CA2167056A1 - Nucleotide sequences and process for amplifying and detection of hepatitis b virus - Google Patents

Abstract

Short nucleotide sequences of hepatitis B virus useful for the determination of the presence and type of hepatitis B virus present in a test sample. The sequences provided can be amplified by various DNA hybridization techniques including a modified polymerase chain reaction or ligase chain reaction. The sequences provided also can be hybridized by standard dot- or replica-blot procedures. Methods and kits also are provided for the detection of hepatitis B virus in the test sample and the determination of the type of hepatitis B virus present in the test sample.

Description

Wo 95/02690 1 PCT/US94/07684 ~' l (Q~ 5~

NUCLEOTIDE SEQUENCES AND PROCESS FOR AMPLIFYING
AND DETECTION OF HEPATITIS B VIRAL DNA

TECHNICAL FIELD
s This invention relates gençr~lly to hepatiti~ B virus and a method and test kit for the detection of h~p~titic B virus. More particularly, the invention relates to nucleotide sequen~es comple,~ ~ y to segm~nt~ of the hepatitis B virus genome which can be ~mrlifi~cl and/or used to determine the presence of h~.p~titi~ B virus DNA in a test sample.

BACKGROUND OF THE INVENTION
The detection of viral multiplication in hepatitis B virus (hereinafter "HB~') has been found to be a useful marker of virus replication and of a patient's infectivity. HBV is the prototype agent for a new virus family called s Hepadnaviridae. These viruses have small circular DNA molecules that arepartly single stranded and an endogenous DNA polymerase that repairs the DNA
to make it fully double stranded. A strong tropism for hepatocytes and the development of persistent infection further characterizes the group.
The complete virion of hepatitis B consi~t~ of a complex double-layered ~lU~;I.ul`t; with an overall di~m~ter of 42 nm. An electron dense core of 27 nm contains a circular double-stranded DNA with a molecul~r weight of 1.6 x 106.
A 7-nm thick outer envelope surrounding the core compri~es a biochemic~lly heterogeneous complex designated HBsAg. HBsAg is produced in excess by infected hepatocytes and is released into the blood as spherical particles with a 2s size range of 17 to 25 nm and as tubular fil~ment~ with similar diallle~ but various lengths. Antibodies to the core and surface antigen are lesign~teA antl-HBc and anti-HBs, respectively. A third antigen-antibody system has also been observed in hep~titi~ B infection and is ~lesign~ted HBeAg/anti-HBe. Current data suggest HBeAg is an integral part of the capsid of the hepatitis B virion.
Because of its close relationship with the nucleocapsid of HBV, it is a reliablemarker of virion concentration and thus for infectivity of the serum.
The goal for all current therapies for chronic type B hepatitis is the sll~t~in~-A inhibition of viral replication. Thus, direct reliable measure of viral DNA is very helpful for early dir~le,l~iation between those patients who do and do not respond to therapy. Serum HBV-DNA and HBeAg are considered reliable 1ll~l j for Illol,iloling HBV replication.

.

WO 95/02690 ~ ~5C~ PCT/US94/07684 There are four principal ~ntigçnic cl~ tf ., . .;-.~ntc or subtypes of HBsAg, termed adw adr, ayw, and ayr. The adw and ayr subtypes predominate in most parts of the world except in Southeast Asia and the Far East, where adr is also co-----lo-~ The ayr subtype is rarely observe~ The group-reactive df l~ IllinAI~I a s is cross-reactive among all four types, and antibody to this cle~ nt protects against re-infection by a second subtype.
Several tests have been employed to detect HBV in serum and other body fluids. Irnmunological tests depend on antibodies produced in humans or animals to detect the specific viral proteins described above. However, 10 immnnQlogical tests are indirect and may result in false positive det~ " .i.~tions due to nonspecific antigen-antibody reactions. Furthermore, under certain ci-~u~n~ nces the antigen-antibody tests are negative in donor serum, but the recipient of the tr~ncfilce~l blood develops HBV infection.
Hybridization techniques such as the Southern blot or Dot Blot S procedures have also been used. Generally, such techniques involve extracting DNA from cell scrapes or biopsy m~tqri~lc and immobilizing it on a solid phase either directly as total DNA or as restriction fr~.~m~ntc after resolution by gel clc~l,up}loresis. The immobili7~ DNA is detectecl most coll~,lonly by a nucleic acid probe calTying a radioactive label. However, the sensitivity of standard 20 hybri-li7~tion meth~s is not sufficient to recognize a minim~l virus replis~ti~ n and can therefore not distinguish infectious from non-infectious patients. To O~'~,lCCl~lC this problem of sensitivity, viral DNA sequences can be ~mplifie~l by using, for example, the polymerase chain reaction (PCR). The products thus obtained can be identified by using conventional hybrirli7~tiQn techniques for 25 identifir~tion of virus types, such as Southern blotting. See C. Oste, BioTechniques 6:163 (1988) and K. B. Mullis, U. S. Patent No. 4,683,202.
PCR is described in U.S. Patent Numbers 4,683,195 and 4,683,202 and has been utilized to improve the sensitivity of standard hybridization methods. U. S.
Patent Number 4,562,159 discloses a method and kit which use PCR to 30 specifically detect HBV DNA in a test sample. In practice, the level of sensitivity is about 50 to 100 copies per sample.
Despite these above-narned screening methods, a signifi~nt percentage of post-transfusion hepatitis cases are still caused by transfusion of blood that is co~ t~d with HBV which eluded detection. Therefore, a need exists for an W O 95/02690 PCTrUS94/07684 ~0;5(~7 ~ltt~rn~tive method to identify HBV in clinical specim~n~ which is more accuIate, reliable and capable of semi-a~ iQn.
An ~lt~m~te meclla,fism for target ~mplifi~tion is known as ligase chain reaction (LCRIM) as described in EP-A-320 308 or in EP-A-439 182 LCRTM
5 can be used to detect single or double stranded DNA targets. In this procedure, two probes (for example, A and B) complem~-nt~ry to a(1j~rent regions of a target nucleic acid se~quence are hybridi_ed and ligated by DNA ligase. This ligated probe then is denatured away from the target, after which it is hybri-li7P,A with two additional probes (A' and B') of sense opposite to the initial probes A and o B. The secondary probes are themselves then ligated. Subsequent cycles of denaturationthybri~li7~tion/ligation create the form~tion of double-length probes of bo~h sense (+) and ~nticçnse (-). By repeated cycles of hybri-ii7~tion and ligation, amplification of the target nucleic acid sequence is achieved.
Up to now, LCR has not been used in the ~letection and/or ql-~ntit~tion of 5 HBV. It th~ ,rc,re would be advantageous to provide oligonucleotide strands ofDNA which could be ~mplified and used to detect the presence, if any, of BV
in a test sample by using LCR. The combined use of oligonucleotide strands would be advantageous for allowing for the specific and sensitive in vitro diagnosis of the presence and specific type of HBV present in test sarnples. It also would be advantageous to provide a method which provides a degree of 4~ ;on of HBV in a test sample to monitor the success of drug therapy of patients with chronic active hepatitic.

2s SUMMARY OF THE INVENTION
Oligonucleotide probes of from about 10 to about 60 nucleotides having a nucleotide sequence hyhrirli7~hle under hybridizing conditions to a target nucleic acid sequence of hepatitis B virus are provided. The target HBV sequences (SEQ ID Nos.
21, 22, 23, 24 and 25) and the oligonucleotide probes may be selected from at least one of the following:

WO 95/02690 PCTrUs94/07684 ~705~ 4 SEQ
ID No 21 Target Sequence at Position 184-226 5'-pGACCCCTGCTCGTGTTACAGGCGGG~lll~lCTTGTTGACAA-3 5 3'- cTGGGGAcGAGcAcAATGTccGcccrAAAAAr~AAcAArTGTTp-5 55'- GACCCCTGCTCGTGTTACAGG
7pGGG~lllll~ll~llGACAA-3 63'- CTGGGGACGAGCACAATGTC
83~-GcccrAAAAAr~AArAArTGTT-5 22Target Sequence at Po~ition 231-251 5'-CCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCT-3' 3l-TTAGGAGTGTTATGGc~l~rcAGATcTGAGcAccAccTr~AAr~ArArTTAAAAGp-5 95'-CCTCACAATACCGCAGAGTCTAGA
15 11pGTGGTGGACTTCTCTCAATTTTCT-3' 32x_TCGTGGTGGACTTCTCTCAATTTTCT-3' 103'-TTAGGAGTGTTATGGCGTCTCAGAp' 313'-TTAGGAGTGTTATGGCGTCTCAGATC_x;
12GAGcAccAccTGAAr~Ar~AGTTAAAAG-5 20 33GAGcAccAccTr~AA~A~A-GTTAA-A-A-5 23Target Sequence at Position 403- 450 5~-pTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTG-3' 3' -AAGGAGAAGTAGGACGACGATACGGAGTAGAAGAATAACCAAGAAGAC-5 25 15'- TTCCTCTTCATCCTGCTGCTATG
3pCTCAl~llCll~llG~ll~ll~lG-3' 28x_CTCAl~,l~llGTTGGTTCTTCTG-3' 23~- AAGGAGAAGTAr~GAr~AcGATAp 273'- AAGGAGAAGTAGGAcrAcr.ATAAx 30 4GGAGTAr~AAr~AAcAAccAAr~AAr~Ac-5 24Target Sequence at Po~ition 664-711 5'- pCTCTTGGCTCAGTTTACTAGTGCCAlll~llCAGTGGTTCGTAGGG-3' 3~- AAr~A~AAccGAGTcAAATGATcAcGGTAAA-rAA~TrAc~AAGcATcp- 5' 35 175~- CTCTTGGCTCAGTTTACTAGTG
19~'lll~llCAGTGGTTCGTAGGG-3' 36x~CAlll~llCAGTGGTTCGTAG -3' 183l- AAr~Ar~AArcGAGTcAAATGATp 353'- GAGAACCGAGTCAAATGATCAC~x 40 20GGTAAArAAGTcAcrAAr~rATc- 5' 37GTAAArAAGTcAccAAGcATc- 5' 25Target Sequence at Position 1875-1894 5'-pCAAGCl~lGCCTTGGGTGGCTTTGGGGCATGGACATTGACCCTTATAAAG-3' 453'- GTTCGACACGGAACCCACCGAAACCCCGTACCTGTAACTGGGAATATTTC-5' 135'- CAAGCTGTGCCTTGGGTGGCTTT
,15pGCATGGACATTGACCCTTATAAAG-3' 143l- GTTCGACACGGAACCCACCGp 16CCCCGTACCTGTAACTGGGAATATTTC-5' x is hydroxyl unless otherwise specified.
Underlined bases are deliberate mi~m~ches, as clescribed herein.

~0 9!;/02690 PCT/US94/07684 Single oligonucleotide probes are selected from the following group:
SEQ ID No. 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 or their complements.
Also provided is a composition for tletP,cting hepatitis B virus DNA
present in a test sample containing non-target DNA in which the com~)osilion s co."1" ;~es a first u~ Galll oligonucleotide probe and a first downstream oligomucleotide probe, each probe cornrri~ing from about 10 to about 60 nu~le~tif1Ps hybri~li7~hlp under hybridi7ing conditions to the same strand of a target nucleic acid sequence of hep~titi~ B virus, the 3' end of the U~
probe being hybridized proximate to the 5' end of the downstream probe, and 0 wherein the target nucleic acid sequence is at least one sequence sçlP~ctP~l from the group con~i~ting of SEQ Id Nos. 21, 22, 23, 24, and 25 as described above or their complemPnt~ The composition is further described as having the 3' end of the u~ G~ll probe and the 5' end of the downstream probe ligation incompetent absent corrections of the ends.
In one elnbo(~ nt, the ligation incompetent end is corrected by eYtPn~ion of the 3' end of the U~ ,alll probe with nucleotides comple - -P .n . y to the intervening unhy~idi7~d portion of the target nucleic acid sequence so that the ends are ligation competent. Such compositions may be selected from the following pair sets or their complements:
Pair Set SEO ID No Target HBV Up~llGalll Down~LIc~
Sequence Probe Probe In another embodiment of the present invention, the ligation-incc ~ etGIll ends are c~llc-;lGd by removal of a non-phosphorylated or mi~m~t~hed base from the tenminus of the 5' end of the downstream probe by a target-dependent exonucleolytic agent, followed by extension of the coll~ onding u~sll~a m probe with nucleotides complc.,le,lt~y to the intervening unhybri-li7P~ portion of 25 the tar~et nucleic acid sequence so that the ends are ligation colllpelGIl~. Such compositions may be selected from the following pair sets or their complements:

.

