EP1874957A1 - Method for amplification - Google Patents

Abstract

The invention refers to a method for multiplex amplification of at least one specific nucleic acid locus, comprising the steps of: providing at least one oligonucleotide probe pair that is designed so that the first and second probe of the pair anneal to a specific nucleic acid locus on a target molecule, in which pair the first probe has an extendable 3'-end, and a second probe has a 5'-end that is directly or indirectly labelled with a phosphate group; providing a target molecule comprising at least one specific nucleic acid locus; allowing the probe pair to anneal to the target molecule; allowing the 3'-end of the first probe to extend by influence of polymerase by adding a set of three different dNTPs; ligating the 3'-end of the extended first probe to the 5'-end of the second probe. Hereby, a method is provided which allows a high specificity for simultaneous amplification of several loci. Further, the invention involves a kit for use in the method of the invention.

Description

Method for amplification

Field of the invention

The current invention describes a novel method for multiplex amplification of specific nucleic acid loci. The invention relies on termination of a polymerase- mediated extension, specific ligation of the extended probe to a second probe and finally amplification by a pair of universal primers.

Background of the invention

The disclosure of the human DNA sequence is only the beginning of efforts in trying to decipher the human genome. The sequence is now the starting point in assigning the relationship between DNA sequence variations and phenotypic variations. Furthermore, with this completed sequence and identification of all human genes, the characterization of complex genetic disorders is estimated to be much more efficient. In addition to complex disorders and disease susceptibility, the sequence information will also shed light on questions such as population genetics, pharmacogenetics, drug development, forensics and cancer.

The DNA sequences of any two humans differ by only 0.1 %. One form of alteration that occurs in the genome is short tandem repeats (STRs). However, recent efforts have been focused on the most abundant form of genetic variation that is single nucleotide polymorphisms (SNPs). SNPs have an estimate frequency of 1 per 1000 bases in human genomic DNA. Some SNPs, predominantly the SNPs in the coding and regulatory sequences are expected to have more impact on susceptibility to different diseases or predisposition to adverse reactions to drugs. However, in addition to advanced algorithms and statistics, the initial step of assigning SNPs to biological functions requires the ability of high-throughput scoring of SNPs to a low cost. Nevertheless, the improvement of sequencing techniques and microarrays in recent years has given rise to a new bottleneck - the amplification of DNA. The polymerase chain reaction (PCR) has its shortcomings since only a few loci can be amplified in the same reaction. In a multiplex PCR, each new DNA segment requires a specific primer pair and the risk for unwanted cross hybridizations and spurious amplification products increases with increased number of primers.

WO02/057491 and WO02/101358 discloses methods for ligation of probes and thereafter multiplex PCR-amplification of the ligated probes. However the method of WO02/101358 suffers from the drawback of unspecific primer hybridization which in combination of uncontrolled extension in presence of all 4 nucleotides results that it is not possible to cycle the initial amplification (linear)/ligation without entering into an exponential amplification. The method of WO02/057491 uses precircle probes that after ligation will be locked (a padlock form) to the target molecule and block the possibility to cycle the initial linear amplification. In addition, unreacted precircle probes have to be removed by enzymatic reactions which (in order to efficiently remove the unreacted probes) forces the technique to use very small amount of precircle probes and thereby further blocking. Thus, it is important that the target material is provided in a sufficient amount. Approximately at least 100 000 copies of each target molecule is roughly necessary when these methods are used.

Thus, multiplex amplification, i.e. the amplification of many different segments in one reaction, has been the major bottleneck in all high-throughput genotyping projects. Accordingly, this invention describes a novel approach for multiplex amplification of SNPs or any other specific loci, suitable for detection with minisequencing, allele-specific oligonucleotide hybridization (Affymetrix) and PrASE platforms or any other array-based technique or bead-based technologies (Illumina Inc, Luminex Co.).

Accordingly, the main objective of this invention is to provide a solution for simultaneous amplification of several loci.

Summary of the invention

This objective is accomplished by introducing a novel method that shows a clearly higher specificity compared to the prior art. Hereby, it is possible to analyse at least about 70 specific nucleic acid loci in the same reaction using as little as about 100 copies of the target material with the potential for co-amplification of thousands of loci. In addition, the method is highly automated.

In a first aspect, the invention involves a method for (multiplex) amplification of at least one specific nucleic acid locus, comprising the steps of:

(a) providing at least one oligonucleotide probe pair that is designed so that the first and second probe of the pair anneal to a specific nucleic acid locus on a target molecule at a distance of 1-30 or more nucleotides from each other, in which pair the first probe has an extendable 3 '-end and a 5 '-end that comprises a universal PCR tag sequence, and which 5 '-end optionally is biotin labelled, and a second probe has a 3 '-end that comprises a universal PCR tag sequence, and a 5 '-end that is directly or indirectly labelled with a phosphate group;

(b) providing a target molecule comprising at least one specific nucleic acid locus;

(c) allowing the probe pair to anneal to the target molecule; (d) allowing the 3 '-end of the first probe to extend by influence of polymerase by adding a set of three different dNTPs;

(e) ligating the 3 '-end of the extended first probe to the 5 '-end of the second probe, that is designed to anneal adjacent to the 3 '-end of the 3-dNTP extension product;

(f) optionally repeating step (a) to (e) in order to linearly amplify the ligated probe pairs;

(g) optionally immobilising the ligated probe pairs to a solid support in order to remove target molecules;

(h) optionally amplifying the ligated probe pairs by PCR.

In a preferred embodiment the method involves the use of a plurality of oligonucleotide probe pairs so that a plurality of specific nucleic acid loci is amplified.

In one embodiment, the specific nucleic acid loci is a single nucleotide polymorphism (SNP), or a mutation site or any other genetic variation, whereby the first and second probe of the oligonucleotide pair(s) are designed to anneal on each side of the SNP site.

Other embodiments include monitoring of specific variations in drug resistance, virus and bacterial typing and mutation analysis and analysis of loss of heterozygosity (LOH).

Preferably, the 3 '-end of the first probe is designed to anneal directly 5' of the SNP site. In another embodiment, the method of the invention is used for expression analysis, optionally involving fluorescently labelled primers and subsequent immobilisation on an array or bead-based platform.

In a preferred embodiment, only two sets of 3-dNTP combinations are used for amplification, whereby the two sets are chosen from the following combinations: AGT and (CTG or GAC), or TCA and (CTG or GAC), or CTG and (AGT or TCA) or GAC and (AGT or TCA).

In a second aspect, the invention involves a kit for use in the method of the invention, comprising at least one oligonucleotide probe pair as defined above, and a ligase for ligating the extended 3 '-end of the first probe to the 5 '-end of the second probe, and optionally a polymerase for linear extension, and optionally reagents and primers for performing an amplification, a ligation reaction and a PCR, and further including instructions for using the kit, as well as instructions for designing the oligonucleotide pair(s).

Further, the kit may comprise a target molecule comprising at least one specific nucleic acid locus, to which the at least one oligonucleotide probe pair are designed to anneal at a distance of 1-30 or more nucleotides from each other. In a preferred embodiment, the kit may comprise more than one oligonucleotide probe pair in order to amplify a plurality of specific nucleic acid loci. Also, as preferred embodiments, the oligonucleotide probe pairs are chosen from the oligonucleotides that are listed in table 2-6 and the specific nucleic acid loci are chosen from the loci that are listed in table 1.

Thus, the invention provides several advantages. In addition to advantages mentioned above, by using the invention, SNPs and other variations can be studied in haploid as well as diploid organisms. Further, by only using 3 nucleotides (out of 4), it is possible to cycle the extension/ligation reaction and consequently minute amounts of genomic DNA can be used.

Brief description of the drawings

Figure 1. The principle of the method. Two probes are hybridized (annealed) to a target molecule. One of the probes (indicated as primer 1 in the figure) has an extendable 3' part (3' part of the probe specifically hybridizes to the target molecule) and a universal primer binding part at its 5' (indicated as TAGl in the figure). This probe is directly or indirectly labeled with biotin. The second probe (indicated as primer 2 in the figure) has a 5' part that specifically binds to the target molecule and a 3' part (indicated as TAG2 in the figure) that serves as a universal primer binding. A gap is thus generated between the two probes and the size of the gap depends on selection of a 3-dNTP combination. In this example the first probe (the extension primer or primer one) is extended by the nucleotides G, T and A. The nucleotide C is thus omitted. By this combination of 3-dNTPs, the extension primer (primer 1) is extended by "gtt" (thus the gap is 3 bases long) and lack of the C nucleotide in the reaction terminates the polymerization. Thereafter, the extended primer 1 will be ligated to primer 2. This procedure may be cycled (1-99 or more). After the extension/ligation procedure, the extended/ligated products are captured by interaction between biotin and streptavidin coated beads and target molecules and excess of primers are washed. After the wash step, the single-stranded extended/ligated products are subjected to PCR amplification by the use of a pair of universal (general) PCR primers. Note that B is biotin and in the cases shown in this figure and figures 5-8, the biotin is directly labelled to the 5 '-end of the extension primer. But, the biotin may as well be on the 3 '-end of the extension primer or the 3 '-end of the phosphorylated primer (primer 2). Or, the fragments (products of the linear extension event) can indirectly be biotinylated by using biotin labeled nucleotides or by ligating a universal sequence labeled with biotin to the universal PCR binding sequence (see also figure 14).

Figure 2. Conventional multiplex PCR amplification leads to generation of many nonspecific fragments, leading to hindrance of higher levels of complexities in the PCR (higher degrees of multiplexing. When a single-plex (1-plex) (n=l) PCR is performed, the PCR primers (primer A and primer B) can theoretically give rise to 3 unwanted PCR fragments (this number is a relative number). As it can be seen in the diagram, the number of unwanted fragments increases dramatically with the increased complexity and for example a 25-plex may give over 1200 cross reacted products.

Figure 3. The principle of the technique in expression analysis. Multiplex amplification of several gene products can be performed by use of a fluorescently labeled universal PCR primer and the PCR products can be hybridized to oligonucleotide or cDNA microarrays.

Figure 4. The six possible substitution SNPs (K, M, Y, R, W and S) are presented. As indicated by arrows, K is complementary to M and Y is complementary to R while W and S do not have complementary copartners. Also, the four possible 3- dNTP combinations (AGT, TCA, CTG and GAC) are shown. The AGT combination is complementary to the TCA combination and CTG combination is complementary to GAC. For SNP W only the combinations AGT and TCA may be used and for SNP S only the combinations CTG and GAC may be used. Thus, in a highly multiplex amplification, two 3-dNTP combination has to be used to cover all SNP positions. The 3-dNTP combinations in each square are complementary to each other and thus when one combination in one square is used for extension, then the other combination should not be employed and instead a 3- dNTP combination from the other square has to be used. Figure 5. Extension of a polymorphic position (Y) with a combination of nucleotides G, A and T and ligation of the extended product to a second probe. This combination results in incorporation (extension) of 3 bases into the extension primer (primer 1).

Figure 6. Extension of a polymorphic position (Y) with a combination of nucleotides G, A and C and ligation of the extended product to a second probe. This combination results in incorporation (extension) of only 1 base into the extension primer (primer 1).

Figure 7. Extension of a polymorphic position (R) with a combination of nucleotides C, T and A and ligation of the extended product to a second probe. This combination results in incorporation (extension) of 4 bases into the extension primer (primer 1).

Figure 8. Extension of a polymorphic position (R) with a combination of nucleotides C, T and G and ligation of the extended product to a second probe. This combination results in incorporation (extension) of only 1 base into the extension primer (primer 1).

Figure 9. Amplification of 10 nano-gram genomic DNA does not render different genotyping results compared to 200 nano-gram DNA. In fact, as shown, the genotyping results (presented as allelic fractions) of the two concentrations is almost identical. This confirms that the multiplex amplification approach can be performed on small amount of genomic DNA. Figure 10. Cluster diagrams for 9 SNP positions as calculated by allelic fractions (x-axis). The y-axis represents logarithmic value of the total fluorescent signal intensity (obtained from both allele-specific primers) for each sample.

Figure 11. Inclusion of the ligase in the extension/ligation reaction gives an end PCR product (left) while exclusion of the ligase does not (right).

Figure 12. Ligase is not present and the extension primer is not biotin labeled and thereby stringent wash may not be performed. This is example of unwanted extension that may occur if biotinylated primers are not used as in Example 1. Smaller dotted lines indicate a first time extension of an oligonucleotide probe. The thicker dotted lines indicate extension (a secondary extension) of an oligonucleotide that was extended in a previous cycle and is subjected for an additional extension (e.g. it has been converted and used as a new primer).

Figure 13. Ligase is not present but the extension primer is biotin labeled which facilitates stringent wash.

Figure 14. An indirect labeling may be performed by the design and use of a universal biotin labeled sequence (the circle represents biotin). An oligonucleotide sequence containing two parts is also used (one part with complementary sequence to the universal PCR binding sequence (the tag on the primer) and one part complementary to the biotin labeled sequence). The complex of the three sequences will anneal to each other at the hybridization stage and then the biotin labeled sequence can be ligated to the universal PCR binding creating a new biotin labeled primer with a target specific sequence (the 3 '-part is target specific).

