqueous acetic acid, 2N sodium hydroxide, then water, then dried with anhydrous m~gn.o~ m sulphate and evaporated. The residue was combined with a smaller batch (from 0.72 g of the iodonium salt) and purified by column chromatography on silica gel (400 g). Elution with ethyl acetate/petroleum spirit (60~-80~) tl:3] gave L-3,5-dibromo-3'-(6-chloro-3-pyrida7inylmethyl)-O-methyl-N-trifluoroacetyl-1-thyronine methyl ester (4.0 g) as a tan coloured froth. IH NMR~(CDCl3) 3.06 (2H, m, ArC_2CH), 3.84 and 3.93(6H, 2s,--OCH3), 4.19(2H, s, ArCH2Py), 4.75(1H, m, ArCH2C_), 6.62(3H, m, ArH), 7.17(2H, m, PyH) and 7.23(2H, s, Ar_).
(f) The above dibromo compound (3.27 g) was dissolved in acetic acid (20 ml) cont~ining sodium acetate (0.79 g). The solution was refluxed for 1.25 hours, sufficient water (approximately 2 ml) added to dissolve the plccipildted sodium chloride, and the solution ev~.poldted to dryness. The residue was partitioned between water and ethyl acetate, the organic layer removed and washed with saturated sodium bicarbonate, then dried with anhydrous m~,.P~iulll sulphate and evaporated to dryness. The residue was crystallised from ethyl acetate/petroleum spirit (60~-80~) to give L-3,5-dibromo-O-methyl-3'-(6-oxo-3(1H)-pyrida_inylmethyl)-N-trifluoro-aceLylLhylunine methyl ester (2.52 g, 79%), m.p. 176~-8~.
(g) This pyric1~7inone (2.45 g) was dissolved in dry dichloromethane (40 ml) and cooled with stirring at 0~. Boron tribromide (6.46 g) in dichloromtoth~nf~ (3 rnl) was added. A red-brown pl~ci~iLdte formed. The mixture was stirred at room temperature for 1.5 hours, then crushed ice was added. The ll~i~Lulc was filtered, the precipitate collected and dissolved in 2N sodium hydroxide (30 ml). The solutionwas heated on a steam bath for 15 minnt~c, acetic acid was then added to pH5, and the mixture cooled. The res~lting pl~ci~iL~Le was collected, washed and dried togive L-3,5-dibromo-3'-(6-oxo-3(1H)-pyrid~inylmethyl)-thyronine (1.74 g, 88%), m.p. 278~-9~ (dec.).
Alternatively, instead of using the perchlorate salt prepared in (d) for reaction step (e), the iodonium trifluoroacetate salt can be used which is prepared as follows:
Iodine (159 g) was suspended in trifluoroacetic anhydride (1 liter) and stirred under nitrogen whilst fuming nitric acid (350 ml) was added over 1.5 hours, keeping the temperature between 36~ and 40~. Trifluoroacetic anhydride (300 ml) was thenadded and the mixture m~int~in~fl at 40~ under a stream of nitrogen until all nitrogen oxides were removed, then allowed to stand at room telll~ldLure overnight. The solvent was then removed under reduced pressure and the residual solvent removedby ~eotroping with trifluoroacetic anhydride (2 X 300 ml). The pale yellow CA 0222~666 l997-l2-23 W O 97102024 PCT~US~6/11158 residual solid was then suspended in trifluoroacetic anhydride (1.2 liters) withstirring and was cooled to -20~. A solution of 2-(6-chloro-3-pyridazinylmethyl)anisole (600 g) in triflouoracetic acid (1.2 liters) was then added dropwise, m~int~ining the temperature between -10~ and -20~. The mixture was stirred at -10~ for 1 hour and at room temperature overnight, then the solvent removed under reduced pressure and the residue poured into a solution of sodium - sulphate (3.5 kg) in water (20 liters) with stirring. The pH of this mixture was adjusted to approximately pH 2 using dilute aqueous sodium hydroxide, then extracted with dichlorom~th~n-~ (2 X 3 liters, 1 x 2 liters), the organic extracts combined, dried (MgSO4), filtered, and reduced in volume to 2 liters, then added to vigorously stirred diethyl ether (12 liters). The dark grey plc-,ipi~ted solid was filtered off, washed with ether, and dried in a vacuum oven at 40~ for 6 hours to give 4,4'-dimethoxy-3,3'-bis-(6-chloro-3-pyridazinylmethyl) diphenyl iodonium trifluoro~cet~t.o (8.14 g, 90%), m.p. 145~-147~.
Further reaction of this salt using procedures analogous to those described in 2(e), (f) and (g) above gives the required L-3,5-dibromo-3'-(6-oxo-3(1H)-pyridazinyl-methyl)thyronine.

Examl?le 2A

Preparation of L-3.5-Dibromo-3'-(6-oxo-3(1H)-pyridazinylmethyl)thyronine (Co~ oulld 2) (a) 2-(6-Chloro-3-pyridazinylmethyl)anisole (plcp~cd as described in Example 2(c)(2.35 g) was dissolved in dry dichloromethane (20 ml) and cooled with stirring to -50~. Boron tribromide (3 ml) was then added dropwise, and the solution was allowed to warm to room tel~ dLulc. After 0.5 hours the orange reaction mixture was poured into ice/water (200 ml) and acetone added to dissolve the precipitated solid. The mixture was extracted with dichlorom~-th~n~, the organicextracts were separated, washed with water, dried, and ev~oldted. The residue was recryst~ erl from ethyl acetate and petroleum spirit to give 2-(6-chloro-3-pyridazinylmethyl)-phenol (1.75 g, 80%), m.p. 132~-132.5~. Anal. Found: C, 59.61;
H, 4.13; N, 12.47; Cl, 16.09; Cl,H9ClN2O Requires: C, 59.87; H, 4.11; N, 12.70; Cl, 16.07%.
(b) To a stirred solution of this phenol (2.4 g) and urea (14 g) in 75%
aqueous sulphuric acid (100 ml) t-butanol (17 ml) was added slowly. The mixture was stirred well and further quantities of t-butanol were added after 4 hours (18 Iq CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/11158 ml), 24 hours (S ml), and 28 hours (20 ml). After 120 hours the mixture was poured into water, the organic phase separated and discarded and the aqueous phase extracted thoroughly with ether. The combined ether extracts were washed with saturated brine, then dried and evaporated. The residue was recryst~ e~ from ether 5 and petroleum spirit to give 2,4-di-t-butyl-6-(6-chloro-3-pyridazinylmethyl)phenol (3.43 g, 94%), m.p. 143.0~-143.5~. Anal. Found: C, 68.32; H, 7.51; N, 8.36; Cl, 10.89; C~gH25ClN20~ Requires: C, 68.56; H, 7.57; N, 8.41; Cl, 10.65%).
(c) A solution of this phenol (1.95 g), L-3,5-dibromo-N-trifluoroacetyl tyrosine methyl ester (3.24 g) in dietheyl ether (100 ml) was stirred under argon at 10 room temperature and then treated with active m~ng~nP,se dioxide (3 X 5 g). After 4 hours the mixture was filtered, and titanium tetrachloride (5 ml) added. After 2minntes the dark solution was treated with water and extracted well with ethyl acetate. The organic extracts were combined, washed with saturated brine, dried and evaporated. The residue was chromatographed on silica gel with petroleum spirit and ether as eluant to give L-3,5-dibromo-5'-t-butyl-3'-(6-chloro-3-pyridazinylmethyl)-N-trifluoroacetyl thyronine methyl ester (2.31 g, 55%), m.p. 84~-86~.
(d) A solution of this dibromothyronine (2.76 g) and anhydrous sodium acetate (0.78 g) in acetic acid (25 ml) was heated at reflux for 10 hours, then cooled and poured into ice-water. The ~leci~iLdted solid was filtered off, dissolved in ethyl acetate, dried, and e~/a~v,d~ed to give L-3,5-dibromo-5'-t-butyl-3'-(6-oxo-3(1H)-pyridazinylmethyl)-N-trifluoroace~ylLhylunine methyl ester, (2.4 g, 55%), m.p. 112~-115~.
(e) A solution of this pyridazinone (0.200 g) and Hbr (1 ml) in glacial acetic acid (20 ml) was heated at reflux for three days. The solution was then cooled, diluted with water, basified with aqueous 2N sodium hydroxide solution and brought to pH 6 by ~ tion of acetic acid. The precipitated solid was filtered, washed, and dried to give L-3,5-dibromo-3'-(6-oxo-3(1H)-pyridazinylmethyl)thyronine (0.100 g, 65%), m.p. 245~-247~ (dec.), spectroscopically icienti~l with that previously isolated (Example 2(g)).

Exa~nple 2B

Preparation of L-3.5-Dibromo-3'-(6-oxo-3(1 H-pyridazinylmethyl)-thyronine (Compound 2~
(a) To a solution of iodine tristrifluoro~ et~t~ (prepared by tre~tm~nt of iodine (10.0 g) with fuming nitric acid (20.95 ml) in acetic anhydride and 2~

CA 0222~666 1997-12-23 W O 97/02024 PCT~USg6/11158 trifluoroacetic acid) in acetic anhydride (50 ml), cooled to -10~, was added dropwise a solution of 2-methoxybenzyl cyanide (30.0 g) in trifluoroacetic acid (60 m1) and acetic anhydride (30 ml). The temperature of the mixture was m~int~in~o~l below 0~
during the addition then allowed to stand at room temperature overnight. The ~ 5 mixture was then poured into a well-stirred ice-cold solution of sodium acetate (100 g) and sodium perchlorate (13.0 g) in water (600 ml). The solid which precipitated was filtered off, washed with water and diethyl ether to give 3,3'-dicyanomethyl-4,4'-dimethoxy-diphenyl iodonium perchlorate as a fine buff solid (23.6 g, 57%),m.p. 183~-4~ (from m~th~nol/diethyl ether).
(b) A solution of this iodonium salt (22.6 g), L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester, triethylamine (6.1 g) in dichlorom~th~n~ (300 ml) was treated with copper bronze (1 g) and the mixture stirred at room temperature for 20 hours. The mixture was then filtered and the filtrate washed with 2N aqueous hydrochloric acid ( 2 X 200 ml), water (2 X 200 ml), and 2N aqueous sodium hydroxide solution (3 X 200 ml), then the organic solution was dried over m~gnlocillm sulphate and evaporated under reduced pressure. The oily residue wasdissolved in dichloromPth~ne (30 ml) and poured into petroleum spirit. A solid pleci~ildted which was filtered off and recryst~llice~ from dichlorom~-th~n~/petroleum spirit to give L-3,5-dibromo-3'-cyanomethyl-O-methyl-N-trifluoroacetylthyronine methyl ester as a colourless crystalline solid, m.p. 148~-149~. The mother liquors were chromatographed on silica gel to give further qu~nti~içs of this compound (total = 8.05 g, 31%).
(c) To a solution of this dibromothyronine (120 mg) and 3,6-dichloropyridazine (31 mg) in dry dimethylforrn~mide (2 ml), sodium hydride (30 mg of a 50% susp~ cinn in oil) was added and the reaction llP~;l~Lulc allowed to stand at room ~el..~.dlu.e for 50 min. It was then treated with ice, and the aqueous mixture extracted with dichlorol~ ilane, the organic solution washed with saturated brine, then dried and evaporated. The residue was chromatographed on a preparative silica gel chromatography plate from which 3,5-dibromo-3'-(1-(6-chloro-3-30 pyridazinyl)-l-cyanomethyl)-O-methyl-N-trifluoroacetylthyronine methyl ester (5 mg) was isolated. IH NMR ~(CDCl3) 3.12 (lH, m), 3.27 (lH, m), 3.79 (3H, s), 3.86(3H,s),4.86(1H,m),5.80(1H,s),6.72(1H,dd),6.83(1H,d),7.04(1H,d),7.15 (lH, broad m), 7.37 (2H, s), 7.50 (2H, dd).
- Elaboration of this intermediate by standard methods gives the title 35 compound.

