CA2217229A1 - Pineal gland specific gene-1 - Google Patents

Abstract

Human pineal gland specific gene-1 polypeptides and DNA (RNA) encoding such polypeptides and a procedure is disclosed. Also disclosed are methods for utilizing such polypeptides for the regulation of the pituitary gland and to modulate biological rhythms. Agonists and antagonists against such polypeptides and their use as a therapeutic to control the actions of such polypeptides are also disclosed. Also disclosed are diagnostic assays for detecting mutations in the polynucleotides encoding the polypeptides and for detecting altered levels of the polypeptide in a host.

Description

WO 96/39158 . PCTAUS95/07067 PIN~ GI~ND SPECIFIC GE2~E-l This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention has been putatively identified as a pineal gland specific gene-1, sometimes hereinafter referred to as nPGSG-ln.
The pineal gland (pineal gland or epiphysis cerebri) of hllmAn~ and other - 1~ is considered to be endocrine in its functional activity. However, in its origin and evolution within vertebrate AnimAls it has had other functional relationships. In lower forms pineal photoreceptive capacity is the major activity suggested on the basis of both microscopic structure and neurophysiology.
The m~m~-lian pineal gland is a distinctive c~ron~nt of the neu oe-~docrine system. Within the pineal gland, neural and hormonal inputs interact to regulate the synthetic and secretory activities of the pineal unique parenchymal cells, the pinealocytes. These cells are believed to synthesize and secrete hormones of two chemical families: indol~Am~ n~s such as melatonin, and peptides resem~ling those of the hypothAlAm~hypophyseal system. The major endocrine function WO96/39158 PCT~US95/07067 of the pineal gland, is mediation or modulation of the timing of some biological rhythms, known as cirC~ 3n rhythms. This modulation relates to changes in the timing of the phases of the 24 hour (circ~ n) and seasonal or ~nnn~l (cirr~nnn~
rhythms in response to environmental cues, such as the daily start and ending of light. The pineal glands rich sympathetic innervation and physiological interrelationships with stress and arousal have suggested that its endocrine activity probably is tied to these factors as well.
The pineal gland is further thought to act on aspects of brain ch~m~try and excitability under certain conditions.
The clearest ~emonctration of pineal function has been made with the seasonal regression of reproductive organs in several photoperiodic species. In the golden ha~ster, the best studied of these species, the reproductive regression that is prompted by darkness or short day photoperiods depends on the presence of the pineal gland. In hllm~n~ as in other species, marked 24 hour and seasonal rhythms occur in blood levels of the pineal hormone melatonin.
The human pineal gland develops early during the second of e~ yo~ic life. Although it is a single m~ n structure in the adult, in the em.bryo it often has two parts, an anterior and solid part originating from the region of the h~h~nlllar commissure, and a posterior and hollow part originating from a secular evagination of the diencephalic roof between the h~h~nnl ~r and posterior com~m~ssures. The m~mm~l ian pineal gland grows from infancy to adulthood mainly by an increase in the size of the pinealocytes and, secon~rily and more variably, by an increase in glial and stromal cells and their products.
Adult human pineal glands are 5 to 8 mm long and 3 to 5 m~ wide. Their thin connective tissue capsule is externally continuous with meningeal tissues and is basally interrupted by the pineal stalk.

The ~om~ n~nt view is that pineal innervation is exclusively autonomic and that the endocrine ~unctioning of the pinealocytes depends on their sympathetic innervation.
The anatomical position of the pineal gland is critical to intracranial venous drainage. It lies close to the union of outflow from the deep cerebral veins within the median and deep dural venous sinuses. Pineal tumors often impede or divert this outflow by compressing it against the splenium of the corpus callosum.
The pinealocytes have organelles for active oxidative metabolism and protein synthesis and have at least parts of structures usually associated with synaptic contacts in central nervous or retinal tissues. Pinealocytes contain vesicles or dense bodies that some authors believe to contain presecretory materials. However, the local conc~ntration and number o~ these vesicles and bodies are generally not great.
Pinealocyte mitochon~ia are notable ~or their relatively great number or concentration in the perikaryon, there polymorphism and frequently large size.
Many of the organelles and inclusions of the pinealocytes follow 24 hour cycles of change. Interest in this subject started with the discovery of high-amplitude 24 hour rhythms in pineal serotonin (5-HT, 5-hydroxytrypt~mine), and subseguently in the enzyme activities contributing to the synthesis of melatonin. The chemical and ultrastructural elements contributing to melatonin synthesis and secretion lie within the pinealocytes. In the pinealocytes, cytoplasmic vesicles, microtubules, glycogen granules, synaptic r~hhonc and synaptic ribbon fields similarly showed marked 24 hour cycles. Many of these elements have their daily peak or acrophase, during the night or dark phase o$
the daily cycle. It has been suggested that synaptic r; hhonc in m~mm~ n pinealocytes may be involved more di~fusely in ~ the transport and release of chemical mediators.

WO 96/39158 PCT~US95/07067 The pineal products are hormonal in function and are thought to act upon other organs and bodies within the brain.
The pineal products are o~ two biochemical types, indeol ~mi nDS and peptides or proteins. The pineal gland is required ~or normal levels o~ melatonin in the blood, since these levels are ~imi ni ~hed in pinealectomized ~nim~
Plasma melatonin concentrations in h~ n~ and other studied species vary with time of day and with seasons or time of year and apparently in a innate 24 rhythmicity in pineal biosynthetic and metabolic activities in the early postnatal ~nim~l comes under sympathetic control and the organ acquires sympathetic innervation. This sympathetic control occurs through the agency of norepineph~ine and cyclic amp.
Many o~ the peptides produced by the pineal gland are ~ound in the hypothAl~m~hypophyseal. Other peptides produced by the pineal gland include arginine, vasopressin, arginine vasotocin, LH-RH, TRH, somatostatin, ~-MSH, angiotensin 2, and substance P (Ouay, W.B., Histology Cell and Tissue Biology (5th ed.), pages 1079 to 1089 (1977), (edited by Weiss, L.)).
Pineal gland tumors, also known as germino~ are thought to destroy an inhibitory effect on the pituitary gland by the pineal gland which results in precocious puberty in children. Pineal ~UIIIUL~ are known most cu ~ in childhood.
In accordance with one aspect of the present invention, there are provided novel mature polypeptides as well as biologically active and diagnostically or therapeutically useful fra~ents, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragmDnts thereof.