Wo 95/02690 PCT/US94/07684 05~

Pair Set SEO ID No Target Upstream Downstream HBVProbe Probe Sequence LTI a third embodiment of the invention, the downstream probe forms a 5' overhang when hybr~ 7~A to its target, and the correction comprises removal of the overhang such that the 5' end of the corrected downstream probes abuts the s 3' end of the u~ alll, so that the ends of the probes are ligation competent.
Further provided is a composition for detecting the DNA of hepatitis B
virus present in a test sample, said composition comprising a first and second oligonucleotide probe of from about 10 to about 60 nucleotides capable of hybridizing to a target nucleic acid sequence of hep~titis B virus, ~he~ the o target nucleic acid sequence is selected from at least one sequen~e selecte~l from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 as described above or their complements, and wherein the probes are hybridi_able to opposite strands at o~l~o~i~ ends of the same target nucleic acid sequence of hepatitis Bvirus DNA. The pairs may be selected from the following pair sets or their 5 complem~nt~:

Pair Set SEO ID No TargetFirst Second HBV U~ lU~ lea Sequence Probe Probe Also provided is a composition for detecting the DNA of hep~titi~ B
virus present in a test sample, the composition defined as:
(a) a first set of oligonucleotides comprising a first u~ lea~l~ probe and a 20 first downstream probe, each probe comprising from about 10 to about 60 nucleotides hybridizable under hybridizing conditions to the same strand of a target nucleic acid sequence of hepatitis B virus, the 3' end of the first upstrearn probe being hybridized proximate to the 5' end of the first downstream probe;

216~

and wherein the target nucleic acid sequence is at least one sequence select~
from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 as described above or their complem~nt~; and (b) a second set of oligonucleotides compri~in~ a second upstream probe and a second downstream probe; both probes hybn(li7~ble to the first set of oligonucleotides of step (a), the 5' end of the second Up~7LlGa,lll probe being hybridi7~1 plo~ te to the 3' end of the second downstream probe.
The cc,~ osilion has ligation hlcol~ ,lent ends which are corrected by exten~innof the 3' end of the first UIJ 7LI~alll probe with nucleotides compk;llle,lL~y to the o intervening unhybridized portion of the target nucleic acid sequence so that the ends are ligation colllpelellt.
In one embodiment, the four oligonucleotide probes are selected from the group consisting of:
(a) Set 403G, wherein SEQ Id Nos. 1 and 3 are the first upstream and lS first downstream probes, respectively and SEQ Id Nos 2 and 4 are the second downstream and second u~ probes, respectively;
(b) Set 1 84G, wherein SEQ Id Nos. 5 and 7 are the first upstream and first downstream probes, respectively and SEQ Id Nos 6 and 8 are the second downstrearn and second U~Sllcdlll probes, respectively;
(c) Set 231G, wherein SEQ Id Nos. 9 and 11 are the first upstream and first downstream probes, respectively and SEQ Id Nos 10 and 12 are the second downstream and second upstream probes, respectively;
(d) Set 1875G, wherein SEQ Id Nos. 13 and 15 are the first u~usll~a and first downstream probes, l~ e~;Lively and SEQ Id Nos 14 and 16 are the 2s second downstream and second upstream probes, respectively; and (e) Set 664G, wherein SEQ Id Nos. 17 and 19 are the first upstream and first downstream probes, respectively and SEQ Id Nos 18 and 20 are the second downstream and second upstream probes, respectively.
These sets are exemplified as:

Wo 95/02690 PCT/US94/07684 5~

SEO ID No.
LCR S . TargetHBV FirstUpstream, SecondDuw,-al-~u,,, et- Sequence Duwllall~ll Upstrealn Prûbes Probes 403G 23 1,3 2,4 184G 21 5,7 6,8 231G 22 9,11 10,12 1875G 25 13,15 14,16 664G 24 17,19 18,20 In another embo liment, the composition has ligation-inco. . .l etr.-l ends which are c-,llecLed by removal of a non-phosphorylated or mi~m~t~hç~l base from the terminus of the 5' end of the first downstream probe by a target-s dependent exonucleolytic agent, followed by extension of the u~leam probe with nucleotides compl~ r to the intervening unhyhri-li7e~1 portion of the target nucleic acid sequence so that the ends are ligation co. . .~ t The composition has four oligonucleotide probes are selecte~ from the group consisting of:
o (a) Set 403E, wherein SEQ Id Nos. 1 and 28 are the first U~all~ll and first downstream probes, l~,ue~ ely and SEQ Id Nos 27 and 4 are the second downstream and second u~slle~ll probes, respectively;
(b) Set 231E (SEQ Id Nos. 9, 31, 32, and 33; wherein SEQ Id Nos. 9 and 32 are the first U~ lG~ll and first downstream probes, respectively and SEQ
Id Nos 31 and 33 are the second downstream and second ulJsll-,dm, respectively;
and (c) Set 664E wherein SEQ Id Nos. 17 and 36 are the first u~ and first downstream probes, respectively and SEQ Id Nos 35 and 37 are the second U~JS~ ll and second downstream probes, respectively.
20 These sets are exemp~ as follows:
SEO ID No.
LCR S TargetHBV FirstUpstream, SecondDow~
e~- Sequence Dow.lsll~....... Upstrearn Probes Probes 403E 23 1,28 27,4 231E 22 9,32 31,33 664E 24 17,36 35,37 In another embo liment, the composition comprises a downstream probe having a 5' overhang when hybridized to its target, and the correction colll~lises removal of the overhang such that the 5' end of the corrected downstream probes ~1~7~

abuts the 3' end of the ull~k~,am, so that the ends of the probes are ligation c~....~ e~
Further provided is a method for detP.nnining the presence of hPp~titi~ B
virus DNA in a test sample wherein the target sequence is selected from at leasts one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their complemPntc, comprising hyhri-li7in~ the DNA in the test sample with at least one oligonncleotide probe of the present invention wh~
the hybridized probe is capable of dirrt;.t;.,liation from the unhybridized probe, and detecting the pl~;,ence of the hyhr~rli7P~l probe.
o In another embodiment, ligatable pair sets are utilized in a method fordt;~ ing the presence of hep~titi~ B virus DNA in a test sample whe~ the target sequence is selPcted from at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their complements, comrri~ing (a) hybridizing the DNA in the test sample with at least one an U~ ,alll oligonucleotide probe and at least one downstrearn oligonucleotide probe according to the present invention, to the same strand of a target nucleicacid sequence of he~ B virus, said hybri-li7~tion resulting in ligation-incompetent ends, absent correction; (b) correcting the 3' end of the u~sll~am probe in a target dependent manner to render the probes ligatable; (c) ligating the 3' end of the hybridized UlJSll~idlll probe to the 5' end of the hybrltli7P~A
downstream oligonucleotide probe, wherein the hybridized probe is capable of dirrt;~ tio~ from the unhyhri~1i7P~l probe; and (d) clet~Pcting the presence of the hybridized probe.
A still further embodiment is a method for t~ f ~ illg the pçesel-ce of hep~titi~ B virus DNA in a test sample by PCR wh~leil- the target sequence is selected from at least one sequence se1ecte~ from the group consisting of SEQ IdNos. 21, 22, 23, 24, and 25 and their complements, comprising: (a) hybridizing the first oligonucleotide probe and the second oligonucleotide probeto opposite strands at opposite ends of the same target nucleic acid sequence ofhepatitis B virus DNA; (b) extending the hybridized first and second oligonucleotide probes to be contiguously complementary to the target sequence, wherein the hybridized probes are capable of differentiation from the unhybridized probes; and (c) detecting the presence of the hybridized probes.

WO 9~/02690 PCT/US94/07684 LCR pairs are also used in a method of detecting the presence, ~hsenr~e.
or quantity of hepatiti~ B ViIUS DNA in a test sample wherein the target sequence is selectec~ from at least one sequence selected from the group consisting of SEQ
Id Nos. 21, 22, 23, 24, and 25 and their complements comprising the steps of:
s (a) exposing a sample suspected of co,.li.;.. i,-g the single stranded target nucleic acid sequence to a first set of oligonucleotides co~ ising a first u~ a,ll probe and a first dow-~LItalll probe; each probe hybri-li7~ble under said hybridizing con~litic-n~ to the same strand of said target nucleic acid sequence of hepatitis B virus, wherein the 5' end of the down~ a~- probe and/or the 3' end of the probe is ligation inco",~GIe,lt absent correction to perrnit hybridization of said probes to target;
(b) correcting the 3' end of the first upstream probe and the 5' end of the first downstrearn probe only when said probes are hybridized to the target sequence, whereby the correction renders the ends ligation competent;
s (c) ligating the first two probes to form a first ligated product and sepdldlillg said fIrst ligated product from the target;
(d) exposing the mixture under hybridizing conditions to a second set of oligonucleotides comprising a second upstream probe and a second downstrearn probe, and ligating the second two second probes to form a second ligated product, separating the second ligated product from the first ligated product, and wherein the ligated probes are capable of differenti~tion from the unligated probes; and repeating steps (a) through (c) at least once; and (e) detennining the presence of the ligated oligonucleotide probes, said presence being related to the presence, absence or quantity of the target DNA.
A kit for detecting h~p~titi~ B virus comprising at least one oligonucleotide according to the present invention targeted to at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their c-)mplement~, said oligonucleotide being labeled so as to be capable of detection; and means for ~lete~ting said oligonucleotide and further co~ isesreagents for amplifying sample hepatitis B virus DNA.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a graphic representation of the process of ligase chain reaction as it is known in the prior art.

wo g~/02690 PCT/US94/07684 ~7~

FIG. 2 is a standard curve relating the number of HBV DNA target molecules to the IMx(~ rate (counts/sec/sec) with probe set 403G (SEQ ID Nos.
1, 2, 3, and 4) 103 HBV genome copies/mL of patient's serum. HBV DNA
positive samples were diluted in human serum negative for HBV markers. The serurn diluent also served as the negative control. The dilution of the positivecontrols inrli~ate~l in the graphs as molecules of HBV DNA per mL serum, were tested in duplicates and the mean values are shown as IMxtg rates. A det~ction limit of 5-10 fg HBV-DNA/mL sample, equivalent to about 2000-3000 genome copies/mL or 10-15 copies per assay, respectively was obtained. LCR results 0 were obtained from FY~mple 1, below.
FMS. 3a-3c are graphs of results obtained from three patients (designated A, B, C) with HBV infection. The data (Example 7) obtained with LCR clearly paralleled the alanine aminotransferase ("ALr') levels semi-qll~ntit~tively (FIG.3a). HBV-DNA levels could also be det~rminçd in s~mples of serial bleeds of patients receiving i~ltelrc;luil tre~tn~nt (3b-3c). In thesepatients' sera, HBV-DNA was clearly d~tect~kle by conventional dot blot hybridization test before starting interferon tre~tm~qnt but became negative after therapy. In the LCR detection system, serum HBV-DNA could be detected even after succeccful tre~tm~nt for several weeks longer than with the conventional hybridization assay.

DETAILED DESCRIPTION OF THE INVENTION
Definitions For the purposes of the present invention, the following terrns are 2s clefinefl "Assay Conditions" refers to the conditions of LCR with regard to temperature, ionic strength, probe concentration and the like. These are generally known in the art. LCR involves essenti~lly two states or conditions:
~nne~ling or hybridization conditions, and de,-aluldlion conditions.
"Hybridization conditions" is defined generally as conditions which promote ~nnealing and hybri~li7~tion. It is well known in the art, however, thatsuch ~nne~ling and hybridization is dependent in a rather predictable manner on several parameters, including temperature, ionic strength, probe length and G:C
content of the probes. For example, lowering the t~mpeldture of the reaction W O 95/02690 PCTrUS94/07684 ~,3 6~ ~S~ 12 pl~ loles ~nne~ling For any given set of probes, melt t~lll~ldture, or Tm, can be ç~ t~A by any of several known methods. Typically assay conditions include It;lll~l~Lul~is which are slightly below the melt ~ ~ldlU~;. Ionic strength or "salt" concentr~tion also impacts the melt L~mpcl~tlllG, since smallcations tend to stabilize the formation of duplexes by n-og~ting the negative charge on the phospho-1iest~r backbone. Typical salt concentrations depend on the nature and valency of the cation but are readily understood by those skilled in the art. Similarly, high G:C content and increased probe length are also known to stabilize duplex formation because G:C pairings involve 3 hydrogen bonds 10 where A:T pairs have just two, and because longer probes have more hydrogen bonds holding the bases together. Thus a high G:C content and longer probe lengths impact the "assay con~litions" by lowering the melt ~C;~ ,ld~UIt;. Once probes are selecteA, the G:C content and length will be known and can be accounted for in detellllil~ing precisely what "assay conditions" will ,.,colll~)ass.
Since ionic strength is ~pically Opl;-O;~k,~ for enzymatic activity, the only ~,.. te left to vary is the l~.,.p.~ .,.I.. e and obtaining suitable "assay conditions" for a particular probe set and system is well within ordinary skill."Dena~ Lion conditions" is defined generally as con-lition~ which promote dissociation of double stranded oligonucleotides to the single stranded 20 form. These conditions include high temperature and/or low ionic strength;
essenti~lly the opposite of the l~ldlllC;Iel:i described above as is well l-n-lerstood in the art.
"Comple,ll~ uy" with respect to bases refers to the following base pairs in the case of DNA: A and T; C and G; in the case of RNA: A and U and C and G. Thus, G is complçm~nt~ry to C and vice versa. Complementary bases are "...~li.hi-~g'~, non-complementary bases are "mi~m~tched". With respect to nucleic acid sequences, a nucleic acid sequence or probe that is "complç~ . Iklll~l y"
to a probe or target means the sequence can hybridize to the complelllelllaly probe or target under assay conditions. Thus, they include sequences that may 30 have mi~m~te~ed base pairs in the hybridizable region, provided the sequencescan be made to hybridize under assay conditions. As defined below, probe A is complenlent~ry to probe A' and probe B is complement~ry to probe B'.
"Correction" refers to the process of rendering, in a target dependent manner, the upstream probes ligatable to their downstream partners. Thus, only 12I~705~