Example 3 ~1 CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 Preparation of 8~8-Ethylenedioxy-2~3 ~7.8.9.10-hexahydro-4-methyl- 1 H-ben_orblthienor2~3-blpyrazolor3.4-dlpyridin-3-one (Compound 3) ~CHa a) Ethyl 2-Cyano-2-(4,4,-ethylenedioxycyclohexylidene)acetate To a mixture of 1,4 cyclohexanedione monoethylene ketal (25 g, 0.160 mol) and ethyl cyanoacetate (18 g, 0.160 mol) in toluene (400 mL) was added dropwise diethylamine (25 g, 0.337 mol) at room tc~ dture~ The reaction mixture was heated at reflux overnight (using a Dean Stark apparatus). The mixture was cooled and partitioned with ethyl acetate and saturated aqueous sodium bicarbonate (3x).
The organic extracts were dried over sodium sulfate, filtered, conccllLIdted in vacuo and recryst~ 7~ll from ethanol to yield the title compound as an white solid (15.8 g, 45%): mp 80-81 ~C; IH NMR (400 MHz, CDC13) o 4.28 (q, J = 7.2 Hz, 2 H), 4.00 (s,4H),3.18(t,J=6.5Hz,2H),2.85(t,J=6.5Hz,2H), 1.89(t,J--6.5Hz,2H), 1.82(t,J=6.5Hz,2H), 1.35 (t,J=7.1 Hz,3H).

b) Ethyl 2-Amino-6,6-ethylenedioxy4,5,6,7-tetrahydroben_o[b]thiophene-3-carboxylate To a suspension of compound of F~mple 3(a) (10 g, 45.6 rnmol), sulfur (1.6 g, 50.2 mmol) in ethanol (164 mL) at 0 ~C, was added dropwise a solution of diethylamine (3.6 g, 50.2 mmol) in ethanol (26 rnL). The resnlting solution stirred at 0 ~C for 1 h, then at room telllpeld~llc for 3.5 h. The reaction llli~l.nC was quenrh~o~ with ethyl acetate and partitioned with saturated aqueous ammonium chloride solution, The aqueous phase was extracted with ethyl acetate, and the organic extracts were washed with brine. The combined organic extracts were dried over sodium sulfate, filtered, concentrated in vacuo and chromatographed (silica gel, gradient 5 to 10% CH2Cl2:EtOAc) to yield the title compound as an oil (11.3 g, 87~ H NMR (400 MHz, CDC13) o 4.25 (q, J = 7.1 Hz, 2 H), 4.02(s, 4 H), 2.92 (t, J= 6.5 Hz, 2 H), 2.74 (s, 2 H), 1.90 (t, J= 6.6 Hz, 2 H), 1.33 (t, J= 7.1, 3 H).

CA 0222~666 1997-12-23 W 097/02024 PCTnUS96/11158 c) Ethyl 7,7-Ethylenedioxy-4-hydroxy-2-methyl-5,6,7,8-tetrahydrobenzo[b]thieno[2,3-b]pyridine-2-carboxylate To a solution of compound of Example 3(b) (11.2 g, 39.5 mmol) in toluene (307 mL) at room telllp~ldluie was added ethyl 3-ethoxycrotonate (12.4 g, 78.6 mmol) and camphorsulfonic acid (0.78 g, 3.4 mmol). The reaction mixture was heated at reflux for 3.5 h using a Dean Stark trap. The mixture was then cooled, and to it was added dropwise a freshly prepared solution of 1 M sodium ethoxide (49 mL). Once the addition was complete the reaction mixture was heated at reflux for 3 h. The mixture was cooled and the precipitate was filtered. The salt was dissolved in methanol (60 mL), to it was added water (500 mL) and acetic acid (2 mL) to yield the title compound as a yellow solid (10.4 g, 76%): mp 94-95 ~C; IH NMR (400 MHz, CDC13) ~ 4.48 (q, J = 7.1 Hz, 2 H), 4.06(s, 4 H), 3.26 (t, J = 6.5 Hz, 2 H), 3.02 (s, 2 H), 2.81 (s, 3 H), 2.02 (t, J = 6.5, 2 H), 1.47(t, J = 7.1 Hz, 3 H); MS (ESI) m/z 350 [M + H]+; Anal. Calcd. for C17HIgNOsS; C, 58.44; H, 5.48; N, 4.01; Found: C,58.34; H, 5.46; N, 3.86.

d) Ethyl 7,7-Ethylenedioxy-4-trifluoromethylsulfonyloxy-2-methyl-5,6,7,8-tetrahydrobenzo[b]thieno[2,3--b]pyridine-3-carboxylate To a solution of compound of Example 3(c) (5.0 g, 14.3 mmol) in pyridine (50 mL) was added dropwise triflic anhydride (4.0 g, 14.2 mmol). The reaction mixture stirred at 0 ~C for 4 h until co~ lcte. The reaction mixture was washed with aqueous copper sulfate solution (3x) followed by water (2x), and brine (2x).
The organic layer evaporated, dried over anhydrous sodium sulfate and concentrated in vacuo. Purification by flash chromatography (silica gel, 1: 1 hexane: ethyl acetate) yielded the title colll~ou~-d as a light yellow solid (3.7 g, 54%): mp 133-134 ~C; IH
NMR (400 MHz, CDCl3) ~ 4.43 (q, J = 7.2 Hz, 2 H), 4.06(s, 4 H), 3.16 (t, J = 6.5Hz,2H),3.10(s,2H),2.77(s,3H),2.03(t,J=6.8Hz,2H), 1.41 (t,J=7.1 Hz,3 H); MS (ESI) m/z 482 [M + H]+; Anal. Calcd. for ClgHlgF3NO7S2; C, 44.90; H, 3.77; N, 2.91; Found: C, 45.03; H, 3.62; N, 2.89.
e) 8,8-Ethylenedioxy-2,3,7,8,9,10-hexahydro4-methyl-lH-benzo[b]thieno[2,3-b]pyrazolo[3,4-d]pyridin-3-one To a solution of compound of Example 3(d) (2.4 g, 5.0 mmol) in methanol (40 mL) at room tel~lpelature was added hydrazine monohydrate (4.1 g, 82.3 mmol).
The reaction mixture was heated at reflux for 3 h. The mixture was cooled then partitioned between pH 7 aqueous buffer and ethyl acetate. The organic layer wasdried over anhydrous sodium sulfate, filtered, concentrated in vacuo and a3 CA 0222~666 1997-12-23 W O 97/02024 PCT~US96tlll58 recystallized from methanol/ethyl acetate to yield the title compound as a lightyellow solid (0.99 g, 60%). IH NMR (400 MHz, d4-MeOH) ~ 4.05 (s, 4 H), 3.15 (t, J=6.5Hz,2H),3.04(s,2H),2.82(s,3H),2.06(t,J=6.5Hz,2H); MS(ESI)m/z 318 [M + H]+; Anal. Calcd. for C15Hl5N3O3SØ25 H2O: C, 55.97; H, 4.85; N, 13.05; Found: C, 55.85; H, 4.75; N, 13.30.

Example 4 Preparation of 4-r4-(4-Methylbenzoyl~benzoyllphenylacetaldehyde (C~ oulld 4) o ~ ~ r a) Methyl 4-(4-methylbenzoyl)ben7o~te A solution of methyl terephthaloyl chloride (6.2 g, 31 mmol) in 250 mL of toluene was treated with ~ linlllll chloride (8.0 g, 60 mmol) at 0~C under an argon atmosphere. The stirring mixture was warmed to 35~C for 0.5 h. and then added slowly to 100 g of ice, followed by 150 mL of ethyl acetate, 50 mL of conc. HC1,and 50 mL of water. The phases were separated, and the aqueous portion was extracted twice with 100 mL of ethyl acetate: The combined organic portionswere washed with water (2 x 75 mL) and brine (1 x 75 mL), dried over rn~gn.~cillm sulfate, filtered, and conce~ dted to a white solid. Recryst~lli7~tion from ethyl acetate and hexane afforded 6.0 g (79%) of the title cc.ll,poulld as white n~efll~s mp. 117- 118~C; IH NMR (400 MHz, CDCl3) o 8.15 (d, J = 8.35 Hz, 2H), 7.83 (d, J
= 8.30 Hz, 2H), 7.73 (d, J=.8.18 Hz, 2H), 7.31 (d, J= 8.04 Hz, 2H), 3.98 (s, 3H), 2.46 (s, 3H); MS (ESI) m/z 255 (M+H)+.

b) 4-(4-Methylbenzoyl)benzoic acid A stirring solution of methyl 4-(4-methylbenzoyl)ben7O~t~ (5.00 g, 20.0 mmol in 150 mL of 2: 1 THF: water at 65~C was treated with lithium hydroxide monohydrate (2.0 g, 48 mmol). After a period of 0.5 h the cloudy reaction mixture was allowed to cool to room telllpeldture and treated with ethyl acetate (300 mL) and 10% HCl (aq.). The organic phase was separated, washed with water (2 x 50 a~i CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 mL) and brine (1 x 50 mL), dried over magnesium sulfate, filtered, and concentrated to a white foam. IH NMR (400 MHz, CDC13) o 8.22(d, J = 8.34 Hz, 2H), 7.81 (d, J
= 8.31 Hz, 2H), 7.73 (d, J=.8.15 Hz, 2H), 7.31 (d, J = 8.00 Hz, 2H), 2.46 (s, 3H).