W O 96/39158 PCT~US9S/07067 In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, for regulating secretions of the pituitary gland and for modulating biological rhythms.
In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.
In accordance with another aspect of the present invention, there is provided a process for screening compounds to determine compounds which bind to and activate the receptor for the polypeptide of the present invention and for compounds which bind to and inhibit the receptors for the polypeptides of the present invention.
In accordance with another aspect of the present invention there is provided a process of utilizing compounds which bind to and activate the receptor for the polypeptide of the present invention for therapeutic purposes.
In accordance with yet another aspect of the present invention, there is provided a process for utilizing ~he compounds which bind to and inactivate the receptor for the polypeptide of the present invention for therapeutic purposes.

WO96/39158 PCT~US95/07067 In accordance with another aspect of the present invention there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid se~l~nc~c ~ncoA;ng a polypeptide of the present invention and for detecting an altered level of the polypeptide of the present invention.
In accordance with yet a further aspect of the present invention, there are provided processes ~or utilizing such polypeptide, or polynucleotides encoding such polypeptides, for in vitro purposes--related to scientific research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should be apparent to those skilled in the art from the teA~h;ngs herein.
The following drawings are illustrative of embo~;m~nts of the inv~nt~on and are not meant to limit the scope of the invention as encompassed by the clA;mc, Figure 1 illustrates the cDNA and corresponding ~e~nc~
amino acid sequence of PGSG-1. The underlined region represents a putative signal sequence and the stAn~A~d one letter a~bl~viations for amino acids are used.
In accordance with an aspect of the present inv~nt;on, there is provided an isolated nucleic acid (polynucleotide) which ~nco~c ~or the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide ~nco~ by the cDNA of the clone deposited as ATCC Deposit No. on May 24, 1995.
A polynucleotide ~nco~;ng a polypeptide of the present invention was discovered in a cDNA library derived from human pineal gland tissue. The polynucleotide of this invention was discovered in a cDNA library derived from a human pineal gland. It cont~;nC an open re~;ng frame ~n~o~;ng a protein of 344 amino acid residues of which d~Lo~imately the first 21 amino acids residues are the putative leader sequence such that the mature protein comprises 323 amino acids. The putative soluble mature portion of the protein comprises amino acid 1 to amino 262 of SEQ ID NO:1. Beyond amino acid 262 of SEQ ID NO:1 the protein is insoluble. The protein includes a tr~n~mh~ane portion which has been putatively identified as comprising amino acids 262 to 323 of SEQ ID
NO:2.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the r~lln~ncy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA.
The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the co~ing sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for t~ mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3~ o~ the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-codins sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for WO 96/39158 PCTrUS95107067 ~ragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants ~ncoAe for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SFQ ID
NO:l) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a ~ otein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' W O 96/39158 PCT~US95107067 amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein r~m~ n~, Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotides of the present in~ention may also have the coding sequence fused in frame to a m-~ker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a m~mm~ n host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglllti nin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to polynucleotides which hybridize to the her~tn~hove-described sequences if there is at least 70%, preferably at least 90~, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the her~in~hove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95~ and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the herein~hove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide ~nco~eA by the cDNAs of Figure 1 (SEQ ID NO:l) or the deposited cDNA(s), i.e. function as a soluble neuro~eptide receptor by ret~ining the ability to bind the ligands for the receptor even though the polypeptide _g_ does not function as a membrane bound neuropeptide receptor, for example, by eliciting a second messenger response.
Alternatively, the polynucleotide may be a polynucleotide which has at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present in~ention and which has an identity thereto, as hereinabove described, and which does not retain activity. Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
The deposit(s) referred to herein will be m~;nt~;ne~
under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposi~ is required under 35 U.S.C. 112.
The sequence of the polynucleotides c~nt~;n~d in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of se~Pnc~s herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID
NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as frasmPnt~ analogs and derivatives of such polypeptide.
The terms ''fragment,ll "derivative" and "analog" when re~erring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein W O 96/39158 PCTrUS95/07067 which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretorv seouen~e or ~ se~ence .which is e~pl~yed for purification of the mature polypeptide or a ~lG~ otein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original envi~o,~..e,~t (e.g., the natural envi~ ,.e"t if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living ~n ~ ~1 iS not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a WO 96/391~8 PCTAJS95/07067 composition, and still be isolated in that such vector or composition is not part of its natural enviroL~ t.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature r polypeptide) as well as polypeptides which have at least 70~
similarity (pre~erably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90~
simil~rity (more preferably at least 90% ;~nt;ty) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally cont~;n;ng at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "s;m;l~ity" between two polypeptides is determined by co~r~ing the amino acid sequence and its conserved amino acid ~ubstitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for pro~nc; ng the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention~
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant technigues.
Host cells are genetically engineered (tr~n~ ced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the CA 022l7229 l997-l0-02 form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the PGSG-1 genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by rec~mh~nAnt techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nnnchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from comh; nAtions of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.
The a~u~Liate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an a~ ~liate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The nNA seguence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E coli. lac or tr~, the phage lambda PL
promoter and other ~u,.-oLers known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.