those probes hyhn~li7~d to target, target complement or polynucleotide sequences generated thel~;L~ are "collccLed." Preferably, the hybridized probes are enzym~t~ ly corrected in a manner which is dependent upon the sc.lu~nce infoll-.aLion contained within the target to render them ligatable to each s other. The preferred enzyme is a DNA polymerase exhihiting 5' to 3' target ~lepçn~lent exonucle~e activity. A 5' to 3' target dependent exnn~lclease activity can also be used in cornhin~tion with a reagent with 5' to 3' target dependent polymerase activity. "Correction" can be accomplished by several procedures, depending on the type of mo~lifie l end used. For example, some of the probes 0 of the present invention, were designed to be "corrected" by gap filling as desclibed in U.S. Serial No.07/769,743 filed October 1, 1991 or by exonuclease cleavage as described in U.S. Serial No. 07/925,402 filed August 3, 1992, both of which are herein incorporated bt reference.
"Exo format" refers to correction of ligatable-incompetent ends by s removal of a non-phosphorylated or mi ~l . .AI( hell base from the 5 ' end of a dow-l..L.. a... oligonucleotide probe by a target-dependent exonucleolytic agent, followed by ç~t~n~ion of the 3' end of a proximate u~L e~-l probe with nucleotides compl~ment~ry to the intervening unhyhrirli7ed portion of the targetnucleic acid sequence so that the ends are ligation cc)lll~lent.
"Exonucleolytic" refers to the excising activity, preferably of an enzyme, from the 5'-end of a DNA or RNA sllhstr~tç Exonucleolytic activity may be associated with an e~conllcl~e or the 5'-3' exonuclç~e activity traditionally associated with some DNA polymerases. Generally, exonucleolytic activity is template-dependent, as is liscll~se l in more detail below.
"Gap format" refers to a method for coll~Ling ligation inco.ll~eLt;nL ends by exten-ling the 3' end of an upstream oligonucleotide probe hybridized to target with nucleotides complement~ry to the intervening unhybridized portion ofthe target nucleic acid sequence so that the ends are capable of ligation.
"Ligation" is a general term and refers to any method of covalently ~tt~ching two probes. Enzyrnatic and photo-ligation are two com--lol-ly used methods of ligation. The conditions and reagents which make possible the p~f~ cd enzymatic ligation step are generally known to those of ordinary skill in the art and are disclosed in the references mentioned in background. Ligatingreagents useful in the present invention include T4 ligase, and prokaryotic --Wo 95/02690 PCT/US94/07684 -ligases such as E. coli ligase, and Thermus thermophilus ligase (e.g., ATCC
27634) as taught in EP-320 308. This latter ligase is ~Icse~lly plcr~lcd for itsability to 111~ ;11 activity during the thermal cycling of LCRTM. Absent a th~rm~lly stable ligase, the ligase must be added again each time the cycle is s repe~t~l Also useful are eukaryotic ligases, including DNA ligase of Drosophila, reported by Rabin, et al., J. Biol. Chem. 261:10637-10647 (1986).
One ~lt~rn~tive to enzymatic ligation is photo-ligation as ~ltos~ribed in EP-A-324 616.
"T .ig~tion inco-~pc~ t absent correction" describes the 3' end of an 0 U~ lcdlll probe or the 5' end of a d~wllsllG~ll probe which is incapable of being ligated to another probe, absent correction in a target dependent manner. The correction can be the removal, replacement, or further mo~lification of this end to render it ligatable. An example of a ligation incompetent end is a non-phosphorylated 5' terminus of a downstream probe, which cannot be ligated to lS the 3' end of the llp~llc~ll probe but which can be corrected in a target dependent manner to render it ligatable. Another example is terminal or internal ~ ch~s of the probe with respect to the t.orminllc of the target. Once the probes hybridize to their respective target, these micm~t~h-o.s are corrected in a target dependent manner to allow ligation of the probes. Other examples are give in US Serial No. 07/925, 402, supra.
"Proximate" is refers to the positioning of the u~ cal~l and downstream probes, as defined below, which are hybridized proximately to the same target strand so that their 3' and 5' ends are within about 1-20 nucleotides, more preferably about 1-10 nucleotides apart. Proximate may include gaps and 2s overhanging extensions. In contrast, "slrlj~cent" probes by definition are hybritli7P,~l ~lo~cilllatcly so their respective 3' and 5' ends are 0 nucleotides apar~
P`l.,~inlaLc probes become ~cljacer)t upon correction.
"Upstream" and "downstream" probes refer to two different non-overlapping oligonucleotides hybridized to different regions of the same target nucleic acid strand, the 3' end of one oligonucleotide pointing to the 5' end ofthe other. The former is termed the "upstream" probe and the latter the "downstream" probe.

Wo 95/02690 YCT~594/07684 - a~

The "prime" (') ~lecign~tion is used to intlic~te a complementary base or sequence. Thus, probe A can be comp]em~ntary, as defined above, to A' even though it may have ends not co-terminal with A'. The same is true of B and B'.
"Suitable and/or a~,~,rù~lia~ deoxynucleotide triphosphates" ("dNTP's") s refer to nucleotides needed to fill gaps in ~u~ aLe probes. The type and quantity of nucleotide required are dependent on the target DNA. Further rliccllc~ion of gap filling is found below. Typical nucleotides involve ~l~nin.o(G), cytosine (C), adenine (A) and thymine ( I) when the context is that of DNA;in the case of RNA, the base uracil (U) replaces thymine. The term also in~lllrl~s o analogs and derivatives of the bases named above such as described in 37 CFR
1.82~(p)(1). Although the degenerate base inosine (I) may be employed with this invention, it is not ~lef~l-c;d to use I within modified portions of the probes according to the invention.

5 Tar~et Nucleic Acid Sequences The oligonucleotide sequences of the present invention identify specific positions on the gene coding for the hepatitis B virus antigen. Different HBV
strains having known genomic sequences were co.l~ d to the wild type HBV
strain (strain adw ) to find conserved regions and the conserved regions tested as 20 consensus sequences. Oligonucleotide probes covering homologous regions are of the HBV genome are first tested which can then be amrllifiefl in a target flepenclent manner. In a ~l~;rwlGd emboflim~nt the oligonucleotide sequences identify specific loci on the gene coding for the surface antigen ("S") of HBV.
By way of illustration and not limit~tion, some exemplary nucleotide sequences 25 and their cull~onding positions on the gene coding for the surface antigen ("S") of HBV are set forth below:
It is a routine matter to synthesize the desired probes using conventional nucleotide phosphoramidite chemistry and the instruments available from Applied Biosystems, Inc, (Foster City, CA); DuPont, (Wilmington, DE); or 30 Milligen, (Bedford, MA). Phosphorylation of the 5' ends of the a~lupliate probes is necessary for ligation by ligase and may be accomplished by a kinase or by colllm~l-;ial synthesis reagents, as is known in the art or as added as a correction mechanism as discussed herein.

_ .

In general, the m~thoA~ of the invention comprise repeated steps of (a) hyhri-li7ing the selected primary probes to the target HBV DNA (and, if double stranded so that target complement is present, to the target complement); (b) co~ g the selected probes in a target dependent manner to render the primary s probes lig~t~hle (c) ligating the cc,llc~;led probe to its partner to form a fused or ligated product; and (d) tlissoci~ting the fused product from the target and repe~ting the hybri~li7~tion, correction and ligation steps to amplify the desired target sequence.

o Hybridization of Probes General Hybri-1i7~tion of probes to target (and optionally to target complement) is adequately e~pl~ined in the prior art; e.g. EP-320 308, US 5185243, and US
4883750. Probe length, probe concentration and stringency of conditions all 5 affect the degree and rate at which hybrirli7~tion will occur. Preferably, theprobes are sufficiently long to provide the desired specificity; i.e., to avoid being hybri-li7~hle to nontarget sequences in the sample. Typically, probes on the order of 15 to 100 bases serve this purpose. P~senLly preferred are probes having a length of from about 15 to about 40 bases.
20 Sin~le Probes and Ligatable Pair Sets The hybrilli7~tic n of single probes and pair sets, as defined herein, is effected at a ~ p~ WG selecte~ to give effective hybri~i7~ion selectivity, preferably m~illlulll hybrkli7~tion selectivity for the specific length of the linked probe. Advantageously, moderate tt;lll~ldtUl~S are normally employed for 25 probes and probe pairs of the present invention. Temperatures will generally range from about 20 C to 90 C, more usually from about 30 C to 70-C, preferably 37 C to 60 C.
Modified PCR
Hybridization for a modified form of PCR, herein called "short PCR" or 30 "sPCR" primers will be as is generally known in the art. Typical conditions are given in example 11 and 12, below. Hybridizing conditions should enable the binding of probes to the single nucleic acid target strand. As is known in the art, the probes are selected so that their relative positions along a duplex sequence are such that an extension product synthesi7ed from one probe, when the extension wo 95/026.0 PCT/US94/07684 95~

product is separated from its template (Gomrlem~nt) serves as a temrl~t~ for theeYt~on~iQn of the other probe to yield a replicate chain of defined length.
Ligase Chain Reaction The hybrirli7~tion of LCRIM probe sets to their targets and optionally to s the target GonlplemPnt~ is adequately exr!~ined in the prior art; e.g., EP 320,308 and EP-439,182. The probes are added in a~pluAilllalely equimolar co~ . aLion since they are tA~e~,Led to react stoichiometric~lly. Each probe is present in a collcelllld~ion ranging from about 5 nanomolar (nM) to about 90 nM;preferably from about 10 nM to about 35 nM. For a standard reaction volume of o 50 ~lL, this is equivalent to adding from about 3 x 101 1 to about 1 x 1012 molecules of each probe; and around S x 101 1 molecules per 50 IlL has been a good starting point. The o~ ulll quantity of probe used for each reaction also varies depending on the number of cycles which must be performed and, of course, the reaction volume. Probe conce,llldlions can readily be determined by one of ordinary skill in this art to provide optimum signal for a given number of cycles.
The stringency of conditions is generally knûwn to those in the art to be dependent on ~ lalllr~, solvent and other ~ l,e~l~. Perhaps the most easily controlled of these p~dlllelel~ is ~ eldlulc and thus it is generally thestringency p~udmelel varied in the performance of LCR. Since the stringency conditions required for practicing this invention are not unlike those of ordinary LCR~ further detail is deemed unnecessary, the routine practitioner being guidedby the ex~mples which follow.
Typically, reactions were ~elr~ ed in LCR Buffer (50 mM EPPS pH
2s 7.8, 20 mM KCl, 30 mM MgC12, 10 mM NH4Cl and optionally 0.5 mM
NAD+) and optionally supplem~nt~-l with acetylated BSA. Tem~ d~LIre cycling was achieved with a e.g. thermal cycler from Coy Laboratory Products (Ann Arbor, MI) or the Progldlll"lable Cycler ReactorlM (available from Ericomp, San Diego, CA).
Correction of prûbes Oligonucleotide probes of the present invention may be corrected by a "gap-fill" format or "exo" format. Both types of correction are described below.

Wo 95/02690 PCT/US94/07684 Correction by Gap-Fill Format Probes which are corrected by a gap-fill method have molifi~cl ends which are created by elimin~ting from one or more of the probes a short sequence of bases, thereby leaving a recess or gap between the 5' end of one s probe and the 3' end of the other probe when they are both hybridized to the target (or target complement, or polynucleotide generated the.Grluln). In order for LCR to amplify the target, the gaps between the probes must be filled in (i.e., the modification must be "corrected"). In the gap format, this can be done using a polymerase or a reverse transcriptase and an excess of o deoxyribonucleûtide triphosphates which are complGIlænL~y to the target strand o~l,osile the gap.
In this embo liment, the invention involves repeated steps of (a) hybri(li7ing thé probes to the target HBV (and, if double stranded so that target complem~nt is present, to the target compl~m~nt); (b) extending at least one probe to fill in at least one gap; (c) ligating the extended probe to the ~ ~entprobe to form a fused or ligated product; and (d) dissociating the fused productfrom the target and l~peaLing the hybri~i7~tion, extension and ligation steps toamplify the desired target sequence.
In this version, which includes both single gap ("SG") and double gap 20 ("DG") configurations, the "gaps" which impart the "morlifie~ ends" are "corrected" by exten~ling one or both of the modified probes using a polymerase or a reverse L ~ls.,lil,L~se. Generally, extension of a probe hybridized to a HBV
DNA target is accomplished by a DNA polymerase or a Klenow fragment as is known in the art. In the case of an RNA target, extension is accomplished by a 25 reverse transcriptase. Exemplary reverse trans~ ses include those from avian myeloblastosis virus (AMV) and Moloney murine le~lk~mi~ virus (M-MuLV) generally available to those skilled in the art. Certain DNA polymerases will also recognize RNA as template under certain conditions. It is, of course, preferableto utili_e extension reagents which are thçrrn~lly stable and can withct~n~l the30 cycling of high temperatures required for LCR. If the extension reagent is not thermally stable, it typically must be re-added at each cycle of LCR. Such thermostable pûlymerases presently include AmpliTaqTM, (available from Cetus-Perkin Elmer), Thennus polymerase (available from Molecular Biology Resources, Inc. Milwaukee, WI, "MBR") and recombinant or purified native WO 9~/02690 PCT/US94/07684 2~7~x~

polymerases from Thermus aquaticus, Thermus thermophilus or other species known to be thc- . . .o~' lhle Correction by extension in this manner l~ui,es the presence in the reacdon mixnlre of deoxyribonucleotide triphosphates (dNTP's) comple~ .n~;1.y s to the bases of the target in the gap region(s). More specifically, with reference to Figure 1, for a gap having the sequence Xn, the dNTP's that must be supplied are designated dX'TP wllelcill ~ stands for the comrlemPnt~ of each base in the gap Xn. The dNTP's are co.n,~ ;ially available from a number of sources, including Pharmacia (Piscataway, NJ) and Bethesda Research Laboratories 10 (Gaithclsl,u,g, MD).
Extension must be termin~te~ precisely at the point of ligation so that the extended probe abuts the adjacent probe and can be ligated to it. "Stopbases" are employed for this purpose. A "stopbase", design~ted Q', (see Figure 1) is defined in terms of its complement, Q and is accomplished by omitting from the lS reaction mixture, dNTP's that are comple-~,enla,y to Q; i.e. by omitting dQ'TP
from the reaction 113ib~Ul`t;. Thus it is seen how the bases for the gap sequence(s) must be select~1 from a set, N, consisting of only three of the four bases, so that the complG- IG-~ y three of the four dNTP's are added to the reaction ~ ule.When the fourth dNlP, dQ'TP, is absent from the reaction mixture exten~inn 20 will tt~min~te at the desired point of ligation. It follows that Q' is the first base in the downstream probe, and the base on the target which codes for the stopbase is the first base adjacent the gap.
Extension by polymerase or transcriptase proceeds in a 5' to 3' direction.
Conse~uently, the 3' ends of both u~sLr~am probe (Figure 1, probes A and B') 25 will be extenrlible by polymerase in the absence of anything to prevent extension Extension is termin~t~A when the next base called for by the templ~t~
is absent from the reaction mixture. Thus, probe A is extended through gap Xn until stopbase complement (Q) is encounle,~;d along the target strand. Similarly, probe B' is extended through gap Ym until stopbase complement (Q) is 30 encoullLe,~d (either on the target complement or on the A half of reo,g~lizedA:B). Neither probe A' nor B will serve as a template for extension of A or B', so probes A and B' are extended only if hybridized to the target (or to reorganized polynucleotide products from previous cycles).

W0~5n2690 PCT/U594/1)7684 --5~

As alluded to above, it is i~ o~ to terminate the extension of A and B' at the end of the ,G~e.;Li~e gaps (i.e., at the point of ligation) so that the extended probe can be ligated to the 5' end of the downstream probes, B and A'.
Therefore, the reaction mixture omits the deoxyribonucleotide triphosphate s complement~ry to the base (Q) immeAi~tt-ly ~rljacent the 5' end of gaps Xn andYm. Of course, it will be understood that it is not required that the same base stop eYt~-n~ion in both directions. A different base can be used provided it is not needed to fill either of the gaps. It should now be al)palG"L that the actual points of ligation in this embodiment are always at the 5' ends of the downstream o probes (A' and B). It is not by mere coincidence that these are also the locations of the stopbases Q'.
Accordingly, the gaps Xn and Ym can be any number of bases long, i.e., n can be any integer greater than or equal to 1, and m is any integer greater than 0. It is to realized, however, that the choice of which gap is Xn and whichs is Ym is arbitrary in the first place; but n and m cannot both be zero. The gaps need not be the same length, i.e., m need not equal n. When, m equals zero, the double gap variation degenerates into the Speci~li7f~d case of the single gap, which is not used in the embodiment being cl~im~A herein. The only restriction on the bases X is that they be selected from a set N which consists of from 1 to20 any 3 of the four bases. Similarly, the bases Y are drawn from set M. Since at least one stopbase Q' must be m:~int~ine(l, the combined sets N and M which lGsenl the possible bases for X and Y, respectively, must include no more than three of the four bases. Accordingly, Y can be from zero to any three of the four bases provided that at least one base remains in the set "not N and not M".25 If set N con~titutes less than three of the four bases, then Y can be a base that is not within N so long as there is at least one base 1~ i";..g, the complem~nt of which can serve as the stopbase Q' for termin~tiQn of probe extension. A single stopbase can serve to terminate extension in both the Xn and Ym gaps.
A second limit~tion on sequence Ym occurs if m equals n. If the gaps 30 are the same length, the sequence Ym should not be complementary to the sequence Xn or the 3' ends of probes A and B' would constitute "sticky ends".
"Sticky ends" would permit a target independent double stranded complex to form wherein probe A hybridizes to probe B' such that ligations and amplification would proceed. Rather, when m equals n it is preferred that Ym ~7~

not be comple~ nlal~ to Xn. In other words, the ends of probes A and B' should at least be "slippery ends" which may be the same length, but are not comr~. . .f..- 1~ 1 ,y.
In a l~lc;r~ d aspect of the invention, the fourth probe B' includes a 3' s terminal seque-nce of Xn, identi~al in length to the Xn sequence gap in the target.
This ~n~ngement is not es~enti~l to the invention, however, as the gap need onlybe formed between the probes. Thus, the 3' termin--c of the fourth probe B' may stop short of the 3' end of sequence Xn, provided there is no 3' recessed end with respect to the second probe B. Since extension occurs in a 5' to 3' 10 direction and dX'TPs must be present anyway (to extend through Xn), probe B' would be extended through the gap, (both Ym and any rem~in~lçr of Xn ) just as the first probe A is extended through the Xn gap.
Correction by the "Exo Fonnat"
In this embotlimPnt, a ligation incompetent end may be a non-5 phosphorylated 5' terminll~ of a downstream probe, which cannot be ligated tothe 3' end of the U~SL~ probe but which can be coTrected in a target dependent mamler to render it ligatable. Another example of a ligation incol,.pct~nl end may be terrninal or internal ...i~ hes of the probe with respect to the ~ .. l.-;....
of the target. Once these types of probes hybridize to their lG*,e.;li~e target,20 these . . .;~ es are cc,ll~ td in a target dP-pen~lent manner by modification of the 5' end of one or more of the probes by elimin~ting a short sequence of bases, thereby leaving a recess or gap between the 5' end of one probe and the 3' end of the other probe when they are both hybridized to the target (or target compl~-m~nt, or polynucleotide generated therefrom). This modification is 25 cull~;led by an exonucleolytic activity, preferably the 5' to 3' exonuclease activity assoçiated with a DNA polymerase (Gelfand, D., Taq DNA Polymerase in PCR Technology: Principles and Appliçations for DNA Amplification. Erlich, H. A., Ed., Stockton Press, N.Y. (1989)). In the presence of the apl)lol)~iate deoxynucleotides, these DNA polyrnerases will initiate synthesis from the 3' 30 hydroxyl end of a probe hybridized to a target DNA, proceed along the DNA
targe~ template, hydrolyzing hybrirli7e(1 DNA sequences and replacing them in the p~ocess. The exonucleolytic degradation of the DNA sequences results in the release of mono, di, and larger nucleotide fragments. Typically this e~tonucle~eactivity is synthesis dependent. It therefore follows that the termination of Wo 95/02690 PCT/US94/07684 ~y"Ll.esis should result in the termination of 5' to 3' exonuclease activity. One way to termin~te synthesis in a controlled manner is to limit the dNTP pool by leaving out one or several of the four dNTPs required for DNA synthesis.
Sy~lhesis by DNA polymerase will continue until a templ~te base ("stop base") s on the target is encou"~,cd which is complern--nt~ry to a deoxyribonucleoside 5'-triphosphate omitted from the dNTP pool. The degradation and synthesis would then termin~t~. at this point.
In LCR, a downstream probe cont~ining a 5' end which is ligation inco",~e~t;n~ absent correction is used. The modification prevents the target o in~epen(lent ligation of the probes. Additionally, in the presence of a targetnucleic acid sequence, adjacent LCR probes would hybridize but would not be ligatable. Sequence information contained within the target DNA is used as a template for correction of the ligation inco"-l~e~ t end. A DNA polymerase with synthesis dependent, strand replacement 5' to 3' exonuclease activity is used to5 extend the upstream probe and hydrolyze the downstream probe using the target nucleic acid as a template. By using a subset of four dNTPs required for DNA
synthesis, the extension of the upstream probe and thereby the hydrolysis of thedow"~L,ca,ll probe could be controlled such that when a template base in the target is encountered to which no comple,--ellt~, y dNTP is present, synthesis and 20 hydrolysis would stop. The resultant downstream probe would terminate with a 5' phosphate which would be a~ cent to the 3' hydroxyl end of the extended U~ alll probe. Adjacent DNA sequences in this orientation represent a suitable substrate for ligation by DNA ligase.
The resulting gap between the probes must be filled in (i.e., the 2s morlification must be "corrected"). This correction proceeds as described above for the gap-filling format.

Ligation Following correction, the next step in the general method comprises the 30 ligation of one probe to its adjacent partner. Thus, each corrected first upstream (or primary) probe is ligated to its associated first downstream probe and each corrected second downstream (or secondary) probe is ligated to its acsori~t~l secondary upstream probe. An "adjacent" probe is either one of two probes hybridizable with the target in a contiguous orientation, one of which lies with its J~O 95/02690 PCTtUS94tO7684 21~ 7~ ~

phosphorylated 5' end in abuLIllenl with the 3' hydroxyl end of the partner probe. "A~ ent" probes are created upon correction of the modified end(s) in a target dependent manner, as described above. Enzymatic ligation is the ~l~rc.l~,d method of covalently attaching two adjacent probes; however, "ligation" is a s general term and is to be understood to include any method of covalently hing two probes.
The con~liti()n~ and reagents which make possible the pl~r~ d enzymatic ligation step are generally known to those of ordinary skill in the art and are disclosed in the references mentioned in background. Ligating reagents o useful in the present invention include T4 ligase, and prokaryotic ligases such as E coli ligase, and Thermus thermophilus ligase (e.g., ATCC 27634) as taught in EP-320 308. This latter ligase is presently preferred for its ability to ~ int .il~
activity during the thermal cycling of LCR. Absent a thenn~lly stable ligase, the ligase must be added again each time the cycle is repeated. Also useful are 15 eukalyotic ligases, including DNA ligase of Drosophila, reported by Rabin, et al., J. Biol. Chem. 261: 10637- 10647 (1986).
Once ligated, the fused, l~,olgani~ed probe is dissociated (e.g. melted) from the target and, as with conventional LCR, the process is repeated for several cycles. The number of repeat cycles may vary from 1 to about 100, 20 although from about 15 to about 70 are pl~r~l-ed presently.
It is desirable to design probes so that when hybridized to their complement~ry (secondary) probes, the ends away from the point of intended ligation are not able themselves to participate in other unwanted ligation reactions. Thus, ligatable sticky or blunt ends should be avoided. If such ends 25 must be used, then 5' terminal phosphates should be avoided, t~limin~te~l or blocked. This can be accompli~h.o,cl either through synth~i7ing oligonucleotide probes (which normally carry no S' terminal phosphate groups), or through the use of phosphatase enzymes to remove terminal phosphates (e.g. from oligonucleotides generated through restriction digests of DNA). Alternatively, 30 ligation of the "wrong" outside ends of the probes can be prevented by blocking the end of at least one of the probes with a "hook" or marker moiety as will be described in detail below. In the absence of one of the above techniques, the outside ends of the probes can be staggered so that if they are joined, they will not serve as templ~te for exponential ~mplifiç~tion.

WO 9~/02690 PCT/US94107684 In a particularly ~lerell~d config1lration, haptens, or "hooks", are ~tt~herl at the available outside ends of at least two probes (opposite ends of fused product), and preferably to the outside ends of all four probes. A "hook"
is any moiety having a specific ligand-l~c~plui affinity. It may be for example a s hapten or a segrnent of a polynucleotide. A hood may be attached to one probe and a label may be att~rh~l to the other probe of the same sense. T ig~tion joins the label to the affinity moiety and st;~ i label can be measured on a solid phase following separation.

l0 Detection The presence of amplified target can be detected by any number of methods. One method is to differentiate reaction products of a specific size by means of molecular weight. Methods for molecular weight differentiation include affinity labeling, composition, gel filtration, se(liment:ltion velocity, osmotic pressure, or gel electrophoresis. A particularly ~llt;fell~d method is gel electrophoresis which is particularly useful when the nucleotides used are labeled with a radiolabel, such as 32p. Typically, detection is pelrolll,ed after separation, by ~iel~ ...i..;.-g the amount of label in the st;~dled fraction. Ofcourse, label in the se~ i fraction can also be dct~ ed subtractively by 20 knowing the total amount of label added to the system and m~cnring the amount present in the unseparated fraction. Separation may be accomplished by electrophoresis, by ch,u-llatography or by the ~l~r~ d method described below. Typically, detection is ~Glrcnllled after separation, by dct~ g the amount of label in the separated fraction. Of course, label in the separated 25 fraction can also be ~:lr~ i--ecl subtractively by knowing the total amount of label added to the system and ll,ea~uling the amount present in the unseparated fraction. Where used, separation may be accomplished by electrophoresis, by cl,lùnlalùgraphy or by the preferred method described below.
Other methûds include the use of labeling the nucleotides with a physical 30 label which is capable of generating a detectable signal. The various "signalgenerating compounds"(labels) contemplated include chromogens, catalysts such as enzymes, Illminescen~ coll1~ou,lds such as fluoroscein and rhotl~mine, chemilnminescent compounds, radioactive elements, and direct visual labels.
Fy~mples of enzymes include alkaline phosphatase, horseradish peroxidase, ~ 0 95/02690 PCT~US94/07684 216~o~

beta~ cto~ e and the like. The selection of a particular label is not critical, but it will be capable of producing a signal either by itself or in conjunction with one or more additional substances.
Many dirr.,~ haptens are known, and virtually any hapten can be used s with the present invention. The invention l'~UilGS only that a specific binding partner is known or can be prepared (a defil~iLio~lal ~lVp~l Ly of "hapten") and that the hapten can be coupled to the probe such that it does not interfere with hybridization. Many methods of adding haptens to probes are known in the literature. Enzo Biochemic~l (New York) and Clontech (Palo Alto) both have ~esrlibe(l and commercialized probe labeling techniques. For ~x~mrle, a primary amine can be attached to a 3' oligo end using 3'-amine-ON CPGTM
(Clontech, Palo Alto, CA). Similarly, a primary amine can be ~tt~ched to a 5' oligo end using Aminomodifier II(~ (Clontech). The amines can be reacted to various haptens using conventional activation and linking chemictries.
In addition, copending applications U.S. Serial Nos. 625,566, filed December 11, 1990 and 630,908, filed December 20, 1990 teach methods for l~beling probes at their 5' and 3' ends respectively. Both the aforementioned c~endillg appliration.~ are incol~ldted by reference. Some illustrative haptens include many drugs (e.g. digoxin, theophylline, phencyclidine (PCP), salicylate,etc.), T3, biotin, fluorescein (FITC), dansyl, 2,4-dinitrophenol (DNP); and modifie~l nucleotides such as bromouracil and bases modified by incorporation of a N-acetyl-7-iodo-2-fluorenylamino (AIF~) group; as well as many others.
Certain haptens described herein are disclosed in co-pending, co-owned patent applications U.S. 07/808,508 (~ m~nt~ne~cetic acid), U.S. Serial Nos.
2s 808,839 (carbazole and dibenzorul~n), both filed December 17, 1991, U.S.07/858,929, and U.S. 07/858,820, both filed March 27, 1992 (collectively referred to herein as the "hapten applications"). The entire disclosure of each of the above hapten applications is incorporated herein by reference.
Protocols for the detection of more than one target, for example HBV
and HCV, may include two labels, a common label and a unique label as more fully described in U.S. Serial No. 860,702 filed March 31, 1992. Either may serve as the detection label. For simplicity, the embodiments are described using haptens as both the common and unique labels. It is, of course, understood that .

Wo 95/02690 PCT/US94/07684 ~,~6~ 26 another label is easily sllbstitl-tP~ for at least one of the h~pten~, especially the co~ lon hapten.
According to a preferred standard LCR protocol, a first hapten is used to capture and s~ ~ Ir. the l~o~ nized molecules. A second hapten is used to s couple the ~wl~ ed complex with the ~ign~ling entity. This procedure is ~escrihed more comrl~Ptely in EP-A ~L39 182. For ex~mrle a fluc ~sceill moiety is ~tt~hed to the 5' end of the first primary probe and to the 3' end of the first secondary probe. In addition, a different hapten, say biotin, is attached to the 3' end of the second plilll~Uy probe and to the 5' end of the second secondary o probe. Thus, when the reorganized molecules are duplexed, two biotins are found at one end of the duplex and two fluoresceins are found at the other end.
A solid phase having a coating of anti-fluorescein is used to separate lwlgani~ed molecules from llnlig~tPd probes having biotins. (Unligated probes having fluor~sceins are also captured.) The separatwd complexes are detected by using 5 avidin or anti-biotin labeled with a ~letect~hle signaling entity such as an enzyme.
The test sample can be any biological m~t~ri~l suspected of co..~ i.-g HBV. Thus, the test sarnple can be human body tissue, or a test sample which contains cells suspected of co.~ i.-i--g HBV. The term can refers to virtually any liquid sample. The test sample can be derived from any desired source, 20 such as a physiological fluid, for example, blood, saliva, ocular lens fluid,cerebral spinal fluid, sweat, urine, milk, ascites fluid, mucous, synovial fluid, .e.iloneal fluid, amniotic fluid or the like. The liquid test sample can be ,LIr~aLed prior to use, such as pr~a~ing plasma from blood, diluting viscous liquids, etc. Methods of ~lr~Ll~An~ t can also involve separation, filtration, 2s ~ till~tion~ concentration, inactivation of inlel~ling components, and the ~lition of re~gentc Besides physiological fluids, other liquid samples such as water, food products and the like can be used. In addition, a solid test sample can be used once it is modified to form a liquid meclillm 30 Kits Reagents employed in methods of the invention can be packaged into diagnostic kits. Diagnostic kits may include the labeled oligonucleotides; if the oligonucleotide is unlabeled, the specific l~beling reagents may also be included in the kit. the kit may further contain suitably packaged combination nucleoside ~ro gs/02690 PCT/US94/07684 ~ ~7~

triphosphates, e.g., dATP, dGTP, dCTP, or dTTP or combinations of up to three of the dNr[Ps, depending on the particular probe design and the gap full or sexo fill needs. The kit can further include a polynucleotide polymerase and also means for covalently attaching Up~ alll and downstream sequences, such as a s ligase. These reagents will typically be in s~i~ale containers in the kit but can be p~clr~g~ in one cont~iner where reactivity and shelf life permit. The relative ou.,l~ of vaTious agents in the kits can vary widely to provide for concentrations of reagents which optimize the reactions needed to occur during the instant invention and to optimize the sensitivity of the assay. The kits mayo further include a denaturation agent for denaturing the analyte, hybrirli7~tion buffers, wash solutions, enzyme substrates, negative and positive controls and written instructions for carrying out the assay.

The invention will now be illustrated by examples. The examples are not int~ndecl to limit the scope of the present invention. In conjunction with the general and detailed invention above, the PY~mples provide further understanding of the present invention and outlines some aspects of the ~I~;rel-~,d embodiment of the invention.

Wo 95/02690 PCT/US94/07684 ~&~

EXAMPLES
Materials and Methods The following terms used in the examples are trademarks, tr~lf-n~mf s or c hf mir~l abbreviations as specififA
s BSA: bovine serum ~lhnmin EDTA: a metal chelator, ethylf nfAi~minf tetr~retir acid EPPS: chemir~l abbreviation for [N-(2-h~/dr~ yt;lllyl)~ ine-N-(3-propanesulfonic acid)] acid, used as a buffer.
FITC: chemir~l abbreviation for fluorescein isothiocyanate, a o fluorescent hapten derivative.
HPLC high performance liquid chl~,lllatography MES: chemic~l abbreviation for [2-(N-morpholino)eth~nes-llfonic acid], a buffer.
IMx(~: tr~ om~rk of Abbott Laboratories for an auLolllaled instrument for pclrolllfillg microparticle enzyme immunoassay (MELA).
Tris a buffer compri~ing Iris(hydroxymethyl)~llino,.lf ~ nf, The following is a table of probes andJor primers used in the examples 20 below. Each sequence is refered to by its "SEQ ID No." in the specific ex~mplf TABLE A
1 5'-pllC~l~llCATC~lG~lGC~ATG
2 3'- AAGGAGAAGTAGGACGACGATAp 3 pCTCAl~ll~lr~ G~,ll~l~ClG-3' 2s 4 GGAGTAr~AAr7AArAArrAAr7AAr7Acp-5 5'-pGACCCCTGCTCGTGTTACAGG

6 3'- CTGGGGACGAGCACAATGTC

7 pGGG~,LllllCll~llGACAA-3' 8 3'-GCCCrAAAAArAArAACTGTTp-5' 9 5~-ccTrArAATAccGcAGAGTcTAGA

10 3'-TTAGGAGTGTTATGGCGTCTCAGAp' 11 pGTGGTGGA~ll~l~lCAATTTTCT-3' 12 GAGcAccAccTrAbr~Ar~A-r7TTAAAAGp-5 13 5'-pCAAGCTGTGCCTTGGGTGGCTTT

14 3'- GTTCr.ArACGGAACCCACCGp 15 pGCATGGACATTGACCCTTATAAAG-3' 16 CCCCGTACCTGTAACTGGGAATATTTCp-5' 17 5'- pCTCTTGGCTCAGTTTACTAGTG

18 3~- AAr7Ar7AAccGAGTcAAATGATp 19 p~ ,llCAGTGGTTCGTAGGG-3' 20 GGTAAArAAGTcAccAAGcATcp- 5' 27 3'- AAGGAGAAGTAGGACGACGATAAx 28 xACTCAlCllC~ GGTTCTTCTG-3' 31 3'-TTAGGAGTGTTATGGCGTCTCAGATCAx;
32 xATCGTGGTGGACTTCTCTCAATTTTCT-3' 33 GAGcAccAccT~AAçAGAGTTAAAAp-5~
35 3'- GAGAACCGAGTCAAATGATCACTx 36 xACAlll~ll'CAGTGGTTCGTAG -3' 37 GTAAArAAGTCACCAAGCATCp- 5' wo 95/02690 PCT/US94/07684 ~ ~7~s~

As a sample any kind of cells, swabs, smears, blood or tissue may be prepared by centrifugation of the respective cellular suspension in phosphate-buffered saline (PBS). Generally, the pellets are lG~,u~nded in 100 ~11 of 10 mM NaOH and heated for S to 10 millul~s at 100 C. After boiling, the samples s are re-centrifuged and the cellular debris removed. An aliquot of the ~ nt~t is added to a reaction mix co~ g 50 mM EPPS pH 7.8, 30 mM MgC12, 20 mM KCl, 1 ,~LM deoxynucleotide triphosphate, and S x l01 1 molecules of oligonucleotide probe of the present invention. The capture ligand oligonucleotide A and A' may be derivatized with carbazole and/or FITC. Probe o B and B' may be derivatized with arl~m~nt~ne or biotin as signal moieties.
Polynucleotide kinase is used for phosphorylation of the selected probes' at their 5' ends. The tube tubes cont~ining the sample and reaction mix are overlaid with mineral oil and boiled for about 3 minutes. Ar~ ls the tubes are held for 1 minute at 85C and 50C for another 1 minute. Therrnus thelmophilus s ligase (Abbott) and Therm~s DNA polymerase (Molecular Biology Resources) are added to the reaction mixture. The tubes are then alternated between 85C
and 50C either in a thermal cycler or between two water baths. Normally 30 LCR cycles are sufficient to amplify the target HBV DNA for assay. For detecting the reaction prr)duct, the mix is separated from mineral oil layer and20 diluted with an equal volume of ~listilled water. A portion of the reaction mixture is loaded into a disposable reaction cell of the IMx(~ analyzer. The respective reagent of the test such as sample dilution buffer, methyl umbelliferone phosphate, antibiotin alkaline phosphatase conjugate, anti-fluorescein coated particles, and the like) are also loaded on the IMx~) analyzer. On completion of25 the MEIA within 30 minutes, the rate of alkaline phosphatase bound is derived from the reaction rate in counts/sec/sec.
Quantities of polymerase are expressed in units, defined as follows: 1 unit of enzyme is as defined by the m~nuf~c~lrer (Molecular Biology Resources). Units of ligase enzyme are defined herein as: 1 mg of 95% purified 30 Thermus thermophilus DNA ligase has a specific activity of about 1 x 108 units.
While this is not precisely standardized and may vary by as much as 20%, optimization is within the skill of the routine practitioner.

WO 9~/02690 PCTIUS94/07684 &

LCRTM Conditions All reactions, unless otherwise stated, were p~,lrulllled in LCR Buffer (50 mM EPPS pH 7.8, 20 mM KCl, 30 mM MgC12, 10 mM NH4Cl).
Tempel~thl~; cycling was achieved with a e.g. thermal cycler from Coy Laboratory Products (Ann Arbor, MI) or the Pro~ hle Cycler ReactorTM
(available from F.ri-,omp, San Diego, CA). pC~ction~ were termin~tYl by L~ iquots into stop Buffer (8o% rul l l l~ d~ 2o mM EDTA~ o.os%
(w:v) xylene cyanol and 0.05% bromophenol blue). The ligated and unlig~t~cl products were resolved on a 16 x 20 x 0.04 cm 15% polyacrylamide gel o conti.i.~ g 8.3 M urea in 80 mM Tris, 80 mM boric acid pH 8.0, 1.0 mM
EDTA. The gel was autoradiographed, the autoradiograph used as a templ~t~- to excise the ligated and unlig~t~d probes and the amount of radioactivity in each band was measured by liquid scintill~tion counting. The percentage of r~1io~ctivity in the ligated product was calculated as a function of the total counts in each lane.

Example 1 LCR~ was performed using probe set 403G con~i~ting of SEQ ID Nos.
1, 2, 3, and 4 (See Table A) in a 0.5 mL polypropylene tube cont~ining LCR
Buffer. A test sample co~ i.,i-,g HBV DNA (2.8 x 107 molecules HBV
DNA/ml) was diluted in human serum negative for HBV m~kt;l~. The serum diluent also served as the negative control. Each probe was present at 5 x 101l molecllles/reaction and the final con~ ntration of DNA ligase at 5000 units and DNA polymerase at 1.0 units. The samples were overlaid with mineral oil and the temperature cycle consisted of a 85 C incubation for 30 seconds followed by a 50 C incubation for 20 seconds. The dilution of the positive controls in~lirP~l in the graphs as molecules of HBV DNA per ml serum, were tested in durli~ates and the mean values are shown as IMx(~ rates in Table 1, below. The evaluation of the linear range is demonstrated in Figure 2 as a linear graph. The axis values are obtained by multiplying the number of molecules/reaction (Table 1) times thenumber of rnL in the reaction (x200) ~0 95/02690 PCT/US94/07684 ~7~

OUANTITATION OFHBY DNA ~ SFRUM WIT~ SET 403C;tSFO ID Nos. 1. 2. 3. 4 ) Sample AVERAGEIMx~ C.V. %
(Mol~eact) c/s/sCoeffiriPn~ of Variation Negative Control*4.88 3.9 Positive Con~ol1642.62 0.7%
1000 molec. 774.74 1.5%
500 molec. 407.54 1.5%
250 molec. 249.69 3.2%
100 molec. 124.05 6.5%
50 molec. 98.62 15.7%
10 molec. 15.61 3.1%
S molec. 12.57 33A%
1 molec. 4.70 16.5%

s F.xample 2 LCR was performed using probe set 403G (Seq Id Nos. 1, 2, 3, 4) for HBV DNA, under con-litions described in Example 1, above. The results are illustrated in Table 2 below.
Table 2 0 Specificity and Sensitivity of 403G (Seq Id Nos. 1. 2. 3. 4)for HBV DNA
NC*- 10 MOLEC 100 MOLEC1000 MOLEC REPLICATES
REPLICATESREPLICATES REPLICATES IMx~
NO. IMx~ IMx~ IMx~9 c/s/s c/s/s c/sls c/s/s 6.2 116.9 638.8 1326.4 2 5.9 157.6 533.8 1310.0 3 5.8 179.1 599.1 1300.4 4 5.8 129.2 348.4 1337.1 5.6 102.6 616.8 1370.3 6 5.6 7 4.9 8 5.3 9 5.6 STAT%CV+ = 5.3%CV+ = 21.9%CV+ = 7.6%CV+ = 2.0 *NC= negative control %CV = Co~fficient of Variation Example 3 LCR was performed using probe sets 231E (SEQ ID Nos. 9, 31, 32, and 33) and 23 lG (SEQ ID Nos. 9, 10, 11, and 12) under conditions described in Example 1, above. For probe set 321E, 45 cycles were p~Çull"ed. The results are in Table 3, below. Forprobe set 231G, 40 cycles at lel~el~tulG of 85 and 60 for 30 and 20 seconds, respectively, were y~lrùlllled. Results are shown in Table 4.
o able 3 Specificity And Sensitivity Of Set .-31E fSEO ID Nos. 9. 31. 32. and 33) For HBV DNA Us ng LCR Exo Forrnat NO .Negative con~ol 10 Mol. ~ ~p s 00 Mol.~ epl i~ At~.s 000 Mol. F~ ~P¦ irr~A A
IMx~ (c/s/s)IMx~ (c/s/s) IMx~ (c/s/s) IMx~ (c/s/s) 7.4 348.3 1101.1 1449.3 2 4.9 507.3 1049.3 1385.6 3 5.2 606.7 1086.1 1306.6 4 5.1 5.3 6 5.0 7 5.0 8 4.7 9 5.7 5.7 11 5.1 12 5.0 13 5.2 14 5.5 6.2 STAT%CV = 12A%CV = 26.4 %CV = 2.4 %CV = 5.2 able 4 Specificity And Sensitivitv Of Set 231G (SEO ID Nos. 9. 10. 11. and 12) For HBV DNA Us ny LCR Gap Forrnat NegativeControl* 1000 mol. 1.4 x 105 mol/rxn No. Imx c/s/s Imx c/s/s Imx c/s/s 9.97 623.9 1289.8 2 9.97 297.8 1278.8 3 9.97 604.3 1246.8 4 9.97 449.5 1267.3 %CV=25.1 %CV=30.9 %CV=1.4 * data ~ ~ut~ as mean of 40 samples ~ 0 95/02690 PCT~US94/07684 2~7~6 Example 4 LCR was performed using probe sets 664G (SEQ ID Nos. 17, 18, 19, and 20) and 664E (SEQ ID Nos. 17, 35, 36 and 37) under conditions described s in Exarnple 1, above. The results are illustrated in Table ~ and Table 6 for 664G
and 664E, respectively.
'able S
Specificity And Sensitivity Of 66'G(SEO ~D Nos. 17~ 18, 19~ and 20) For HE V DNA:
N O. N C 1000 molec. 140,000 molec.
IMx clsls IMx rates IMx rates 5.8 6.4 46.2 2 6.0 7.0 40.1 3 6.3 6.3 44.2 4 6.6 6.9 27.8 6.7 6.6 22.6 STAT x=6.28 x=6.65 x=36.34 (+/- 0-37) (+/- 0.30) (+/- 10.51) %CV=5.9 %CV=4.5 %CV=28.9 Tab e 6 Specificity And Sensitivity Of 664E (SEO II) Nos. 17. 35. 36 and 37) For HBV
lS ~
NO. NC 1000 molec. 140,000 molec.
IMx c/sls IMx rates IMx rates 11.4 36.9 345.2 2 13.2 31.2 375.3 3 15.4 28.4 273.2 STAT x=13.37 x=32.19 x=331.24 (+/- 2.01) (+/- 4.29) (+/- 52.45) %CV=15.1 %CV=13.3 %CV=15.8 E~mple 5 LCR was performed using probe set 403G (SEQ ID Nos. 1, 2, 3, and 4) under con~litions described in Example 1, above except that 1350 units of ligasewere used. The specificity of these probes for HBV-DNA was de.llollsL,~Ied s using 31 serum ~mples from healthy, non B ht~p~ti~i~ and auto imm-lne h- p~l;l;c patients (see Table 6, below). Each patient tested negative as intlil~teA by liver function tests in-lir~ting no false positives using the LCR m~tho~l Each test sample had 250 molecules of HBV DNA per serum sample. Healthy patients had no liver disease, non-B hepatitis patients demnn~trated positive signs of liver o disease and ~ o;"""~ e hepatitis patients had hepatitis-like s~ o"~s and clinical ~ ires~l;on of liver problems.

Wo 95/02690 PCT/US94/07684 ~1 ~ 7~

Table 6 Evaluation Of 31 Serum Samples Using HBV Probe Set 403G
SAMPLE ID HBV LCR IMX~ STATISTICS
Healthy Patients mean = 9.01 +/- 5.66 9bCV = 62.8 4.7 2 6.4 3 4.1 4 7.6 19.7 6 6.9 7 13.7 Non B Hepatitis mean = 5.63 +/- 1.52 %CV = 26.94 Patients 8 3.7 9 3.9 6.2 11 5.2 12 5.4 13 6.6 14 4.9 6.1 16 8.7 ~nt,.~ ln.o mean = 7.11 +/- 4.58 %CV = 64A6 Hepatitis Patients 17 6.5 18 6.7 19 5.8 6.1 21 4.6 22 7.8 23 10.2 24 7.8 5.6 26 4.9 27 4.1 28 4.6 29 3.5 22.5 31 5.9 Negarive Control 10.5/19.55 Positive Control 239.1/342.2 %CV=Coefficient of Variation s Example 6 LCR was performed using probe sets 403G (SEQ ID Nos. 1, 2, 3, and 4) and 184G (SEQ ID Nos. 5, 6, 7, and 8) under conditions described in Example 1, above using twenty human serum samples from different groups of o patients with hepatitis B infections (HBsAg+). The results shown in Table 7, below. The samples were tested in two replicates and mean values are shown as ~16~

signal-to-noise (S/N) ratio. The criteria for evaluation of tested sarnples (-, +/-, + or ~) are defined in terms of IMx(~) bac~,ound (bg) rates wherein a 0 - 1.5 x bg rate is defined as negative (-); >1.5 - 3.0 x bg rate as indete~ ate (+/-); 3.0 - 20 x bg rate as weak positive (+); and >20 x bg rate as positive (++).
s In at~ tion to LCR, the samples were evaluated using Abbott HBV DNA
test (DNA solution hybrirli7~tion assay) and the Polymerase Chain Reaction (PCR). All samples were HBsAg positive and the results of HBeAg or Anti-HBe are inrl~ e-l The tested HBV carriers had different clinical backgrounds. High viremia was characterized by the ~ sence of HBV DNA and HBeAg; low o viremia by the presence of anti-HBe and HBV DNA; and asympLc lllatic HBV
carriers by the presence of anti-HBe.
Table 7 Evaluation Of 20 HBV Human Sera Sample BsAg BeAg Anti- HBV LCR HBV LCR BV PCR
ID HBeSet 403G Set 184G DNA Result (S/N)/result (S/N)/result p~/ml + nd* nd* 0.9 - 44.5 +
+ - + 1.0 - 13.1 +
19 + nd* nd* 1.3 - 1.0 66 + - + 3.1 + 5.3 +
72 + - +/- 34.2 ++ 51.9 ++ - -(+)**
26 + - + 2.0 ++ 22.4 ++ - +
27 + + - 66.8 ++ 273.8 ++ - +
+ - +/- 2.0 + 10.2 + - +
52 + - + 19.9 + 63.6 + - +
57 + + - 130.8 ++ 369.8 ++ - +
+ - + 300.3 ++ 361.4 ++ - +
64 + + - 194.9 ++ 324.7 ++ - +
67 + - + 2.0 +/- 2.5 +/- - +
69 + - + 22.8 ++ 239.3 ++ - +
+ - + 246.3 ++ 340.7 ++ - +
6 + nd* nd* 323.0 ++ 437.9 ++ 44 +
13 + - + 231.5 ++ 415.7 ++ 97 +
41 + - + 335.5 ++ 419.1 ++ 17 +
74 + + - 373.2 ++ 455.2 ++ 107 +
+ + - 363.8 ++ 446.0 ++ 88 +
* nd is "not ~ r~ n~
5 ~*After seeing LCR data and retesting by PCR, it became weak positive.
S/N (signal/noise)= sample IMx(~) rate/background (bg) IMx(E~ rate Fxample 7 LCR was performed using probe set 403G (SEQ ID Nos. 1, 2, 3, and 4) 20 under conditions described in Example 1 and used to monitor HBV DNA levels ~o 95/02690 PCT/US94/07684 ~67~5~

in follow-up samples of patients (A, B, C) with chronic liver infections. The LCR data from the IMx(~) instrument presented as signal-to-noise (S/N) ratio can be com~dled directly in the graphs with the serum level (m/l) of the liver derived enzyme alanine aminotr~n~min~e (ALT). The criteria for ev~ tion of s tested ~mrles was as described in Example 6, above.
The study was conducted as follows. Patient A received inte. rt;l~ll therapy (designated ~ in table below) on June 13, 1990 and October 15, 1990 (A2 and A3, below); HBV DNA levels were moniLulGd at set intervals through March 17, 1992. Patient C received inl~lÇ~,iull therapy on November 14, 1991, December 10, 1991, January 7, 1992, January 28, 1992, and March 3, 1992 (C4-C8, below). HBV DNA levels were l.lonilol~d at set intervals through May 26, 1992. In these patients' sera, HBV-DNA was clearly detectable by conventional dot blot hybIi-li7~tion test before starting interferon tr~trn~nt but beearne negative after therapy. In the LCR detection system, serum HBV-DNA
5 could be detectecl even after successful tre~tm~nt for several weeks longer than with the conventional hybri-li7~tion assay. The sllit~hility of semi~ e molliL~ g of HBV DNA and ALT by LCR detection is sc~lem~ti~,lly illllstr~t~
in Figures 3a-3c.

Wo 95102690 PCT/US94/07684 ~;rl~i~ 38 Table 8 Serial Serum Samples (Therapy Monitorin~) Patient LCR data LCR resultHBV DNA pg/ml PCR HBeAg a-HBe ALT m/l Al 329.6 ~+ 96 ++ - +/- 248 A2* 285 ++ 10 ++ - + 263 A3* 59.6 +~ nd** nd**nd**nd** 54 A4 2.5 +1- nd** nd**nd**nd** 29 AS 18.5 + - ++ - + 28 A6 5.5 + - nd nd**nd** 30 A7 4.2 + - nd**nd**nd** 28 A8 2.1 +/- - + - - 26 A9 20.1 +f - nd** - + 33 Bl 31.3 ++ t nd** + - 32 B2 168.7 ++ 15 nd** + - 48 B3 46.2 ++ 6 nd** + - 48 B4 6.8 + - nd** +/- +/- 55 BS 2.4 +/- - nd** - +/- 38 B6 5.3 + - nd** +/- - 29 B7 13.7 + - nd** + - 28 B8 166.9 ++ 10 nd** + - 70 B9 62.7 ++ - nd** + - 44 B10 101.0 ++ - nd** + - 38 Bll 117.9 ++ nd ++ + - 37 B12 3~8 + - + nd**nd** 28 Cl 129.7 ++ 52 nd** + - 126 C2 130.7 ++ 81 ++ + - 107 C3 130.5 ++ nd** ++ nd*~nd** nd**
C4* 128.4 ++ nd~* nd**nd**nd** nd**
CS* 124.9 ++ 70 nd** + - 79 C6* 101.6 ++ 12 nd** + - 159 C7~ 11.1 + nd ++ + - 78 C8* 3.3 + 63 ++ + - 18 C9 4.7 + - nd** (+) - 13 C10 4.3 + - nd** + - 14 Cll 5.9 + - + + - 12 * = patient received il~ r~ n therapy **nd is "not del~l--,ined"
s Exarnple 8 LCR was ~lrul-l,ed using probe set 403G (SEQ ID Nos. 1, 2, 3, and 4) under conditions described in Example 1, except 0.5 units of DNA polymerase and 3400 units of DNA ligase were used. Reactions were set up either with a o HBV DNA negative serum (negative control) or serum col,~inillg HBV type adw or type ~y.
Following amplification, reactions were diluted 1:1 with IMx~ diluent buffer, and the LCR ~mplifis~tion products were detected via a sandwich immuno~c~y p~;lro,med using the Abbott IMx(~ automated immllno~s~y 5 system. The numerical values given in the following examples are the rate reads of this process, e~ ssed in counts/sec/sec (c/s/s). The amount of ligated ~0 95/02690 PCTrUS94/07684 ~ ~7~3 ~

probes was direcdy related to the read rate (as described in European Patent .Applir~ation No. 357-011). The samples were tested in three repli-~tes; the average values are listed as mean value and the coefficient of variation (CV%) of the three repli-~ates is illustrated in Table 9 below.
s Table 9 Consensus Detection of HBV Subtypes adw and ~ Using Probe Set 403G
(SEO ID Nos. 1. 2~ 3. and 4) mean HsV-strains values %CV
(d ilu t.) * c/sls * *
HBV a~w (1:500) 573.83 8.8 (1:250) 781.53 25.1 (1:100) 1230.42 2.4 HCBV ay (1:500) 223.80 16.7 (1:250) 282.79 53.2 (1:100) 486.59 33.7 ne~. con~. 37.89 36.7 ~) diluted with HBV negative human serum 0 ~*) each dilution/sample tested in 3 replicates The results in-lic~te that probe set 403G is useful for concenC-lc detection of HBV subtypes and for following patients eligible for or undergoing anti viraltherapy.
Example 9 Probes SEQ Id Nos. 1 and 4 were used as primers for the detection of HBV DNA using a modification of Polymerase Chain Reaction (PCR) referred to as "short PCR" or "sPCR". sPCR was ~elro~ ed escenti~lly following the p~ age insert of the coll~ ;ially available Gene-AMPTM kit available forrn Perkin-Elmer/Cetus, Emeryville, CA. Controls were used from the Abbott Genostics IM DNA kit. PCR was run using primer set SEQ ID nos. 1 and 4 at 1x1012 molec./reaction, reaction buffer for 30 cycles of: 94-C for 30 seconds and ~O C for 20 seconds and Taq Polymerase (Cetus) at 1.25 units per reaction.
The duplex product was isolated and detected in an IMx(~ instrument as 2s described in EP 357,011 to Laffler, et al. published March 7, 1990, which isherein incorporated in its entirety by reference. The average results of duplicate runs are given below.

X1~i703~

PCR with SEO Id. Nos.l and 4 SAMPLE DNA IMxTM rates (mean values) Negative Control 4.3 Positive control 102().0 5.2 x105 molecules/mL 79-3 1.4 x107 molecules /mL1024.6 2.8 x 107 molecules/mL1143.5 Example 10 s Probes SEQ Id Nos. 5 and 8 were used as primers for the detection of HBV DNA with PCR as described in Example 9, above. The average results of ~upli~te runs are given below.
PCR with SEO Td Nos. 5 and 8 SAMPLE DNAIMx(~) rates (mean values) Negative Control 6.9 Positive control 1765.2 5.2 x105 molecules/mL945.1 1.4 x107 molecules /mL1736.8 2.8 x 107 mt lecule~/mL 1730.3 Example 11 Using probes SEQ ID Nos. 1 and 3, target specific polymerization and ligation is ~lÇu~ ed as described in U. S. Patent Number 5185243 issued February 9, 1993, which is incorporated in its entirety by reference. The probes5 are derivatized with FITC and/or fluo,~,scein as described above and mixed with select~o-l target HBV DNA, a mo-lifiç~l t7 DNA polymerase available from United States Biochemical, Cleveland, Ohio), buffer and water. The mixture is heated to 80 C for 5 minutes and is allowed to cool slowly to 23C. After a brief spin,32P-labeled dCTP, T4 DNA ligase, and DNA polymerase are added to the 20 reaction. The resulting solution is incubated at 23 C for 12 hours. Den~tll~ ;llg polyacrylamide gel electrophoresis of an aliquot from the above reaction shows a32P-labeled product of 48 bases in length. This product corresponds to the fill-in and ligation product of SEQ ID Nos. 1 and 3 after hybridization to target.

21 67Q~

Exarnple 12 Using probes SEQ ID Nos. 1 and 28 are hybri-li7ecl to target HBV DNA
under condition.c described in Exarnple 11, above except dATP and dCI'P are added. An aliquot of the reaction mixture shows a 32P-labeled product of 48 s bases in length. This product co~ pollds to the fill-in and ligation product of SEQ ID Nos. 1 and 28 after hybri-li7~tir n to target.

WO 95/02690 PCTrUS94/07684 ~i6~

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Abbott Laboratories (ii) TITLE OF INVENTION: NUCLEOTIDE SEQUENCES AND PROCESS FOR
AMPLIFYING AND DETECTION OF HEPATITIS B VIRAL DNA
(iii) NUMBER OF SEQUENCES: 33 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Abbott Laboratories (B) STREET: One Abbott Park Road (C) CITY: Abbott Park (D) STATE: Illinois (E) COUNTRY: USA
(F) ZIP: 60064 - 3500 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy diskette (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Wordperfect (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: U.S. 08/090,755 (B) FILING DATE: JULY 13, 1993 (C) CLASSIFICATION: 435 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Thoma~ D. Brainard (B) REGISTRATION NUMBER: 32,459 (C) REFERENCE/DOCKET NUMBER: 5284.PC.01 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 708 - 937 - 4884 (B) TELEFAX: 708-938 - 2623 (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2 3 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
CClCllCA TCCTGCTGCT ATG 23 21 ~7~5~

(3) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 (B) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

(4) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(5) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 25 (B) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CA~AA~.AACC AA~AA~AA~A TGAGG 25 (6) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRA~DEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

(7) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) 2~Q~

txi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

(8) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
GGGG~ C TTGTTGACAA 20 (9) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
TTGTCAACAA ~AAAAAcccc G 21 (10) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (~ynthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
CcT~A~AATA CCGCAGAGTC TAGA 24 (11) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 (B) TYPE: nucleic acid (C) STRANDEDNE,SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

(12) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 (B) TYPE: nucleic acid W O 95/02690 PCTrJS94/07684 21~705~

(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) ~xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

(13) INFORMATION FOR SEQ ID NO:12:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

(14) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

(15) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

(6) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

(17) INFORMATION FOR SEQ ID NO:16:

WO 9~/02690 PCT/US94/07684 ~

~ l ~7o~

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

(18) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:

(19) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:
TAGTAAACTG AGCCAA~A~A A 21 (20) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

(21) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 (B) TYPE: nucleic acid (C) STRA~DEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

~ =

2~7~6 CTAC~.AAC~A CT~AA~AAAT GG 22 (22) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:

(23) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:

(24) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:
C~CllCA TCCTGCTGCT ATGCCTCATC TTCTTGTTGG TTCTTCTG 48 (25) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:

(26) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: genomic DNA

21~7~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:
CAAGCTGTGC ~lLGGGlGGC TTTGGGGCAT GGACATTGAC CcTTATAAA~ 50 (27) SEQUENCE ID NO. 26 IS UNASSIGNED

(28) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: Other nucleic acid (synthetic DNA) (ix) FEATURE:
(A) NAME/KEY: 5' hydroxyl (B) LOCATION: 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27:

(29) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (ix) FEATURE:
(A) NAME/KEY: 5' hydroxyl (B) LOCATION: 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28:

(30) SEQUENCE ID NO. 29 IS UNASSIGNED

(31) SEQUENCE ID NO. 30 IS UNASSIGNED
(31) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (ix) FEATURE:
(A) NAME/KEY: 5' hydroxyl (B) LOCATION: 1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31:

~10 95/02690 PCT/US94/07684 2~S7(~

(33) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 (B) TYPE: nucleic acid tC) STRANDEDNESS: single tD) TOPOLOGY: linear tii) MOLECULE TYPE: Other nucleic acid t~ynthetic DNA) tix) FEATURE:
tA) NAME~KEY: 5' hydroxyl tB) LOCATION: 1 txi) SEQUENCE DESCRIPTION: SEQ ID NO: 32:
ATC~lG~lGG A~~ CTCA ATTTTCT 27 t34) INFORMATION FOR SEQ ID NO:33:
ti) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 (B) TYPE: nucleic acid (C) STRANDEDNESS: single tD) TOPOLOGY: linear tii) MOLECULE TYPE: Other nucleic acid (~ynthetic DNA) txi) SEQUENCE DESCRIPTION: SEQ ID NO: 33:

t35) SEQUENCE ID NO. 34 IS UNASSIGNED
t36) INFORMATION FOR SEQ ID NO:35:
ti) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 23 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear tii) MOLECULE TYPE: Other nucleic acid (synthetic DNA) (ix) FEATURE:
(A) NAME/KEY: 5' hydroxyl tB) LOCATION: 1 txi) SEQUENCE DESCRIPTION: SEQ ID NO: 35:

t37) INFORMATION FOR SEQ ID NO:36:
ti) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 22 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (~ynthetic DNA) (ix) FEATURE:
(A) NAME/KEY: 5' hydroxyl (B) LOCATION: 1 txi) SEQUENCE DESCRIPTION: SEQ ID NO: 36:

~;7Ua~ 50 ACALll~llC A~lG~llCGT AG 22 (38) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (~ynthetic DNA) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37:
CTACGAACCA CT~.AA~AAAT G 21

Claims (51)

What is claimed is:

1. A composition for detecting hepatitis B virus DNA present in a test sample containing non-target DNA, said composition comprising a first upstream oligonucleotide probe and a first downstream oligonucleotide probe, each probe comprising from about 10 to about 60 nucleotides hybridizable under hybridizing conditions to the same strand of a target nucleic acid sequence of hepatitis B virus, the 3' end of the upstream probe being hybridized proximate to the 5' end of the downstream probe, and wherein the target sequence is at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 or their complements.

2. The composition according to claim 1, wherein the 3' end of the upstream probe or the 5' end of the downstream probe are ligation incompetent absent corrections of said ends.

3. The composition of claim 2 wherein the ligation incompetent ends are corrected by extension of the 3' end of the upstream probe with nucleotides complementary to the intervening unhybridized portion of the target nucleic acidsequence so that the ends become ligation competent.

4. The composition according to claim 1, wherein the upstream and downstream oligonucleotide probes are a pair selected from the group consisting of pairs:
(a) SEQ Id Nos. 1 and 3;
(b) SEQ Id Nos. 5 and 7;
(c) SEQ Id Nos. 9 and 11, (d) SEQ Id Nos. 13 and 15; and (b) SEQ Id Nos. 17 and 19.

5. The composition according to claim 2, wherein the ligatable-incompetent ends are corrected by removal of a non-phosphorylated or mismatched base from the 5' end of the downstream probe by a target-dependent exonucleolytic agent, followed by extension of the upstream probe with nucleotides complementary to the intervening unhybridized portion of the target nucleic acid sequence so that the ends becomeligation competent.

6. The composition according to claim 5, wherein the upstream and downstream oligonucleolide probes are a pair selected from the group consisting of pairs:
(a) SEQ Id Nos. 1 and 28;
(b) SEQ Id Nos. 9 and 32; and (c) SEQ Id Nos. 17 and 36; or their complements.

7. The composition according to claim 2 wherein the downstream probe forms a 5' overhang when hybridized to its target, and the correction comprises removal of the overhang such that the 5' end of the downstream probe abuts the 3' end of the upstream, so that the ends of the probes are ligation competent.

8. A method for determining the presence or amount of hepatitis B virus DNA in a test sample comprising:
(a) hybridizing the DNA in the test sample with at least one an upstream oligonucleotide probe and at least one downstream oligonucleotide probe according to claim 1, to the same strand of a target nucleic acid sequence of hepatitis B virus, said hybridization resulting in ligation-incompetent ends, absent correction;
(b) correcting the 3' end of the upstream probe in a target dependent manner to render the probes ligatable;
(c) ligating the 3' end of the hybridized upstream probe to the 5' end of the hybridized downstream oligonucleotide probe, wherein the ligated product is capable of differentiation from the unligated probe; and (d) detecting the extent to which ligated product is formed as a measure of the presence or amount of HBV DNA in the sample.

9. The method according to claim 8 wherein said probe is differentiated by molecular weight.

10. The method according to claim 8 further comprising the steps of (a) conjugating a reporter group to at least one of the oligonucleotide probes, said reporter group capable of directly or indirectly producing a detectable signal;

(b) generating a signal from said reporter group associated with the hybridization; and (c) determining the presence of hepatitis B virus by detecting the signal generated.

11. The method according to claim 8 further including an amplification step prior to or concurrent with said hybridizing step.

12. The method according to claim 11 wherein the amplification is LCR or PCR.

13. The method according to claim 8 wherein the correction comprises extending at least one end of one the probes by nucleotides complementary to theintervening unhybridized portion of the target sequence so that the 3' end of the upstream probe and 5' end of the downstream probes become ligation competent.

14. The method according to claim 8 wherein the correction comprises removal of a non-phosphorylated or mismatched base from the terminus of the 5' end of the downstream probe by a target-dependent exonucleolytic activity, followed by extension of the upstream probe with nucleotides complementary to the intervening unhybridized portion of the target nucleic acid sequence so that the ends are ligation competent.

15. The method according to claim 14 wherein the detection is by monitoring the removal of fragments from the downstream probe.

16. The method according to claim 8 wherein the downstream probe forms a 5' overhang when hybridized to its target, and the correction comprises removal of the overhang such that the 5' end of the corrected downstream probes abuts the 3' end of the upstream, so that the ends of the probes are ligation competent.

17. A kit for detecting hepatitis B virus comprising a composition comprising an upstream and downstream probe according to claim 1, wherein at least one of the probes being labeled so as to be capable of detection; and means for detecting said probe.

18. The kit according to claim 17 further comprising a ligase.

19. The kit according to claim 17 further comprising a polymerase and a supply of at least one deoxynucleotide triphosphate.

20. A composition for detecting the DNA of hepatitis B virus present in a test sample, said composition comprising a first and second oligonucleotide probe of from about 10 to about 60 nucleotides capable of hybridizing to a target nucleic acid sequence of hepatitis B virus, wherein the target nucleic acid sequence is selected from at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their complements, and wherein the probes are hybridizable to opposite strands at opposite ends of the same target sequence of hepatitis B virus DNA.

21. The composition according to claim 20, wherein the first and second oligonucleotide probes are a pair selected from the group consisting of pairs:
(a) SEQ Id Nos. 1 and 4;
(b) SEQ Id Nos. 5 and 8;
(c) SEQ Id Nos. 9 and 12; and (d) SEQ Id Nos. 13 and 16.

22. A method for determining the presence of hepatitis B virus DNA in a test sample using a composition of claim 20 comprising:
(a) hybridizing the first oligonucleotide probe and the second oligonucleotide probe to opposite strands at opposite ends of the same target nucleic acid sequence of hepatitis B virus DNA;
(b) extending the hybridized first and second oligonucleotide probes to form extension products such that, when the extension products are separated from thetemplates on which they were formed, the extension products can serve as templates for hybridization and extension of the opposite probe;
(c) separating the extension products from the templates on which they are formed:
(d) hybridizing the first and second oligonucleotide probes of step (a) to the extension products of step (b) and creating extension products therefrom;
(e) repeating steps (c) and (d) at least once; and (f) detecting the presence of the extended probes as a measure of the hepatitis DNA present in the test sample.

23. The method according to claim 22 wherein steps (c) and (d) are repeated at least 10 times.

24. The method according to claim 22 further comprising the steps of (a) conjugating a reporter group to at least one of the oligonucleotide probes, said reporter group capable of directly or indirectly producing a detectable signal;
(b) generating a signal from said reporter group associated with the hybridization; and (c) determining the presence of the extended oligonucleotide probes, said presence being related to the presence of the target DNA.

25. A kit for detecting hepatitis B virus comprising a composition comprising a pair of oligonucleotide probes according to claim 20, wherein at least one of the probes is labeled so as to be capable of detection; and means for detecting said probe.

26. The kit according to claim 25 further comprising a polymerase and a supply of all four deoxynucleotide triphosphates.

27. A composition for detecting the DNA of hepatitis B virus present in a test sample, said composition comprising (a) a first set of oligonucleotides comprising a first upstream probe and a first downstream probe, each probe comprising from about 10 to about 60 nucleotides hybridizable under hybridizing conditions to the same strand of a target nucleic acid sequence of hepatitis B virus, and wherein the target sequence is at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their complements; and (b) a second set of oligonucleotides comprising a second downstream probe and a second upstream probe; both probes hybridizable to the first set of oligonucleotides of step (a).

28. The composition according to claim 27 wherein the 5' end of at least one of the first downstream probe and/or the 3' end of at least one of the upstream probes is ligation incompetent absent correction.

29. The composition according to claim 28 wherein the ligation incompetent ends are corrected by extension of the 3' end of the first upstream probe with nucleotides complement to the intervening unhybridized portion of the target nucleic acid sequence so that the ends become ligation competent.

30. The composition of claim 29 wherein the four oligonucleotide probes are selected from the group consisting of:
(a) Set 403G, wherein SEQ Id Nos. 1 and 3 are the first upstream and first downstream probes, respectively and SEQ Id Nos 2 and 4 are the second downstreamand second upstream probes, respectively;
(b) Set 184G, wherein SEQ Id Nos. 5 and 7 are the first upstream and first downstream probes, respectively and SEQ Id Nos 6 and 8 are the second downstreamand second upstream probes, respectively;
(c) Set 231G, wherein SEQ Id Nos. 9 and 11 are the first upstream and first downstream probes, respectively and SEQ Id Nos 10 and 12 are the second downstream and second upstream probes, respectively;
(d) Set 1875G, wherein SEQ Id Nos. 13 and 15 are the first upstream and first downstream probes, respectively and SEQ Id Nos 14 and 16 are the second downstream and second upstream probes, respectively; and (e) Set 664G, wherein SEQ Id Nos. 17 and 19 are the first upstream and first downstream probes, respectively and SEQ Id Nos 18 and 20 are the second downstream and second upstream probes, respectively;

31. The composition according to claim 27 wherein the ligation incompetent ends are corrected by removal of a non-phosphorylated or mismatched base from the terminus of the 5' end of the first downstream probe by a target-dependent exonucleolytic agent, followed by extension of the upstream probe with nucleotides complementary to the intervening unhybridized portion of the target sequence so that the ends become ligation competent.

32. The composition of claim 31 wherein the four oligonucleotide probes are selected from the group consisting of:
(a) Set 403E, wherein SEQ Id Nos. 1 and 28 are the first upstream and first downstream probes, respectively and SEQ Id Nos 27 and 4 are the second downstream and second upstream probes, respectively;
(b) Set 231E (SEQ Id Nos. 9, 31, 32, and 33; wherein SEQ Id Nos. 9 and 32 are the first upstream and first downstream probes, respectively and SEQ Id Nos 31 and 33 are the second downstream and second upstream probes, respectively; and (c) Set 664E wherein SEQ Id Nos. 17 and 36 are the first upstream and first downstream probes, respectively and SEQ Id Nos 35 and 37 are the second downstream and second upstream probes, respectively.

33. The composition according to claim 27 wherein the downstream probe forms a 5' overhang when hybridized to its target, and the correction comprises removal of the overhang such that the 5' end of the corrected downstream probes abuts the 3' end of the upstream, so that the ends of the probes are ligation competent.

34. A method of detecting the presence, absence or quantity of hepatitis B
virus DNA in a test sample using a composition of claim 27 by a ligase chain reaction comprising the steps of:
(a) exposing a sample suspected of containing the single stranded target nucleicacid sequence to a first set of oligonucleotides comprising a first upstream probe and a first downstream probe; each probe hybridizable under said hybridizing conditions to the same strand of said target nucleic acid sequence of hepatitis B virus, wherein the 5' end of the downstream probe and/or the 3' end of the upstream probe is ligation incompetent absent correction to permit hybridization of said probes to target;
(b) correcting the 3' end of the first upstream probe and/or the 5' end of the first downstream probe only when said probes are hybridized to the target sequence, whereby the correction renders the ends ligation competent;
(c) ligating the first two probes to form a first ligated product and separatingsaid first ligated product from the target;
(d) exposing the mixture under hybridizing conditions to a second set of oligonucleotides comprising a second upstream probe and a second downstream probe, and ligating the second two second probes to form a second ligated product, separating the second ligated product from the first ligated product, and wherein the ligated probes are capable of differentiation from the unligated probes;
and repeating steps (a) through (c) at least once; and (e) determining the presence of the ligated oligonucleotide probes, said presence being related to the presence, absence or quantity of the target DNA.

35. The method according to claim 34 wherein the ligated probes are detected by molecular weight.

36. The method according to claim 34 wherein the ligated probes are selected by affinity labeling, composition, gel filtration, sedimentation velocity, osmotic pressure, or gel electrophoresis.

37. The method according to claim 34 further comprising the steps of (a) conjugating a reporter group to at least one of the oligonucleotide probes, said reporter group capable of directly or indirectly producing a detectable signal;
(b) generating a signal from said reporter group associated with the hybridization; and (c) determining the presence of the extended oligonucleotide probes, said presence being related to the presence of the target DNA.

38. The method of claim 34 wherein the correction step comprises extension of the 3' end of the first upstream probe and/or the 5' end of the first downstream probe with nucleotides complementary to the intervening unhybridized portion of the target nucleic acid sequence so that the ends become ligation competent.

39. The method of claim 34 wherein the correction step comprises removal of a non-phosphorylated or mismatched base from the terminus of the 5' end of the first downstream probe by a target-dependent exonucleolytic agent, followed by extension of the upstream probe with nucleotides complementary to the intervening unhybridized portion of the target nucleic acid sequence so that the ends becomeligation competent.

40. The method of claim 34 wherein the first downstream probe forms a 5' overhang when hybridized to its target, and the correction comprises removal of the overhang such that the 5' end of the corrected downstream probes abuts the 3' end of the upstream, so that the ends of the probes are ligation competent.

41. A kit for detecting the presence of hepatitis B virus DNA in a test sample comprising a composition according to claim 27 wherein at least one of the probes is labeled so as to be capable of detection; and means for detecting said probe.

42. The kit according to claim 41 further comprising a ligase.

43. The kit according to claim 42 further comprising a polymerase and a supply of at least one deoxynucleotide triphosphate.

44. An oligonucleotide probe of from about 10 to about 60 nucleotides having a nucleotide sequence hybridizable under hybridizing conditions to a target nucleic acid sequence of hepatitis B virus, wherein the target sequence is selected from at least one sequence selected from the group consisting of SEQ Id Nos. 21, 22, 23, 24, and 25 and their complements.

45. The oligonucleotide probe according to claim 44 selected from the group consisting of SEQ Id. Nos. 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 or their complements.

46. A method for determining the presence of hepatitis B virus DNA in a test sample, comprising hybridizing the DNA in the test sample with at least oneoligonucleotide probe according to claim 44, wherein the hybridized probe is capable of differentiation from the unhybridized probe, and detecting the presence of the hybridized probe.

47. The method according to claim 46 further comprising the steps of (a) conjugating a reporter group to at least one of the oligonucleotide probes, said reporter group capable of directly or indirectly producing a detectable signal;
(b) generating a signal from said reporter group associated the hybridization;
and (c) determining the presence of hepatitis B virus by detecting the signal generated.

48. The method according to claim 46 further including an amplification step prior to or concurrent with said hybridizing step.

49. The method according to claim 48 wherein the amplification is LCR or PCR.

50. A kit for detecting hepatitis B virus comprising at least one oligonucleotide according to claim 44, said oligonucleotide being labeled so as to be capable of detection; and means for detecting said oligonucleotide.

51. The kit according to claim 50, further comprising reagents for amplifying sample hepatitis B virus DNA.