5 c) 4-[4-(4-Methylbenzoyl)benzoyl]anisole A solution of compound of Example 4(b) in 250 mL of toluene was treated with oxalyl chloride (21.8 g, 0.17 mol). The resulting mixture was heated to reflux for 2 h, then concentrated and allowed to stand overnight at 0.5 mm Hg and 25~C.This solid was then dissolved in 100 ml of anisole and treated with ~lnminllm chloride (11.2 g, 84 mmol) at 0~C. The mixture was heated to 70~C for 1 h and then added slowly to 100 g of ice, followed by 150 mL of ethyl acetate, 50 mL of conc.
HCI, and 50 mL of water. The phases were separated and the aqueous portion was extracted with 100 mL of ethyl acetate. The combined organic extracts were washed with water (2 x 75 mL) and brine (1 x 75 mL), dried over m~gn.ocillm sulfate, filtered, and concentrated to a white solid. Recryst~11i7~tion from ethyl acetate and hexane yielded 4.6 g (70%) of the title compound. mp. 167-169~C; IH NMR (400 MHz, CDC13) o .7.8-7.9 (m, 6H), 7.77 (d, J = 8.06 Hz, 2H), 7.32 (d, J = 8.01 Hz,2H), 7.0 (d, J = 8.74 Hz, 2H), 3.92 (s, 3H), 2.47 (s, 3H); MS (ESI) m/z 331 (M+H)+.

d) 4-[4-(4-Methylbenzoyl)benzoyl]phenol A solutioR of compound of Example 4(c) (700 mg, 2.12 mmol) in 20 mL of dichloromethane was treated with alllminllm chloride (1.0 g, 7.5 mmol) and 7.0 mL
of 1.0 M boron trichloride solution in dichlo.~ ne and heated to reflux for 1 h.The IlliX.~Ul'C was then diluted with 100 mL of dichloromloth~n.- and washed with 10% HCl (aq) (1 x 25 mL), water (1 x 25 mL), and brine (1 x 25 mL). The organic phase was dried over magn~cillm sulfate, filtered, and concentrated to a dark residue which was subjected to flash chromatography (silica gel, elution with 1: 1 ethylacetate: hexane) to yield 550 mg (82%) of the title compound. IH NMR (400 MHz, CDC13) ~ .7.8-7.9 (m, 6H), 7.77 (d, J = 8.05 Hz, 2H), 7.32 (d, J = 8.01 Hz, 2H), 6.93 (d,J=8.6Hz,2H),2.47(s,3H).

e) 4-[4-(4-Methylbenzoyl)benzoyl]phenyl trifluo.oll.cthylsulfonate A solution of compound of Example 4(d) (320 mg, 1.0 mmol) in THF (20 mL) was treated with sodium hydride (40 mg, 1.67 mmol) and N-phenyltrifluolo",~Stll~ntoslllfonimide (500 mg, 1.40 mmol) at 0 ~C. The reactionmixture was allowed to warm up to room te.l-pe.dture and was then stirred for 18 h.
room temperature. The reaction was then partitioned between ethyl acetate and ~5 CA 0222~666 l997-l2-23 brine; layers were separated and the organic extract was dried over m~gnPcium sulfate and evaporated. Purification by flash chromatography (silica gel, 80:20 hexane: ethyl acetate) afforded the title compound (300 mg, 66%). mp. 180-181~C;
IHNMR(400MHz,CDC13)o7.96(d,J=8.6Hz,2H),7.89(s,4H),7.76(d,J=
8.1 Hz,2H),7.45(d,J=8.6Hz,2H),7.33(d,J=8.1Hz,2H),2.47(s,3H).

f) 4-[4-(4-Methylbenzoyl)benzoyl]phenyl~ret~ hyde To a solution of compound of Example 4(e) (445 mg, 1.0 mmol) in DMF (10 mL) was added allyltributyltin (0.35 mL, 1.12 mmol), bis(triphenylphosphine)p~ m(II) chloride (55 mg, 0.077 mmol) and lithium chloride (125 mg, 2.95 mmol). The reaction mixture was heated to 90 ~C for 1 h, and then allowed to cool to room temperature before being partitioned between ethyl acetate and brine. The organic layer was dried over m~gn~ocillm sulfate and concentrated to a residue concicting of the desired product, 3-[4-[~(4-methylbenzoyl)benzoyl]phenyl]-l-propene, and tin-cont~inin~ by-products. This m~t~ was subjected to flash chromatography (silica gel, elution with 95:5 hexane: ethyl acetate) which removed most, but not all, of the tin impurities. A second chromatography (gradient 5% to 10% ethyl acetate in hexane) yielded 100 mg (30%)of clean olefin, which was then dissolved in dichlolu. . ~ n~ ol (3: 1, 16 mL) at -78 ~C. Ozone was bubbled through this solution for 5 min. The reaction was qllenrh~d with five drops of dimethyl sulfide and stirring continued for 30 min at -78 ~C. The solvent was evaporated and the res~ ing m~t~ l purified by flash chromatography (silica gel, elution with gradient 85: 15 to 75:25 hexane: ethyl acetate) to yield the title compound (40 mg, 40%). mp. 188-190~C; IH NMR (400 MHz, CDCl3) o 9.83 (s, 1 H), 7.88 (s, 4 H), 7.86 (d, J = 8.1 Hz, 2 H), 4.03 (s, 4 H), 3.73(s,3H),3.76(t,J=6.0Hz,2H),3.00(s,2H),2.80(s,3H),2.03(t,J=6.0 Hz, 2 H); MS (ESI) m/z 343 (M+H)+.

Example 5 Preparation of 1 ~4-Dimethyl-8.8-ethylenedioxy-2.3.7.8.9.10-hexahydro- 1 H-ben~o~blthienor2~3-blpyrazolor3.4-dlpyridin-3-one (Compound 5) CA 0222~666 1997-12-23 W O 97/02024 . PCTrUS9~/11158 H3C ,H

~CH3 - 1,4-Dimethyl-8,8-ethylenedioxy-2,3,7,8,9,10-hexahydro- IH-benzo[b]thieno[2,3-b]pyrazolo [3,4-d]pyridin-3 -one A solution of compound of Example 3(d) (0.4 g, 0.83 mmol) in methanol (6.7 mL) at room temperature was treated with methylhydrazine (0.16 g, 3.45 mmol) and the mixture is heated at reflux for 2 h. The mixture was cooled and the precipitate, cont~ining 150 mg of the 2,4-dimethyl regioisomer, filtered. The filtrate was evaporatewd and purified by flash chromatography (silica gel, elution with ~0 80:20:5 ethyl acetate:methanol:acetic acid) to provide the title compound as a yellow solid (22 mg). IH NMR (400 MHz, CDC13) o 4.03 (s, 4 H), 3.73 (s, 3 H), 3.76 (t, J
=6.0Hz,2H),3.00(s~2H),2.80(s,3H),2.03(t~J=6.0Hz,2H);MS(ESI)m/z 332 (M+H)+.

E~ le 6 PlGp~a~ion of 4-carboxy-benzophenone4-carboxamido-trans4-methyl-cyclohexyl-N-hexyl carboxamide (Compound 6) HO2C J ~N ~

a) N-t-butyloxy carbonyl-trans4-aminomethyl cyclohexyl carboxylic acid Aqueous sodium hydroxide (lN, 100 ml, 100 mmol) was added to a solution of 4-trans-aminomethyl-cyclohexyl-carboxylic acid (9.0g, 60 mmol), in dioxane (100 ml), water (100 ml) at 0 degrees C. Boc anhydride (15.9 g, 66 mmol) was added and the reaction was warmed to rt and stirred overnight. The solution was concentrated to 50 ml, then was diluted with EtOAc (100 ml) and acidified to pH 2 with adqueous KHSOI (lN). The organic layer was then extracted with water (100 ml) two times, and the organics were concentrated in vacuo. The solid was recryst~lli7Pc~ from EtOAc/ hexanes to yield 9.2g + 3.4g (second crop) of a white solid. (80% yield). MS (ES) m/e 242 [M+H]~.

CA 0222~666 1997-12-23 W O 97/02024 . PCTrUS96/11158 b) N-t-butyloxy carbonyl-trans-4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate Kaiser oxime resin (20 g, 0.7 mmol/g lo~ling, Advanced Chem Tech) was 5 added to a solution of N-t-butyloxy carbonyl-trans4-aminomethyl cyclohexyl carboxylic acid (5.0 g, 20 mmol) and DCC (4.4 g, 20 mmol) in methylene chloride (200 ml) and was gentle mixed at rt overnight. The solid was filtered and collected, then washed with methylene chloride (5 x 100 ml). Then the resin was ~c~ s~endedin methylene chloride (200 rnl), and N-t-butyloxy ca 1,onyl-trans-4-aminomethyl cyclohexyl carboxylic acid (5.0 g, 20 mrnol) and DCC (4.4 g, 20 mmol) were addedand the reaction was gently mixed overnight at rt. The solid was filtered and collected, then washed with methylene chloride (5 x 100 ml), then was dried overnightundervacuum. IR(KBr,cm'')=1820, 1771, 1520.

c) trans-4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate N-t-butyloxy call,onyl-trans-4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate (20 g) was s-lcpen-led in methylene chloride (100 ml) and TFA (25 ml) was added. The reaction was gently mixed for 0.5 h, then the solid was filtered and collected, then was washed with with methylene chloride (5 x 100 rnl), then was dried overnigh~ under V~L~;UU~ll. IR (KBr, cm'')=3150, 1770, 1526 d) 4-carboxy-benzoph~non~-4-carboxamido-trans-4-methyl-cyclohexyl-(Kaiser oxime resin) ca l,o~ylate Trans-4-~min~ mPthyl cyclohexyl (Kaiser oxime resin) carboxylate (200 mg) was s~lspe~ in DMF (3.0 ml) and N-methyl morpholine (0.2 ml) and 4, 4'-benzophenone dic~L,-,~ylic acid (190 mg, 0.7 mmol) and HBTU (265 mg, 0.7 mmol) was added and the reaction was gently mixed for 3 h. The solid was filtered and collected, then was washed with with DMF (3 x 20 ml), then water (3 x 20 ml), then was resuspended in DMF (3.0 ml) and N-methyl morpholine (0.1 ml) and 4,4'-benzophenone dicarboxylic acid (0.35 mmol) and HBTU (0.35 mmol) was added and the reaction was gently mixed for 3 h. The solid was filtered and collected, then was washed with with DMF (3 x 20 ml), then water (3 x 20 ml), then methylene chloride (5 x 20 ml), then was dried under vacuum.

e) 4-carboxy-benzophenone4-carbox~midQ-trans4-methyl-cyclohexyl-N-hexyl carboxamide 4-carboxy-benzophenone4-carboxamido-trans4-methyl-cyclohexyl-(Kaiser CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 oxime resin) carboxylate (200 mg) was suspended in methylene chloride (3.0 ml) and hexyl amine (0.3 mmol) was added. The reaction was gently mixed for 3 h thenwas filtered, and the filtrate was concentrated in vacuo to yield the title compound:
MS (ES) m/e 493 [M+H]+.

Example 7 Preparation of 4-nitro-benzamido-trans-4-methyl-cvclohexyl-N-hexyl carboxamide (Compound 7) 02N~N~O H

10 ~

4-nitro-ben7~mi-1Q-trans-4-methyl-cyclohexyl-N-hexyl carboxamide Following the procedure of Example 6(a)-(e), except substituting 4-nitro benzoic acid for and 4, 4'-benzophenone dicarboxylic acid, the title compound was 15prepared: MS (ES) m/e 390 [M+H]+.

Exam~le 8 Plc~dLion of 4-~ et~mido-benzamido-trans-4-methyl-cyclohexyl-N-1-(amino-R-2-(methoxy methyl)-pyrrolidine) carboxamide (Compound 8) N~' HN 12 Following the procedure of Example 6(a)-(e), except substituting 4-acetamido- benzoic acid for and 4, 4'-benzophenone dicarboxylic acid and R- 1-25arnino-2-(methoxy methyl)- pyrrolidine (RAMP) for hexyl amine, the title compound was prepared: MS (ES) m/e 331 [M+H]+.