WO 96/39158 PCT~US95/07067 The vector may also include appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable marker genes to pro~ide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector cont~n;ng the a~ iate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transf~-~ an appropriate host to permit the host to express the prc _ln.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Stre~tomYces, S~lmon~lla t~himurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and S~odoptera Sf9;
~nim~l cells such as CH0, COS or 80wes m~l ~nom~;
adenoviruses; plant cells, etc. The selection of an appropriate host is ~Dm~ to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the se~nc~s as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embo~m~nt, the construct further ~ ises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are rcially av~ hl e. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript S~, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKR223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNE0, W O 96/39158 . PCT~US95/07067 pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chlor~mp~nicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR~ PL and trp.
Fukaryotic promoters include CMV imm~~i~te early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the a~ iate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells cont~;n;ng the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~mm~lian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, I.., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional m~nnPr to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Fra~ntc of the polypeptides of the present invention may be employed for producing the correspon~;ng full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments of the polynucleotides of the present invention may be used in a similar m~nnPr to CA 022l7229 l997-l0-02 W O 96/39158 PCT~US9./'~ 7 synthesize the full-length polynucleotides of the present invention.
Mature proteins can be expressed in m~mmAlian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translat;~n systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory ~n~ , Second Edition, Cold Spring ~arbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an Pnh~ncer sequence into the vector. Enhancers are cis-acting elements of DNA, usually a~out from 10 to 300 bp that act on a promoter to increase its transcription.
Bxamples include the SV40 Pnh~ncPr on the late side of the replication origin bp 100 to 270, a cyto-e~lovirus early promoter Pnh~ncer, the polyoma enhancer on the late side of the replication origin, and adenovirus Pnh~ncers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase ~PGK), ~-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assem~led in ~luyriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence CA 022l7229 l997-l0-02 W O 96/39158 . PCT~US95/07067 can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a ~unctional promoter. The vector will cG...yLise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, S~lmnn~lla tvDhimurium and various species within the genera Psel~mon~s, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially av~ hle plA~mi~ comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such cQm~~~cial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are cnmhin~d with an ayyl~yriate promoter and the structural sequence to be expressed.
Following trans~ormation o~ a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shi~t or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract ret~;ne~ for further purification.
-Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
V_rious mAmmAlian cell culture systems can also be employed to express recombinant protein. Examples of mAmm~lian expression systems include the COS-7 lines o~
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable o~ expressing a compatible vector, ~or example, the C127, 3T3, CHO, HeLa and BHK cell lines. ~AmmAl;An expression vectors will comprise an origin o~ replication, a suitable promoter and ~nhAncer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic el~m~ntc.
The polypeptide can be recovered and purified from recsmh;nAnt cell cultures by methods including Amm~n~um sulfate or ethanol precipitation, acid extraction, anion or cation ~h~nge chromatography, phosphocellulose chromatography, hydLO~hObic interaction chromatography, a~inity chromatography, hydroxylapatite chromatography and lectin rh~o~tography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for ~inal puri~ication steps.
The polypeptides o~ the present invention may be a naturally puri~ied product, or a product o~ chemical synthetic prsc~ ~es, or produced by recomh~nAnt techniques ~rom a prokaryotic or eukaryotic host (for _example, by bacterial, yeast, higher plant, insect and m~m~-l ;An cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial methionine amino acid residue.
Pineal tumors occur at any age, but are most co~on in childhood. Precocious puberty is a result of pineal tumors, especially in boys. The tumor compresses the aqueduct of Sylvius, causing hydrocephalus, papilledema and other signs of increased intracranial pressure. The region with the superior colliculi is also compressed, resulting in paralysis of upward gaze, ptosis, and loss of pupillary light and acco~mn~Ation reflexes.
Accordingly, A~m~ n; stration of a therapeutically effective amount of PGSG-1 polypeptide may be employed to treat the conditions outlined above which result from pineal gland tumors.
The PGSG-1 gene and gene product, in particular the soluble form of the gene product, may be also be employed to regulate biological rhythms, in particular, cirC~A~An rhythms, since it is known that the pineal glad produces melatonin which is known to regulate circA~An rhythms.
The PGSG-l gene and gene product may also be employed to regulate pituitary secretion of hormones which regulate the onset of puberty, namely luteinizing hormone (LH), follicular stimulating hormone (FSH) and growth hormone (GH) released by the pituitary.
Fragments o~ the full length PGSG-1 gene may be used as a hybridization probe ~or a CDNA library to isolate the ~ull length PGSG-1 gene and to isolate other genes which have a high sequence s~m;lA~ity to the gene or s~mi ~ A~ biological activity. Probes of this type have at least 20 bases preferably at least 30 bases, and even more preferably at least 50 bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contA~ n the complete gene WO 96/39158 PCT~US95/07067 including regulatory and promotor regions, exons, and introns. An example o~ a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence compl~m~nt~ry to that o~
the gene o~ the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members o~ the library the probe hybridizes to.
The polynucleotides and polypeptides o~ the present invention may be employed as research reagents and materials for discovery o~ treatments and diagnostics to human disease.
This invention provides a method for i~nti~ication of the receptor for a PGSG-l polypeptide. The gene Pnro~;ng the receptor can be identi~ied by numerous methods known to those o~ skill in the art, ~or example, ligand panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1~2), Chapter 5, (1991)). Pre~erably, expression cloning is employed wherein polyadenylated RNA is prepared ~rom a cell responsive to the PGSG-l polypeptide, and a cDNA library created ~rom this RNA is divided into pools and used to trans~ect COS cells or other cells that are not responsive to the PGSG-l polypeptide. Trans~ected cells which are grown on glass slides are exposed to labeled PGSG-1 polypeptide. The PGSG-1 polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-sp~ci~ic protein kinase. Following ~ixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-trans~ected using an iterative sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
As an alternative approach ~or receptor identification, labeled ligand can be photoa~inity linked with cell membrane or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE and exposed to X-W O 96/39158 . PCTAJS95/07067 ray film. The labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
This invention also provides a method of screening compounds to identify those which ~nh~nce (agonists) or block (antagonists) the interaction of PGSG-1 and its receptor. As an example, when screening ~or compounds which bind to and activate the PGSG-1 receptor, the PGSG-1 receptor in an isolated, ;m~oh;lized or cell-bound form is contacted with a plurality of compounds and those compounds are selected which bind to and interact with the receptor. The binding or interaction can be measured directly by using radioactively labeled compounds of interest or by the second messenger signals resulting ~rom the interaction or b;n~;ng of the candidate compound to the receptor.
When screening for compounds which bind to and inhibit interaction of PGS&-1 with its receptor, the candidate compounds are subject to competition-screening assays, in which PGSG-l, preferably labeled with an analytically detectible reagent, most pre~erably radioactivity, is introduced with the compound to be tested and the compounds capacity to inhibit or ~nh~nce the b;n~;ng of the labeled PGSG-1 is measured.
Another example of screening for compounds which inhibit activation of the PGSG-1 receptor comprises contacting the co."~ound to be screened and the PGSG-1 polypeptide with the PGSG-1 receptor in isolated or ,.,~ ~ne-bound form.
Inhibition of the signal generated by PGSG-1 upon interaction with its receptor indicates that the compound inhibits activation of the receptor by blocking the receptor or preventing the interaction of PGSG-1 with its receptor.