Figure 15. Making a complementary strand of the extended/ligated products to avoid the biotin labeled primers in the exponential PCR phase. The circle represents a biotinylated primer or extended/ligated product that is captured on a streptavidin coated solid phase. A universal PCR primer (complementary to the tag on the phosphorylated primer or primer 2) is used and extended. Thus, a complementary sequence to the extended/ligated strand is generated. Note that complementary sequence to the extension primer (or primer one or the primer with the biotin labeling cannot be generated. The newly synthesized strand can then be separated from the old strand and thus only the complementary sequence to the extended/ligated product will be used in the PCR.

Detailed description of the invention

The present invention allows a robust and highly multiplexed amplification of target DNA or RNA molecules. In general, the method comprises a number of different components as listed below:

(I) Target molecule hybridization with a first oligonucleotide probe having an extendable 3'-terminus (i.e. the 3'-part of the probe anneals specifically to the target DNA molecule). This specific oligonucleotide probe contains a 5 '-part that serves as a universal PCR tag sequence and which does not anneal to the target locus. It is preferred that this first oligonucleotide probe is biotin labeled (directly or indirectly) at its 5'- end facilitating immobilization to streptavidin.

(II) Target molecule hybridization with a second oligonucleotide probe having a 5 '-part that specifically anneals to the target locus and a 3 '-part that serves as a universal PCR tag sequence and which does not anneal to the target locus. This second oligonucleotide probe is directly or indirectly labeled with a phosphate group at its 5 '-end facilitating ligation in the following steps.

(III) Polymerase-mediated extension of the first oligonucleotide probe with only 3 dNTPs. (IV) Ligation of 3 ' -end of the extended first oligonucleotide probe to 5 ' -end of the second oligonucleotide probe.

(V) In a preferred embodiment, cycling (repeating) of the steps (I) to (IV) can be conducted, leading to a linear amplification of the specific positions. However, in another embodiment, cycling (repeating) of the steps (I) to (IV) (linear amplification of the specific positions) is not required (not desired) and thus step (V) can be omitted.

(VI) Preferably, immobilization of the ligated products (5'-biotin labeled) to streptavidin coated magnetic beads can be performed and thus complete removal of genomic DNA/transcriptomic RNA or cDNA and also removal of the second oligonucleotide probe can be done. This removal is accomplished by stringent wash and repeated alkali treatment. However, if removal of the target template is not considered as an important factor, step (VI) can be omitted.

(VII) Amplification of the ligated products by a pair of universal PCR primers

Accordingly, the invention is directed to multiplex amplification of several loci and involves novel approaches to avoid spurious amplification products. However, firstly, the invention involves the use of probes comprising a binding (hybridizing) partner that will bind to the target molecule. Furthermore, each specific probe also comprises one universal nucleic acid priming sequence that will allow the amplification of the specific sequence. Consequently, two universal priming sequences can be used, such as standard PCR priming sequences. Identical universal priming sequences can be used for two probes, facilitating the use of single primer in the exponential PCR.

By an "oligonucleotide probe pair" is in the context of the invention meant a pair of oligonucleotides that are designed to anneal close to each other on the same target molecule so that one of the probes can be extended and the two probes thereafter are ligated to each other.

By a "target molecule" is meant a single stranded nucleic acid molecule, such as DNA or RNA.

By a "universal PCR tag sequence" is meant a nucleic acid sequence that will function as a target for a PCR primer, so that the molecule that comprises the universal PCR tag sequence(s) can be amplified by PCR. Note that in a multiplex amplification all specific probes will have the same (universal) PCR tag.

By "directly or indirectly labeled with a phosphate group" is meant that a phosphate group is present at the 5 '-end of the probe that allows a ligation reaction to occur in the presence of a ligase. Direct labeling can be performed in the oligonucleotide synthesis while indirect labeling can be performed by enzymatic means such as the use of T4 kinase (supplied by Fermentas).

The first and second probe of the probe pair are according to the invention designed so that they anneal to the target molecule at a distance of 1 to about 30 or more nucleotides, preferably about 1 to 15 nucleotides and even more preferably about 2-12 nucleotides from each other.

Thus, amplifying a number of loci requires equal number of pair of specific probes with universal nucleic acid priming sequences but the pair of specific probes for each locus has the same direction (e.g. both probes bind to the same genomic strand) (see Figure 1). However, to avoid spurious amplification products only three dNTPs, or analogues thereof such as dUTP or labelled nucleotides are used in the first extension reaction (preferably performed by a thermostable DNA or RNA polymerase to allow cyclic linear amplification). A factor that greatly hampers the multiplexing in conventional PCR is formation of unwanted primer- template compounds and exponential amplification of these. However, in order to introduce exponential amplification at least two such unwanted bindings have to take place in close vicinity (about 10.000 base pairs or less). Consequently, with higher levels of complexities (high degree of multiplexing and higher number of binding probes) the number of unwanted primer-template compounds increases and the risk that a high number of such spurious primer-template bindings are close to each other increases dramatically. This fact and initiation of extension by polymerase (any DNA or RNA polymerase, preferably thermostable) in presence of all four dNTPs leads to exponential amplification of the un-specific (unwanted) fragments in the following cycles of the PCR (Figure 2). Nevertheless, in this invention, the extension of these unwanted (and also wanted) primer-template bindings is terminated by using only 3 dNTPs in the extension steps. Thus, the extension by 3 dNTPs never gives the polymerase (preferably a thermostable polymerase such as Stoffel Fragment) the possibility to initiate an exponential amplification. Accordingly, the possibility to perform the extension in a cyclic (repeating) fashion can be considered as desirable since it allows the use of only 0.1-9 (or less) nanogram (ng) of target molecules (DNA or RNA). As 1 ng human genomic DNA represents only 150 cells (300 copies of human genomic DNA), the cyclic feature of the invention (linear amplification of the target molecules) becomes important in application where a limiting number of cells is available (i.e. microdissected cells from cancer tissues or in forensics). However, it should be stressed that the cyclic aspect of the invention is not an absolute requirement since only one extension reaction may be sufficient.

The second step in the invention involves ligation of the first oligonucleotide probe (that has been extended by the 3 dNTPs) to the second oligonucleotide probe. This ligation by a DNA ligase or RNA ligase (preferably thermostable ligase to allow cyclic linear amplification) (for example ampligase (Epicentre), Pfu DNA ligase (Stratagene), T4 DNA ligase and T4 RNA ligase (Fermentas + New England Biolabs)) is highly specific. In order to be able to join the first probe to the second probe by a ligase, the 3 '-base of the first probe (extended by a limited number of bases) has to be adjacent to 5 '-base (labeled with phosphate) of the second probe. However, it is important to note that the 5 '-end-base of the second probe is the base that has not been included in the extension reaction. Thus, the first probe is extended by 3 dNTPs and the extension is terminated when the fourth nucleotide (the lacking nucleotide) has to be incorporated and just on the terminated base the 5'-end-base of the second probe is situated (see Figure 1). Accordingly, only specific probes that are extended may be jointed to their corresponding second probe. This combination of use of only 3 dNTPs and the ligation of the first and second probes assures a highly specific discrimination of non-specific extended probes. As mentioned above, to enhance the sensitivity, the extension-ligation procedure may be cycled (1 to 100 or more times) and the cyclic extension by 3 dNTPs (a linear amplification) does not permit the polymerase to initiate an exponential amplification.

Another key feature of the invention is that after extension-ligation step, the ligated products can be immobilized to streptavidin coated magnetic beads and complete removal of the targeting material (i.e. genomic DNA or transcriptomic RNA and/or cDNA) can be achieved by a very stringent wash procedure. The wash procedure involves removing of the supernatant and wash of the immobilized products with dH₂O (1 to 15 times or more) and an additional wash and treatment with NaOH (1 to 15 times or more). These washing procedures ensure that non-biotinylated materials that is genomic DNA or transcriptomic RNA and/or cDNA are completely removed and can not be targeted for nonspecific hybridizations and spurious exponential amplification in the following PCR step. The PCR amplification is then carried out by the use of a universal primer pair. The washing can be facilitated by binding biotin to streptavidin (for example streptavidin coated magnetic beads). However, the biotin labeling can be performed directly (at the oligonucleotide synthesis) by labeling either the extension primer (primer 1) or the phopshorylated primer (primer 2). Indirect biotin labeling can be done by either using one or more (1, 2 or all 3) biotin labeled nucleotides in the linear extension event or by using a biotin labeled universal oligonucleotide that can be ligated to the universal PCR binding sequence (see figure 14).

The amplified fragments may then be analyzed (genotyped) by for example the PrASE protocol (Hultin et al., Nucleic Acids Research 2005, Mar 14; 33(5):248) or minisequencing (Pastinen et al., Genome Research, 1997, Jun; 7(6): 606-614) or by allele-specific oligonucleotide hybridization (Wang et al., Science 1998, 280, 1077-1082) or any other array-based or the use of beads as solid support, or by dynamic allele-specific hybridization, oligonucleotide ligation assays, allele- specific primer extension or any array-based technique or by suspension array technologies (S AT) such as the Luminex platform or any technology platform capable of analyzing parallel (multiplex) amplified PCR fragments.

As mentioned above, this multiplex amplification approach may be employed on genomic DNA, mRNA and cDNA, for applications such as expression analysis and analysis of polymorphic positions, drug resistance typing, virus and bacterial typing and hot spot mutations. In the case of expression analysis, multiplex amplification of several gene products can be performed by use of a fluorescently labeled universal PCR primer and the PCR products can be hybridized to oligonucleotide or cDNA microarrays (see Figure 3). In this application, a computer software may be used to design the primers in which an optimal number of nucleotides are incorporated (1 to 10 or more). In addition, the software can design the position of the primers in a way that allows extension of primers with only one set of three nucleotides (i.e. ACG or ACT or AGT or CGT) (i.e. only one reaction for the linear extension/amplification).

Another application of the method, as indicated previously, is in typing of polymorphic positions. The most abundant form of genetic variation is the single nucleotide polymorphism (SNP). It is defined as a variation in a single base pair at a certain position where one of the alleles is present in more than one percent of a population. SNPs are thought to have an occurrence of one in every thousand bases and an initial step will be to conduct genetic mapping studies in order to assign each SNP with difference in phenotype or a medical disorder, which later can become routine in medical diagnostics. Simultaneous screening of thousands of SNPs, which will predict risk for different diseases and will help in decision making of suitable treatment, will become very useful. However, the initial step of assigning SNPs with biological function requires the ability of high-throughput scoring of SNPs to a low cost. Methods, that are a necessity in de novo sequencing, such as Sanger sequencing and Pyrosequenceing, both suitable for the essential first time discovery of an SNP, might not be optimal for high-throughput scoring. Instead, microarray technologies such as PrASE, Minisequencing or hybridization on Affymetrix chip which offer parallel analysis of several thousands of SNPs might be a solution in the effort to reduce cost and time. The improvement of microarray techniques in recent years however demands implementation of multiplex PCR amplification prior to the genotyping, which is the aim of this invention.

As shown in Figure 4, six classes of SNPs (substitution polymorphisms) are possible and these are: K=G/T, M=C/A, Y-C/T, R-G/A, W=A/T and S=G/C. Thus, to be able to cover all SNPs by 3-dNTP extensions, 4 extension reactions are required (AGT and TCA and CTG and GAC). Consequently, SNP positions having a G to T (K) substitution may be extended either with nucleotide combination AGT or CTG and C to A (M) SNPs may be extended with TCA or GAC combinations. In the same way, SNP C to T (Y) may be extended with TCA or CTG, SNP G to A (R) with AGT or GAC, SNP A to T (W) with AGT or TCA and SNP G to C (S) with CTG or GAC. But note that AGT is complementary to TCA and CTG is complementary to GAC. Also, as K is complementary to M and Y is complementary to R while W and S lack complementary copartner, only two extension reactions could be sufficient to cover all the polymorphisms. Yet, the two 3-dNTP extension reactions of choice should not be complementary. For example, if AGT is selected, the other reaction with 3-nucleotide combination should not be TCA and has to be either CTG or GAC. Thus, the use of three dNTPs in this invention makes it possible to reduce the number of required reactions from 4 to 2. It should however be mentioned that the use of two extension reaction is optional and preferred (in order to reduce time and cost) but the invention is not limited and the use of four extension reaction with the four 3- dNTP combinations is fully possible. Note that if only two dNTPs were used (e.g. if the SNP is G to T and a combination of GT is used in the extension reaction), 4 reactions have to be conducted to be able to cover all polymorphisms.

Figures 5, 6, 7 and 8 illustrate the four extension scenarios for a polymorphic position with a C to T base variation (G to A for the complementary strand). As shown, four different 3-dNTP combinations may be employed to this SNP. When the DNA strand with the Y (C to T) polymorphism is used as target template, the combinations GAT (Figure 5) and GAC (Figure 6) can be used. Note that the nucleotides G and A have to be present in order to extend both allelic variants. When the GAT nucleotide combination is used in the reaction (Figure 5), primer 1 (the extension primer) is extended by 3 bases in each allele variant. In this case, if the polymorphic position in the target template is homozygous C, the nucleotides "gβ" are incorporated and since the nucleotide C is not included, the extension will be terminated when C has to be incorporated and ligation of the extended product to primer 2 can be conducted. However, if the polymorphic position in the target template is homozygous T the polymerase incorporates nucleotides "atf and lack of the C nucleotide terminates the extension, and ligation of the extended product to primer 2 can be done by the enzyme ligase. Consequently, when the sample is heterozygous C/T, the target allele with C variant will have incorporation of "gtt" and the target allele with the T variant will have incorporation of "aft" and thus both allele products can be ligated to primer 2 and amplified in the PCR reaction that follows. Accordingly, when GAC nucleotide combination is used (Figure 6) only one base can be incorporated into primer 1 (the extension primer). This is because the T nucleotide is not included in the reaction and since the first nucleotide to be incorporated after the polymorphic position is a T, the extension will be terminated and the extended product (extended with one base) will be ligated to primer 2. As shown in Figures 5 and 6, the extension primer in both case of choice (GAT or GAC nucleotide combinations) is the same (same sequence) and preferably its 3 '-end is situated next to the polymorphic site. However, note that primer 2 in Figure 5 and primer 2 in Figure 6 have to be relocated depending on the number of incorporated bases in the gap (the gap between primer 1 and primer 2). However, in Figures 7 and 8 the DNA strand with the R (A to G) polymorphism is used as target template and thus the combinations CTA (Figure 7) and CTG (Figure 8) can be used. As the polymorphic target position is R (A or G) the nucleotides C and T (complementary to R) have to be present in order to extend both allelic variants. As shown, when the nucleotide combination of CTA is used, the extension primer (primer 1) is extended by four bases ("cact" in the case of homozygous G, "tact" in the case of homozygous A and one allele with "cact" and the other allele with "tact" in the case of heterozygous sample). In the same way, if nucleotide combination CTG is employed (Figure 8), only one base ("c" if the target is homozygous G, "t" if the target is homozygous A and in the case of heterozygous, "c" in the allele with the G variant and "f in the allele with the A variant) can be incorporated into primer 1 (the extension primer). This is because the A nucleotide is not included in the reaction and since the first nucleotide to be incorporated after the polymorphic position is an A₅ the extension will be terminated and the extended product (extended with one base) will be ligated to primer 2.

As illustrated in Figures 5-8 and described above, the user of the invented technique has the option to use any of the four 3-dNTP combinations. After the extension/ligation reaction (which, if desired, may be cycled several times), the extended/ligated product can be captured and thus complete removal of genomic DNA/trascriptomic RNA or cDNA and also removal of the second oligonucleotide probe can be done. This removal is accomplished by stringent wash and repeated alkali treatment. The capturing of the extended/ligated products can be facilitated by streptavidin-coated beads (preferably streptavidin-coated magnetic beads). The extended/ligated products are then subjected to a PCR amplification by the use of a pair of universal primers.

After PCR amplification, the amplified products are subjected for genotyping. Since the method represents a general solution to multiplex amplification of polymorphic positions, the genotyping can be performed by any array-based or any technique capable of handling a multiplex PCR amplification. As demonstrated in Figures 5-8 and described above, any of the four 3-dNTP combinations can be used. However, in order to compensate for an eventual unspecific extension/ligation event, an extension length scoring system can be implemented, favoring extensions with more than one base. Thus, the genotyping primer not only functions as a scoring probe but also serves as an extra discrimination factor.

However, as discussed above, after extension/ligation procedure, the products are captured (facilitated by biotin-strepavid binding) and complete removal of the targeting material and also the second primer(s) (phosphorylated primer(s) or primer(s) 2) can be achieved by a very stringent wash procedure. But, the biotinylated primer(s) are also captured and will be present in the PCR reaction. However, by making a linear amplification (1-100 or more cycles) of the extended/ligated products by the use of only one universal primer, a complementary strand to the extended/ligated strand can be synthesized. This newly synthesized strand can be eluted and be used in the exponential PCR with the two universal primers and thus the presence of the biotinylated primer(s) can be avoided (see Figure 15).

Below, the invention is described further by way of examples, which are only intended to illustrate specific embodiments of the invention, and should not be regarded as limiting for the scope of the invention as defined by the claims.

Examples

EXAMPLE 1

A Novel Approach for Multiplex Amplification of Single Nucleotide Polymorphisms

INTRODUCTION

Single nucleotide polymorphism (SNP), the most informative and abundant form of genetic variation in the human genome, is a single base pair position in the genome at which different sequence alternatives exist. The analysis of SNPs will have a major impact upon population genetics, functional genomics, pharmacogenetics, drag development, disease susceptibility, forensics, cancer and genetic disease research but requires methods for high throughput scoring since each individual accommodates millions of SNPs. Several technologies for sensitive and accurate massively parallel scoring of SNPs exist to date but the prior step; amplification of DNA is a major bottleneck. Traditional PCR is not suitable for multiplexing due to false priming and cross hybridization. However, this work describes a novel method for multiplex amplification. In brief, a polymerization reaction spanning the SNP position is conducted by using three dNTPs, thus creating an elongation stop after the polymorphic site. A ligation to a second primer is carried out at the termination point followed by a complete removal of genomic DNA and excess primer. This is accomplished by using biotinylated extension primers that can be immobilized onto streptavidin coated super paramagnetic beads, and an automated workstation. The final step is a PCR reaction containing all SNPs but without the presence of genomic DNA and the amplification is performed with one pair of general (universal) primers.

MATERIALS AND METHODS

SNPs and oligonucleotides

A total of 75 SNPs located in genes related to cancer were identified using the SNP500Cancer- and Ensembl databases. The human genome was screened with the flanking sequences of the candidate SNP using BLASTN to control occurrence of duplicated genomic segments or repetitive regions. The Gene ID, dbSNP ID, the base variation, and chromosome number for each of these SNPs is listed in Table 1. In Table 2, the extension primer for each of the 75 SNPs is listed. As it can be noticed, the 5 '-part of each extension primer (indicated with small letters) contains a universal priming sequence (that is not complementary to the target sequence). The 3 '-part of each extension primer (indicated with capital letters) however contains target specific binding sequence. Thus, it is the target specific part of the extension primer that will be extended. All the extension primers are 5 '-end biotinylated. Table 2 also indicates which 3-dNTP combination that is used for each extension primer ("fcg" or "gtø"). This means that two extension/ligation pools are prepared and in one pool the primers that should be extended with "teg" combination are mixed and in the other pool the primers that should be extended with "gta" combination will be mixed. Thus, 39 of the target SNPs were extended in the "teg" pool and 36 of the target SNPs were extended in the "gta" pool. Each of the specific extended products however will be ligated to its corresponding second probe (here referred as phosphorylated primer since these are phosphorylated at the 5 '-end to facilitate ligation). The phosphorylated primer for the targeted SNPs is listed in Table 3. The phosphorylated primers contain a 5'- part that has a target specific binding sequence (indicated with capital letters) and a 3 '-part that has a universal priming sequence and which is not complementary to the target sequence (indicated with small letters).

After the extension/ligation procedure, the joined (and 5 '-end biotin labeled) products are captured on streptavidin-coated magnetic beads and washed (to completely remove genomic DNA and excess primers). After this wash, the ligated products are subjected to PCR amplification with a pair of general (universal) primers. The sequence of the general PCR primers is, 5'- gagctgctgcaccatattcctgaac-3' (this primer is 5 '-end biotin labeled) and 5'- ccatgtcatacaccgccttcagagc-3 ' .

After the PCR amplification with the universal primers, the amplified fragments are genotyped with a protease-mediated allele-specific extension (PrASE) protocol. The PrASE method requires two primers with alternating 3 '-terminus and the sequence of these allele-specific primers is listed in Tables 4 and 5. Table

4 provides the sequence of the first allele-specific primer for each SNP and Table

5 presents the second allele-specific primer for each SNP. Each allele-specific primer in Tables 4 and 5 contains a 3 '-part (sequence) that is complementary to the biotinylated strand of the amplified (SNP) fragment and this part is indicated with capital letters. However, each primer contains also a 5 '-part sequence (indicated with small letters) that serves as a signature (signature tag) when the PrASE products are hybridized to a generic tag array. Table 6 provides the sequence of the tags that are immobilized on the glass slide. As it can be seen, each tag on the slide is complementary to a signature tag on the allele-specifϊc primers. It should be mention that all the sequence tags that are used on the slide contain a 15-T residue (at their 5'), which serves as spacer. All oligonucleotides were synthesized by MWG-Biotech AG (Ebersberg, Germany).

Samples

A total of 40 healthy Caucasians were analyzed in this study. 30 of these samples (ECACC Human Random Control (HRC) DNA) were obtained from Sigma- Aldrich Sweden AB (Stockholm, Sweden). The concentration for these samples was 8 ng/μl and 1 μl was used in the extension/ligation reaction (e.g. only 8 ng genomic DNA was used). The remaining 10 genomic DNA were isolated from blood from 10 Swedish individuals. The undiluted concentration for these 10 DNA samples was about 200 ng/μl. To investigate if the genotyping results would be the same or if these differed, undiluted (200 ng/μl) and diluted (10 ng/μl) samples were multiplexed amplified and compared.

Multiplexed extension/ligation reactions

The reaction with the 3-dNTP combination of "teg" (the "teg" pool) contained extension- and phosphorylation primers for 39 of the 75 SNPs and the reaction with the 3-dNTP combination of "gfø" (the "gfø" pool) contained primers for the remaining 36 SNPs. The final concentration for each of the extension primers was 0.01 μM while the final concentration for each of the phosphorylation primers was 0.05 μM.

One unit (U) AmpliTaq® DNA Polymerase Stoffel fragment (Applied Biosystems™, Foster City CA, USA) and 2 U Ampligase® (Epicentre™, Madison, Wisconsin, USA) was added to a IX Ampligase buffer (20 mM Tris- HCl (pH 8.3), 25 mM KCl, 10 mM MgC12, 0.5 mMNAD and 0.01 % Triton X- 100) (Epicentre™). The nucleotides dCTP, dGTP, dTTP (0.2 mM each) were added to the "teg" reaction pool. In the similar fashion, the nucleotides dATP, dGTP and dTTP were added to the ^ugta" reaction pool. Finally 1 μl of genomic DNA (see above for information regarding the concentration) was added, resulting in a total reaction volume of 10 μl for both reaction pools. The temperature profile consisted of an initial pre-cycling step (20° C for 5 min, 95° C for 5 min) followed by a 99-cycle step for annealing, extension and ligation (95° C for 15s and 65° for 12 min). The extension/ligation reactions were performed on a thermocycler from Applied Biosystems™ (Foster City, CA, USA).

Purification

The removal of genomic DNA and excess primers was automatically performed using a liquid handling robot, a Magnatrix 1200 (Magnetic Biosolutions AB, Stockholm, Sweden) running custom made scripts. The biotin labeled extension/ligation products were immobilized onto streptavidin-coated Dynabeads DP superparamagnetic beads (Dynal™, Oslo, Norway) and after incubation for 15 minutes in room temperature with three mixes, the beads were magnetically collected and washed twice with IxTE (1OmM Tris-HCL, pH 7,5, ImM EDTA) followed by 10 times wash with pure MiIIiQ water and 10 times wash with 0.1M NaOH under constant mixing. Finally, the DNA fragments were released by heating to 80° C for Is in pure MiIIiQ water (Magnetic Biosolutions AB, Stockholm, Sweden).

Amplification

The single-stranded DNA products were then amplified in a PCR-reaction containing 10 mM Tris-HCl (pH 8.3), 2 mM MgCl₂, 50 mM KCl, 0.1% (v/v) Tween 20, 0.2 mM dNTPs, 0.2 μM of each of the universal primers and 1 unit of AmpliTaq Gold® (Applied Biosystems™, Foster City, CA, USA) in a total volume of 50 μl. Amplification of the "teg" and "gta" was now conducted in one reaction tube resulting in a 75-plex amplification. One of the amplification primers was biotinylated (see above). This PCR mixture was preactivated for 12 min at 95° C and then amplified in 60 cycles with the temperature profile of 95° C for 30s, 68° C for 30s and 72° C for 30s) followed by a final elongation step (72° C for 2 min).

Array preparation, PrASE genotyping and hybridization, and data analysis

150 oligonucleotide tags functioning as probe captures on the glass slide were selected (see Table 6). The tags containing a 5 '-poly T spacer of 15 thymine residues were synthesized by MWG-Biotech AG (Ebersberg, Germany) with a 5'- terminus amino link with a C6 spacer (to facilitate covalent immobilization to the pre-activated slides). The oligonucleotides were suspended at a concentration of 20 μM in 150 niM sodium phosphate pH 8.5 and 0.06 % sarkosyl and were spotted with a Q-array (Genetix, Hampshire, United Kingdom) on Code Link activated slides (Amersham Biosceinces, Uppsala, Sweden). Sarkosyl was added to the spotting solution as it improved spot uniformity. After printing, the arrays were incubated overnight in a humid chamber followed by post coupling as outlined by the manufacturer.

The 150 oligonucleotides were printed in 16 identical arrays (an array of arrays) on the slide and each array contained duplicates of each oligonucleotide. The 16 sub-arrays were separated during hybridization by a reusable silicone mask (Elastosile ® RT 625 A/B, Wacker-Chemie GmbH, Munich, Germany) molded in an inverted 96 well plate and excised to fit the slide. A Custom made rack was used to press the silicone firmly to the slide and keep it in place during the reactions.

The procedures of PCR product immobilization, washing, annealing of 3'- terminus allele-specific primers and the multiplex allele-specific extensions were automated by the use of a Magnatrix 1200 pipetting robot system capable of handling magnetic beads (Magnetic Biosolutions, Stockholm, Sweden). 200 μg streptavidin-coated super paramagnetic beads (Dynabeads M280; Dynal, Oslo, Norway) were used to immobilize the multiplexed PCR products. After immobilization and wash with a binding/washing buffer (B/ W) (10 niM Tris-HCl pH 7.5, 1 mM EDTA, 2 M NaCl, 1 mM β-mercaptoethanol, 0.1% Tween® 20), ssDNA was obtained by alkali elution (0.1 M NaOH, 5 min at RT) of the non- biotinylated strand. The supernatant was discarded and the beads were washed once with Tris-EDTA. A mixture (total volume of 60 μL) containing 0.08 μM of each extension primer (two 3 '-terminus allele-specific primers per SNP) (see Table 4 and 5), IX annealing buffer (AB) (10 mM Tris-acetate pH 7.75, 2 mM Mg-acetate) and 0.5 ug single stranded binding protein (SSB) was added to the immobilized ssDNA. Each allele-specific extension primer contained a specific tag at its 5 '-end. A comparison of Tables 4 and 5 and Table 6 shows that each tag on the glass slide is complementary to one of the tags on the allele-specific extension primers. The allele-specific extension primers were allowed to anneal to the captured strands at 72° C for 3 min, 50° C for 7 min and 40° C for 1 min. The excess of primers was discarded and the immobilized ssDNA was washed once with IX AB and then resolved in IX AB to a volume of 20 μl. The protease mediated allele specific primer extension (PrASE) reaction was performed at 45° C by adding firstly 20 μL of a solution containing 10 U exonuclease-deficient (exo-) Klenow DNA polymerase (New England Biolabs, Beverly, MA, USA), IX extension buffer (EB) (42.5 mM Tris-HCl pH 8, 5 mM MgCl₂, 1 mM DTT) and 0.25 % BSA (Bovine Serum Albumin) to the ssDNA. A second mixture containing 1.5 μM of each dNTP (50 % Cy 5 -labeled dCTP and dTTP (Amersham Biosciences)), 2X EB, 0.5 % BSA and 20 μg Proteinase K was added to initiate the extension by exo- Klenow polymerase and simultaneously terminate the extension by degradation of the Klenow polymerase by the protease. After polymerization, the enzymes and dNTPs were discarded and immobilized DNA was washed with IX AB. To release the extended primers, the immobilized DNA was treated with 7 μl 0.1 M NaOH (5 min at RT) and the supernatants, i.e. the PrASE products were neutralized with 0.1 M HCl and 1OX AB to a total volume of 15 μl. 15 μl 2X hybridization buffer (HB) (1OX SSC, 0.4 % SDS) and 0.5 μg SSB was finally added to a total volume of 30 μl.

The fluorescently labeled PrASE products, each containing a specific signature tag at the 5 '-end, were then hybridized to the generic tag arrays on the glass slide for 60 minutes at 50° C. After hybridization, the slide was washed with 50° C pre- warmed 2X SSC / 0.1 % SDS for six minutes, then with 0.2X SSC at room temperature for one minute and finally with 0. IX SSC at room temperature for one minute. After the washing steps the slide was dried by a brief centrifugation.

Data analysis

Data were obtained by scanning the slide with an Agilent scanner (Agilent Technologies, CA, USA). Data was analyzed by GenePix Pro 5.0 software (Axon instruments, USA). The median local background intensities were subtracted from the median intensities of the spots by GenePix Pro 5.0 and the data were analyzed in Microsoft Excel where the mean values of fluorescence intensities of the duplicates for each signature tag were used to calculate the allelic fractions of the 75 SNPs for each individual.

RESULTS

The panel of Swedish individuals (10 samples), with a high concentration of genomic DNA (about 200 ng/μl in undiluted form), was first subjected to the multiplex amplification approach (a 75-plex) and then (after amplification) were genotyped with the PrASE protocol. The same samples were diluted to a concentration of 10 ng/μl and multiplexed amplified and then genotyped with exact same reaction conditions as the undiluted samples. In both analyses, signals and genotyping results were acquired for 70 of the 75 target SNPs, which is a very high number considering that errors in the oligonucleotide synthesis occurs often. The SNPs that did not give detectable signals are: SNP 16, SNP 25, SNP 34, SNP 70 and SNP 71. However, the multiplex amplification and the subsequent genotyping of the 200 and 10 ng starting genomic DNA were compared for the working SNP. This comparison was performed to investigate the correlation in multiplex amplification of the two concentrations and to prove that there is not any difference in the amplification when low amount of genomic DNA is used. However, to analyze the genotypes of the SNPs, the extension signals from the allele-specific primer pairs were used. The relative allelic fractions were calculated by taking the fluorescent signal intensity from spotl / (spotl + spot2), where spotl and spot2 correspond to primer extension of the first and the second allele respectively. This calculation gives allelic fractions of approximately 0.5 for heterozygous and near to 0 and 1 respectively for the homozygous samples. After calculation of the allelic fractions for each SNP and individual, the allelic fraction results for 200 ng and 10 ng target genomic DNA were plotted in a cluster diagram. Thus, in the case of good correlation, the genotyping results (which directly reflects the amplification results) of homozygous and heterozygous samples will be close to a straight line. In fact, the results for all working SNPs correlated very well between the 200 ng and the 10 ng genomic DNA which is a very strong indication that the approach can be used for multiplex amplification of very small amount of target genomic DNA as starting material. The result of 6 such cluster diagram is presented in Figure 9.

Thus, as we were convinced that this multiplex amplification approach will work with small amount of starting material, the project was continued with using only one digit nano-gram genomic DNA as starting material. Thus, a panel of genomic DNA with concentration of 8 ng/μl (1 micro-liter was used in the extension/ligation reaction) was acquired. The individuals in this panel are Caucasians. A total of 30 individuals were amplified with the multiplexing protocol. The multiplex amplified samples were then genotyped with PrASE and cluster diagrams for each SNP were obtained by calculating the allelic fractions. The cluster diagrams for 9 of the 70 working SNPs is shown in Figure 10. As illustrated, complete partitioning of homozygous and heterozygous genotypes was obtained.

EXAMPLE 2

The Multiplex Amplified Fragments Are the Result of Extension/Ligation Reaction

In order to demonstrate that the multiplex amplified fragments in the reaction tube are the result of the extension/ligation reaction and not a result of conventional PCR amplification, a simplex (single-plex or 1-plex) reaction was designed and conducted. A SNP position with the dbSNP ID number rs760589 was selected. An extension primer labeled with biotin at its 5 '-end and a 5 '-end phosphorylated primer were designed for this purpose. The sequence of these primers is: 5'— Biotin- GAGCTGCTGCACCATATTCCTGAAC- TGTGGCGGTTGTGCGGATTCA-3' (extension primer) and 5 -P- CACATGGCTGCCACTTAGGA-GCTCTGAAGGCGGTGTATGACATGG-y (phosphorylated primer). The sequences in italic indicate the universal primer binding sequences. The universal PCR primers were 5'-Biotin- GAGCTGCTGCACCATATTCCTGAA-y and 5'-

CCATGTCATACACCGCCTTCAGAG -3'. The experimental procedures (the extension/ligation reaction, capture and purification of extended/ligated products), PCR amplification and PrASE reactions were identical as in EXAMPLE 1. However the 3-dNTP extension was performed by using the combination of TAG. Thus the resulted extension/ligation will be 5' - Biotin - GAGCTGCTGCACCATATTCCTGAA CTGTGGCGGTTGTGCGGATTCARTGG

GTTATGGAGCACATGGCTGCCACTTAGGAGCΓCΓGX4GGCGGΓGL4ΓGL4

CATGG - 3'. The sequences in bold indicate the bases that have been extended by the DNA polymerase in the extension step. In addition, only 2.5 ng of genomic DNA was used. Also, in one reaction, the enzyme ligase was not included. Since the nucleotides T, A and G are included in the extension, the polymerization (extension) will be stopped (terminated) when a C nucleotide has to be incorporated. After the termination, the product of the extended primer will be ligated to the phosphorylated primer.

However, after PCR amplification, the PCR products were investigated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA; www.agilent.com), a lab-on-a-chip technology for accurate and sensitive sizing and quantification of DNA fragments. The experiments were performed according to the manufacturer's instructions using a DNA500 LabChip® kit. As shown in Figure 11, when ligase is included in the extension/ligation reaction (left diagram), a distinct peak representing the PCR product can be observed (indicated by arrow). However, when ligase is omitted in the reaction (right diagram), no PCR product can be observed. Note that the first and the last peaks are reference peaks and are used to calibrate sizing and quantification of the DNA fragments. The rational for conducting this experiment can be explained by studying Figure 12 and Figure 13. As shown in Figure 12 in which extension primer is not biotin labeled and therefore the washing after extension/ligation reaction cannot be performed, though ligase is not present in the extension/ligation reaction, the PCR step after extension/ligation will result in product(s). The reason is that one of the universal primers in the PCR is complementary to the 3 '-part (universal primer binding sequence) of the phosphorylated primer and due to present of this primer, the universal primer binds to this and generates a complementary sequence. This new complementary sequence segment will however contain a 3 '-part that is complementary to the genomic DNA. Note that because no wash has been performed, even the genomic DNA is present in this PCR step. Thus, this new synthesized sequence will function as a PCR primer and eventually PCR product(s) will be generated. This (these) PCR products are then a result of conventional PCR amplification and since conventional PCR amplification (especially when multiplexed) result in unspecific amplified fragments, the remove of un-reacted phosphorylated primers and genomic DNA become an important step of the invention. However, as demonstrated in Figure 13, when the extension primer is biotin labeled and can be captured by streptavidin coated beads, the phosphorylated primers and the genomic DNA can completely be removed and thus no PCR product should be observed when ligase is excluded in the extension/ligation reaction, which we successfully demonstrated in Figure 11.

Claims

Claims:

1. Method for (multiplex) amplification of at least one specific nucleic acid locus, comprising the steps of:

(a) providing at least one oligonucleotide probe pair that is designed so that the first and second probe of the pair anneal to a specific nucleic acid locus on a target molecule at a distance of 1-30 or more nucleotides from each other, in which pair the first probe has an extendable 3 '-end and a 5 '-end that comprises a universal PCR tag sequence, and which 5 '-end optionally is biotin labelled, and a second probe has a 3 '-end that comprises a universal PCR tag sequence, and a 5 '-end that is directly or indirectly labelled with a phosphate group;

(b) providing a target molecule comprising at least one specific nucleic acid locus;

(c) allowing the probe pair to anneal to the target molecule;

(d) allowing the 3 '-end of the first probe to extend by influence of polymerase by adding a set of three different dNTPs;

(e) ligating the 3 '-end of the extended first probe to the 5 '-end of the second probe;

(f) optionally repeating step (a) to (e) in order to linear amplify the ligated probe pairs;

(g) optionally immobilising the ligated probe pairs to a solid support in order to remove target molecules;

(h) optionally amplifying the ligated probe pairs by PCR.

2. Method according to claim 1, wherein the method involves the use of a plurality of oligonucleotide probe pairs so that a plurality of specific nucleic acid loci is amplified.

3. Method according to claim 1 or 2, wherein the specific nucleic acid loci is a single nucleotide polymorphism (SNP), whereby the first and second probe of the oligonucleotide pair(s) are designed to anneal on each side of the SNP site.

4. Method according to claim 3, wherein the 3'-end of the first probe is designed to anneal directly 5' of the SNP site.

5. Method according to any one of the preceding claims, for use in expression analysis, optionally involving fluorescently labelled primers and subsequent immobilisation on a microarray.

6. Method according to any one of the preceding claims, wherein the distance between the probes of the primer pair is 2-12 nucleotides.

7. Method according to any one of the preceding claims, wherein only two sets of three different dNTPs are used for amplification, whereby the two sets are chosen from the following combinations: AGT and (CTG or GAC), or TCA and (CTG or GAC), or CTG and (AGT or TCA) or GAC and (AGT or TCA).

8. Method according to any one of the preceding claims, further involving a step (f) comprising repeating step (a) to (e) in order to linear amplify the ligated probe pairs.

9. Method according to any one of the preceding claims, further involving a step (g) comprising immobilising the ligated probe pairs to a solid support in order to remove target molecules.

10. Method according to claim 9, wherein a complementary sequence to the immobilised ligated probe pairs is generated in order to remove biotin labelled primers.

11. Kit for use in the method of claim 1-10, comprising at least one oligonucleotide probe pair that is designed so that the first and second probe of the pair anneal to a specific nucleic acid loci on a target molecule at a distance of 1-30 or more nucleotides from each other, in which pair the first probe has an extendable 3 '-end and a 5 '-end that comprises a universal PCR tag sequence, and which 5 '-end optionally is biotin labelled, and a second probe has a 3 '-end that comprises a universal PCR tag sequence, and a 5 '-end that is directly or indirectly labelled with a phosphate group, and a ligase for ligating the extended 3 '-end of the first probe to the 5 '-end of the second probe, and optionally reagents and primers for performing an amplification, a ligation reaction and a PCR, and further including instructions for using the kit, as well as instructions for designing the oligonucleotide pair(s).

Table 1.

Table 2.

SNP

Extension Primer ->3 3-dNTP

1 gagctgctgcaccatattcctgaacGACCATCACTTAAATCAGGTCCTCC teg

2 gagctgctgcaccatattcctgaacCTCTTCAGCTCCCAGAGTCACCA gta 3 gagctgctgcaccatattcctgaacTGGATTTTTACATATGAGCCTTCAATG gta 4 gagctgctgcaccatattcctgaacGGCCAACAAGATCAGTCTGTTCTCT gta 5 ;agctgctgcaccatattcctgaacACCCTAGATTGTATTGTAGGAGGCAT teg 6 ;agctgctgcaccatattcctgaacCTTTCATTCTGCTCAAGTCTTCGCC gta 7 ;agctgctgcaccatattcctgaacCCGGCCTCTGGCGTTCTACTCA teg δ ;agctgctgcaccatattcctgaacTTGCACAAGGTAAGTTTATTCTAGCTT teg

9 gagctgctgcaccatattcctgaacCCTGAATATCAGGTAGGAATGTTTGT teg

10 gagctgctgcaccatattcctgaacACAAAGGCAGCCTTTCATACCTTAG gta

11 gagctgctgcaccatattcctgaacCAAACCTTACAGCATCGATAAGTTTC teg

12 gagctgctgcaccatattcctgaacGCGGTGGGCGCGCAGTGCGTTCTC teg

13 gagctgctgcaccatattcctgaacCCAGGGTAAGGGAGAGGGCCACA gta

14 gagctgctgcaccatattcctgaacATATGTTCCCTTCCTGAATTTGTCTAA gta

15 gagctgctgcaccatattcctgaacAAAAGCCTAAGAACTCTAAGCATTGC gta

16 gagctgctgcaccatattcctgaacGAACACTGCCCTCGCACGGCCCC gta

17 gagctgctgcaccatattcctgaacCAGCTAGAGATAGGGGAAGTGTATA gta

18 gagctgctgcaccatattcctgaacCTTCCACTCTCAAAGGGCTTCTGAT teg

19 ;agctgctgcaccatattcctgaacTGGATTCTGAATGTGCTTAATTTAAAAG teg

20 gagctgctgcaccatattcctgaacCTAATTCTGTTTCATTTCTATAGGCGA gta

21 gagctgctgcaccatattcctgaacCTTCCCTCTCCTCAGCGCCTAAGAG gta

22 ;agctgctgcaccatattcctgaacGTGAGAATCCCTGAGCCCAGGCGGT gta

23 gagctgctgcaccatattcctgaacGGCACCTTTCCTCTAATCCAGCAAA gta

24 gagctgctgcaccatattcctgaacCATTTCAAGGCAGTTTTTAAAGAAGTC gta

25 gagctgctgcaccatattcctgaacCTAGGACTCCTGCTAAGCTCTCCT teg

26 ;agctgctgcaccatattcctgaacGTTTCAAAGCGCCAGTCATTTGCTC teg

27 gagctgctgcaccatattcctgaacGGAGCTGCTGGTGCAGGGGCCACG teg

28 gagctgctgcaccatattcctgaacGTGCCTGGACATTTGCCTTGCTGGA teg

29 gagctgctgcaccatattcctgaacGTGTGAGAGAAAAGAATGGAATAAGC gta

30 gagctgctgcaccatattcctgaacTTCCAATGTCCCCCGGTTGGAGTC teg

31 gagctgctgcaccatattcctgaacGGTGGAGCCACACGAAGCGGTG teg

32 gagctgctgcaccatattcctgaacAGGCAGGGCAGGTCCAGGCCCTGC gta

33 gagctgctgcaccatattcctgaacGAGGTATCAGAGGTAATAAATATTCTAT gta

34 gagctgctgcaccatattcctgaacCTCCCCCACCCCGCTTCACTCTG teg

35 gagctgctgcaccatattcctgaacTCCCCGCCTGGGGAAGGAGAGGCC teg

36 gagctgctgcaccatattcctgaacGAATTCATCGGACATGTTACTGTTTTT teg

37 gagctgctgcaccatattcctgaacTAAAGTTTGGTCCCTTTCGCTCCG teg

38 gagctgctgcaccatattcctgaacGTCAGGATTGCTGGTGTTATATTCTG gta

39 gagctgctgcaccatattcctgaacGTTTGATTCACCTTTGAGCACTCTTA gta

40 gagctgctgcaccatattcctgaacATTCCTCTGGTATTTTCTAAAACAGAAA gta

41 gagctgctgcaccatattcctgaacCTAGCTGGCCTTATTCTACTGACTT teg

42 gagctgctgcaccatattcctgaacGTACTGGACGTTGATGCCACTGAA teg

43 gagctgctgcaccatattcctgaacAGAAAGTGAGGACAGACAGAAGGC gta

44 gagctgctgcaccatattcctgaacCATCTGCAGTCCCTGGGGGCCA teg

45 gagctgctgcaccatattcctgaacGGATGGCGAGGCAGCAGGGGCA teg

46 gagctgctgcaccatattcctgaacTGCGTCGGCGGCTGCCCTCCC gta

47 gagctgctgcaccatattcctgaacGATTCTCACGACTCTACCATGTCCA gta

SNP

Extension Primer 5' ->3 3-dNTP

48 gagctgctgcaccatattcctgaacGGAGGGCTGGGAGTCCGGAATG teg gagctgctgcaccatattcctgaacCCAGTCCTGTCATGTCAGGGTTG gta gagctgctgcaccatattcctgaacAGCGGATGGTGGATTTCGCTGGC gta gagctgctgcaccatattcctgaacTTCCTGGCTCCATTTTCTCCACCAG teg gagctgctgcaccatattcctgaacCCTGCCCAGGCTGAGTGCGGA teg gagctgctgcaccatattcctgaacGCGAGGATGTCGTCCACCTCTG teg jagctgctgcaccatattcctgaacTGATGCTTTCGAAGTTTCAGTTGAAC teg gagctgctgcaccatattcctgaacTCGGACCGCATGGGTCGGACAGGT teg gagctgctgcaccatattcctgaacGCAAGCGGTGAGTTTTCAGATGGGCA teg gagctgctgcaccatattcctgaacTTGATATTCTTCATTAGCTTGCCTGAT gta gagctgctgcaccatattcctgaacTGTCTGCTCCAAATATAGCAATGAAG teg gagctgctgcaccatattcctgaacCTGGGGGGTGGCTCAGGGGAGGGTG gta gagctgctgcaccatattcctgaacGTTCTGGCAGGCATTTGGCATCAGC teg gagctgctgcaccatattcctgaacGAGGGCTAAAAAGGTCCTGTAAGAAG teg gagctgctgcaccatattcctgaacCCTTCCCGGTCAGCTACTCCTCTTCC gta gagctgctgcaccatattcctgaacGTCGTTTCCAAGAGAGATCCTTTCTT teg gagctgctgcaccatattcctgaacTGTTTTCACTGTCTTGCTTCTGGTAA teg gagctgctgcaccatattcctgaacGCACAGAAAGACCTGTGTGCTGC teg gagctgctgcaccatattcctgaacCAGGCCATACTCTCCTTTACCATACTA teg gagctgctgcaccatattcctgaacGCTGGACAGGAAGGGAGAATTCTGA teg gagctgctgcaccatattcctgaacGGAGCTGCAGAGGTGTGGGCCCCTG gta gagctgctgcaccatattcctgaacATATTTCAAGAGCTCCCATGTTCAGT gta gagctgctgcaccatattcctgaacTTTTAATAATCGACTTTTTAAATGTGATCA gta gagctgctgcaccatattcctgaacTAGGTAAAAATTATTAAGTGAAATTATTCAT gta gagctgctgcaccatattcctgaacGGCGGGTCTGGGTGCGGCCTGCCGCA gta ;agctgctgcaccatattcctgaacTTTTAGTTTGGTGATAGAACAGCTCTT gta gagctgctgcaccatattcctgaacGGCCAGGACCAGTTGGGC AACAAAAT gta gagctgctgcaccatattcctgaacACCAGAGAGGCTCTGAGAAACCTC teg

Table 3.

SNP

5'-PhosphoryIated Primer 5' >3'

1 AGAGTCAAGTTATTTAAAAAATCTGGCCgctctgaaggcggtgtatgacatgg

2 ^CACTTACATACTTGTCCCTCTAAGgctctgaaggcggtgtatgacatgg

3 :CTGGTTACTATTATTAAAGAATTTCTCgctctgaaggcggtgtatgacatgg

4 CTGCTTATCTGACAACCCTCAGATCgctctgaaggcggtgtatgacatgg

5 ATGGATGGCTGCTGGAAACCCCTgctctgaaggcggtgtatgacatgg

6 ^CGATCCCTATCTACTTTCTCTCCgctctgaaggcggtgtatgacatgg

7 ACCTCTTTGTCCTGCAGCAGTTTTCgctctgaaggcggtgtatgacatgg

8 ATTTTGTGGTGAAAGTGCCTAAATTTGgctctgaaggcggtgtatgacatgg

9 ATCGCGCTCCCTGAGGATACTCAgctctgaaggcggtgtatgacatgg

10 :CAGCTTCCCAGAAGTTGTGCATAgctctgaaggcggtgtatgacatgg

11 AAAGAAACCAATGTTTGCAAAGTAGATAgctctgaaggcggtgtatgacatgg

12 AGGGCAGCTGTTCCGCCTGCGATgctctgaaggcggtgtatgacatgg

13 :CTTGGAGTTTGAAAGACAAAGGGAgctctgaaggcggtgtatgacatgg

14 CTGAGTTGGGGGGTGGTTGCTGgctctgaaggcggtgtatgacatgg

15 :GCCAAGTTTGAAGGAACTCGAATTgctctgaaggcggtgtatgacatgg

16 ^CCCCACATTTGTGCCGACACTGTTgctctgaaggcggtgtatgacatgg

17 CCCAATGCTTCCAAAGAGGAAAGGgctctgaaggcggtgtatgacatgg

18 ACATTTGAATCTAATGGATCAGTATCATgctctgaaggcggtgtatgacatgg

19 ATTTTTACAAAGTGATCGAAAGTTTTATCgctctgaaggcggtgtatgacatgg

20 :ATGATCAGGAAGGCCGGGTGATgctctgaaggcggtgtatgacatgg

21 :CCAGTGCGGGTGAGGAGTCGCGAgctctgaaggcggtgtatgacatgg

22 :CAGGAGGTGTCTGGACTGGCTGGgctctgaaggcggtgtatgacatgg

23 :CCTGCACACCAGAGACAAGCAGgctctgaaggcggtgtatgacatgg

24 ^GACGGCGGCACCTTTCCTCTgctctgaaggcggtgtatgacatgg

25 ACGCTTTTGCTAAAAACAGCAGAACTgctctgaaggcggtgtatgacatgg

26 AAATCCAGGAAATGCAGAAGAGGAATgctctgaaggcggtgtatgacatgg

27 AGCAGCCTCTGGCATTCTGGGAGCTgctctgaaggcggtgtatgacatgg

28 ACTGGGGATGTGGGAGGGAGCAGAgctctgaaggcggtgtatgacatgg

29 :TGCCATGCTCAGAGAATCCTAGAgctctgaaggcggtgtatgacatgg

30 ATCTGCAATGCTCCAGAGGGCAAGAgctctgaaggcggtgtatgacatgg

31 AATTAGTGGTCGGATTTCCAAAGACAgctctgaaggcggtgtatgacatgg

32 ^TGAGTGCCGGGGACGTACAGTGGCgctctgaaggcggtgtatgacatgg

33 :AATAAGGTTTCTCAAGGGGCTGGgctctgaaggcggtgtatgacatgg

34 ACTGGAGCCCCACAGCCCCCACgctctgaaggcggtgtatgacatgg

35 AGCGGCGGCACGGCCGCCTTCGgctctgaaggcggtgtatgacatgg

36 ATGTACCACCAACTTTACGTTTGCATgctctgaaggcggtgtatgacatgg

37 AAAATGCTCTAACGGCAGGAGGTCgctctgaaggcggtgtatgacatgg

38 CAAAACAAGGAGAGAAGGAGTTGGAgctctgaaggcggtgtatgacatgg

39 CAGAAGAGGCGTAACTGGTTACAAAgctctgaaggcggtgtatgacatgg

40 CATCAACTTTGTGTATCTATTCAGAAAAgctctgaaggcggtgtatgacatgg

41 AAGGCTGCTCCAGCCAGCACTGgctctgaaggcggtgtatgacatgg

42 AGTTTTCCACACAGACTTTCCCGATgctctgaaggcggtgtatgacatgg

43 CACCATGTCACCCTCAGGCGTGgctctgaaggcggtgtatgacatgg

44 AGCTGAGCAGTGCCTTCCAGAGCgctctgaaggcggtgtatgacatgg

45 AGCTTGGGATGCCCTAGGAAGGGgctctgaaggcggtgtatgacatgg

46 CCTCACACGCCAACCCTGCTCCTgctctgaaggcggtgtatgacatgg

47 CAGAGATCGTTCCTATACATTTCTGTgctctgaaggcggtgtatgacatgg

SNP

5^T-Phosphorylated Primer 5^? >3*

48 AGTTGTGGGGCCCAGACTCCTAGgctctgaaggcggtgtatgacatgg 49 CTCAGGGGAAAATATGAGGGGCACgctctgaaggcggtgtatgacatgg 50 :AAGGTGTGCATGCCTGACCCGTgctctgaaggcggtgtatgacatgg 51 AATACATGAGCCAGACCCGCAGCTTgctctgaaggcggtgtatgacatgg 52 AGAGCTCCACCGAGGGGTGGGgctctgaaggcggtgtatgacatgg 53 ACCTTGGACACCGGGACAAAGGTgctctgaaggcggtgtatgacatgg 54 AAAAAGTTTCTTTAAATGTAAGAGCAGGgctctgaaggcggtgtatgacatgg 55 ATCTAAGTGGGACAAGTTGACCCAGGgctctgaaggcggtgtatgacatgg 56 AGAAGTGCATGTCCAGTGCCTGGCgctctgaaggcggtgtatgacatgg 57 CCATAGTAGAAACACATCAGTACTGAgctctgaaggcggtgtatgacatgg 58 ACCCTCAACCTCTGCTGTCAAAGTgctctgaaggcggtgtatgacatgg 59 "AGGCGGTTCAAGCCGTTGGCTGGAgctctgaaggcggtgtatgacatgg 60 ACTCGTCCACATCCTCGGTACAGTAgctctgaaggcggtgtatgacatgg 61 ATAGCACCCGTGGTGCATGGTATGgctctgaaggcggtgtatgacatgg 62 CCCGCCGGCCCTCGCTGGACTCCAgctctgaaggcggtgtatgacatgg 63 ATACACATCTGTACTGGGAGCTTGGgctctgaaggcggtgtatgacatgg 64 ACCAGGTGTGGAATTCGAGTTCCTgctctgaaggcggtgtatgacatgg 65 ACTCACATTCAGTACATTTGGGTTCCgctctgaaggcggtgtatgacatgg 66 ACTGGACTCAGGCTGGAGGCAGAgctctgaaggcggtgtatgacatgg 67 AACATGCAGCGAAGTATCATGTGAGgctctgaaggcggtgtatgacatgg 68 CCCAGAAGTCCAGCCACTGGGCTCCgctctgaaggcggtgtatgacatgg 69 CCTGGAGAAGGAAAGCTCTTTTTGTgctctgaaggcggtgtatgacatgg 70 CTATAATATTGTACAGTTATTATAGGGCgctctgaaggcggtgtatgacatgg 71 CTTTCAGTTTCATCTTTCTCCTGGGgctctgaaggcggtgtatgacatgg 72 CTCGTGGTTCGGAGGCCCACGTGGCgctctgaaggcggtgtatgacatgg 73 CATGAGTACGTATCTTTTCTTTTAAAAGgctctgaaggcggtgtatgacatgg 74 CTGGGCACTTGCTGCCAGTACTGGGgctctgaaggcggtgtatgacatgg 75 AAACTTAGATCATCAGTCACCGAAGGTgctctgaaggcggtgtatgacatgg

Genotyping (PrASE) primer one

SNP

1 rs3021094_l_A_LT2 gcagatcaattaatacgatacctgcgATTTTTTAAATAACTTGACTCTGAGGA 2 rs6166_2_T_LT4 ttagtctccgacggcaggcttcaatGG ACAAGTATGTAAGTGGAACCAT 3 rs 1800587_3_C_LT6 cctggtggttgactgatcaccataaCTTTAATAATAGTAACCAGGCAACAC

4 rs2286940_4_C_LT8 gctagatgaagagcaagcgcatggaGGGTTGTCAGATAAGCAGTCTACC 5 rs2254514_5_G_LT10 ttcaatctggtctgacctccttgtgTTCCAGCAGCCATCCATCCACG 6 rs 1042124_6_C_LT12 ttgaagttcgcagaatcgtatgtgtGAAAGTAGATAGGGATCGGACACC 7 rs 1295686_7_A_LT14 ggcaactcatgcaattattgtgagcGCAGGACAAAGAGGTCAGCACA rsl72520_8_G_LT16 aagcagtctgtcagtcagtgcgtgaaGGCACTTTCACCACAAAATGAAAGG

9 rs998074_9_A_LTl 8 aatacacgaaggagttagctgatgcCCTCAGGGAGCGCGATGAGGA

10 rs 1998206_l 0_A_LT20 gcggaacggtcagagagattgatgtAACTTCTGGGAAGCTGGACTTATA

11 rs2301635_l l_G_LT22 ttacctatgattgatcgtggtgatatccgTTGCAAACATTGGTTTCTTTAGGCG

12 rs3824120_12_A_LT24 tgacgtcattgtaggcggagagctaGGAACAGCTGCCCTCCACACA 13 rs 17658_13_T_LT26 ttatcggctacatcggtactgactcGTCTTTCAAACTCCAAGGTTCCCT 14 rsl 111350_14_T_LT28 ggcgtaccttcgcggcagatataatCCACCCCCCAACTCAGCCTTT 15 rs2228527_l 5_T_LT30 gttgtgctgaattaagcgaataccgGTTCCTTCAAACTTGGCGTCTCT 16 rs2235128_16_T_LT32 aagaggcggcgcttactaccgattcGGCACAAATGTGGGGGCCCTTT 17 rs2227973_17_T_LT34 aagaagagtcaatcgcagacaacatCCTCTTTGGAAGCATTGGGATTCT 18 rs 144848_18_C_LT36 aaggtactgcaagtgctcgcaacatTGATCCATTAGATTCAAATGTAGCAC 19 rs4151539_19_C_LT38 aacctaacattgattcaggtacaggTTTCGATCACTTTGTAAAAATC AAAGC 20 rs3136820_20_C_LT40 atatgttatctgccacgccgattatGCCTTCCTGATCATGCTCCTCC 21 rsl 1636097_21_T_LT42 catcgtcaacgacgttctcatggttCTCACCCGCACTGGGCCTCT 22 rs3212363_22_T_LT44 gccatcgctggactatcgaagagtgGTCCAGACACCTCCTGGCATCT 23 rs2523_23_C_LT46 gaacgcaatattcacaagcaatgcgGTCTCTGGTGTGCAGGGAATCAC 24 rs6949_24_T_LT48 gcagaactgatgagcgatccgaataGGTGCCGCCGTCTGTTTCCAT 25 rsl6942_25_A_LT50 gtgtggcgagacagcgacgaagtatCTGTTTTTAGCAAAAGCGTCCAGAA 26 rs799917_26_G_LT52 aaggagattatgtaccgaggaagaaTCTGCATTTCCTGGATTTGAAAACG 27 rs 1042522_27_C_LT54 ttgagaaggaagatatcctcgcatggAATGCCAG AGGCTGCTCCCCC 28 rsl042658_28_G_LT56 ggatataccgctcaccgtattgcagCTCCCACATCCCCAGTCCCCG 29 rsl799950_29_T_LT58 ttgcggagctattagagcttatacaGATTCTCTGAGCATGGCAGTTTCT 30 rs2229080_30_C_LT60 ggcctgcttaggtgacgtctctcgtCTCTGGAGCATTGCAGATCAGCC 31 rs4987843_31_A_LT62 aagatgaccatctacattactgagcGAAATCCGACCACTAATTGCCAAA 32 rsl07288_32_C_LT64 aacgtcagcgagctggttgatatggCGTCCCCGGCACTCAGCACAC 33 rs3024496_33_C_LT66 aacatcgccgcacagatggttaacttTGAGAAACCTTATTGTACCTCTCTC 34 rs3765713_34_A_LT69 aatatgctgcttgaggcttattcggGTGGGGCTCCAGTCAGAACGAA 35 rs 1042821_35_G_LT71 aatccagatggagttctgaggtcatGTGCCGCCGCTGCCCCCGG 36 rs2229571_36_C_LT73 tctacgaatcgagagtgcgttgcttAAGTTGGTGGTACATCAGGGAGC 37 rs3136228_37_C_LT76 cacttctaagtgacggctgcatactCGTTAGAGCATTTTCGCAAGGAGC 38 rsl l466512_38_T_LT78 aatgattcgtcatctgcgaggctgtTCTCTCCTTGTTTTGTTTCCCCAT 39 rs3185733_39_C_LT80 atggttcctgcatatgatgacaatgGTTACGCCTCTTCTGTAAACTCTC 40 rs2302473_40_C_LT82 gcatatatgaatgaacgatgcagagATAGATACACAAAGTTGATGTATTAAAC 41 rs6185_41_C_LT84 ttatgtcaacaccgccagagataatTGGAGCAGCCTTCCACGCACC 42 rs 1800860_42_AJLT86 ttgtgcatccatctggattctcctgCTGTGTGGAAAACTGCCAGGCA 43 rs670984_43_C_LT88 ttaaccacatcaggctcggtggttctGGGTGACATGGTGCCCTCACC 44 rs861539__44_G_LT90 cactcaggcggccttgatagtcataCACTGCTCAGCTCACGCAGCG 45 rs2296313_45_A_LT92 caatggcatattgcatggtgtgctcGCATCCCAAGCTCCCAGGGGA 46 rs25487_46_T_LT94 catgtcgtctgccagttctgcctctGGCGTGTGAGGCCTTACCTCT 47 rsl051690 47 T LT96 ttcatcgttaaccggagtgatgtcgATAGGAACGATCTCTGAACTCCAT

S]SP Genotyping (PrASE) primer one

48 rs3817074_48_G_LT98 ggtacgctgcaggataatgtccggtGGCCCCACAACTCAGCGCAAG 49 rs819136_49_T_LT 100 acataatgcaggccttcacgcttcaTATTTTCCCCTGAGCCTTCATTCT 50 rs4680_50_T_LT102 ttactgataagttccagatcctcctGGCATGCACACCTTGTCCTTCAT 51 rs875233_51_G_LT104 gtcttgttcgattaactgccgcagaaGGGTCTGGCTCATGTATTCGGG 52 rs3765702_52_G_LT106 gccagcgtcagacatcatatgcagatacTGGAGCTCTGAGACCGAGCCG 53 rs3210400_53_A_LT108 tgtatgccgactctatatctataccTGTCCAAGGTGAGCGGGCAGA 54 rs20541_54_G_LTl 10 caattcgaatattggttacgtctgcAAAGAAACTTTTTCGCGAGGGACG 55 rsl799971_55_A_LT112 attatcactgttgattctcgctgtcCAACTTGTCCCACTTAGATGGCA 56 rs2282140_56_G_LT114 cctcgtctatgtatccattgagcattCACTGGACATGCACTTCTCCCG 57 rsl035972_57_T_LT116 caagtactaataagccgatagatagccGTTTCTACTATGGCCCATTATTCTT 58 rslO3612_58_G_LTl 18 gctggcagcattcttgagtccaataGGTTGAGGGTGGGAAGGAGGG 59 rs2236405_59_T_LT120 aacggttcgaccttctaatcctatcCGGCTTGAACCGCCTGCCCT 60 rsl l574885_60_A_LT122 ttgtcaggttaccaactactaaggtCGAGGATGTGGACGAGTGCCA 61 rsl7731_61_A_LT124 ttgctaggcactgatacataactctTGCACCACGGGTGCTATGCCA 62 rsl799939_62_T_LT126 ctatgtgccggagcggacattacaaGCGAGGGCCGGCGGGCACT 63 rsl884929_63_G_LT128 ggaatatcagaagtggaacggcacaTCCCAGTACAGATGTGTATGGCG 64 rs425321 l_64_C_LT130 ggtgcacatgcgcatacagttggtaCCACACCTGGTGAAGAAAAGGCC 65 rsl057992_65_A_LT132 cagcggtcgtgctgtattgtctcagTGAATGTGAGTCCACACCAACCA 66 rs 1052536_66_G_LT 134 gtcacctgacgcactgaatacgctgCTCCAGCCTGAGTCC AGTCCAG 67 rs20579_67_G_LT136 aagatatagcttcagctgtcgcgcttTGATACTTCGCTGCATGTTGGCG 68 rsl805419_68_T_LT138 cagtggcgtggagtgcaggtatacagGTGGCTGGACTTCTGGGTCCT 69 rs8679_69_C_LT140 cactatgagagcctgcgtggacgttAAAGAGCTTTCCTTCTCCAGGAAC 70 rsl0847_70_T_LT142 ggaagtaagcgtactgtcagcggcaCTATAATAACTGTACAATATTATAGTCT 71 rsl4804_71_C_LT144 aacgctctggtcgtcatacactgaaAGGAGAAAGATGAAACTGAAAGCAC 72 rs2273267_72_T_LT146 gattgaaggtccggtggatggcttaGGGCCTCCGAACCACGAGTCT 73 rs3830035_73_T_LT148 ttctctcggtgccagtatggtgctcTAAAAGAAAAGATACGTACTCATGAAT 74 rs2735842_74_T_LT151 atcgtgaggatgactggtggcgtaaACTGGCAGCAAGTGCCCAGTAT 75 rsl l515_75_C_LT154 agattgcgtccatcagccagagtgtGGTGACTGATGATCTAAGTTTCCC

Table 5.

SNP Genoiyptog (PrASE) primer two

1 rs3021094_l_C_LT3 ggttctgttcttcgttgacatgaggATTTTTTAAATAACTTGACTCTGAGGC 2 rs6166_2_C_LT5 ctgtgacagagccaacacgcagtctGGACAAGTATGTAAGTGGAACCAC 3 rs 1800587_3_T_LT7 gcatgtatagaacataaggtgtctcCTTTAATAATAGTAACCAGGCAACAT 4 rs2286940_4_T_LT9 tacaaccgacagatgtatgtaaggcGGGTTGTCAGATAAGCAGTCTACT 5 ^■s2254514_5_A_LTl l acacgatgtgaatattatctgtggcTTCCAGCAGCCATCCATCCACA 6 ^■sl042124_6_A_LT13 aacgtctgttgagcacatcctgtaaGAAAGTAGATAGGGATCGGACACA 7 ^■sl295686_7_G_LT15 ccagaagtatattaatgagcagtgcagGCAGGACAAAGAGGTCAGCACG 8 rs 172520_8_A_LT 17 aatgatgctctgcgtgatgatgttgGGCACTTTCACCACAAAATGAAAG A rs998074_9_G_LT 19 gctgttaatcattaccgtgataacgccCCTCAGGGAGCGCGATGAGGG

10 rs 1998206_l 0_C_LT21 gttatggtcagttcgagcataaggcAACTTCTGGGAAGCTGGACTTATC 11 rs2301635_l l_A_LT23 gctgtggcattgcagcagattaaggTTGCAAACATTGGTTTCTTTAGGCA

12 rs3824120_12_C_LT25 tcaataatcaacgtaaggcgttcctGGAACAGCTGCCCTCCACACC 13 rs 17658_13_C_LT27 ccattatcgcctggttcartcgtgaGTCTTTCAAACTCC AAGGTTCCCC 14 rsl 111350_14_C_LT29 aactgagccgtagccactgtctgtccCCACCCCCCAACTCAGCCTTC 15 rs2228527_l 5_C_LT31 ttatatctgcacaacaggtaagagcGTTCCTTCAAACTTGGCGTCTCC 16 rs2235128_16_C_LT33 cggtcacacgttagcagcatgattgGGCACAAATGTGGGGGCCCTTC 17 rs2227973_17_C_LT35 catatcgcgctgtgacgatgctaatCCTCTTTGGAAGCATTGGGATTCC 18 rsl44848_18_A_LT37 ctgcattctgcggtaagcacgaactTGATCCATTAGATTCAAATGTAGCAA 19 rs4151539_19_G_LT39 cagttgatcatcagcaggtaatctggTTTCGATCACTTTGTAAAAATCAAAGG 20 rs3136820_20_A_LT41 aactggatacgattggattcgacaaGCCTTCCTGATCATGCTCCTCA 21 rsl l636097_21_C_LT43 ccattccagacatgctcgttgaagcCTCACCCGCACTGGGCCTCC 22 rs3212363_22_A_LT45 atctcgttccgtatcgcgtcgaactGTCCAGACACCTCCTGGCATCA 23 s2523_23_T__LT47 aagagaccgcgacttaccatgtatcGTCTCTGGTGTGCAGGGAATCAT 24 ^•s6949_24_A_LT49 aaccttcaactacacggctcacctgGGTGCCGCCGTCTGTTTCCAA 25 s 16942_25_G_LT51 cctgtatcaggacatggtacgagctaCTGTTTTTAGC AAAAGCGTCC AGAG 26 ^■s799917_26_A_LT53 aataccggaacatctcggtaactgcTCTGCATTTCCTGGATTTGAAAACA 27 rs 1042522_27_G_LT55 ggaattacaccacgtggattggcatcAATGCCAGAGGCTGCTCCCCG 28 rsl042658_28_A_LT57 tcatggatacaggttgtgaacatccaaCTCCCACATCCCCAGTCCCCA 29 rs 1799950_29_C_LT59 ttgtggtaataggccagtcaaccagGATTCTCTGAGCATGGCAGTTTCC 30 rs2229080_30_G_LT61 aaccaatcgtagtaaccattcaggaCTCTGGAGCATTGCAGATCAGCG 31 rs4987843_31_G_LT63 cgcagatgagcttgtccatatgactgGAAATCCGACCACTAATTGCCAAG 32 rsl07288_32_T_LT65 gagcctggctaaccgtgaccagaacCGTCCCCGGCACTCAGCACAT 33 rs3024496_33_T_LT67 agaattctggcgaatcctctgaccaTGAGAAACCTTATTGTACCTCTCTT 34 rs3765713_34_G_LT70 aatactcaacttcggcagaggtaacGTGGGGCTCCAGTCAGAACGAG 35 rsl042821_35_A_LT72 aatcgcaatgcttggaactgagaagGTGCCGCCGCTGCCCCCGA 36 rs2229571_36_G_LT74 atctaacaccgtgcgtgttgactatAAGTTGGTGGTACATCAGGGAGG 37 rs3136228_37_A_LT77 tcttctgaaccagactcttgtcattCGTTAGAGCATTTTCGCAAGGAGA 38 rsl l466512_38_A_LT79 cctcatcagtggctctatctgaacgTCTCTCCTTGTTTTGTTTCCCCAA 39 rs3185733_39_A_LT81 ggtatcatgtagccgcttatgctggaGTTACGCCTCTTCTGTAAACTCTA 40 rs2302473_40_T_LT83 ttggtaggtgagagatctgaattgcATAGATACACAAAGTTGATGTATTAAAT 41 rs6185_41_G_LT85 gtgcgtcctgctgatgtgctcagtatTGGAGCAGCCTTCCACGCACG 42 rs 1800860_42_G_LT87 aatggatccactcgttattctcggaCTGTGTGGAAAACTGCCAGGCG 43 rs670984_43_T_LT89 aattgctataagcagagcatgttgcgGGGTGACATGGTGCCCTCACT 44 rs861539_44_A_LT91 acgcctcgagtgaagcgttattggtCACTGCTCAGCTCACGCAGCA 45 rs2296313_45_C_LT93 gctctgagcctcaagacgatcctgaatGCATCCCAAGCTCCCAGGGGC 46 rs25487_46_C_LT95 tacctctgaatcaatatcaacctggGGCGTGTGAGGCCTTACCTCC 47 rsl051690 47 C LT97 ggaacagagcggcaataagtcgtcaATAGGAACGATCTCTGAACTCCAC

SNP Genotyping (PrASE) primer two

48 rs3817074_48_A_LT99 ctgttcgacagctctcacatcgatccGGCCCCACAACTCAGCGCAAA 49 rs819136_49_C_LT101 ttcgcggtgcttcttcagtacgctaTATTTTCCCCTGAGCCTTCATTCC 50 rs4680_50_C_LTl 03 ttcgctcacttcgaacctctctgttGGCATGCACACCTTGTCCTTCAC 51 rs875233_51_A_LT105 ccgtaatagcgatgcgtaatgatgtGGGTCTGGCTCATGTATTCGGA

52 rs3765702_52_A_LT107 ttgagtacggtcatcatctgacactTGGAGCTCTGAGACCGAGCCA 53 rs3210400_53_G_LTl 09 ccatatcatccagtggtcgtagcagTGTCCAAGGTGAGCGGGCAGG 54 rs20541_54_A_LTl 11 ataactcaatgttggcctgtatagcAAAGAAACTTTTTCGCGAGGGACA 55 rsl799971_55_G_LT113 ttcgtagcgatcaagccatgaatgtCAACTTGTCCCACTTAGATGGCG 56 rs2282140_56_A_LT115 ttccttcattgatattccgagagcaCACTGGACATGCACTTCTCCCA 57 rs 1035972_57_C_LT117 ttaacacacgtgcgaactgtccatgaGTTTCTACTATGGCCCATTATTCTC 58 rslO3612_58_A_LTl 19 ttattgcttctcttgaccgtaggacGGTTGAGGGTGGGAAGGAGGA 59 rs2236405_59_A_LT121 actgacctgtcgagcttaatattctCGGCTTGAACCGCCTGCCCA 60 rsl l574885_60_G_LT123 ggatgaatcgcttggtgtacctcatCGAGGATGTGGACGAGTGCCG 61 rsl7731_61_G_LT125 aagtattcgttcacttccgataagcTGCACCACGGGTGCTATGCCG 62 rsl799939_62_C_LT127 tcgttgctggaagcctggaagaagtaGCGAGGGCCGGCGGGCACC 63 rsl884929_63_A_LT129 ttataatctgctggccggaactaatTCCCAGTACAGATGTGTATGGCA 64 rs4253211_64_G_LT131 ctcacagtctgagcggttcaacaggCCACACCTGGTGAAGAAAAGGCG 65 rsl057992_65_C_LT133 ctaccaccatgactaacgcgcttgcTGAATGTGAGTCCACACCAACCC 66 rsl052536_66_A_LT135 gtactggccgcgattgcagatgttaCTCCAGCCTGAGTCCAGTCCAA 67 rs20579_67_A_LT137 ggcgttacagcatggatgtggagtaTGATACTTCGCTGCATGTTGGCA 68 rsl805419_68_C_LT139 ggtggtccggcagtacaatggattaGTGGCTGGACTTCTGGGTCCC 69 rs8679_69_T_LT141 ggattaacgtgaagtaccgttatgaAAAGAGCTTTCCTTCTCCAGGAAT 70 rsl0847_70_C_LT143 aaccagcacgcgttatcttggtacgCTATAATAACTGTACAATATTATAGTCC 71 rsl4804_71_T_LT145 ggaataccaacatatccggtgtcacgAGGAGAAAGATGAAACTGAAAGCAT 72 rs2273267_72_A_LT147 gaagcgaaggacaacctgaagtccaGGGCCTCCGAACCACGAGTCA 73 rs3830035_73_C_LT149 gcgcagttacatgagactctgcctgaTAAAAGAAAAGATACGTACTCATGAAC 74 rs2735842_74_C_LT153 tgaataacgtcatgtcagagcagaaACTGGCAGCAAGTGCCCAGTAC 75 rsl 1515_75_G_LT155 cgagtcactcagcgcactggttaagGGTGACTGATGATCTAAGTTTCCG

Table 6. Sequence of the tags on the chip

LT2 spotTTTTTTTTTTTTTTTCGCAGGTATCGTATTAATTGATCTGC

LT3 spotTTTTTTTTTTTTTTTCCTCATGTCAACGAAGAACAGAACC

LT4 spotTTTTTTTTTTTTTTTATTGAAGCCTGCCGTCGGAGACTAA

LT5 spotTTTTTTTTTTTTTTTAGACTGCGTGTTGGCTCTGTCACAG

LT6 spotTTTTTTTTTTTTTTTTTATGGTGATCAGTCAACCACCAGG

LT7 spotTTTTTTTTTTTTTTTGAGACACCTTATGTTCTATACATGC

LT8 spotTTTTTTTTTTTTTTTTCCATGCGCTTGCTCTTCATCTAGC

LT9 spotTTTTTTTTTTTTTTTGCCTTACATACATCTGTCGGTTGTA LTlO spot TTTTTTTTTTTTTTTCACAAGGAGGTCAGACCAGATTGAA

LTl 1 spot TTTTTTTTTTTTTTTGCCACAGATAATATTCACATCGTGT

LT12 spot TTTTTTTTTTTTTTTACACATACGATTCTGCGAACTTCAA

LT13 spot TTTTTTTTTTTTTTTTTACAGGATGTGCTCAACAGACGTT

LT14 spot TTTTTTTTTTTTTTTGCTCACAATAATTGCATGAGTTGCC

LTl 5 spot TTTTTTTTTTTTTTTCTGCACTGCTCATTAATATACTTCTGG

LT 16 spot TTTTTTTTTTTTTTTTTCACGCACTGACTGACAGACTGCTT

LTl 7 spot TTTTTTTTTTTTTTTCAACATCATCACGCAGAGCATCATT

LT 18 spot TTTTTTTTTTTTTTTGCATCAGCTAACTCCTTCGTGTATT

LT19 spot TTTTTTTTTTTTTTTGGCGTTATCACGGTAATGATTAACAGC

LT20 spot TTTTTTTTTTTTTTTACATCAATCTCTCTGACCGTTCCGC

LT21 spot TTTTTTTTTTTTTTTGCCTTATGCTCGAACTGACCATAAC

LT22 spot TTTTTTTTTTTTTTTCGGATATCACCACGATCAATCATAGGTAA

LT23 spot TTTTTTTTTTTTTTTCCTTAATCTGCTGCAATGCCACAGC

LT24 spot TTTTTTTTTTTTTTTTAGCTCTCCGCCTACAATGACGTCA

LT25 spot TTTTTTTTTTTTTTTAGGAACGCCTTACGTTGATTATTGA

LT26 spot TTTTTTTTTTTTTTTGAGTCAGTACCGATGTAGCCGATAA

LT27 spot TTTTTTTTTTTTTTTTCACGAATGAACCAGGCGATAATGG

LT28 spot TTTTTTTTTTTTTTTATTATATCTGCCGCGAAGGTACGCC

LT29 spot TTTTTTTTTTTTTTTGGACAGACAGTGGCTACGGCTCAGTT

LT30 spot TTTTTTTTTTTTTTTCGGTATTCGCTTAATTCAGCACAAC

LT31 spot TTTTTTTTTTTTTTTGCTCTTACCTGTTGTGCAGATATAA

LT32 spot TTTTTTTTTTTTTTTGAATCGGTAGTAAGCGCCGCCTCTT

LT33 spot TTTTTTTTTTTTTTTCAATCATGCTGCTAACGTGTGACCG

LT34 spot TTTTTTTTTTTTTTTATGTTGTCTGCGATTGACTCTTCTT

LT35 spot TTTTTTTTTTTTTTTATTAGCATCGTCACAGCGCGATATG

LT36 spot TTTTTTTTTTTTTTTATGTTGCGAGCACTTGCAGTACCTT

LT37 spot TTTTTTTTTTTTTTTAGTTCGTGCTTACCGCAGAATGCAG

LT38 spot TTTTTTTTTTTTTTTCCTGTACCTGAATCAATGTTAGGTT

LT39 spot TTTTTTTTTTTTTTTCCAGATTACCTGCTGATGATCAACTG

LT40 spot TTTTTTTTTTTTTTTATAATCGGCGTGGCAGATAACATAT

LT41 spot TTTTTTTTTTTTTTTTTGTCGAATCCAATCGTATCCAGTT

LT42 spot TTTTTTTTTTTTTTTAACCATGAGAACGTCGTTGACGATG

LT43 spot TTTTTTTTTTTTTTTGCTTCAACGAGCATGTCTGGAATGG

LT44 spot TTTTTTTTTTTTTTTCACTCTTCGATAGTCCAGCGATGGC

LT45 spot TTTTTTTTTTTTTTTAGTTCGACGCGATACGGAACGAGAT

LT46 spot TTTTTTTTTTTTTTTCGCATTGCTTGTGAATATTGCGTTC

LT47 spot TTTTTTTTTTTTTTTGATACATGGTAAGTCGCGGTCTCTT

LT48 spot TTTTTTTTTTTTTTTTATTCGGATCGCTCATCAGTTCTGC

LT49 spot TTTTTTTTTTTTTTTCAGGTGAGCCGTGTAGTTGAAGGTT

LT50 spot TTTTTTTTTTTTTTTATACTTCGTCGCTGTCTCGCCACAC

LT51 spot TTTTTTTTTTTTTTTTAGCTCGTACCATGTCCTGATACAGG

LT52 spot TTTTTTTTTTTTTTTTTCTTCCTCGGTACATAATCTCCTT

LT53 spot TTTTTTTTTTTTTTTGCAGTTACCGAGATGTTCCGGTATT

LT54 spot TTTTTTTTTTTTTTTCCATGCGAGGATATCTTCCTTCTCAA

LT55 spot TTTTTTTTTTTTTTTGATGCCAATCCACGTGGTGTAATTCC

LT56 spot TTTTTTTTTTTTTTTCTGCAATACGGTGAGCGGTATATCC

LT57 spot TTTTTTTTTTTTTTTTTGGATGTTCACAACCTGTATCCATGA LT58 spot TTTTTTTTTTTTTTTTGTATAAGCTCTAATAGCTCCGCAA

LT59 spot TTTTTTTTTTTTTTTCTGGTTGACTGGCCTATTACCACAA

LT60 spot TTTTTTTTTTTTTTTACGAGAGACGTCACCTAAGCAGGCC

LT61 spot TTTTTTTTTTTTTTTTCCTGAATGGTTACTACGATTGGTT

LT62 spot TTTTTTTTTTTTTTTGCTCAGTAATGTAGATGGTCATCTT

LT63 spot TTTTTTTTTTTTTTTCAGTCATATGGACAAGCTCATCTGCG

LT64 spot TTTTTTTTTTTTTTTCCATATCAACCAGCTCGCTGACGTT

LT65 spot TTTTTTTTTTTTTTTGTTCTGGTCACGGTTAGCCAGGCTC

LT66 spot TTTTTTTTTTTTTTTAAGTTAACCATCTGTGCGGCGATGTT

LT67 spot TTTTTTTTTTTTTTTTGGTCAGAGGATTCGCCAGAATTCT

LT69 spot TTTTTTTTTTTTTTTCCGAATAAGCCTCAAGCAGCATATT

LT70 spot TTTTTTTTTTTTTTTGTTACCTCTGCCGAAGTTGAGTATT

LT71 spot TTTTTTTTTTTTTTTATGACCTCAGAACTCCATCTGGATT

LT72 spot TTTTTTTTTTTTTTTCTTCTCAGTTCCAAGCATTGCGATT

LT73 spot TTTTTTTTTTTTTTTAAGCAACGCACTCTCGATTCGTAGA

LT74 spot TTTTTTTTTTTTTTTATAGTCAACACGCACGGTGTTAGAT

LT76 spot TTTTTTTTTTTTTTTAGTATGCAGCCGTCACTTAGAAGTG

LT77 spot TTTTTTTTTTTTTTTAATGACAAGAGTCTGGTTCAGAAGA

LT78 spot TTTTTTTTTTTTTTTACAGCCTCGCAGATGACGAATCATT

LT79 spot TTTTTTTTTTTTTTTCGTTCAGATAGAGCCACTGATGAGG

LT80 spot TTTTTTTTTTTTTTTCATTGTCATCATATGCAGGAACCAT

LT81 spot TTTTTTTTTTTTTTTTCCAGCATAAGCGGCTACATGATACC

LT82 spot TTTTTTTTTTTTTTTCTCTGCATCGTTCATTCATATATGC

LT83 spot TTTTTTTTTTTTTTTGCAATTCAGATCTCTCACCTACCAA

LT84 spot TTTTTTTTTTTTTTTATTATCTCTGGCGGTGTTGACATAA

LT85 spot TTTTTTTTTTTTTTTATACTGAGCACATCAGCAGGACGCAC

LT86 spot TTTTTTTTTTTTTTTCAGGAGAATCCAGATGGATGCACAA

LT87 spot TTTTTTTTTTTTTTTTCCGAGAATAACGAGTGGATCCATT

LT88 spot TTTTTTTTTTTTTTTAGAACCACCGAGCCTGATGTGGTTAA

LT89 spot TTTTTTTTTTTTTTTCGCAACATGCTCTGCTTATAGCAATT

LT90 spot TTTTTTTTTTTTTTTTATGACTATCAAGGCCGCCTGAGTG

LT91 spot TTTTTTTTTTTTTTTACCAATAACGCTTCACTCGAGGCGT

LT92 spot TTTTTTTTTTTTTTTGAGCACACCATGCAATATGCCATTG

LT93 spot TTTTTTTTTTTTTTTATTCAGGATCGTCTTGAGGCTCAGAGC

LT94 spot TTTTTTTTTTTTTTTAGAGGCAGAACTGGCAGACGACATG

LT95 spot TTTTTTTTTTTTTTTCCAGGTTGATATTGATTCAGAGGTA

LT96 spot TTTTTTTTTTTTTTTCGACATCACTCCGGTTAACGATGAA

LT97 spot TTTTTTTTTTTTTTTTGACGACTTATTGCCGCTCTGTTCC LT98 spot TTTTTTTTTTTTTTTACCGGACATTATCCTGCAGCGTACC

LT99 spot TTTTTTTTTTTTTTTGGATCGATGTGAGAGCTGTCGAACAG LTlOO spot TTTTTTTTTTTTTTTTGAAGCGTGAAGGCCTGCATTATGT LTlOl _.spot TTTTTTTTTTTTTTTTAGCGTACTGAAGAAGCACCGCGAA

LT 102 spot TTTTTTTTTTTTTTTAGGAGGATCTGGAACTTATCAGTAA LT103 spot TTTTTTTTTTTTTTTAACAGAGAGGTTCGAAGTGAGCGAA LT 104 spot TTTTTTTTTTTTTTTTTCTGCGGCAGTTAATCGAACAAGAC

LT 105_.spot TTTTTTTTTTTTTTTACATCATTACGCATCGCTATTACGG LT 106 spot TTTTTTTTTTTTTTTGTATCTGCATATGATGTCTGACGCTGGC LT 107 spot TTTTTTTTTTTTTTTAGTGTCAGATGATGACCGTACTCAA LTl 08 spot TTTTTTTTTTTTTTTGGTATAGATATAGAGTCGGCATACA

LTl 09 spot TTTTTTTTTTTTTTTCTGCTACGACCACTGGATGATATGG

LTI lO spot TTTTTTTTTTTTTTTGCAGACGTAACCAATATTCGAATTG

LT 111 spot TTTTTTTTTTTTTTTGCTATACAGGCCAACATTGAGTTAT

LTl 12 spot TTTTTTTTTTTTTTTGACAGCGAGAATCAACAGTGATAAT

LTl 13 spot TTTTTTTTTTTTTTTACATTCATGGCTTGATCGCTACGAA

LTl 14 spot TTTTTTTTTTTTTTTAATGCTCAATGGATACATAGACGAGG

LTl 15 spot TTTTTTTTTTTTTTTTGCTCTCGGAATATCAATGAAGGAA

LTl 16 spot TTTTTTTTTTTTTTTGGCTATCTATCGGCTTATTAGTACTTG

LTl 17 spot TTTTTTTTTTTTTTTTCATGGACAGTTCGCACGTGTGTTAA

LTl 18 spot TTTTTTTTTTTTTTTTATTGGACTCAAGAATGCTGCCAGC

LTl 19 spot TTTTTTTTTTTTTTTGTCCTACGGTCAAGAGAAGCAATAA

LT120 spot TTTTTTTTTTTTTTTGATAGGATTAGAAGGTCGAACCGTT

LT121 spot TTTTTTTTTTTTTTTAGAATATTAAGCTCGACAGGTCAGT

LT122 spot TTTTTTTTTTTTTTTACCTTAGTAGTTGGTAACCTGACAA

LT 123 spot TTTTTTTTTTTTTTTATGAGGTACACCAAGCGATTCATCC

LT124 spot TTTTTTTTTTTTTTTAGAGTTATGTATCAGTGCCTAGCAA

LT125 spot TTTTTTTTTTTTTTTGCTTATCGGAAGTGAACGAATACTT

LT126 spot TTTTTTTTTTTTTTTTTGTAATGTCCGCTCCGGCACATAG

LT127 spot TTTTTTTTTTTTTTTTACTTCTTCCAGGCTTCCAGCAACGA

LT128 spot TTTTTTTTTTTTTTTTGTGCCGTTCCACTTCTGATATTCC

LT129 spot TTTTTTTTTTTTTTTATTAGTTCCGGCCAGCAGATTATAA

LT130 spot TTTTTTTTTTTTTTTTACCAACTGTATGCGCATGTGCACC

LT131 spot TTTTTTTTTTTTTTTCCTGTTGAACCGCTCAGACTGTGAG

LT132 spot TTTTTTTTTTTTTTTCTGAGACAATACAGCACGACCGCTG

LT133 spot TTTTTTTTTTTTTTTGCAAGCGCGTTAGTCATGGTGGTAG

LTl 34 spot TTTTTTTTTTTTTTTCAGCGTATTCAGTGCGTCAGGTGAC

LT135 spot TTTTTTTTTTTTTTTTAACATCTGCAATCGCGGCCAGTAC

LT136 spot TTTTTTTTTTTTTTTAAGCGCGACAGCTGAAGCTATATCTT

LT137 spot TTTTTTTTTTTTTTTTACTCCACATCCATGCTGTAACGCC

LT138 spot TTTTTTTTTTTTTTTCTGTATACCTGCACTCCACGCCACTG

LT139 spot TTTTTTTTTTTTTTTTAATCCATTGTACTGCCGGACCACC

LT140 spot TTTTTTTTTTTTTTTAACGTCCACGCAGGCTCTCATAGTG

LT141 spot TTTTTTTTTTTTTTTTCATAACGGTACTTCACGTTAATCC

LT142 spot TTTTTTTTTTTTTTTTGCCGCTGACAGTACGCTTACTTCC

LT143 spot TTTTTTTTTTTTTTTCGTACCAAGATAACGCGTGCTGGTT

LT144 spot TTTTTTTTTTTTTTTTTCAGTGTATGACGACCAGAGCGTT

LT145 spot TTTTTTTTTTTTTTTCGTGACACCGGATATGTTGGTATTCC

LT146 spot TTTTTTTTTTTTTTTTAAGCCATCCACCGGACCTTCAATC

LT147 spot TTTTTTTTTTTTTTTTGGACTTCAGGTTGTCCTTCGCTTC

LT148 spot TTTTTTTTTTTTTTTGAGCACCATACTGGCACCGAGAGAA

LT149 spot TTTTTTTTTTTTTTTTCAGGCAGAGTCTCATGTAACTGCGC

LTl 51 spot TTTTTTTTTTTTTTTTTACGCCACCAGTCATCCTCACGAT

LTl 53 spot TTTTTTTTTTTTTTTTTCTGCTCTGACATGACGTTATTCA

LTl 54 spot TTTTTTTTTTTTTTTACACTCTGGCTGATGGACGCAATCT

LTl 55 spot TTTTTTTTTTTTTTTCTTAACCAGTGCGCTGAGTGACTCG