Example 9 Preparation of 4-formyl-E-cinn~mi~lo-trans-4-methyl-cyclohexyl-N-(propyl) 30carboxamide (Compound 9) .

CA 02225666 l997-l2-23 W O 97/02024 PCT~US96/11158 OHC~ 3~ O
1 ~N O H

Following the procedure of Example 6(a)-(e), except substituting 4-formyl cinnzlmi~ acid for and 4, 4'-benzophenone dicarboxylic acid and propyl amine for5 hexyl amine, the title compound was p.c~a ed: MS (ES) m/e 357 [M+H] .

Example 10 Preparation of 2.3.7.8.9.10-Hexahydro-4-methyl-1 H-benzorblthienor2.3-blpyrazolor3.4-dlpyridin-3-one (Compound 10) H

C~CHa a) Ethyl 4-Hydroxy-2-methyl-5,6,7,8-tetrahydrobenzo[b]thieno[2,3--b]pyridine-2-carboxylate A solution of ethyl 2-amino-4,5,6,7-tetrahydrobenzo[b]thiophene-3-carboxylate (8.9 g, 39 mmol) and ethyl 3-ethoxycrotonate (12.4 g, 78 mmol) in toluene (300 rnL) was treated with c~mph.nrsulfonic acid (0.78 g, 3.4 mmol) and the reaction mixture was heated at reflux for 3 h using a Dean Stark trap. The mixture was then cooled to room ~e~ ,.h-re and was subsequently treatedwith a freshly prepared 1 M solution of sodium ethoxide (48 mL, 48 mmol). After addition was complete the reaction mixture was heated at reflux for 3 h. The mixture was cooled, concentrated and the residue dissolved in ethyl acetate. Acetic acid (2 mL) was added, solvent evaporated and resulting solid Lli~uldled with methanol to yield the title compound as an off-white solid (8.4 g, 74%): mp 140 ~C; IH NMR (400 MHz, CDC13) o 4.48 (q, J = 7.2 Hz, 2 H), 3.04 (br s, 2 H), 2.81 (s, 3 H), 2.80 (br s, 2 H), 1.87 (br s, 4 H), 1.47 (t, J = 7.2 Hz, 3 H);; Anal. Calcd. for ClsH17NO3S: C, 61.83;
H,5.88;N,4.81;Found: C,61.69;H,5.81;N,4.73.

b) Ethyl 4-Chloro-2-methyl-5,6,7,8-tetrahydrobenzo[b]thieno[2,3--b]pyridine-2-~C

CA 0222~666 1997-12-23 WO 97/02024 PCTrUS96/11158 carboxylate A solution of compound of Example lO(a) (8.0 g, 27.4 mmol) in phosphorus oxychloride (100 mL) was refluxed for 3.5 hours. The phosphorus oxychloride was removed under vacuum and the residual oil was dissolved in ethyl acetate, washedwith 5% aqueous sodium bicarbonate and dried over anhydrous sodium sulfate.
Evaporation of the solvent provided the title compound as a crystalline solid (8.5 g, 95%): mp 65-66 ~C; lH NMR (400 MHz, CDCl3) ~ 4.47 (q, J = 7.1 Hz, 2 H), 3.10 (br s, 2 H), 2.85 (br s, 2 H), 2.60 (s, 3 H), 1.89 (br s, 4 H), 1.43 (t, J= 7.1 Hz, 3 H);
Anal. Calcd. for C15HI6ClNO2SØ125 H2O: C, 57.73; H, 5.25; N, 4.49; Found: C, 57.69; H, 5.08; N, 4.30.

c) 2,3,7,8,9,10-Hexahydro-4-methyl-lH-benzo[b]thieno[2,3-b]pyrazolo[3,4-d]pyridin-3-one A solution of compound of Example lO(b) (2.0 g, 6.4 mmol) in methanol (50 mL) was treated with hydrazine monohydrate (10 mL) and the resl-lting rnixture was heated at reflux for 16 h. The reaction was poured over diluted aqueous hydrochloric acid and the title compound ~eci~iL~t~d as a yellow solid (1.8 g). IH NMR (400 MHz, d4-MeOH) ~ 3.01 (br s, 2 H), 3.00 (s, 3 H), 2.92 (br s, 2 H), 2.00 (br s, 4 H); Anal. Calcd. for C13H13N3OS.HCL0.25 H2O: C, 52.00; H, 4.87; N, 13.99; Found: C, 51.92; H, 5.01; N, 13.70.

Example l l-Protocol for the Determination of Activity of Compounds at Human SH2 Domains The activity of compounds at the different human SH2 domains is determined in vitro using SH2 domains expressed as fusion proteins either in ~ coli or baculovirus. The SH2 domains used herein were the human forms of the Stat 6 SH2 domain, src SH2 domain, Grb2 SH2 domain, lck SH2 domain, Stat 5 SH2 domain, fyn SH2 domain, SH-PTP2 SH2 domain, p85 SH2 domain and hcp SH2 domain.
The fusion proteins cont~ining the src, Stat 6,1ck, Stat 5 and hcp SH2 domains were expressed as the general sequence: DET1-DET2-spacer-ek-SH2, where DET1, DET2, spacer, ek and SH2 are as described below. DET1 ("defined epitope tag 1") (SEQ ID NO: 1) is an 11 amino acid sequence found in the Human Immunodeficiency Virus Type 1 (HIV-1) envelope protein gpl20 (or gpl60).
3i CA 0222~666 l997-l2-23 W O 97/02024 . PCTrUS96/11158 Monoclonal antibodies to various epitopes of HIV-l gpl20 (or gpl60) are known inthe art, see, for example U.S. Patent 5,166,050. One preferred example is monoclonal antibody 178.1 (see, e.g., Thiriart et al., J. Immunol.. 143:1832-1836 (1989)), which was prepared by imml]ni7~tion of mice with a yeast-expressed HIV-l .
gp 160 molecule from strain BH 10 (Ratner et al., Nature, 313:277~284 (1985)). This tag was used for detection of expression (by Western blot), for pnrific~tion of the protein (by affinity chromatography), and for configuring assays in which the fusion protein is captured or irnmobilized using the 178.1 antibody. DET2 is a hexa-histidine sequence tag (SEQ ID NO: 2) which binds to nickel-cont~ining resins and was used for purification purposes. Spacer (SEQ ID NO: 3) was utilized to design a BamHl restriction site at the indicated position of the construct. The terrn -ek-refers to a recognition sequence (SEQ ID NO: 4) for the enterokinase protease which provides for the optional removal of the tags from the SH2 domain, thus producing an SH2 domain that contains no extraneous amino acids. SH2 domains which contain no extraneous amino acids are preferable to tagged protein for crystallography studies. SH2 refers to the SH2 dom~in~ of different proteins.
The DNA sequence encoding each DETl-DET2-spacer-ek-SH2 was ~1esign~ such that the in~ t~l restriction sites (BamHl and XbaI) flank the spacer-ek-SH2 region, thereby allowing different spacer-ek-SH2 contructs to be readily substituted into any one of the vectors described in Procedures 2, 3, 5 or 6 below to create a DETl-DET2-spacer-ek-SH2 tagged protein. The DNA sequence encoding each DETl-DET2-spacer-ek-SH2 construct was also ~e~ign~ such that the entire tagged SH2 domain can be moved as an NdeI-XbaI fragment into any expression vector con~ining an NdeI site at an a~p~vpliate~ t~nl~e downstream of E. coli orbaculovirus transcription and translation regulatory sequences and a downstream cloning site compatible with XbaL Although any suitable vector would yield sirnilar results (e.g., pET-l la; Novagen, Inc.), the vector used in the instant experiments are the E. coli expression vector pEAlKnRBS3. This vector is a derivative of the series of vectors described in Sh~3~7m~n, A, Gross, M, and Rosenberg, M, 1990, "Expression using vectors with phage lambda regulatory sequences", In: Current Protocols in Molecular Biology (F.A. Ausubel et al, eds.), pp. 16.3.1- 16.3.11, 3~

CA 0222~666 l997-l2-23 WO 97/02024 PCT~US96/11158 Greene Publishing and Wiley-Interscience, N.Y. (hereinafter F.A. Ausubel et al.).
The specific vector pEAlKnRBS3 is described in Bergsma et al, 1991, J. Biol.
Chem. 266:23204-23214.
The procedures below describe the expression of chicken src, human src, 5 human Stat 6, human lck, human Stat 5 and human hcp SH2 domains. First, the chicken src SH2 domain was expressed as DET1-DET2-spacer-SH2. Then, the others were inserted into this vector in place of chicken src to express proteins in the form DET1-DET2-spacer-ek-spacer-SH2 as described in procedures 1 to 6 below.

10 Procedure 1: Cloning and Expression of chicken src SH2 domain cont~ining tags DET1 and DET2 (DETl-DET2-spacer-SH2).
A DNA sequence encoding the tagged protein DET1-DET2-spacer-SH2 was PCR ~mplifi~rl from a cDNA clone cont~ining the chicken src gene (p5H; Levy et al 1986. Proc. Natl. Acad. Sci. USA 83:4228) by methods well known to those skilled15 in the art by using the following primers:

TTCCATATGAAAAGTATTCGTATTCAGCGTGGCCCGGGCCGTCACCACCA
CCACCACCACGGGATCCCCGCTGAAGAGTGGTAC l-l-r 3 ' (SEQ ID NO: 17) The llnci.orlin~d sites are an NdeI recognition site (5') and a BamHI
recognition site (3').

S' GGAATTCTAGATTACTAGGACGTGGGGCAGACGTT 3' (SEQ ID NO: 18) The lln~1erlinPd region is an XbaI recognition site.
The PCR product was digested with NdeI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into NdeI-XbaI-digested pEAlKnRBS3 vector (Bergsma et al, supra) that had been agarose gel 30 purified as a 6.5 kbp fr~gmtont The ligation reaction was used to transform E coli MM294cI~ (F.A. Ausubel et al., supra). A plasmid cont~ining an insertion of the CA 02225666 l997-l2-23 W O 97/020~4 PCT~US96/11158 correct fragment was identified and confirmed by DNA sequencing. The resultant plasmid encodes DET1-DET2-spacer-SH2 under the control of the phage larnda PL
promoter and regulatory system. Plasmid DNA was purified from MM294cr and used to transform E ~li strain AR120. In this host strain, expression of the phage promoter can be inrlvcecl by addition of nalidixic acid to the growing culture as described in F.A. Ausubel et al, supra. Nalidixic acid induction of AR120 cont~ining this plasmid, followed by analysis of the cellular proteins on an SDS-polyacrylamide gel stained with Coomassie Blue (F.A. Ausubel et al., ~), resulted in appearance of a protein band with an apparent molecular weight of 15,000; this band was not seen in llnin~ ced cells or in induced cells conr~ining pEAlKnRBS3 lacking the PCR arnplified fr~gmPnt Western blotting co~firm that the indl-ced protein band reacted with the anti-DET1 monoclonal antibody 178. l.