Second messenger signals include but are not limited to, cAMP
guanylate cyclase, ion rh~nn~l S or phosphoinositide hydrolysis.
Specific examples of compounds which inhibit activation of the PGSG-1 receptor include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide, or a closely related protein which binds to the receptor sites, but which are inactive $orms of the polypeptide and thereby block the receptor sites.
Another example is an antisense construct prepared using antisense technology. Antisense technology can be used to ~ontrol gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of $rom about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see hee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 ~1991)), thereby preventing transcription and the production of PGSG-l. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PGSG-1 polypeptide (Antisense - Okano, J.
Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors o$ Gene Expression, CRC Press, Boca Raton, ~L
(1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of PGSG-1.
Further examples also include a small molecule which binds to and occupies the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
These compounds .~y be employed to regulate the secretion of hormones from the pituitary gland which regulate growth and differentiation, for example, L~, FSH and GH.
They may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The polypeptides of the present invention and antagonist and agonist compounds thereof may be employed in combination with a suitable pharmaceutical carrier. Such c~ ~ositions compri~e a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of ~-; ni stration.
The invention also provides a phanmaceutical pack or kit comprising one or more ~ont~in~rs filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such cont~in~r(s) can be a notice in the form prescribed by a governm~nt~l agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects a~lov-al by the agency of manufacture, use or sale for human ~min; stration. In addition, the polypeptides of the present invention or compounds may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be ~m; n; stered in a ~u.~ve~ient m~nn~r, e.g., parenterally. The pharmaceutical compositions are A~m;n;stered in an amount which is effective for treating and/or prophylaxis of the specific indication.
In general, they are ~i n; stered in an amount of at least about 10 ~g/kg body weight and in most cases they will be ~m;nistered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 WO 96/39158 . PCT~US95107067 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of A~m~ n; stration, symptoms, etc.
The PGSG-1 polypeptides and compounds which activate or inhibit its receptor and which are also polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a polynucleotide ~DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells ~hen being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art and are apparent from the t~chings herein. For example, cells may be engineered by the use of a retroviral plasmid vector contA;n;ng RNA
encoding a polypeptide of the present invention.
S~m;lArly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaging cell is transduced with a retroviral plAcm;~ vector contA;n;ng RNA
encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles cont~;n;ng the gene of interest. These producer cells may be A~m;n;~tered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for ~mt n;~tering a polypeptide of the present invention-by such method should be apparent to those skilled in the art from the teachings of the present invention.
Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human ;~llnodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and m~ ry tumor virus.

W O 96/39158 . PCT~US95/07067 In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniaues, Vol. 7, No. 9, 980-990 ~1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters The selection of a suitable promoter will be apparent to those skilled in the art from the teachings cont~ne~ herein.
The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs her~n~hsve described); the ~-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell WO 96/391~8 PCTrUS95/07067 lines as described in Miller, Human Gene Therap~, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then A~m~n;stered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid seguence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence~s) ~nro~ing the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carc;no~- cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronrh~Al epithelial cells.
This invention is also related to the use of the gene gene of the present invention as a diagnostic. Detection of a mutation in a polynucleotide sequence of the present invention allows a diagnosis of a disease or a susceptibility to a disease which results from under-expression of PGSG-1 for example, precocious puberty.
Individuals carrying mutations in the human PGSG-1 gene may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obtA~ne~ from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR
(Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid sequence encoding a polypeptide o~ the prevention can be used to identi~y and analyze mutations. Point mutations can be identi~ied by hybridizing ampli~ied DNA to radio-labeled PGSG-1 RNA or alternatively, radio-labeled PGSG-1 antisense DNA sequences. For example, deletions and insertions can be detected by a change in size of the ampli~ied product in comparison to the normal genotype. Point mutations can be identi~ied by hybridizing ampli~ied DNA to radiolabeled PGSG-1 RNA or alternatively, radiolabeled PGSG-1 antisense DNA
se~l~nre~. Perfectly matched sequences can be distinguished ~rom mismatched duplexes by RNase A digestion or by dif~erences in melting temperatures.
Sequence di~ferences between the re~erence gene and genes having mutations may be revealed by the direct DNA
sequencing method. In addition, cloned DNA segments may be employed as probes to detect speci~ic DNA segments. The sensitivity o~ this method is greatly ~nh~nced when cg~h; n~
with PCR. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modi~ied PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic seguencing procedures with fluorescent-tags.
Genetic testing based on DNA sequence dif~erences may be achieved by detection o~ alteration in electrophoretic mobility of DNA ~ragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA
fragments o~ dif~erent sequences may be distinguished on denaturing ~ormamide gradient gels in which the mobilities o~
di~erent DNA ~ragments are retarded in the gel at di~erent positions according to their speci~ic melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 ~1985)).