Procedure 2: Cloning, expression and purifi~tion of human src SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-src SH2).
A DNA sequence encoding protein ek-src SH2 was PCR ~mrlifi~d from a cDNA clone cont~ining the human src gene (c-src SH2 DNA sequence iclentie~l to that described in Takeya,T. and Hanafusa, H, 1983 Cell 32:881-890) using the following primers:

5' CGGGATCCTGGACGACGACGACAAAGCTGAGGAGTGGTATTTT 3' (SEQ ID NO: 19) The underlined site is a BamHI recognition site 5' GGAATTcrAGACTATTAGGACGTGGGGCACACGGT 3' (SEQ ID NO: 20) The ~IndPrlined region is an XbaI recognition site.

3~

CA 0222~666 1997-12-23 W 0 97/02024 PCT~US96/lllS8 The PCR product was digested with BamHI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~ining the tagged chicken src gene DET1-DET2-spacer-SH2 described in Procedure I above. In that vector, the BamHI site is 5 located between the coding regions for DET2 and SH2, and the XbaI site is located after the 3' end of the SH2 coding region. The ligation reaction was used to transform E. coli MM294cI~. The construct DET1-DET2-spacer-ek-src SH2 was confirrn~ by DNA sequencing (SEQ ID NO: 5) and inrlllce~ in E ~Q~ strain AR120 as described in Procedure 1 above. A Coomassie-Blue-stained, Western-blot-lO positive induced protein band with an apparent molecular weight of 16,000 wasobserved after nalidixic acid induction.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~NTA
column. After washing the column with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCI) and the sarne buffer cont~inin~ 15 mM imi~i~7ole~ the protein was eluted in highly purified form with 25 mM imi~l~7ole in equilibration buffer. The SH2 domain, purified in this fashion, was found to bind with high affinity in a specific, saturable fashion to the a~ iate pY peptide in the "Binding Assays" described below, demonstrating that the tag did not interfere with function.
20 This expressed fusion protein, DET1-DET2-spacer-ek-src SH2, was utilized in the "Binding Assays" ~iesr-rihe~l below in order to ~letPrrninP the specificity of compounds to selectively innibit the human src SH2 domain.

Procedure 3: Cloning and expression of human lck SH2 domain cont~ining tags and 25 an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-lck SH2).
A DNA sequence encoding protein ek-lck SH2 was PCR amplified from a cDNA clone cont~ining the human lck gene (Genbank accession number M36881) using the following primers:
-30 5' CGGGATCCTGGACGACGACGACAAAGAGCCCGAACCCTGGTTCl'r 3' (SEQ ID NO: 21) , CA 02225666 l997-l2-23 W O 97/02024 PCT~US96/11158 The underlined site is a BarnHI recognition site.

5' GCTCTAGACTATTACTGGGGCTTCTGGGTCTG 3' (SEQ rD NO: 22) s The lln~lerlin~ region is an XbaI recognition site.
The PCR product was digested with BamHI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~ining the tagged chick~on src gene DETl-10 DET2-spacer-SH2 described in Procedure 1 above. In that vector, the BamHI site is located in between the coding regions for DET2 and SH2, and the XbaI site is located after the 3' end of the SH2 coding region. The ligation reaction was used to transforrn E. coli MM294cI~. The construct cont~ining DETl-DET2-spacer-ek-lck SH2 was confirrned by DNA sequenring (SEQ rD NO: 6) and ind~lced in E. coli 15 strain AR120 as described in Procedure 1 above. A Coomassie-Blue-stained, Western-blot-positive intlucecl protein band with an app~.~llt molecular weight of 17,000 was observed after nalidixic acid induction.
Cells were lysed at neutral pH by sonication in the pl~sance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~NTA
20 column. After washing the column with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaC1) and the same buffer cont~ining 15 mM imi~ ole, the protein was eluted in highly purified form with 25 mM imic~7Ole in equilibrationbuffer. The SH2 domain, purified in this fashion, was found to bind with high affinity in a specific, saturable fashion to the a~ pliate pY peptide in the 'IBinding 25 Assays" described below, demon~.L,d~ g that the tag did not interfere with function.
This expressed fusion protein, DET1-DET2-spacer-ek-lck SH2, was utilized in the "Binding Assays" described below in order to c~eterrnin~ the specificity of compounds to selectively inhibit tne human lck SH2 domain.

30 Procedure 4: Cloning and expression of human hcp SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DETl-DET2-spacer-ek-hcp SH2).
3(o CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 A DNA sequence encoding protein ek-hcp SH2 (hcp SH2 DNA sequence ti~l to that described in Shen, S-H. Nature (1991) 352: 736-739) was reverse transcriptase-PCR amplified from human fetal liver RNA. RNA isolation used Tri-Reagent (Molecular Research Center Inc.) and the Reverse Transcriptase system 5 (GIBCO-BRL) according to the manufacture's instructions. PCR was carried out using the following primers:

5' GAAGATCTTGGACGACGACGACAAATCCCGTGGGTGGTTTCAC
3'(SEQ ID NO: 23) The underlined site is a BglII recognition site.
.

5' GCTCTAGACTATTAACTAGTGGGATCGGAGCA 3' (SEQ ID NO: 24) The nnt1torlined region is an XbaI recognition site.
The PCR product was digested with BglII and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector cont~inin~ the tagged human src gene DETl-DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the 20 BamHI site is located in between the coding regions for DET2 and ek, and the XbaI
site is located after the 3' end of the SH2 coding region. Thus, the ek-hcp SH2 sequence replaced the ek-src SH2 sequence in the above vector. The ligation reaction was used to transform E.5~Q~ MM294cI~. The construct cont~ining DETl-DET2-spacer-ek-hcp SH2 was confirrn~l by DNA sequencing (SEQ ID NO: 7) and 25 used to transform E. coli GI698 (Invitrogen Corporation, San Diego, CA). Induction of the phage lambda promoter was induced by addition of tryptophan to the culture medium to 10 mg/ml, per the m~nllf~tllre's instructions. A Coomassie-Blue-stained, Westem-blot-positive induce~ protein band with an apparent molecular - weight of 15,000 was observed after tryptophan induction of cells growing at 30~ C.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
~ After centrifugation, the insoluble pellet was solubilized with 8 M urea in Tris buffer W O 97/02024 PCT~US96/11158 pH 8 and bound onto a Ni~NTA column. The resin was washed with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCl, 8 M urea and S mM BM~) and the same buffer cont~ining 15 mM imidazole. The protein was refolded on the column during the removal of urea in the presence of 5 mM BME and the purified refoldedprotein eluted with 300 mM imi~l~7Ole in Tris buffer pH 8. The SH2 domain, purified in this fashion, was found to bind with high affinity in a specific, saturable fashion to the a~oyliate pY peptide in the "Binding Assays" described below, demonstrating that the tag did not interfere with function and that the protein was refolded sllccescflllly. This expressed fusion protein, DETl-DET2-spacer-ek-hcp SH2, was utilized in the "Binding Assays" described below in order to determine the specificity of compounds to selectively inhibit the human hcp SH2 domain.

Procedure 5: Cloning, expression and purification of human Stat 6 SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-Stat 6 SH2).
A DNA sequence encoding protein ek-Stat 6-SH2 was PCR amplified from a cDNA clone cont~ining the human Stat 6 gene (Stat 6 SH2 DNA sequence identical to that described in Science 265, (1994) 1701) using the following primers:

5' CGGGATCCTGGACGACGACGACAAACTCCGGAGCTAC-3' (SEQ rD NO:
27) The lln~ierlin~c~ site is a BamHI recognition site.

5' GGAATTCTAGACTACTTGATGGTAGC-3' (SEQ rD NO: 28) The underlined region is an XbaI recognition site.

The PCR product was digested with BamHI and XbaI, followed by isolation of the digested fragment on an agarose gel. The fragment was ligated with the vector fragment derived from BamHI-XbaI digestion of the expression vector CA 0222~666 1997-12-23 W O 97/02024 PCTrUSg6/11158 cont~ining the tagged human src gene DET1-DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the BamHI site is located between the coding regions for DET2 and SH2, and the XbaI site is located after the 3' end of the SH2 coding region. The ligation reaction was used to transform E. coli MM294cI+. The5 construct DET1-DET2-spacer-ek-Stat 6 SH2 was confirmed by DNA sequencing (SEQ ID NO: 29) and induced in E. coli strain GI698 (Invitrogen Corporation, SanDiego, CA). Tnd~-ction of the phage lambda promoter was induced by addition of tryptophan to the culture medium to 10 mg/ml, per the m~nuf~rture's instructions, also as described in procedure 4. A Coomassie-Blue-stained, Western-blot-positive in~ ce~l protein band with an apparent molecular weight of 15,000 was observed after tryptophan induction of cells growing at 27~ C.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~NTA
column. After washing the column with equilibration buffer (Tris buffer pH 8 containing 0.5 M NaCI) and the same buffer cont~ining 15 mM imid~7ole, the protein was eluted in highly purified form with 25 mM imi~l~7ole in equilibration buffer. This expressed fusion protein, DET1-DET2-spacer-ek-STAT 6 SH2, is utilized in the "Rin~ling Assays" described below in order to flete~mine the specificity of compounds to selectively inhibit the human Stat 6 SH2 domain.
Procedure 6: Cloning, expression and purifi~tion of human Stat 5 SH2 domain cont~ining tags and an enterokinase proteolytic cleavage site (DETl-DET2-spacer-ek-Stat 5 SH2).
A DNA sequence encoding protein ek-Stat 5-SH2 (Stat 5 SH2 DNA
sequence i-içnti~l to that described in Hou, J. et al., T~ y 2, (1995) 321-329) (SEQ ID NO: 30)) was synth~oci7t~t1 according to well known procedures as described in Rosen et al., Bio. Tecnniques 9, (1990) 298-300. The rçsnlting DNA sequence of the coding strand of the gene is as follows:

TTGCTTGGATCCTGGACGACGACGAC AAAATGGAAG TTCTGAAAAA
ACACCACAAA CCGCACTGGA ACGACGGTGC TATCCTGGGT

CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 TTCGTTAACA TCACGACCTG CTGATCAACA AACCGGACGG
TACCTTCCTG CCGACTCCGA AATCGGTGGT ATCACCATCG
CTTGGAAATT GAACGTAACC TGTGGAACCT GAAACCGTTC
ACCACCCGTG CCGTTCCCTG GCTGACCGTC TGGGTGACCT

CCAAATACTA CACCCCGTAATAGTCTAGAACGAA (SEQ ID NO: 31) Restriction sites for BamHI and XbaI are underlined in the sequence above.
The ek-Stat 5-SH2 gene sequence was digested with BamHI and XbaI, 10 followed by isolation of the digested fragment on an agarose gel. The fragment was ligated with the vector fragment derived from BamHI-XbaI digestion of the expression vector cont~ining the tagged human src gene DETl-DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the BarnHI site is located between the coding regions for DET2 and SH2, and the XbaI site is located after the 15 3' end of the SH2 coding region. The ligation reaction was used to transform E. coli MM294cI+. The construct DETl-DET2-sp~er-ek-Stat S SH2 was co~ rA by DNA sequçnt~ing (SEQ ID NO: 32) and in~illred in E. coli strain GI698 (Invitrogen Corporation, San Diego, CA). Tn~llction of the phage lambda promoter was inrluced by addition of tryptophan to the culture ..~ n.. to 10 mg/ml, per the m~nllf~c~lrels 20 instructions, also as described in procedure 4. A Coomassie-Blue-stained, Western-blot-positive ind~1ced protein band with an ap~&-;nt molçc-ll~r weight of 15,000 was observed after tryptophan induction of cells growing at 27~ C.
Cells were lysed at neutral pH by sonication in the presance of Iysozyme.
After centrifugation, the soluble extract is chromatographed on a Ni~NTA column.25 After washing the column with equilibration buffer (Tris buffer pH 8 cont~ining 0.5 M NaCI) and the same buffer cont~ining 15 mM imidazole, the protein is eluted inhighly purified form with 25 mM imidazole in equilibration buffer. This expressed fusion protein, DET1-DET2-spacer-ek-STAT 5 SH2, is utilized in the "Binding Assays" described below in order to determine the specificity of compounds to 30 selectively inhibit the human Stat 5 SH2 domain.

~G

CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 Fusion proteins having the structure GST-X-SH2 are prepared as described in the GST gene fusion kit system available from Pharmacia (New Jersey). GST is the tagging sequence glutathione s-transferase epitope (SEQ ID NO: 8) for fyn, Grb2 and SH-PTP2 and is the tagging sequence glutathione s-transferase epitope (SEQ ID
NO: 9) for p85. SH2 refers to the SH2 domains of fyn, Grb2, p85 and SH-PTP2 which were expressed and purified using glutathione Sepharose 4B (Pharmacia) according to "Current Protocols in Molecular Biology", ed. FM Ausubel et al., pub.
John Wiley and Sons, Inc., (1995), p 16.7.1. X is an aL,L)lupfiate linker, preferably of 6 to 21 base pairs, used to keep the SH2 construct in frame and complement cloning.
As such, the sequence of X is not critical. One skilled in the art can readily construct the a~pro~-iate linker. The DNA sequence encoding each GST-X-SH2 fusion protein was clt--signPd such that the in~lir~t~.d restriction sites (BamH1 and EcoRI) flank the SH2 region. The vector used in the instant e~elill~.lt~ was the E. coli expression vector pGEX-2T (Ph~rrn~ ) for fyn, Grb2 and SH-PTP2, and pGEX-3X
(Pharmacia) for p85. Each of these vectors result in SH2 constructs having additional C-terrnin~l amino acids as described belûw.
The sequence encoding the SH2 domain of human fyn (amino acids 143-252) (Yamamoto, T. et al. Proc. Natl. Acad. Sci. USA 83, 5459-5463 (1986)) was cloned into the BamHI and EcoRI sites of the expression vector pGEX-2T. The SH2 domain inrlnrling the additional C-terrninal amino acids leucine-threonine-asparagine-serine-serine (SEQ ID NO: 10) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-fyn. This expressed fusion prûtein was then utilized in the "Binding Assays" described below in order to determinP the specificity of compounds to selectively inhibit the human fyn SH2 domain.
Human p85 SH2 domain: The sequence encoding the SH2 domain of human p85 (amino acids 321 440) (Skolnik, E. et al., Cell 65, 83-90 (1991)) was clonedinto the BamHI and EcoRI sites of the expression vector pGEX-3X. The SH2 domain including the additional C-terminal amino acids asparagine-serine-serine (SEQ ID NO: l l)was clûned by PCR techniques known tû thûse skilled in the art to yield the expressed fusion protein GST-X-p85. This expressed fusion protein was ~1 CA 0222~666 l997-l2-23 W O 97/02024 . PCT~US96/11158 then utilized in the "Binding Assays" described below in order to ~leter~nine the specificity of compounds to selectively inhibit the human p85 SH2 domain.
Human SH-PrP2 SH2 domain: The sequence encoding the SH2 domain of human SH-PTP2 (amino acids 1-106))(Bastien, L. et al., Biochem. Biophys. Res.
Comrnun. 196, 124-133 (1993)) was cloned into the BamHI and EcoRI sites of the expression vector pGEX-2T. The SH2 domain including the additional C-terrnin~l arnino acids glut~rninç-phenyl~l~nin~--isoleucine-valine-threonine-aspartate (SEQ ID
NO: 12) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-SH-PTP2. This expressed fusion protein was then utilized in the "Binding Assays" described below in order to determine the specificity of compounds to selectively inhibit the human SH-~1~2 SH2 domain.
Human Grb2 SH2 domain: The sequence encoding the SH2 domain of human Grb2 (amino acids 58-159) (Lowenstein, E. et al., ~1 70, 431-442 (1992)) was cloned into the Bam~ and EcoRI sites of the expression vector pGEX-2T. The SH2 domain including the additional C-~eiTnin~l arnino acids isoleucine-hicti-lin.o-arginine-aspartate (SEQ ID NO: 25) was cloned by PCR techniques known to those skilled in the art to yield the expressed fusion protein GST-X-Grb2. A six nucleotide linker was used and resulted in the amino acids glycine and serine between the GST and SH2 domain. This expressed fusion protein was then utilized in the "Binding Assays" described below in order to ~letP~Tninto the specificity of compounds to selectively inhibit the human Grb2 SH2 domain.

Binding Assays: The potency of compounds at the SH2 domains is det~rTnin~l basedon the al~ility of such compounds to selectively inhibit such SH2 domain from binding to its respective specific pY peptide.
The binding assays for the SH2 domains and pY peptides are perforrned in an ELISA-based 96 well plate assay. In Millipore 96 well filter plates, hydrophilicDurapore(~) (pore size 0.65um Cat. No. MADVN6550), are added 2 ul (50%
suspension) of Protein-G Sepharose (available from Pharmacia of N.J. Cat. No. 17-0618-01) and either 2 ul of 2 mg/ml of MAB178.1 (for gpl20/SH2 domain fusion proteins src, lck, Stat 5, Stat 6 and hcp) or 0.25 ul of anti-GST polyclonal antisera ~t2 CA 0222~666 l997-l2-23 W O 97/02024 PCT~US96/11158 (available from Pharmacia of N.J.) (for GST/SH2 domain fusion proteins fyn, Grb2, p85 and SH-PTP2). 10 pmol of the subject SH2 domain fusion protein are added to their respective wells. The volume is brought to 100 ul with TBS-T (tris buffered saline plus 0.05% tween-20), incubated and shaken at room t~ peiaLu~e for 1 hr.
then washed lx with TBS-T (4~C). 90 ul of TBS-T is then added to each well.
Specific pY biotinylated peptides are diluted to a concentration of 1.0 uM in TBS-T
(these pçpt ~ç~ç2n he obta}nPdf.r~m.B2che.m. Bioscience of Pennsylv~nia, ~Jel,osys Biotechnologies of Texas and California Peptide Research of California). 10 ul is aliquoted per well to yield a final concentration of 0.1 uM (approx. the Kd for each SH2 domain/peptide pair) and a final volume of 100 ul. The assay plates are inc~-b~red until equilibrium binding was zltt~inf~l (3 hr at 4~C with ~h~king). The assay plates are washed 2 X per well TBS-T (4~C), then 100 ul of SABC
(Strepavidin biotinylated horseradish perûxidase complex, available from the Zymed corporation of California cat. nû. 93-0043, 1 drûp reagent A (~Llc;~lavidin) and 1 drop of reagent B (AH-biotin conjugated-horseradish peroxidase) per 10 ml of TBS-T, incubated at 37~C for 30 minllt~s, then coûled to 4~C) is added per well, then incubated at 4~C for 30-60 minll~los The plates are then washed 4 X with TBS-T
(4~C) (250 ul/well)/wash). 100 ul of 1 mg/ml OPD (o-phenyldiamine, Sigma Chemical Corporation, St. Louis Missouri) in Citrate Buffer is added per well. To stop development, 100 ul of 10% sulfuric acid is added per well. 150 ul from each well is then removed from the assay plate and placed in an ELISA plate. The A490 of each ELISA plate is then ~-termin~
DeLe~ ation of (IC50) for Table I
Each control or compound is assayed in duplicate. The duplicates are averaged and the background subtracted and the mAxim~l values with no inhibitionare taken from the plate, then all other data points are expressed as a percent of the maximal value (or as % control). These % control data values are graphed in Kaleidagraph for Macintosh (Synergy Software). The curves on these graphs are nonlinear curve fitted with the following equation F(x)=Emax/(l+(kd/conc)~slope), wherein the kd term represents the ICso for each of the curves.
Determination of (Ki) for Table II

CA 0222~666 l997-l2-23 The Ki for respective compounds is calculated via the following equation (see below). This expanded equation must be used under the conditions of this assay, due to the fact that the pY biotinylated peptide is not in vast excess concentration (lOOX) over the SH2 domain fusion protein. The IC50 is an 5 extrapolated value from a nonlinear curve fit using K~lei~l~graph. Rtot and *D are known values for reagents input into the assay. KD generally must be experim~.nt~lly determined for each combination of SH2 domain fusion protein andpY biotinylated peptide.

1 0 KI=(ICso-Rtot+Rtot/2((*D/(KD+*D))+(KD/(KD+*D+Rtot/2)))/( l+*D/KD+Rtot/KD((KD+*D
/2)/(KD+*D))) KI=(uM)KDof col,l~l~tor 15 IC50=(uM) IC50 for inhibitor, derived via nonline~r curve fit of competition selectivity assay data for each SH2 domain Rtot=(uM)total SH2 domain concentration within 1 assay (microtitre plate) well *D=(uM)concentration of specific pY and biotinylated peptide for each SH2 domainKD=(uM)KD value for the specific pY and biotinylated peptide for each SH2 20 domain IC50 is the concentration of inhibitor at which the response or signal is inhibited by 50%

KD is the dissociation constant for a ligand in a receptor/ligand interaction, normally 25 equaling the concentration of ligand which is at 1/2 Vmax on a saturation binding curve>

The pY peptide ligands used in the above Binding Assays are as follows:

30 Biotinylated pY peptide ligand cont~ining an aminocaproic acid (Aca) linker used for src, lck, and fyn SH2 domains CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 Glu-Pro-Gln-pTyr-Glu-Glu-Ile-Pro-Ile-Tyr-Leu (SEQ ID NO: 13) Biotinylated pY peptide ligand cont~ining an aminocaproic acid (Aca) linker used5 for p85 SH2 Asp-Gly-Gly-pTyr-Met-Asp-Met-Ser-Lys-Asp-Glu (SEQ ID NO: 14) Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used 10 for SH-PTP2 SH2 Glu-Asn-Gly-Leu-Asn-pTyr-Ile-Asp-Leu-Asp-Leu (SEQ ID NO: 15) Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used 15 for hcp SH2 Thr-Pro-Pro-His-Leu-Lys-pTyr-Phe-Tyr-Phe-Val-Val-Ser-Asp-Ser-Gly (SEQ lD
NO: 16) 20 Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used for Grb2 SH2 Leu-Pro-Val-Pro-Glu-pTyr-Ile-Asn-Gln-Ser-Val (SEQ ID NO: 26) 25 Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used forStat6:

Ser-Gly-Glu-Glu-Gly-pTyr-Lys-Pro-Phe-Gln-Asp-Leu-Ile (SEQ ID NO: 33) 30 Biotinylated pY peptide ligand cont~ining an arninocaproic acid (Aca) linker used for Stat 5:

W O 97/02024 PCT~US96/111~8 Ala-Val-Asp-Gly-pTyr-Val-Lys-Pro-Gln-Ile-Lys (SEQ ID NO: 34) Results of Binding Assays:
5 Tables I and II illustrate the cross reactivity compounds at the indicated SH2domains. From the methods described herein, compounds which have binding ~ffinifi~c which are greater than fifty-fold higher at the Stat 5 SH2 domain than the binding affmities at other SH2 domains can be readily identified.
Once a suitable selective ligand for Stat 5 is identified, a dimeric form is 10 prepared by ~tf~l hing two molecules of the ligand to one molecule of a bifunctional spacer by methods well known to those skilled in the art. The size of the spacer may be varied to opLill~ize activation of Stat S as ~letermin~ by incubation of unsrim~ te~l cell extracts with the compound and assaying for Stat S activation in a DNA gel shift assaying as described in Hou et al., T~2rr~nit,v 2. (1995), 321 ~o 329.
Contemplated herein is the method of activating other Stat SH2 dom~inc (specifically Stat 1, Stat 2, Stat 3, Stat 4 and Stat 6) by dimeric activation with a bidentate ligand.