CA 022l7229 l997-l0-02 WO 96/391~8 PCTrUS9S/07067 Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA se~ncing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorph;smc (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA se~l~n~tng, mutations can also be detected by in situ analysis.
The present invention also relates to a diagnostic assay for detecting altered levels of a polypeptide of the present invention which is below normal when compared to a normal control tissue sample, which may be employed to detect the presence of a penial tumor. Assays to detect levels of a polypeptide of the present invention in a sample derived protein in a sample derived from a host are well-known to those of skill in the art and include radiotm~nn~Assays, competitive-htn~tng assays, Western Blot analysis and preferably an ELISA assay. An ELISA assay initially comprises preparing an antibody specific to the PGSG-1 antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter An~ihody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid su~olL, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein btn~t ng sites on the dish are then covered by incubating with a non-specific protein such as bo~ine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides of the present invention attAch~ to the W O 96/39158 . PCTAJS9~/07067 polystyrene-proteins attached to the polystyrene dish. All unbound monoclonal antibodv is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to a polypeptide of the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of the polypeptide of the present invention present in a given protein present in a given volume of patient sample when comr~ed against a st~n~d curve.
A competition assay may be employed wherein antibodies specific to PGSG-1 protein are attached to a solid support and labeled PGSG-1 protein and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of PGSG-1 protein in the sample.
The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need ~or identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing P~R primers (preferably 15-25 bp~ from the cDNA.
Computer analysis of the 3~ untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR

WO 96/391S8 PCT~US95/07067 screening of somatic cell hybrids cont~in~ng individual human chromosomes. Only those hybrids cont~;ning the human gene correspon~;ng to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous m~nnPr Other mapping strategies that can s;m;lArly be used to map to its chromosome include iR
situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in si tu hybridization (FISH) of a cDNA
clone to a met~ph~ce chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA having at least 50 or 60 bases. ~or a review of this technique, see Verma et al., Human Chromosomes: a M~n~ of Basic Techniques, Pe ydll-On Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, M~n~l ian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is obser~ed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

CA 022l7229 l997-l0-02 W O 96/391~8 PCTAUS95/07067 With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kh ) -The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an imm-lnogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The ~ esent invention also includes ~him~ic~ single chain, and h-lm~nized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be ob~ine~ by direct injection of the polypeptides into an ~nim-l or by ~h~inistering the polypeptides to an ~nim~l, preferably a nonhllm~n. The antibody so obtained will then bind the polypeptides itself. In this m~nne~, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies h; n~i ng the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Imm-lnology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

WO 96/39158 PCT~US95/07067 Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to ;mmllnogenic polypeptide products o~ this invention. Also, transgenic mice may be used to express hnm~nized antibodies to immllnogenic polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate unders~An~;ng of the following examples certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either l_ Qrcially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially av~;lAhle and their reaction conditions, cofactors and other requir~m~nts were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1 of buffer solution. For the purpose of isolating DNA
fra~m~nts for plasmid construction, typically 5 to 50 ~g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and su~strate amounts for particular restriction enzymes are specified by the W O 96/39158 . PCT~US95/07067 manufacturer. Incubation times o~ about 1 hour at 37 C are ordinarily used, but may ~ary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
I'Oligonucleotides'' refers to either a single stranded polydeoxynucleotide or two compl~m~nt~y polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid rragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 ~g of approximately equimolar amounts of the DNA fra~m~nts to be ligated.
Unless otherwise stated, transfonmation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

ExamDle 1 Bacterial Ex~ression and Purification of a soluble form of PGS&-1 Drotein The DNA sequence encoding PGSG-1, ATCC ~ _, is initially amplified using as a 5' oligonucleotide primer has sequence GCAGATCTGACAA~l~rlA~-l~L~AGTCATC (SEQ ID N0:3) which contains ~ a BglII restriction enzyme site followed by 24 nucleotides of PGSG-1 coding sequence starting from the presumed terminal WO 96/39158 PCTrUS95/07067 amino acid of the processed protein codon and as a 3 sequence GCAAGATCTTAACGCAGGTTGGGCCGGCL-rl-l w CT~ (SEQ ID NO:4) which contains complementary sequences to a BglII restriction enzyme site and is ~ollowed by 28 nucleotides of PGSG-1 coding sequence and ~urther includes a stop codon ending at amino acid 262 of SEQ ID NO:2. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9. pOE-9 encodes antibiotic resistance (Ampr), a bacterial origin o~ replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome h;n~;ng site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamHI. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding ~or the histidine tag and the ribosome h~n~;ng site (RBS). The vector contA;n;ng insert with a ppropriate orientation was confirmed by se~lencing, The ligation mixture was then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sa~ ook, J. et al., Molecular Cloning A Laboratory ~AnnAl, Cold Spring Laboratory Press, (1989). M15/rep4 cont~;n~
multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kanr).
Transformants are identified by their ability to grow on T-R
plates and ampic;llin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and con~irmed by restriction- analysis. Clones contA; ni ng the desired constructs were grown overnight (O/N) in li~uid culture in LB
media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG
(nIsoyro~yl-B-D-thiogalacto pyranosiden) was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leA~ng to increased gene expression. Cells were grown an extra 3 to 4 hours.

-3g-W O 96/391~8 PCTAJS95/07067 Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized PGSG-1 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins contA~n~ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). 90~ pure protein was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After ~ncnhAtion in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.

Example 2 Cloning and exPression of a solu~le form of PGSG-1 usinq the baculovirus expression s~stem The DNA sequence encoding the full length PGSG-1 protein, ATCC # , was amplified using PCR
oligonucleotide primers correspon~ng to the 5' and 3' sequences o~ the gene:
The 5' primer has the sequence 5' GCAGATCTATCATGAAAGGTG
AACTGCTCCT 3~ (SEQ ID NO:4) which ront~ns a BglII
restriction enzyme site (in bold).
The 3' primer has the sequence 5' GCAGA,~,rlAACGCAGGTTGG
CCGG~ GCTT 3' which cont~ ns the cleavage site for the restriction ~n~onllrlease BglII and 24 nucleotides complementary to the 3' sequence of the PGSG-1 gene. The amplified sequences were isolated from a 1% agarose gel using a romm~rcially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the ~n~nl~cleases BglII and purified again on a 1% agarose gel.
This fragment is designated F2.
~ The vector pA2 (modification of pVL941 vector, discussed below) is used ~or the expression of the PGSG-1 protein using W O 96/39158 . PCTrUS95/07067 the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A m~nn~l o~ methods ~or baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. lS55). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction ~n~onllclease BamXI. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of reCOmh;nAnt virus the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by ~iral sequences for the cell-mediated homologous reromh;n~tion of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pA2, such as pRGl, pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzyme BamHI and dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1~ agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA
is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli XL-l Blue cells were then transformed and bacteria i~nt;fied that cont~n~d the plasmid (pBac PGSG-1) with the PGSG-1 gene encoding the soluble form of the protein. Using the XhoII sequence and orientation, the cloned fragment was confirmed by DNA
seq-l~nC; n~, 5 ~g o~ the plasmid pBacPGSG-1 was co-transfected with 1.0 ~g of a commercially av~ hle 1;ne~rized baculovirus (nBaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) W O 96/39158 . PCTnUS95/07067 using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid pBac PGSG-1 were m_ ed in a sterile well of a microtiter plate cont~intng 50 ~l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l Lipofectin plus 90 ~l Grace's medium were added, mixed and incubated for 1~ minutes at room temperature. Then the transfection mixture was added drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate .~as rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27~C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10~ fetal calf serum was added. The plate was put back into an incubator and cultivation cont;nlled at 27~C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue s~;ne~ plaques. (A
detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, pa~e 9-10) .
Four days after the serial dilution, the virus was addedto the cells and blue stained plaques were picked with the tip of an Eppendorf pipette. The agar cont~in;ng the recombinant viruses was then resuspended in an Eppendorf tube cont~;n;ng 200 ~l of Grace's medium. The agar was removed by a brief centrifugation and the supernatant cont~;n;ng the recomh;n~nt baculovirus was used to infect Sf9 cells seeded in 3S mm rl;~2h~c, Four days later the supernatants of these culture dishes were harvested and then stored at 4~C.

CA 022l7229 l997-l0-02 W O96/39158 PCT~US95/07067 S~9 cells were grown in Grace~s medium supplemented with 10~ heat-inactivated FBS. The cells were in~ected with the recombinant baculovirus V-PGSG-1 at a multiplicity o~
infection (MOI) o~ 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added. The cells were ~urther incubated for 16 hours be~ore they were harvested by centri~ugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Exam~le 3 Ex~ression via Gene Therapy Fibroblasts are obt~ne~ ~rom a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small ch~nk-c of the tissue are placed on a wet surface o~ a tissue culture ~lask, a~o~imately ten pieces are placed in each ~lask. The ~lask is turned upside down, closed tiyht and left at room temperature over night. After 24 hours at room temperature, the ~lask is inverted and the chunks o~ tissue remain ~ixed to the bottom o~ the ~lask and ~resh media (e.g., Ham's F12 media, with 10% F8S, penicillin and streptomycin, is added.
This is then incubated at 37~C ~or a~loximately one week.
At this time, ~resh media is added and subsequently changed every several days. A~ter an additional two weeks in culture, a monolayer o~ ~ibroblasts emerge. The monolayer is trypsinized and scaled into larger ~lasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) ~lanked by the long terminal repeat_ of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subse~uently treated with cal~ intestinal phosphatase. The linear vector is ~ractionated on agarose gel and puri~ied, using glass beads.

_ - -W O 96/39158 . PCTAUS95/07067 The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer c~nt~;ning an EcoRI site and the 3' primer further includes a HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear backbone and the ampli~ied EcoRI and HindIII fragment are added together, in the presence _ T4 DNA ligase The resulting mixture is ~intAine~ under conditions appropriate for ligation o~ the two fragments. The ligation mixture is used to trans~orm bacteria B 101, which are then plated onto agar-cont~ining kanamycin for the purpose of confirming that the vector had the gene o~ interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DM~M) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector cont~inina the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles cont~ining the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested ~rom a 10 cm plate of confluent producer cells. The spent media, cont~ining the infectious viral particles, is filtered through a millipore ~ilter to remove detached producer cells and this media is then used to infect ~ibroblast cells. Media is removed from a sub-confluent plate o~ fibroblasts and quickly replaced with the media ~rom the producer cells. This media is removed and replaced with ~resh media. If the titer o~ virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered ~ibroblasts are then injected into the host, either alone or after having been grown to con~luence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scoF- of the appended claims, the invention may be practiced otherwise than as particularly described.