W O 97/02024 PCT~US96/11158 V :~ X X X X X X X X X X

O ~
a -~ x X x x x x x x x x ~ 1 ~ X ~ ~, o _ X z g ~ c~l Z o ~ -- _ o, V ~
O Z Z Z Z Z Z Z Z Z Z
E-Z ~ _ 1: _ _ _ _ _ _ _ _ 5 U~ ~ Z Z Z Z Z Z Z Z Z Z
E- ~
Z Z Z X Z X Z Z Z Z

~ C Z Z Z Z Z Z Z Z Z Z
C'l ~ ~ ~ Z ~ ~ O Z ~ ~ o X ~
o ~1 C~i ~ 0 1~ ~'I O

Z ~ D -- X o ~ D
C~ ~ C
' ~ ~ ~ ~ O
V Z X
~1~

W O 97/02024 PCT~US96/11158 X X X X
~ ~ Xx Xx X X X X X X X X
Z V' , X X X XX X X X X X X
V~
~ 3 X X X X X X X X X X

O ~ Z, Z ~ Z Z
C~
~ ~ _ _ _ _ _ _ _ _ _ _ ~ C Z Z Z Z Z Z Z Z Z Z
E-~ ~ ~ Z Z Z X Z Z Z Z Z Z
~Z
Z C _ _ _ _ _ _ _ _ _ _ -- U~, Z Z Z Z Z Z Z Z Z Z

~" ~y X Z ' ~ =~ o o X

O O

~~. ~ ~ ~ ~ ~X v~

D~ C~
V~ C C ~ --~, C ~ ~ o ~ O
~ Z X X

-W 097/02024 PCTrUS96/11158 While the preferred embo-iimenr.s of the invention are illustrated by the above, it is to be understood that the invention is not limited to the precise instructions herein disclosed and that the right to all modifications coming within the S scope of the following clairns is reserved.

~lq CA 0222~666 1997-12-23 SEQUENCE LISTING

(1) GENERAL INFORMATION

(i) APPLICANT: DUNNINGTON, DAMIEN

(ii) TITLE OF THE INVENTION: USE OF Stat 5 SH2 DOMAIN
SPECIFIC COMPOUNDS TO ENHANCE ERYTHROPOIESIS

(iii) NUMBER OF SEQUENCES: 34 (iv) CORRESPONDENCE ~nDR~Cs (A) ADDRESSEE: SmithKline Beecham Corporation (B) STREET: 709 Swe~ A n d Road (C) CITY: King of Prussia (D) STATE: PA
(E) COUNTRY: USA
(F) ZIP: 19406 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COMPUTER: IBM Compatible (C) OPERATING SYSTEM: DOS
(D) SOFTWARE: FastSEQ Version 1.5 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/598,715 (B) FILING DATE: 08 February 1996 (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Dustman, Wayne J
(B) REGISTRATION NUMBER: 33,870 (C) REFERENCE/DOCKET NUMBER: P50323-2Q2 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 610-270-5023 > (B) TELEFAX: 610-270-5090 (C) TELEX:

(2) INFORMATION FOR SEQ ID NO:l:

U ~:N~ CHARACTERISTICS:
(A) LENGTH: ll amino acids ( B) TYPE: amino acid (C) STR~Nn~N~-CS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(xi) ~Qu~ DESCRIPTION: SEQ ID NO:l:

Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg l 5 l0 (2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~.~S: single (D) TOPOLOGY: linear 5\

WO 97/02024 PCT~US96/111S8 (ii) MOLECULE TYPE: peptide (iii) HYPO~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) s~Qu~ DESCRIPTION: SEQ ID NO:2:

10 His His His His His His l 5 (2) INFORMATION FOR SEQ ID NO:3:

( i ) SEQUENCE CHAP~ACTERISTICS:
(A) LENGTH: 3 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ llCAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:

(xi) ~:Q~N~ DESCRIPTION: SEQ ID NO:3:

Gly Ile Leu (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single CA 0222~666 l997-l2-23 W O 97/02024 PCTrUS96/11158 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
. 5 (iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Asp Asp Asp Asp Lys (2) INFORMATION FOR SEQ ID NO:5:

( i ) ~QU~ CHARACTERISTICS:
(A) LENGTH: 130 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(Xi) ~QU~ DESCRIPTION: SEQ ID NO:5:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His Gly Ile Leu Asp Asp Asp Asp Lys Ala Glu Glu Trp Tyr Phe Gly Lys Ile Thr Arg Arg Glu Ser Glu Arg Leu Leu Leu Asn Ala Glu Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu Thr Thr Lys Gly CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 Ala Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Ala Lys Gly Leu Asn Val Lys His Tyr Lys Ile Arg Lys Leu Asp Ser Gly Gly Phe Tyr Ile Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu Val Ala Tyr Tyr Ser Lys His Ala Asp Gly Leu Cys His Arg Leu Thr Thr Val Cys Pro Thr Ser (2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 134 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~CS single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~u~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His Gly Ile Leu Asp Asp Asp Asp Lys Glu Pro Glu Pro Trp Phe Phe Lys Asn Leu Ser Arg Lys Asp Ala Glu Arg Gln Leu Leu Ala Pro Gly Asn Thr His Gly Ser Phe Leu Ile Arg Glu Ser Glu Ser Thr Ala Gly Ser Phe Ser Leu Ser Val Arg Asp Phe Asp Gln Asn Gln Gly Glu 5~

CA 0222~666 l997-l2-23 W O 97/02024 . PCTrUS96/11158 Val Val Lys His Tyr Lys Ile Arg Asn Leu Asp Asn Gly Gly Phe Tyr Ile Ser Pro Arg Ile Thr Phe Pro Gly Leu His Glu Leu Val Arg His 5 Tyr Thr Asn Ala Ser Asp Gly Leu Cys Thr Arg Leu Ser Arg Pro Cys Gln Thr Gln Lys Pro Gln (2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 133 amino acids . (L) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His Gly Ile Leu Asp Asp Asp Asp Lys Ser Arg Gly Trp Phe His Arg Asp Leu Ser Gly Leu Asp Ala Glu Thr Leu Leu Lys Gly Arg Gly Val His Gly Ser Phe Leu Ala Arg Pro Ser Arg Lys Asn Gln Gly Asp Phe Ser Leu Ser Val Arg Val Gly Asp Gln Val Thr His Ile Arg Ile Gln Asn Ser Gly Asp Phe Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Ala CA 0222~666 l997-l2-23 WO 97/02024 PCT~us96/111~8 Thr Leu Thr G1U Leu Val Glu Tyr Tyr Thr Gln Gln Gln Gly Val Leu Gln Asp Arg Asp Gly Thr Ile Ile His Leu Lys Tyr Pro Leu Asn Cys Ser Asp Pro Thr Ser (2) INFORMATION FOR SEQ ID NO:8:

(i) ~Qu~ CHARACTERISTICS:
(A) LENGTH: 224 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 5û 55 60 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser 5~

CA 0222~666 l997-l2-23 WO 97/02024 PCT~US96/11158 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn - 5 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro - Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu - Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 5~

CA 0222~666 l997-l2-23 WO 97/02024 PCTAus96/11158 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Ile Glu Gly Arg (2) INFORMATION FOR SEQ ID NO:10:

(i) ~u~ CHARACTERISTICS:
(A) LENGTH: 117 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide ( iii ) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys Leu Gly Arg Lys Asp l 5 10 15 Ala Glu Arg Gln Leu Leu Ser Phe Gly Asn Pro Arg Gly Thr Phe Leu Ile Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr Ser Leu Ser Ile Arg Asp Trp Asp Asp Met Lys Gly Asp His Val Lys His Tyr Lys Ile Arg ~ 60 Lys Leu Asp Asn Gly Gly Tyr Tyr Ile Thr Thr Arg Ala Gln Phe Glu Thr Leu Gln Gln Leu Val Gln His Tyr Ser Glu Arg Glu Arg Ala Ala Gly Leu Cys Cys Arg Leu Val Val Pro Cys His Lys Gly Met Pro Arg Leu Thr Asn Ser Ser (2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 amino acids (B) TYPE: amino acid (C) STR~Nn~N~CS single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

~q CA 0222~666 l997-l2-23 WO 97/02024 PCT~us96/11158 Gly Met Asn Asn Asn Met Ser Leu Gln Asn Ala Glu Trp Tyr Trp Gly Asp Ile Ser Arg Glu Glu Val Asn Glu Lys Leu Arg Asp Thr Ala Asp Gly Thr Phe Leu Val Arg Asp Ala Ser Thr Lys Met His Gly Asp Tyr Thr Leu Thr Leu Arg Lys Gly Gly Asn Asn Lys Leu Ile Lys Ile Phe His Arg Asp Gly Lys Tyr Gly Phe Ser Asp Pro Leu Thr Phe Ser Ser Val Val Glu Leu Ile Asn His Tyr Arg Asn Glu Ser Leu Ala Gln Tyr Asn Pro Lys Leu Asp Val Lys Leu Leu Tyr Pro Val Ser Lys Tyr Gln Gln Asp Gln Val Val Lys Glu Asp Asn Ser Ser (2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 112 amino acids (B) TYPE: amino acid (C) sTR~Nn~NF~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Met Thr Ser Arg Arg Trp Phe His Pro Asn Ile Thr Gly Val Glu Ala Glu Asn Leu Leu Leu Thr Arg Gly Val Asp Gly Ser Phe Leu Ala Arg C&~

CA 0222~666 1997-12-23 WO 97/02024 PCTtUS96tlll58 Pro Ser Lys Ser Asn Pro Gly Asp Phe Thr Leu Ser Val Arg Arg Asn Gly Ala Val Thr His Ile Lys Ile Gln Asn Thr Gly Asp Tyr Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Ala Thr Leu Ala Glu Leu Val Gln Tyr Tyr Met Glu His His Gly Gln Leu Lys Glu Lys Asn Gly Asp Val Ile Glu Leu Lys Tyr Pro Leu Asn Cys Ala Asp Gln Phe Ile Val Thr Asp (2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 4...4 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Glu Pro Gln Tyr Glu Glu Ile Pro Ile Tyr Leu ~D~

CA 0222~666 1997-12-23 (2) INFORMATION FOR SEQ ID NO:l4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 4...4 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

25 Asp Gly Gly Tyr Met Asp Met Ser Lys Asp Glu l 5 l0 15 (2) INFORMATION FOR SEQ ID NO:l5:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (0~

CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96111158 (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 6.. 6 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Glu Asn Gly Leu Asn Tyr Ile Asp Leu Asp Leu (2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (~3 CA 0222~666 1997-12-23 WO 97/02024 PCT~Us96/11158 (B) LOCATION: 7...7 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Thr Pro Pro His Leu Lys Tyr Phe Tyr Phe Val Val Ser Asp Ser l 5 l0 15 Gly (2) INFORMATION FOR SEQ ID NO:l7:

(i) SEQu~N~ CHARACTERISTICS:
(A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: li~ear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
( vi ) ORIGINAL SOURCE:

(xi) ~QU~N-~ DESCRIPTION: SEQ ID NO:17:

TTCCATATGA AAAGTATTCG TATTCAGCGT GGCCCGGGCC GTCACCACCA CCACCACCAC
GGGATCCCCG CTGAAGAGTG GTACTTT

(2) INFORMATION FOR SEQ ID NO:l8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs CA 0222~666 1997-12-23 W O 97/02024 PCT~US96/11158 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GGAATTCTAG ATTACTAGGA CGTGGGGCAG ACGTT

(2) INFORMATION FOR SEQ ID NO:l9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~ y~O~l~r:lICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:

CGGGATCCTG GACGACGACG ACAAAGCTGA GGAGTGGTAT TTT
~6 ( 2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:
(DS

CA 0222~666 1997-12-23 WO 97/02024 PCT~US96/11158 (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

GGAATTCTAG ACTATTAGGA CGTGGGGCAC ACGGT

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STR~Nn~n~cs single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAG~ENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

CGGGATCCTG GACGACGACG ACAAAGAGCC CGAACCCTGG TTCTT

(2) INFORMATION FOR SEQ ID NO:22:

CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

GAAGATCTTG GACGACGACG ACAAATCCCG TGG~lG~ CAC

(2) INFORMATION FOR SEQ ID NO:24:

, CA 0222~666 1997-12-23 WO 97/02024 PCT~us96/11158 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid S (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

GCTCTAGACT ATTAACTAGT GGGATCGGAG CA

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 106 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~ss: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) ~Y~O~ CAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

His Pro Trp Phe Phe Gly Lys Ile Pro Arg Ala Lys Ala Glu Glu Met l 5 l0 15 Leu Ser Lys Gln Arg His Asp Gly Ala Phe Leu Ile Arg Glu Ser Glu CA 0222~666 1997-12-23 Ser Ala Pro Gly Asp Phe Ser Leu Ser Val Lys Phe Gly Asn Asp Val Gln His Phe Lys Val Leu Arg Asp Gly Ala Gly Lys Tyr Phe Leu Trp Val Val Lys Phe Asn Ser Leu Asn Glu Leu Val Asp Tyr His Arg Ser Thr Ser Val Ser Arg Asn Gln Gln Ile Phe Leu Arg Asp Ile Glu Gln Val Pro Gln Gln Pro Thr Ile His Arg Asp l00 105 (2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll amino acids (B) TYPE: amino acid (C~ STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal ( vi ) ORIGINAL SOURCE:
(ix) FEATURE:

(A) NAME/KEY: Other (B) LOCATION: 6...6 (D) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID No:26:

Leu Pro Val Pro Glu Tyr Ile Asn Gln Ser Val l 5 l0 ~9 CA 0222~666 1997-12-23 WO 97/02024 . PCTrus96/11158 ~2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~O~ LlCAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

CGGGATCCTG GACGACGACG ACAAACTCCG GAGCTAC

( 2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAG~ENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) SEQUENCE DESCRIPTION: SEQ ID No:28:
GGAATTCTAG ACTACTTGAT GGTAGC

~C, CA 0222~666 1997-12-23 W O 97/02024 PCTrUS96/11158 (2) INFORMATION FOR SEQ ID NO:29:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 145 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~Qu~ DESCRIPTION: SEQ ID NO:29:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His His His G~y IIe Leu Asp Asp Asp Asp Lys Leu Arg Ser Tyr Trp Ser Asp Arg Leu Ile Ile Gly Phe Ile Ser Lys Gln Tyr Val Thr Ser Leu Leu Leu Asn Glu Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala His Val Ile Arg Gly Gln Asp Gly Ser Pro Gln Ile Glu Asn Ile Gln Pro Phe Ser Ala Lys Asp Leu Ser Ile Arg Ser Leu Gly Asp Arg Ile Arg Asp Leu Ala Gln Leu Lys Asn Leu Tyr Pro Lys Lys Pro Lys Asp Glu Ala Phe Arg Ser His Tyr Lys Pro Glu Gln Met Gly Lys Asp Gly Arg Gly Tyr Val Pro Ala Thr Ile Lys r1l -CA 0222~666 l997-l2-23 WO 97/02024 PCT~US96/11158 (2) INFORMATION FOR SEQ ID NO:30:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 108 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:

(xi) ~:Qu~ DESCRIPTION: SEQ ID NO:30:

Met Glu Val Leu Lys Lys His His Lys Pro His Trp Asn Asp Gly Ala l 5 l0 lS~0 Ile Leu Gly Phe Val Asn Lys Gln Gln Ala His Asp Leu Leu Ile Asn Lys Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala Trp Lys Phe Asp Ser Pro Glu Arg Asn Leu Trp Asn Leu Lys Pro Phe Thr Thr Arg Asp Phe Ser Ile Arg Ser Leu Ala Asp Arg Leu Gly Asp Leu Ser Tyr Leu Ile Tyr Val Phe Pro Asp Arg Pro Lys Asp Glu Val Phe Ser Lys Tyr Tyr Thr Pro l00 105 (2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 320 base pairs (B) TYPE: nucleic acid CA 0222~666 1997-12-23 WO 97/02024 PCTrUS96/lll58 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:

(xi) ~:Qu~N~ DESCRIPTION: SEQ ID NO:31:

TTGCTTGGAT CCTGGACGAC GACGACAAAA TGGAAGTTCT GAAAAAACAC CACAAACCGC

ACTGGAACGA CGGTGCTATC CTGGGTTTCG TTAACATCAC GACCTGCTGA TCAACAAACC

GGACGGTACC TTCCTGCCGA CTCCGAAATC GGTGGTATCA CCATCGCTTG GAAATTGAAC

GTAACCTGTG GAACCTGAAA CCGTTCACCA CCCGTGCCGT l~CC~lGGCTG ACC~l~l~GGG

20 TGACCTGTCC TAC~l~lCCC GGACC~lCCG AAAGACGAAG ~ l~lCCAA ATACTACACC

CCGTAATAGT CTAGAACGAA

( 2) INFORMATION FOR SEQ ID NO:32:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 134 amino acids (B) TYPE: amino acid ( c ) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
( iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
rl~

CA 0222~666 1997-12-23 WO 97/02024 PCTruS96/lll58 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His l 5 l0 l5 His His Gly Ile Leu Asp Asp Asp Asp Lys Met Glu Val Leu Lys Lys His His Lys Pro His Trp Asn Asp Gly Ala Ile Leu Gly Phe Val Asn Lys Gln Gln Ala His Asp Leu Leu Ile Asn Lys Pro Asp Gly Thr Phe Leu Leu Arg Phe Ser Asp Ser Glu Ile Gly Gly Ile Thr Ile Ala Trp Lys Phe Asp Ser Pro Glu Arg Asn Leu Trp Asn Leu Lys Pro Phe Thr Thr Arg Asp Phe Ser Ile Arg Ser Leu Ala Asp Arg Leu Gly Asp Leu l00 105 ll0 Ser Tyr Leu Ile Tyr Val Phe Pro Asp Arg Pro Lys Asp Glu Val Phe Ser Lys Tyr Tyr Thr Pro (2) INFORMATION FOR SEQ ID NO:33:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STR~Nn~n~CS: single (D) TOPOLOGY: linear ~ 30 (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) Feature:

CA 0222~666 1997-12-23 ~A) NAME/~EY: Other (B) LOCATION: 6 6 (C) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
, Ser Gly Glu Glu Gly Tyr Lys Pro Phe Gln Asp Leu Ile (2) INFORMATION FOR SEQ ID NO:34:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE:
(ix) Feature:

(A) NAME/KEY: Other (B) LOCATION: 5 5 (C) OTHER INFORMATION: phosphorylated tyrosine residue (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

Ala Val Asp Gly Tyr Val Lys Pro Gln Ile Lys .

~5

Claims (24)

What is claimed is:

1. A method of enhancing erythropoiesis in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

2. The method of claim 1 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

3. The method of claim 1 which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain, f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

4. The method of claim 3 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

5. A method of treating anemia in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat S SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

6. The method of claim 5 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

7. The method of claim 5 which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

8. The method of claim 7 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

9. A method of enhancing hematopoiesis in a subject which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the comro-ln-binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat S SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;

g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

10. The method of claim 9 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

11. The method of claim 9 which comprises administering to the subject a therapeutically effective amount of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

12. The method of claim 11 which comprises administering to the subject a therapeutically effective amount of a compound which binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

13. Use of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; in the manufacture of a medicament for use in enhancing erythropoiesis.

14. A use according to claim 13 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

15. A use according to claim 13 wherein the compound:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;

f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

16. A use according to claim 15 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 6SH2 domain.

17. Use of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PIP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;

f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; in the manufacture of a medicament for use in treating anemia.

18. A use according to claim 17 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

19. A use according to claim 17 wherein the compound:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human Ick SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

20. A use according to claim 19 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 6SH2 domain.

21. Use of a compound which:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than fifty-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; in the manufacture of a medicament for use in enhancing hematopoiesis.

22. A use according to claim 21 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than fifty-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain.

23. A use according to claim 21 wherein the compound:
a. binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-fold higher than the binding affinity with which the compound binds to a human Stat 6 SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
e. binds to a human Grb2 SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
f. binds to a human src SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain;
g. binds to a human lck SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain; and h. binds to a human fyn SH2 domain with a binding affinity which is greater than one hundred-fold lower than the binding affinity with which the compound binds to such Stat 5 SH2 domain.

24. A use according to claim 23 wherein the compound binds to a human Stat 5 SH2 domain with a binding affinity which is greater than one hundred-foldhigher than the binding affinity with which the compound binds to a human Stat 6SH2 domain.