CA 022l7229 l997-l0-02 W O 96/39158 PCTrUS95/07067 SEOUENCE LISTING
(1) GENER~L INFORMATION:
(i) APPLICANT: HE, ET AL.
(ii) TITLE OF INVENTION: Pineal Gland Speci~ic Gene - 1 (iii) NUMBER OF SEQUENCES: 6 (iv) ~O~R-~PONDEN OE ~nn~ss (A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, OE CCHI, STEWART & OLSTEIN
(B) STREET: 6 BEC ~ R FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) ~UNl~Y: USA
(F) ZIP: 07068 (v) COh~ Ul~:K READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DIS ~ TTE
(B) COM~ul~: IBM PS/2 (C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) ~UR~NT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Submitted herewith (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: NONE
(B) FILING DATE: NONE
(viii) Al-LO~N~Y/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134 (C) REFERENCE/DOCKET NUMBER: 325800-(viii) TELECOMMUNICATION lN~O~ ~TION:
(A) TEL~Oh~: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) lN~O~ATION FOR SEQ ID NO:1:
(i) ~U~N~ CHARACTERISTICS
(A) LENGTH: 1198 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA

WO 96/39158 PCT~US95/07067 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TACGAGGTCA GCAAGGACGC CCAAGAAGAC TCAGTCATGA AAGGTGAACT G~L~ 60 TCCAGTGTGA '11~1~1~-1' CCAG~L~1A TGCAGCTGCC CGGACAAGTG TTACTGTCAG 120 TCATCTACAA A1-1-1-1~1-AGA CTGCAGCCAG CAG~-1'~1'~G CCGAAATCCC TTCCCATTTA 180 C~1~1 AGA CTCGAACGCT GCATTTACAA GATAATCAGA TACACCATCT TCCTGCTTTT 240 GCATTTAGGT CAGTGCCATG GCTCATGACC TTAAACTTGT CCAACAATTC CL111'~AAAT 300 CTGGCCCCTG GAG~ A TGGGCTTCAG CA--11GCAGG TTTTAAATCT AACCCAGAAT 360 TCA.1~.-1-.-1 CC~-1~AAAG CAGACTTTTC CA1 l~C~-lCC CTCAGCTGAG GGAGCTTGAT 420 TTGTCATCAA ACAACATAAG CCAC-11~CC ACA1C--1-1~G GAGAGACTTG GC-AGAACCTA 480 ACTATACTTG C'G~-11~AACA AAACCAGCTT CAGCAGCTTG ATCGAGCGCT CCTGGAATCC 540 ATGCCCAGTG TGAGGCTTTT A~-1-1'~-1~AAG GACAACCTCT GGAAATGCAA TTGCCACTTG 600 ~-l-L~lL-l 1A AACTCTGGCT GGAGAAATTT GTCTATAAAG GGGGACTAAC AGACGGCATC 660 A'L~-1~'1~AAT CACCAGACAC CTGGAAGGGA A~GGACCTCC TTAGGATCCC TCATGAGCTG 720 TACCAGCCCT GCC-1-1L~C 1GL-1~L-1~AT CCA~1~L~-L CGCAGGCTCA ~L~GC'CCGGC 780 TCTGCCCACG ~1'~'L~1C~-1 GA~GCCTCCT G~r~rr~r~ ACGC~G&G~A GCGAGAACTC 840 GTCATCATCA CTGGCGTTGT ~1~L~G~ATT ~1'~1~'L~-1~'A TGATGTTGGC AGCTGCCATC 960 AATGATCCTG GGAAGGTGGA AGAAAA~G CGATTTGACA GCTCACCAGC CTGAGAGCTT 1080 '1-1~1-~AAA TAGGATTGGT CATTGCAGGC CAGAAGATAG TGTCTGAGTA GGGCTGATGT 1140 ~'1-1-1-~-L~1-L AGTCTGATTT ~l~-l-l-l-l~C ~AA~rAAA AAAi~AA~ AAAAAAAA 1198 (2) INFORMATION FOR SBQ ID NO:2:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 344 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANv~vN~:SS:
(D) TOPOLOGY: r~TN~
(ii) MOLECULE TYPE: PR~L~IN
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:2:
Met Lys Gly Glu Leu Leu Leu Phe Ser Ser Val Ile Val Leu Leu Gln Val Val Cys Ser Cys Pro Asp Lys Cys Tyr Cys Gln Ser Ser Thr Asn Phe Val Asp Cys Ser Gln Gln Gly Leu Ala Glu Ile Pro Ser His Leu Pro Pro Gln Thr Arg Thr Leu His Leu Gln Asp Asn Gln Ile His His Leu Pro Ala Phe Ala Phe Arg Ser Val Pro Trp Leu Met Thr Leu Asn Leu Ser Asn Asn Ser Leu Ser Asn Leu Ala s5 60 65 Pro Gly Ala Phe His Gly Leu Gln His Leu Gln Val Leu Asn Leu Thr Gln Asn Ser Leu Leu Ser Leu Glu Ser Arg Leu Phe His Ser Leu Pro Gln Leu Arg Glu Leu Asp Leu Ser Ser Asn Asn Ile Ser His Leu Pro Thr Ser Leu Gly Glu Thr Trp Glu As~rLeu Thr Ile Leu Ala Val Gln Gln Asn Gln Leu Gln Gln Leu Asp Arg Ala Leu W O 96/39158 PCT~US9S/07067 Leu Glu Ser Met Pro Ser Val Arg heu Leu Leu Leu Lys Asp Asn Leu Trp Lys Cys Asn Cys His Leu Leu Gly Leu Lys Leu Trp Leu Glu Lys Phe Val Tyr Lys Gly Gly Leu Thr Asp Gly Ile Ile Cys Glu Ser Pro Asp Thr Trp Lys Gly Ley Asp Leu Leu Arg Ile Pro His Glu Leu Tyr Gln Pro Cys Pro Leu Pro Ala Pro Asp Pro Val Ser Ser Gln Ala Gln Trp Pro Gly Ser Ala His Gly Val Val Leu Arg Pro Pro Glu Asn His Asn Ala Gly Glu Arg Glu Leu Leu Glu Cys Glu Leu Lys Pro Lys Pro Arg Pro Ala Asn Leu Arg His Ala 2~0 255 260 Ile Ala Thr Val Ile Ile Thr Gly Val Val Cys Gly Ile Val Cys Leu Met Met Leu Ala Ala Ala Ile Tyr Gly Cys Thr Tyr Ala Ala Ile Thr Ala Gln Tyr His Gly Gly Pro Leu Ala Gln Thr Asp Pro Gly Lys Val Glu Glu Lys Glu Arg Phe Asp Ser Ser Pro Ala (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQuKN-~ CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~.~SS: SINGLE
(D) TOPOLOGY: LIN~R
(ii) MOLECULE TYPE: Oligonucleotide (xi) S~yuKNCE DESCRIPTION: SEQ ID NO:3:
GCAGATCTGA CAA~L~l-lAC TGTCAGTCAT C 31 (2) INFORMATION FOR SEQ ID NO:4:
(i) ~QU~N~ CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~SS: SINGLE
(D) TOPOLOGY: T.TNR~
- (ii) MOLECULE TYPE: Oligonucleotide (xi) S~Qu~N-CE DESCRIPTION: SEQ ID NO:4:

WO 96/39158 .PCTrUS95/07067 GCAAGATCTT AACGCAGGTT GGCCG&CCTT GGCTT 35 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 34 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAhl)KI ~ K-~S: SINGLE
(D) TOPOLOGY: T.T ~ AT~
(ii) MOLECULE TYPE: Oligonucleotide (Xi) S~YUKN~_ DESCRIPTION: SEQ ID NO:6:

W O 96/39158 PCTrUS95/07067 ¦ Applicant's or agent's file ¦ Lllellla-iullal a~plica~iùn No Us95/07067 reference number 32 9~C~66 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A The; ~ made below relate to the r~ uol~ referred to in the de~ Liu on pages 6 32,33,(44), and 45 lines 31,17.49,(44 and 49),32,l~t,~ 1y.
B IDENTIFICATIONOF DEPOSIT Furtber dcposlU ~re iden~filed on n~ddilio~l ~heet O
Name of dep~J~;tUly; -~
American Type Culture Cr~ cti-~n Address of d~,~Ju~;Lal~ B~ postal codc and country) 12301 Parklawn Drive Rockville Maryland 20852 U S A

Dste of de~sit May 24,199S ~ocuionN~xr 97162 C. ADDITIONAL INDICATIONS (kav~ bfanl~ if not appffc~bk) Thu i~fon~ u co~ined on n ~ ~hee~ O

D DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE hrthc f~i~s ar~ no farafl ~si~nat~l S~w s) E. SEPARATE FURN--~-~ C OF IMDICATIONS (k~u~ blonlr frnot applialbl~) l'he " lis~ed below will be submitted to the I Bureau later (spcafy ~hc gcncral narurc of thc indications ' 8~cccssion Numbcr of Dcposir~) Fo~ ~eceiving Office u e onb P~ I sure u u~c o lb ~1 Ibi- ~ w~ received wilh tbe it~er~nor~ pplic tion ~ThL~ ~et ~ leceived hy tb~ I sure u on 7 ~ NnvF~
~d7~doffl~ ~jzodofffcer ~ I

Claims (20)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:2;
(b) a polynucleotide encoding the polypeptide comprising amino acid 1 to amino acid 262 as set forth in SEQ ID NO:2 (c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 which encodes the polypeptide as set forth in SEQ ID NO:2.

6. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide which encodes a mature polypeptide encoded by the DNA contained in ATCC Deposit No. _______;
(b) a polynucleotide which encodes a polypeptide expressed by the DNA contained in ATCC Deposit No. ______;

(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (c) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

7. A vector containing the DNA of Claim 2.

8. A host cell genetically engineered with the vector of Claim 7.

9. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 8 the polypeptide encoded by said DNA.

10. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of Claim 7.

11. A polypeptide selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID NO: 2 and fragments, analogs and derivatives thereof; (ii) a polypeptide comprising amino acid 1 to amino acid 262 of SEQ ID NO: 2; and (iii) a polypeptide encoded by the cDNA of ATCC Deposit No. ____ and fragments, analogs and derivatives of said polypeptide.

12. A compound effective as an agonist for the polypeptide of claim 11.

13. A compound effective as an antagonist against the polypeptide of claim 11.

14. A method for the treatment of a patient having need of PGSG-1 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 11.

15. The method of Claim 14 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

16. A method for the treatment of a patient having need of PGSG-1 comprising: administering to the patient a therapeutically effective amount of the compound of claim 12.

17. A method for the treatment of a patient having need to inhibit PGSG-1 comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 13.

18. A process for diagnosing a disease or a susceptibility to a disease related to expression of the polypeptide of claim 11 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.

19. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 11 in a sample derived from a host.

20. A method for identifying compounds which bind to and activate or inhibit a receptor for the polypeptide of claim 11 comprising:
contacting a cell expressing on the surface thereof a receptor for the polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to and activates or inhibits the receptor by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor.