CA2157874C - Anti-hiv monoclonal antibody - Google Patents
Anti-hiv monoclonal antibody Download PDFInfo
- Publication number
- CA2157874C CA2157874C CA002157874A CA2157874A CA2157874C CA 2157874 C CA2157874 C CA 2157874C CA 002157874 A CA002157874 A CA 002157874A CA 2157874 A CA2157874 A CA 2157874A CA 2157874 C CA2157874 C CA 2157874C
- Authority
- CA
- Canada
- Prior art keywords
- gly
- antibody
- hiv
- ser
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Abstract
The present invention is directed to a monoclonal antibody useful for clinical application which recognizes the conserved region of V3-PND region of glycoprotein antigen having a molecular weight of about 1.2 x 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV) and which has an ability to neutralize a broad range of various HIV variants, or a fragment thereof, and the chimeric and humanized antibodies derived therefrom. By using as an immunogen a plurality of peptides having PND-Tip region containing the highly conserved GPGR sequence within PND of HIV gp120, a monoclonal antibody having a neutralizing activity to many HIV variants can be prepared.
By transplanting the gene fragment coding for the variable region of said monoclonal antibody or complementarity determining region (CDR) of said region to a human antibody gene, a chimeric antibody or a reshaped antibody having an anti-HIV neutralizing activity which are effective for clinical applications can be obtained.
By transplanting the gene fragment coding for the variable region of said monoclonal antibody or complementarity determining region (CDR) of said region to a human antibody gene, a chimeric antibody or a reshaped antibody having an anti-HIV neutralizing activity which are effective for clinical applications can be obtained.
Description
Anti-HIV Monoclonal Antibody The present invention relates to an immunological technique which provides a novel substance useful for prevention, treatment, diagnosis of viral infection, and for study of biochemistry and histology. More particularly, it relates to a monoclonal antibody having a broad neutralization spectrum against human immunodeficiency virus (HIV), a causative virus of acquired immunodeficiency syndrome (AIDS), a hybridoma secreting said antibody and a process for preparing the same.
The present invention further relates to a humanized recombinant monoclonal antibody for clinical application.
Human immunodeficiency virus (HIV) is a human retrovirus which causes a series of diseases such as acquired immunodeficiency syndrome (AIDS) and AIDS related complexes (ARC). Today, these diseases have become a serious problem in the world, but no vaccines or established therapies effective for these diseases have been provided.
As an anti-viral agent against HIV, reverse transcriptase inhibitors of nucleic acid analogues such as 3' azido-2',3'-dideoxythymidin(AZT)or2',3'-dideoxyinosin (ddI) have been used, and thereby therapeutic efficacy such as inhibition of viral growth, increase in the number of CD4 positive cells and prolongation of life span has been _;:
The present invention further relates to a humanized recombinant monoclonal antibody for clinical application.
Human immunodeficiency virus (HIV) is a human retrovirus which causes a series of diseases such as acquired immunodeficiency syndrome (AIDS) and AIDS related complexes (ARC). Today, these diseases have become a serious problem in the world, but no vaccines or established therapies effective for these diseases have been provided.
As an anti-viral agent against HIV, reverse transcriptase inhibitors of nucleic acid analogues such as 3' azido-2',3'-dideoxythymidin(AZT)or2',3'-dideoxyinosin (ddI) have been used, and thereby therapeutic efficacy such as inhibition of viral growth, increase in the number of CD4 positive cells and prolongation of life span has been _;:
- 2 -observed. However, in most cases, therapeutic efficacy of these drugs to AIDS is partial or temporal, and in addition, these drugs exhibit toxicity or growth inhibition to hemato-poietic cells, and thereby inhibit reconstruction of an immune system which has become deficient . From these points of view, development of more effective anti-HIV agents has been desired.
An antibody is an important protein which plays a role in an immune reaction in mammals including humans and has a function to neutralize and remove foreign substances invaded from outside or substances recognized as foreign substances by the living body. In this respect, an antibody is expected to be useful for treatment of infectious diseases.
Karpas et al. observed remission of clinical symptoms after administration of anti-HIV antibodies derived from healthy patients infected with HIV to AIDS patients (Proc. Natl. Acad. Sci. USA, 85, p.9234 (1989), Proc. Natl.
Acad. Sci. USA, 87, p. 7613 (1990)). Jackson et al. also obtained similar results (Lancet, 2, p. 647 (1988)). These results show usefulness of an antibody therapy in AIDS.
Apart from such a passive immunotherapy, an active immunization of patients with a component vaccine of HIV has also been attempted in order to enhance immune capacity (AIDS
Res. Hum. Retroviruses, 8, P1051 (1992)). This treatment was found to be effective to patients who have not yet developed symptoms, but did not show significant effect in patients who
An antibody is an important protein which plays a role in an immune reaction in mammals including humans and has a function to neutralize and remove foreign substances invaded from outside or substances recognized as foreign substances by the living body. In this respect, an antibody is expected to be useful for treatment of infectious diseases.
Karpas et al. observed remission of clinical symptoms after administration of anti-HIV antibodies derived from healthy patients infected with HIV to AIDS patients (Proc. Natl. Acad. Sci. USA, 85, p.9234 (1989), Proc. Natl.
Acad. Sci. USA, 87, p. 7613 (1990)). Jackson et al. also obtained similar results (Lancet, 2, p. 647 (1988)). These results show usefulness of an antibody therapy in AIDS.
Apart from such a passive immunotherapy, an active immunization of patients with a component vaccine of HIV has also been attempted in order to enhance immune capacity (AIDS
Res. Hum. Retroviruses, 8, P1051 (1992)). This treatment was found to be effective to patients who have not yet developed symptoms, but did not show significant effect in patients who
- 3 -developed AIDS with a decreased number of CD4-positive cells since they are deficient in active immune response.
Accordingly, in the case of those patients whose disease has progressed, one cannot but rely on passive immunotherapy, and hence, a neutralizing antibody has a great significance.
Epitopes recognized by an antibody neutralizing HIV
are located in a glycoprotein antigen having a molecular weight of about 1. 2 x 105 daltons ( gp120 ) present on a coating membrane of HIV, a transmembrane glycoprotein antigen having a molecular weight of about 4 . 1 x 104 daltons ( gp41 ) and a nuclear protein antigen having a molecular weight of about 1.7 x 104 daltons (p17). Among these epitopes, that located in the third variable region (V3) of gp120 (amino acid number 303-338), which is also referred to as Principal Neutraliza-tion Domain (PND), can induce a potent neutralizing antibody, and hence, is a major target in developing medica-ments or vaccines.
- Although a correct role of PND region in viral infection still remains unknown, it is assumed to help invasion of viruses after binding between gp120 and CD4. PND
region also plays an important role in formation of multinu-clear giant cells by CD4-positive cells. Accordingly, if an antibody which binds to this region and inhibits infection and growth of viruses is prepared, this can possibly be an effective anti-HIV agent.
Accordingly, in the case of those patients whose disease has progressed, one cannot but rely on passive immunotherapy, and hence, a neutralizing antibody has a great significance.
Epitopes recognized by an antibody neutralizing HIV
are located in a glycoprotein antigen having a molecular weight of about 1. 2 x 105 daltons ( gp120 ) present on a coating membrane of HIV, a transmembrane glycoprotein antigen having a molecular weight of about 4 . 1 x 104 daltons ( gp41 ) and a nuclear protein antigen having a molecular weight of about 1.7 x 104 daltons (p17). Among these epitopes, that located in the third variable region (V3) of gp120 (amino acid number 303-338), which is also referred to as Principal Neutraliza-tion Domain (PND), can induce a potent neutralizing antibody, and hence, is a major target in developing medica-ments or vaccines.
- Although a correct role of PND region in viral infection still remains unknown, it is assumed to help invasion of viruses after binding between gp120 and CD4. PND
region also plays an important role in formation of multinu-clear giant cells by CD4-positive cells. Accordingly, if an antibody which binds to this region and inhibits infection and growth of viruses is prepared, this can possibly be an effective anti-HIV agent.
- 4 -However, since PND region shows a high variability in amino acid sequence as compared to other epitopes in gp120, most of the monoclonal antibodies which recognize this region are viral strain-specific neutralizing antibody which recognizes only a specific HIV strain. If such strain-specific monoclonal antibody is used for treatment or prevention, its efficacy is restricted to those patients who are infected with HIV strain that can be neutralized with that antibody.
Furthermore, in an individual HIV-infected patient, HIV is never present as a single HIV strain but usually as quasispecies of many HIV variants whose amino acid sequence show several percent variation.
Therefore, the possibility of a monoclonal antibody as a medicament is closely related to what extent of the many HIV
variants present in patients or within a single patient said antibody can bind and neutralize, i.e. the range of neutral-ization spectrum of antibody. In order to obtain a clinically useful HIV medicament, a monoclonal antibody having as broad a neutralization spectrum as possible is preferably established.
An object of the present invention is to provide a monoclonal antibody which recognizes the above PND region of HIV and has a broad neutralization spectrum and a hybridoma which is capable of producing said antibody, and further to provide a chimeric or humanized antibody which is prepared from said monoclonal antibody for administration to humans and =~a process for preparing the same. The present inventors have
Furthermore, in an individual HIV-infected patient, HIV is never present as a single HIV strain but usually as quasispecies of many HIV variants whose amino acid sequence show several percent variation.
Therefore, the possibility of a monoclonal antibody as a medicament is closely related to what extent of the many HIV
variants present in patients or within a single patient said antibody can bind and neutralize, i.e. the range of neutral-ization spectrum of antibody. In order to obtain a clinically useful HIV medicament, a monoclonal antibody having as broad a neutralization spectrum as possible is preferably established.
An object of the present invention is to provide a monoclonal antibody which recognizes the above PND region of HIV and has a broad neutralization spectrum and a hybridoma which is capable of producing said antibody, and further to provide a chimeric or humanized antibody which is prepared from said monoclonal antibody for administration to humans and =~a process for preparing the same. The present inventors have
- 5 -studied PND region of viruses obtained from many HIV-infected individuals, and as a result, have revealed that the so-called PND-Tip region, said region including Gly-Pro-Gly-Arg sequence present in the central area of PND region, is relatively conserved although some regions show high variability in amino acid sequence (AIDS Res. Human Retroviruses, 7 p.825 (1991)).
Therefore, if there can be prepared an antibody which recognizes this conserved region, it is expected to be a clinically effective monoclonal antibody capable of neutraliz-ing many kinds of viral strains.
However, it is foreseeable that such antibody recognizing this region can only be prepared with low efficiency. Boudet et al. (Int. Immunol., 4, p.283 (1992)) suggested, within in PND region, high immunogenicity is shown by a basic amino acid residing outside the above-mentioned Gly-Pro-Gly-Arg (GPGR; hereinafter the same) but the immunogenicity of GPGR sequence is low. The fact that most antibodies recognizing PND region are strain-specific also suggests that antibody-producing cells which produce an antibody having a broad neutralization spectrum as mentioned above are scarce in HIV-infected patients or animals (mouse etc.) immunized with HIV antigens. Accordingly, it is required to increase the number of cells which produce said antibody in any way.
Under the circumstances, the present inventors have provided a novel method for immunization as will be discussed ~ereinbelow and thereby succeeded in positive derivation of P s. .
of
Therefore, if there can be prepared an antibody which recognizes this conserved region, it is expected to be a clinically effective monoclonal antibody capable of neutraliz-ing many kinds of viral strains.
However, it is foreseeable that such antibody recognizing this region can only be prepared with low efficiency. Boudet et al. (Int. Immunol., 4, p.283 (1992)) suggested, within in PND region, high immunogenicity is shown by a basic amino acid residing outside the above-mentioned Gly-Pro-Gly-Arg (GPGR; hereinafter the same) but the immunogenicity of GPGR sequence is low. The fact that most antibodies recognizing PND region are strain-specific also suggests that antibody-producing cells which produce an antibody having a broad neutralization spectrum as mentioned above are scarce in HIV-infected patients or animals (mouse etc.) immunized with HIV antigens. Accordingly, it is required to increase the number of cells which produce said antibody in any way.
Under the circumstances, the present inventors have provided a novel method for immunization as will be discussed ~ereinbelow and thereby succeeded in positive derivation of P s. .
of
- 6 -anti-HIV antibodies which recognize PND-Tip region. That is, a test animal is firstly immunized with one strain of HIV
which includes GPGR sequence. Then, the second and the following immunizations are conducted sequentially with another HIV strains which also contain GPGR sequence of PND
region in common but have different amino acid sequences at the side of the N and C termini from those of the HIV strain used for the first immunization. An antigen for immunization includes a viral particle, an infected cell, a purified gp120, gp120 with a suitable treatment (e. g., with enzymatic treat-ment), or a peptide synthesized based on the amino acid sequence of PND region and a derivative thereof etc. Among these, a synthetic peptide comprising an amino acid sequence of PND region or a conjugate thereof with a serum albumin or keyhole limpet hemocyanin (KLH) etc. are preferable for inducing immunization which is limited within PND region. A
mouse used for immunization includes BAI,B/c, C57BL/6, C3H/HeN, and_F1 mouse therefrom. Immunization is conducted using 20 to 200 ~g of an antigen per one mouse (4 to 8 weeks old, weighing 20 to 30 g) four to seven times with an interval of 1 to 2 weeks.
With such immunization procedure, as a result of a booster effect of the second and the following immunizations, antibody-producing cells which produce an antibody that recognizes an overlapping region of the antigens used for the first, the second and the following immunizations, i.e. PND-Tip region, should increase in a population of antibody-producing cells which are induced within the living body of the immunized animal. Spleen cells of this immunized mouse can be used as a material for cell fusion in order to efficiently produce the desired antibody-producing cells.
Without using a cell fusion technique, monoclonal antibody-producing cells may be produced by another method which comprises transforming B cells from HIV-infected patients with Epstein-Barr virus (EBV), and converting said antibody-producing cells into monoclonal antibody-producible one. However, this method is not suitable for the method of the present invention since the source of antibody-producing cells is peripheral blood in the case of the method of the present invention, and hence, the materials are hardly available. In addition, this method is not an efficient method since most of the neutralizing antibodiesfound in HIV-infected individuals are strain-specific antibodies whereas antibodies recognizing the above-mentioned PND-Tip region are quite rare. On the contrary; a hybridoma method is advantageous in that it employs an experimental animal such as a mouse to allow for an immunogen being readily available and for devising the above-mentioned immunization procedure. Accordingly, for positively inducing the desired monoclonal antibody-producing cells (recognizing PND-Tip region), a hybridoma method can effi-ciently be used in the present invention.
In the drawings:
Fig. 1 shows reactivity between anti-serum obtained from mouse sequentially immunized with multiple PND
_ g -peptides (SP-1, SP-17, SP-11, SP-12, SP-14, SP-30) and each of V3 peptides.
Fig. 2 shows reactivity between anti-serum obtained from mouse sequentially immunized with a single PND
peptide (SP-1) and each of V3 peptides.
Fig. 3 shows activity of the monoclonal antibody C25 of the present invention and of the strain-specific neutralizing antibodies u5.5, oc64 to inhibit infection of various HIV variants ( infection by cell-free viruses and cell-to-cell infection).
Fig. 4 shows reactivity of C25 antibody with various PND peptides.
Fig. 5 shows reactivity of X5.5 antibody with various PND peptides.
Fig. 6 shows reactivity of C25 antibody with each of ten nonapeptides which are obtained by deleting each of one amino acid from decapeptides IHIGPGRAFY derived from MN, IRVGPGRAIY
derived from NI54-2 and IRVGPGRTLY derived from NI53.
Fig. 7 shows reactivity of C25 antibody with overlapped peptide groups comprising 3 to 10 amino acids (a series of peptides having an amino acid sequence shifted one by one from the N terminus) which are prepared based on the MN-derived peptide IHIGPGRAFY.
Fig. 8 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 1st amino acid ( I ) in the MN-derived peptide IHIGPGRAFY with other amino '°,~cids .
_ 9 _ Fig. 9 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 2nd amino acid ( H ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 10 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 3rd amino acid ( I ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 11 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 4th amino acid ( G ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 12 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 5th amino acid ( P ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 13 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 6th amino acid (G) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 14 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 7th amino acid ( R ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 15 shows reactivity of C25 antibody with _''.~decapeptides which are obtained by substituting the 8th amino - to -acid (A) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 16 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 9th amino acid ( F ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 17 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 10th amino acid ( Y ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 18 shows reactivity between consensus PND
peptides derived from HIV-infected individuals in Japan and C25 antibody in comparison with those of X5.5 and cc64.
Fig. 19 shows nucleic acid and amino acid sequences of H chain variable region of C25 antibody.
Fig. 20 shows nucleic acid and amino acid sequences of L chain variable region of C25 antibody.
Fig. 21 shows a nucleic acid sequence at the 5' terminus of a gene of H chain variable region of humanized C25 antibody (RC25) and an amino acid sequence at the N terminus thereof.
Fig. 22 shows a nucleic acid sequence at the 3' terminus of a gene of H chain variable region of humanized C25 antibody (RC25) and an amino acid sequence at the C terminus thereof.
Fig. 23 shows a nucleic acid and amino acid sequence of L chain variable region of humanized C25 antibody (RC25).
Fig. 24 shows antibody dependent complement-mediated cytotoxicity (ACC) of humanized C25 antibody (RC25) against HIV-infected cells in comparison with those of C25 antibody and normal human immunoglobulin.
Fig. 25 shows antibody dependent cell-mediated cytotoxicity (ADCC) of humanized C25 antibody (RC25) against HIV-infected cells in comparison with. those of C25 antibody and normal human immunoglobulin.
Fig. 26 shows a neutralizing activity of humanized C25 antibody (RC25 ) against virus derived from plasma obtained from HIV-infected patient (YHI).
Fig. 27 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (ASA).
Fig. 28 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (HHA).
Fig. 29 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (MNI).
Fig. 30 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (MOK).
Fig . 31 shows decrease in an effective concentration of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (KMO) after reconstitution of CD8.
Fig. 1 shows reactivity, of a serum of mouse immunized in accordance with the above-mentioned procedure with various PND region peptides. That is, anti-serum obtained from mouse immunized sequentially with multiple PND
peptides, each having GPGR sequence in common but a different remaining amino acid sequence, reacted all the PND peptides used for immunization. More surprisingly, said anti-serum reacted not only with the peptides used for immunization but also with other PND peptides comprising GPGR sequence in common . It also reacted strongly with the peptide ( SP-30 ) comprising 5 repeats of the amino acid sequence GPGR which is common in the immunogenic PND peptides. It was further confirmed that this anti-serum could neutralize many HIV
strains.
On the contrary, as shown in Fig. 2, anti-serum obtained from mouse immunized 5 to 6 times with a single peptide (SP-1) reacted with the immunogenic PND peptide but ~'' tshowed a low reactivity with other PND peptides. Reactivity with the synthetic GPGR peptide was also studied but it hardly reacted. That is, such a mouse immunized with a single peptide showed merely a response of a strain-specific antibody even with hyperimmunization.
This reveals that such a mouse immunized sequentially with several different PND peptides of HIV induced anti-PND-Tip antibody having a broad neutralizing spectrum against various HIV strains. Therefore, it was expected that cell fusion with spleen cells from this mouse could efficiently prepare cells which produce monoclonal.antibody having a broad neutralization spectrum.
A hybridoma is prepared in accordance with the procedures by Kohler and Milstein (Nature 256, p.495 (1975)).
A myeloma cell preferably includes MOPC-21NS/1 (Nature 256, p.495 (1975)), SP2/0-Agl4 (Nature 276, p.269 (1979)), p3X63Ag8-U1 (Eur. J. Immunol. 6, p.511 (1976)), p3X63-Ag8 (Nature, 256, p.495 (1975)), p3X63-Ag8.653 (J. Immunol. 123, p. 1548 { 1979 ) ) , etc . Spleen cells and myeloma cells are mixed together at a ratio of 1:1 to 10:1. Fusion is conducted in a phosphate buffer (pH 7.2 to 7.4) containing NaCl (about 0.850 and polyethylene glycol having a molecular weight of 1, 000 to 6, 000 . Fusion is conducted by incubating the mixture of both cells at 35 to 37°C for 1 to 5 minutes. Selection of fused cells (hybridomas) is made by selecting growing cells using a basal medium containing hypoxanthine (1.3 to 1.4 mg/dl), aminopterin (18 to 20 ul/dl), thymidine (375 to 4,000 [,_~ul/dl), streptomycin (50 to 100 ~g/ml), penicillin (50 to 100 Units/ml ) , glutamine ( 3 . 5 to 4 . 0 g/1 ) and fetal calf serum ( 10 to 20$). The basal medium includes those which are generally used for culture of animal cells, such as RPMI1640 medium, Eagle MEM medium, etc. Cloning of fused cells is conducted at least twice by a limiting dilution method.
Another important aspect to be considered in preparing a monoclonal antibody is what kind of antibodies produced by a hybridoma should be selected. That is, cell fusion provides many hybridomas, but among these, hybridomas producing a desired antibody must be,cloned. Selection is usually made by using a reactivity with HIV strains employed in laboratories such as HIV-MN or a neutralizing epitope, PND
peptide, derived therefrom, as an index. However, such strains are those subcultured in vitro, and hence, do not always reflect HIV strains actually occurring within the living body of patients. Since an object of the present invention is to drive away HIV strains which are present within the body of patients and actually epidemic, selection of a hybridoma producing a neutralizing antibody for this purpose is preferably conducted by using HIV strains derived from infected patients . Therefore, a gene coding for an amino acid sequence of PND region is directly isolated from HIV-infected individuals and expressed in E. coli. Using the reactivity with this recombinant PND peptide as an index, selection of a desired hybridoma is conducted to select a hybridoma producing a monoclonal antibody which binds to HIV
.. '.ky present within the body of patients. Furthermore, in order ?'e' to establish an antibody having a broad neutralization spec-trum, recombinant PND peptides are prepared from as many HIV-infected individuals as possible, and an antibody capable of reacting with most of these peptides is selected.
Employing the above-mentioned method, the present inventors have established a monoclonal antibody C25 which broadly neutralizes various HIV variants. C25 antibody strongly inhibited infection by cell-free viruses and cell-to-cell infection in vitro. C25 antibody reacted with most peptides used as an immunogen and neutralized many additional HIV strains, suggesting that an epitope recognized by this antibody is a region conserved among strains, i.e. GPGR and surroundings thereof.
As a result of detailed analysis of epitopes using synthetic peptides, C25 antibody of the present invention was found to react with a series of peptides comprising the following amino acid sequence at around PND-Tip in PND region:
Xal-Gly-Pro-Xa2-Arg-Xa3 wherein Xal is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr Xa2is Gly or Ala Xa3is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr.
Furthermore, C25 antibody of the present invention was found to react with the peptides:
Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val, Tyr;
Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp, Tyr;
Val-Gly-Pro-Gly-Arg-Thr;
Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala.
That is, C25 antibody of the present invention recognized an epitope formed by six amino acids comprising GPGR as a core and each one amino acid adjacent thereto at the N and C termini.
Based on the above observation, it was confirmed that C25 antibody has a broad neutralization spectrum since it recognized a highly conserved amino acid sequence within PND region of HIV and inhibited many HIV infections.
Then, the present inventors have examined usefulness of .C25 antibody in actual clinical usage by studying a neutralization spectrum of C25 antibody against HIVs derived from actual HIV-infected individuals.
Clinical usefulness means, first of all, what range of actually epidemic HIV variants C25 antibody can bind to and neutralize. In this respect, PND region of HIV variants present within the living body of each infected individual is first studied to determine an amino acid sequence of HIV
having the highest frequency as a consensus sequence, and ._ !reactivity between PND peptides having said sequence and C25 antibody was studied. As a result, C25 antibody reacted with about 80$ of the consensus peptides of HIV variants derived from each patient. Viewing that the strain-specific neutral-izing monoclonal antibody X5.5 previously established by the present inventors showed a binding rate of 30~, C25 antibody was found to have quite a broad neutralization spectrum.
A second aspect of clinical usefulness is to what range of variants it is effective among quasispecies of HIV
variants occurring in a single patient. When an amino acid sequence of viral variants occurring in a respective HIV-infected individual is determined, they do not have a completely identical amino acid sequence, but quasispecies of viral variants having a slightly diverse amino acid sequence infect a patient. Accordingly, for driving away all the infected viruses from the living body by administering an antibody as a medicament, the antibody must react with most HIV variants occurring in a patient. In this respect, reactivity between C25 antibody and PND region peptides isolated from a single patient was determined. When the strain-specific antibody u5.5 was used, there remained in the living body several HIV variants which did not reacted with the antibody. On the contrary, C25 antibody could react with all or most HIV variants occurring in an infected individual.
As mentioned above, it was revealed that C25 antibody of the present invention is a monoclonal antibody which recognizes a highly conserved PND-Tip region of PND
;,'region and shows a strong neutralizing activity, and hence, can sufficiently cope with the diversity of HIV. In fact, C25 antibody reacted with a majority of HIV variants occurring in the living body of infected individuals, and hence, has much clinical usefulness, suggesting clinical applicability of said antibody.
A representative hybridoma producing the monoclonal antibody C25 of the present invention has been deposited at National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology with the accession number of FERM BP-4561 in accordance with the Budapest Treaty on February 10, 1994.
Although C25 antibody of the present invention has a broad neutralization spectrum and is suggested to be clinically useful as mentioned above, since it is a mouse-derived antibody, its administration to humans is actually impossible from the viewpoint of safety (induction of antigenicity) or effectiveness(shortening of a half-life). Therefore, it is necessary to modify C25 antibody to a molecule having an amino acid sequence of a human antibody without altering an antigen-binding capacity by using a genetic engineering technique.
In order to prepare a so-called chimeric or humanized antibody wherein the antigen-binding site of C25 antibody is linked to a human antibody constant region, a variable (V) region gene of C25 antibody was firstly cloned and a base sequence and an amino acid sequence coded thereby were determined.
~:
A V region gene can be isolated by a usual gene manipulation technique. For example, it can be isolated by cloning a V region gene from a chromosomal DNA of a cell in accordance with the conventional method (for example, see T.
Maniatis, "Molecular Cloning" Cold Spring Harbor Lab. (1982)) or by synthesizing cDNA from mRNA materials of a cell in accordance with the conventional method (for example, D.M.Glover ed. "DNA cloning Vol. I" IRL press (1985)) and cloning a V region gene. In either procedure, as a probe for cloning a V region gene, DNA probes synthesized with reference to the nucleic acid base sequence of a mouse immunoglobulin gene which has already been reported (for example, Sakano et al., Nature, 286, p.676 (1980); E.E.Max et al., J.Biol.Chem., 256, p5116, (1981)) can be utilized. Cloning using PCR
(polymerase chain reaction) can also be conducted (R.Orlandi et al., Proc. Natl. Acad. Sci. USA, 86, 3833 (1989); W.D.Huse et al., Science, 246, 1275 (1989)).
Using the above procedures; a variable region gene of C25 antibody was isolated and the base and amino acid sequences were analyzed, and as a result, it was found that the variable region of C25 antibody has quite a novel sequence different from those of antibodies which hitherto have been reported . CDRl to CDR3 regions in Figs . 19 and 20 are regions which actually bind to an antigen, and a sequence thereof is assumed to be closely related to a broad neutralization spectrum of C25 antibody.
n~
In this respect, there were prepared a chimeric antibody gene by linking a gene fragment coding for an amino acid sequence of the regions to the upstream of a gene fragment of a human antibody constant region, or a humanized C25 antibody gene by transplanting the above-mentioned CDR
regions alone at CDRs of a human antibody variable region.
These genes were expressed and expression products were analyzed for their properties, and as a result, it was found that the chimeric and humanized C25 antibodies had a neutral-ization spectrum equivalent to that of mouse C25 antibody.
Among other things, the fact that the humanized C25 antibody, wherein CDR regions alone were transplanted, reacted with PND
means that, among V region of.an antibody, CDRs are just the most important amino acid for binding. In addition, said antibody reacted only with an anti-human IgG but not with anti-mouse IgG, revealing that said antibody shows an antigenicity as a human antibody. Accordingly, it was suggested that, when administered to humans, the chimeric and humanized C25 antibodies do not provoke severe antigenicity.
Another advantage of the chimeric and humanized antibodies is that they have an effector activity due to a constant region of a human antibody such as an antibody dependent complement-mediated cytotoxicity (ACC) and an antibody dependent cell-mediated cytotoxicity (ADCC). As mentioned hereinabove, C25 antibody inhibits infection by cell-free HIV viruses or cell-to-cell infection. However, in addition to this, whether it can destroy infected cells is ~:~ ~rz ~a r another important factor for a medicament. Generally, an antibody alone cannot kill and destroy infected cells but can destroy infected cells via complement or effector cells having FcR. It is a constant region where an antibody binds to the complement or FcR (Mol.Immunol, 22, p161 (1985)).
In this respect, ACC and ADCC activities of the chimeric and humanized C25 antibodies of the present invention based on the antibody constant region were examined. As a result, the chimeric and humanized C25 antibodies significant-ly destroyed cells with continuous ,HIV infection in the presence of complement or effector cells. This suggests that the chimeric or humanized C25 antibody of the present invention can not only inhibit infection by free viral particles or a viral antigen on the surface of infected cells but also destroy infected cells.
As mentioned hereinabove, HIV variants actually occurring in HIV-infected patients do not have a completely identical amino acid sequence but they are quasispecies of many variants having different amino acid sequence. Accord-ingly, for driving away infected viruses from the living body by administering an antibody for treating purpose, the antibody should neutralize most of the quasispecies of variants. In this respect, said humanized C25 antibody was tested for a neutralizing activity against viruses derived from plasma and peripheral blood mononuclear cells from patients and as a result, apparently showed a neutralizing ,"activity against many viruses derived from the patient. This '.
revealed that said humanized C25 antibody is clinically useful against actual patients.
As mentioned above, the present inventors have prepared the monoclonal antibody C25 which is capable of broadly neutralizing many kinds of HIV strains from infected individuals. Furthermore, humanization of said antibody could decrease antigenicity in humans and confer an effector activity such as destruction of infected cells. Thus, the present invention provides an antibody useful for prevention, treatment and diagnosis of HIV infection.
Example 1: Preparation of monoclonal antibody 1-1) Preparation of antigen (synthetic PND peptide) Synthetic PND peptides corresponding to the amino acid Nos. 303-322 of gp120 as shown in Table 1 were used as an antigen for immunization and an antigen for assay.
Table 1 Synthetic PND Isolated HIV Amino acid sequence peptides strains SP-10 NI63-1 NN'IRKRVTMGPGRVYYTTGE-C
S P-17 N I 18 NNTRE~tITIGPGRVYYTTGE-C
SP-20 NI63-2 NN'IRRGIRIGPGRAFYATDK-C
For chemical synthesis of the above peptides, ABI430A peptide synthesizer (Applied Biosystem) was used. As s.', a result, a crude product was obtained. The peptide was removed from the resin by the TFMSA method and then purified by a reverse high performance liquid chromatography (HPLC).
Purification by a reverse HPLC was repeated three times and the obtained fractions were collected.
Then, each of the obtained synthetic peptides was lyophilized and bound with KLH to prepare a peptide-KLH
conjugate. First, each of the above peptides (10 mg) was dissolved in 10 mM PBS (pH 7.0; 2 ml) and thereto was added a solution of dimethylformamide (MBS type crosslinking agent) ( 40 mg/100 ~1 ) and the mixture was stirred at room temperature for 30 minutes. The reaction solution was then washed three times with dichloromethane (2 ml) and the obtained aqueous layer was separated (Solution A) . Separately, KLH (20 mg) was dissolved in 0.2 M Tris-HC1 (pH 8.6, 8M urea) (5 ml) and thereto was added dithiothreitol (DTT) and the mixture was stirred at room temperature for 1 hour. To the reaction solution was added 10~ trichloroacetic acid (3 ml). The precipitate was filtered by suction, washed with distilled water ( 2 ml ) , and then dissolved in 20 mM NaPB (pH 7 . 0 6M
urea) (5 ml) (Solution B). Solutions A and B were mixed together and the mixture was stirred at room temperature for 3 hours. The reaction product was dialyzed and then lyophi-lized.
As mentioned above, PND peptide and PND peptide-KLH
conjugate were prepared and used as an antigen for immuniza-'A''~,~ tion and an antigen for assay.
1-2) Immunization of mouse By way of example, immunization with the synthetic peptides prepared as mentioned above is shown hereinbelow but the order of the peptides for immunization can be varied.
BALB/c and C3H/HeN mice of 4 to 8 weeks old were used. Immunization was conducted by five intraperitoneal inoculations and one following intravenous inoculation.
That is, there were made intraperitoneal (i.p.) administration of SP-1-KLH in the presence of Freund's complete adjuvant on Day 0; i.p. administration of SP-17-ICHL in the presence of Freund's incomplete adjuvant on Day 7; i.p. administration of SP-11-KHL in the presence of Freund's incomplete adjuvant on Day 14; i.p. administration of SP-12-KHL in the presence of Freund's incomplete adjuvant on Day 21; i.p. administration of SP-14-KHL in the presence of Freund's incomplete adjuvant on Day 28; and intravenous administration of SP-30-KLH in the absence of adjuvant on Day 35.
1-3.) Measurement of antibody titer in anti-serum of immunized mice This was conducted by EIA method. The synthetic peptide antigen (2 ug/ml) prepared as mentioned above was added to a 96-well microtiter plate at 100 ul/well and the plate was incubated at 4°C overnight to immobilize the antigen. Thereto was further added 1~ BSA (bovine serum albumin) solution (150 ul) and the plate was incubated in the same way for masking. To the thus prepared antigen-immobi-~lized plate were added hybridomas obtained by a cell fusion method or a culture supernatant of hybridomas after cloning.
After incubating the plate at 4°C for 1.5 hours, it is washed three times with 0.1~ TweenTM20/PBS and then a solution of peroxidase-labelled anti-mouse immunoglobulin antibody (manufactured by Kappel; 5,000 times dilution) was added thereto at 100 ul/well. After incubating the plate at 4°C for 1 hour, it was washed five times with 0.1$ Tween20/PBS. Then, a solution of TMBZ substrate was added to develop a color reaction by a conventional procedure and an absorbance at a wave length of 450 nm was measured.
As is clear from Fig. 1, the anti-serum obtained after final immunization reacted all the peptides SP-1, SP-17, SP-11, SP-12, SP-14 and SP-30. Surprisingly, the anti-serum reacted not only with the peptides used for immunization but also with PND peptides SP-6, SP-9 and SP-20, derived from other HIV strains. In contrast, when a mouse is immunized with a single peptide SP-1 five to six times, the obtained anti-serum was highly reactive with the immunogenic peptide ( SP-1 ) but showed a lower reactivity with other peptides ( Fig .
2). As to the reactivity with SP-30, the anti-serum of the mouse immunized with a single peptide hardly reacted with this peptide (Fig. 2) whereas the anti-serum of the mouse immunized with different PND peptides showed strong reactivity ( Fig . 1 ) .
A neutralization test was also conducted for anti-sera, and as a result, it was found that the anti-serum of the mouse immunized with SP-1 alone could neutralize only HIV-MN strain ,a ~S~hereas the anti-serum of the mouse immunized with many kinds of PND peptides could neutralize many HIV strains. This revealed that the immunized mouse induced an anti-GPGR
antibody having a broad neutralization spectrum against various HIV strains. The anti-serum was also confirmed to neutralize various HIV strains. Therefore, a cell fusion was conducted using spleen cells of this mouse.
1-4) Cell fusion and culture of hybridomas Three days after the final immunization, spleen cells were collected from the mouse by the conventional procedure.
The spleen cells were mixed with myeloma cells p3X63Ag8-U1 at a ratio of cell number, 1:5, and the mixture was subjected to centrifugation (1,200 r.p.m. for 5 minutes) to remove supernatant. After loosening the precipitated cell lump sufficiently, a polyethylene glycol solution (polyethyl-ene glycol-4000 (2 g), RPIM1640 (2 ml)) (1 ml) was added thereto while stirring. The mixture was incubated at 37°C for minutes, and then RPMI1640 was added slowly to the mixture to give a total volume of 50 ml. After centrifugation (900 r . p . m . for 5 minutes ) , the supernatant was removed and the cells were loosened mildly. Thereto was added a normal medium (RPMI-1640 medium supplemented with 10~ fetal calf serum) (100 ml) and the cells were mildly suspended using a measuring pipet.
The suspension was poured into each well of a 24 well culture plate (at 1 ml/well), and culture was conducted q in an incubator containing 5~ carbonic acid gas at 37°C for 24 hours. Then, 1 ml/well of an HAT medium (a normal medium supplemented with hypoxanthine (1.3 to 1.4 mg/dl), thymidine (345 to 4,000 ~1/dl) and aminopterin (18 ~1/dl)) was added to the plate and culture was further continued for 24 hours.
Thereafter, the culture supernatant (1 ml) was exchanged with the same volume of the HAT medium at an interval of 24 hours for 2 days and culture was conducted for 10 to 14 days in the same manner.
For each well where fused cells (about 300 cells) were observed to grow in the, shape of colony, the culture supernatant (1 ml) was exchanged with the same volume of an HT medium (the above HAT medium devoid of aminopterin) and thereafter the same exchange was conducted at an interval of 24 hours for 2 days. After culture on the HT medium for 3 to 4 days, a portion of the culture supernatant was taken and a desired hybridoma was selected by the screening method as mentioned hereinbelow.
1-5.) Screening of hybridoma Selection of a desired hybridoma was made by a combination of the following EIA method and the Western blotting method. The thus selected clone was measured for its neutralizing activity.
(1) EIA method To a 96-well microtest plate were added the synthetic PND peptide antigens prepared as mentioned above or PND peptides expressed in E.coli as described in Examples 2 '~:(2-5) (protein concentration: 1 to 10 ~g/ml) at 100 ~.1/well, ,.
and the plate was incubated at 4 °C overnight to immobilize the peptide. Thereto was further added 1$ BSA (bovine serum albumin) solution (150 ~1) and the plate was incubated in the same manner for masking. To the thus prepared antigen-immobilized plate were added the hybridomas or the culture supernatant of the hybridomas after cloning. After incubating the plate at 4°C for 1.5 hours, the plate was washed three times with 0.1~ Tween20/PBS and a solution of peroxidase-labelled anti-mouse immunoglobulin antibody (manufactured by Kappel; 5,000 times dilution) (100 ~1/well) was added to the plate. After incubating the plate at 4°C for 1 hour, the plate was washed five times with 0.1~ Tween20/PBS. Then, a solution of TMBZ substrate was added to develop a color reaction by the conventional procedure and an absorbance at a wave length of 450 nm was measured. Hybridomas which commonly react with a group of peptides whose GPGR sequence in PND
region is conserved are selected and cloned. Hybridoma clones after cloning were also selected in the same manner.
(2) Western blotting method This method was conducted in accordance with Towbin et al. (Proc.Natl.Acad.Sci.U.S.A., 76, p.4350 (1979)).
Viral particles of laboratory strains such as HIV-MN, HIV-LAV or HIV-RF or of clinically isolated strains such as NI61, NI23, NI54-2, NI53, NI18 or NI63, or PND peptides expressed in E.coli as described in Examples 2 (2-5), were prepared. The prepared viral particles or peptides were subjected to electrophoresis using 10$ SDS-PAGE, the gel was transferred to a nitrocellulose membrane to transfer the viruses to said membrane, and the membrane was cut with 0.4 to 0.5 cm width. Each strip was immersed into the culture supernatant of the hybridomas and incubated overnight.
Thereafter, the strips were washed three times with PBS and incubated in 1:750 dilution of a biotin-labelled anti-mouse IgG (manufactured by TAGO) for 2 hours. After washing the strips three times with PBS, they were immersed into an avidin coupled with horseradish peroxidase (manufactured by Sigma) (1:1000 dilution) and incubated for 1 hour. After washing the strips three times with PBS, a color reaction was developed with a coloring agent using 4-chloro-1-naphthol (manufactured by Bio-Rad) and the hybridomas were selected and cloned which commonly reacted with bands of the viral gp120 and the PND
peptides expressed in E . coli whose GPGR sequence in PND region is conserved. Hybridoma clones after cloning were also selected in the same manner.
(3)_Measurement of neutralizing activity For measurement of neutralizing activity, various laboratory viruses having respective PND amino acid sequence and various viruses isolated from patients and a culture supernatant of the viruses after cloning were used as a viral source (104'5 to 105 TCIDSO) . Cloning of the viruses was made by a limiting dilution method, or a plaque method in CD4-HeLa cells.
First, the viral solution adjusted to 10 TCIDso/50 ~1 and a culture supernatant of the hybridoma clone or purified ascites (50 ~1) (with various dilutions) were inoculated onto a 96-well flat.bottom plate and the plate was incubated at 37°C for 1 hour. Then, 104 cells/100 ~1/well of MT4 cells (suspended in RPMI1640 medium containing 10~ FCS, L-glutamine 3.5 to 4.0 g/1, penicillin 50 U/ml and streptomy-cin 50 ul/ml) were added and cultured for 5 days.
Neutralizing activity was evaluated based on whether an antibody inhibits syncytium formation occurring upon infection or not. A neutralization titer was expressed as a minimum effective concentration of an antibody which inhibits the syncytium formation by 100.
A hybridoma producing the monoclonal antibody C25 was obtained by the above-mentioned selection method.
1-6) Preparation of C25 monoclonal antibody To pristan-treated SPF female mouse (BALB/c, C3H~HeN, and F1 mouse thereof) of 8 weeks old, 5 x 106 cells/mouse of the hybridoma C25 antibody strain obtained in the above 1-5 was administered intraperitoneally. After 10 to 21 days, ascitic cancer was induced. Ascites was taken out of mice and, after removing solid components by centrifugation at 3000 r.p.m. for 5 minutes, purified by affinity chromatog-raphy using AffigelTM Protein A MAPS-II kit (manufactured by Bio-Rad).
Example 2: Analysis of properties of C25 monoclonal antibody ~..ys,~:
2-1) Activity of C25 antibody to neutralize virus A neutralizing activity of C25 antibody against HIV
was analyzed using various HIV strains. Fig. 3 shows viral strains used and an amino acid sequence of PND region of the viruses. A neutralization test was conducted as shown in Example 1. As a control, monoclonal antibodies X5.5 which neutralizes HIV-MN strain in a strain-specific manner and cc64 which neutralizes NI53 strain in a strain-specific manner were used and compared with C25 antibody.
The left side of Fig. 3 shows a minimum effective concentration (~g/ml) of antibodies which inhibit infection of cell-free viruses by 100. The neutralizing activity of C25 antibody is almost the same as those of X5.5 or cx64, and hence, is quite strong. As to specificity to HIV strains, C25 antibody neutralized much more HIV strains as compared to the strain-specific antibodies such as u5.5 or oc64, revealing a broad neutralization spectrum of C25 antibody.
The right side of Fig. 3 shows a minimum effective concentration of antibodies which inhibit a cell-to-cell infection of infected cells by more than 80~. An inhibitory activity of C25 antibody against cell-to-cell infection is also almost the same as those of u5.5 or oc64, and hence, is quite strong. C25 antibody inhibited cell-to-cell infection of much more HIV strains as compared to the strain-specific antibodies such as X5.5 or c~c64, revealing a broad neutraliza-tion spectrum of C25 antibody.
r v~'~-i''~eo ,,'~'=2) Reactivity with various synthetic peptides The neutralization test revealed that C25 antibody had a broad neutralization spectrum. Then, how C25 antibody reacts with various PND peptides (comprising 20 amino acids) shown in Example 1 (1-1) was examined by EIA method.
As is clear from Fig. 4, C25 antibody reacted with SP-1, SP-6, SP-9, SP-11, SP-12, SP-20, and SP-30. This suggested that C25 antibody recognized PND-Tip region, a consensus sequence of the peptides. On the contrary, the strain-specific antibody X5.5 bound only with the antigen used for immunization, SP-1, but did not react with other peptides (Fig. 5).
2-3) Analysis of epitope recognized by C25 antibody Since it was suggested that the epitope recognized by C25 antibody is located in Tip sequence around GPGR in PND
region, the recognized epitope was identified in accordance with the following method.
(1) Binding test with PND peptides which is devoid of a specific amino acid The above experiment 2-2 revealed that C25 antibody reacts with the peptides SP-1 (YNKRKRIHIGPGRAFYTTKN-C) derived from HIV-MN strain, SP-12 (NNTKKAIRVGPGRTLYATRR-C) derived from NI53, and SP-11 (NNTRKGIRVGPGRAIYATEK-C) derived from NI54-2. By synthesizing peptides devoid of either one of amino acids of these peptides and examining the reactivity of the resulting peptides with C25 antibody, specific amino acids which contribute to the binding will be clarified. According-~.;ly, each ten nonapeptide which is devoid of either one of amino acid from the decapeptides, IHIGPGRAFY derived from MN
strain and IRVGPGRTLY derived from NI53 strain, both decapeptides being known to bind to C25 antibody, were synthesized on a polyethylene rod and were tested for reactivity with C25 antibody (Fig. 6).
In the case of IHIGPGRAFY derived from HIV-MN strain, the peptides devoid of the 3rd to 8th amino acids, I, G, P, G, R and A, hardly react with C25 antibody. In case of IRVGPGRTLY derived from NI53 strain, the peptides devoid of the 3rd to 8th amino acids, V, G, P, G., R and T, do not react with C25 antibody. Furthermore, in case of IRVGPGRAIY derived from NI54-2 strain, the peptides devoid of the 3rd to 8th amino acids, V, G, P, G, R and A, did not react with C25 antibody.
These results revealed that the sequence IGPGRA is indispensable for binding of C25 antibody with HIV-MN strain, the sequence VGPGRT for binding with NI63 strain, and the sequence VGPGRA for binding with NI54-2 strain, suggesting that six amino acids comprising a GPGR core and each one amino acid adjacent to both sides of said core is an epitope recognized by C25 antibody.
(2) Binding test with overlapped hexapeptides Then, based on the peptide IHIGPGRAFY derived from HIV-MN strain with which C25 antibody reacts, a group of overlapped peptides comprising 3 to 10 amino acids (a series of peptides which have an amino acid sequence shifted one by ''~~~ne from the N terminus) were synthesized on a solid phase as in (1). The reactivity between these peptide groups and C25 antibody was examined by EIA, and a possible portion as an epitope was assessed (Fig. 7).
As a result, C25 antibody had a low reactivity with shorter peptides of less than a pentapeptide but showed a sufficient reactivity with longer peptides of more than a hexapeptide. Among these overlapped hexapeptides, the peptide which showed the strongest reaction was IGPGRA and the peptide whose reactivity comes second was GPGRAF. However, HIGPGR and PGRAFY showed an extremely decreased .reactivity, suggesting that the epitope recognized by C25 antibody is the six amino acid sequence, IGPGRA, like the result shown in (1).
2-4) Amino acid substitution analysis In order to investigate neutralization broadness (neutralization spectrum) of C25 antibody to HIV variants, the reactivity with PND peptides prepared by serially replacing each amino acid with either one of the other 19 amino acids was examined (Figs. 8 to 17). By way of example, the decapeptide IHIGPGRAFY derived from HIV-MN strain was used herein for substitution.
When G1, P and R in IIHIzGIPGZRAFY were replaced with other amino acids, C25 antibody hardly bound to these peptides. C25 antibody reacted strongly with a peptide wherein the 6th GZ is replaced with A, and hence, it was found that GZ
can be replaced with A. Accordingly, the amino acids which most contribute to the binding were considered to be GPGR.
r ; 4.~ ';
IZ located at the N terminal side of GPGR could be replaced with A, L, M, N, P, Q, S, T, V and Y, whereas A located at the C terminal side of GPGR could be replaced with every amino acid other than P. This proved that the amino acids located at both sides of GPGR are not crucial but contribute to the binding to some extent. Even after replacement of I1, H, F and Y, which are located biased more to the N and C termini, with other amino acids, the peptides maintained the reactivity with C25 antibody.
The results of the above experiments 2-3 and 2-4 proved that C25 antibody recognized the epitope formed by six amino acids comprising GPGR as a binding core and each one amino acid adjacent to both sides thereof as shown below.
In addition, the results of the amino acid substitu-tion analysis in 2-4 revealed that C25 antibody could cope with the following many amino acid variances:
(1) Xal-Gly-Pro-Gly-Arg-Ala wherein Xal is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr;
(2) Ile-Gly-Pro-Gly-Arg-Xa2 wherein Xa2 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr;
(3) Val-Gly-Pro-Gly-Arg-Thr;
(4) Val-Gly-Pro-Gly-Arg-Ser;
(5) Ile-Gly-Pro-Ala-Arg-Ala.
2-5 ) Reactivity of C25 antibody with PND peptides derived from viruses of infected individuals Then, the reactivity of C25 antibody with HIV
actually occurring within the living body of HIV-infected individuals was examined by the following method.
First, peripheral blood lymphocytes (PBL) of HIV-infected individuals were suspended in 1 x RSB buffer and thereto were added SDS (final concentration 1~), Proteinase K ( final concentration 1 mg/ml ) , and the mixture was incubated at 37°C for 2 hours. Then, phenol extraction and ethanol precipitation procedures were repeated to give DNAs (genomic DNAs) having a high molecular weight. Also, HIV particles were precipitated from serum of infected individuals and cDNAs were synthesized with a reverse transcriptase. Using these DNAs having a high molecular weight or cDNAs as a template, gp120/PND region of HIV in infected patients were amplified using the following primers A and C.
Primer A; (5')GCCGGATCCACACATGGAATTAGGCCAGTA(3') Primer B; (3')AGTCCTCCCCTGGGTCTTTAAACTGACGTCTCG(5') Amplification was carried out using Taq polymerase for 30 to 35 cycles.
The thus obtained amplified DNA fragments were cloned into pUCl8 plasmid and the amplified DNA fragments were sequenced by a dideoxy method. Furthermore, the cloned DNA
fragments were incorporated into pUEX2 expression vector and E.coli was transfected with this vector and subjected to heat induction at 42°C for expression. The expressed protein in .q the form of a fused protein with j3-galactosidase was purified from the inclusion in E.coli as follows. E.coli cells which undertook expression were destroyed with glass beads and then treated with lysozyme (final concentration 0.1 mg/ml) at 4°C
and the precipitates obtained from centrifugation were treated with TritonTM X-100(final concentration 0.5~). The precipi-tates obtained from centrifugation were solubilized with 8M
urea and then reacted with C25 antibody. The binding property was confirmed by the EIA method and the Western blotting method as described in Example 1 (1-5).
Fig. 18 shows an amino acid sequence of PND region of HIVs which occur most frequently in patients and the reactivity of C25 antibody therewith. C25 antibody bound with the consensus sequences derived from twenty five patients among thirty HIV-infected individuals examined herein. That is, the binding spectrum of C25 antibody was as broad as 83~.
On the contrary, the strain-specific monoclonal antibodies, X5.5 or cz64, had a spectrum of only about 30~.
When viruses in an HIV-infected individual were examined for their amino acid sequence, they do not show a completely identical sequence but they infect a patient as quasispecies of viruses having a somewhat different amino acid sequence. To drive away viruses from the living body of infected individuals by administration of an antibody, the antibody must react with most of HIVs present within the living body of the patient . Tables 2 and 3 show the reactivity s ~ .~h:.
of C25 antibody with PND region peptides derived from HIVs isolated from a single patient.
Table 2 HIV clone No. of Amino acid sequence C25 u5.5 analysis of PND
HIV-MN - YNKRKRIHIGPGRAFYTTKNIIG
TIW-Ol 7 N-T--S-P----------GE--- + -TIW-02 4 N-T--S-P----------GEV-- + -TIW-09 1 N-T--G-P----------GE--- + -Binding rate (~) 100 0~
(12/12) (0/12) Table 3 .
HIV clone No. of Amino acid sequence C25 u5.5 analysis of PND
HIV-MN - YNKRKRIHIGPGRAFYTTKNIIG
NI230-1 3 N-T--S------------GE--- + +
NI230-4 1 N-T--S------------GE-M- + +
NI230-8 2 N-T--G-Y------V---ER--- + -NI230-7 1 N-T--G-Y------V---GR--- + _ NI230-5 1 N-T--G-Y------V---ER--- + -Binding rate (~) 100 50~
(8/8) (4/8) In the case of the patient TIW, C25 antibody bound all the HIVs whereas u5.5 bound none of HIVs (Table 2). In case the infected individual NI230, C25 antibody could bind all the HIVs whereas there remained some HIVs with which the antibody u5.5 could not react (Table 3). Table 4 summarizes results obtained from such 13 HIV-infected individuals. C25 antibody showed a reactivity at a high rate in almost all the infected individuals, wherein 100 reactivity was shown in 8 individu als, and more than 90~ reactivity was shown in as many as 11 r y individuals. On the contrary, the strain-specific u5.5 antibody showed a low reactivity wherein more than 90$
reactivity was shown in only one individual. These proved that C25 antibody could sufficiently cope with a high variability of HIVs and hence could actually be clinically applicable.
Table 4 HIV-infected Bidinct rate of neutralizing antibody ($~
individuals C25 ,-u5.5-NI56 100$(11/11) 100$(11/11) KMO 92$(12/13) ~ 46$(6/13) TI 93$(14/15) 20$(3/15) TIW 100$(12/12) 0$(0/12) YHI 92$(11/12) 0$(0/12) HHA 100$(35/35) 60$(21/35) NI229 75$(6/8) 0$(0/8) NI230 100$(8/8) 50$(4/8) NI334 100$(8/8) 25$(2/8) NI373 100$(10/10) 0$(0/10) NI252 100$(11/11) 0$(0/11) NI380 82$(9/11) 46$(5/11) NI382 100$(11/11) 0$(0/11) No. of applica- 8(11) 1(1) ble patientsl Note 1) Number of patients having an antibody binding rate of 100$
The number in the parenthesis shows number of patients having an antibody binding rate of more than 90$.
Example 3: Preparation of chimeric C25 antibody (CC25) 3-1) Isolation of V region gene of C25 antibody Isolation of a gene coding for mouse immunoglobulin variable (V) region was carried out as mentioned hereinbelow.
Whole RNAs were extracted from C25 cells in accordance with A
a , conventional procedure [Glober ed. "DNA cloning Vol. 1"
IRL press (1985)] and a single-stranded cDNA was synthesized using cDNA Synthesis System Plus (Amersham). Using this single-stranded cDNA as a template, a polymerase chain reaction (PCR) was carried out using DNA primers synthesized based on the nucleic acid base sequence of V region and J
region as classified by Kabat et al. (Sequences of Proteins of Immunological Interest 4th ed. , Public Health Service, NIH, Washington DC, 1987). HindIII and BamHI sites were included in the V region primer and J region primer, respectively. PCR
was conducted in accordance with the protocol of CETUS. That is, each 100 pmol of the primers were used and PCR reagents were a kit from CETUS. The PCR conditions were 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute, and PCR was conducted for 25 cycles. After PCR, the obtained DNA
fragments were subcloned into HIncII site of pUCl8 (manufac-tured by Takara Shuzo K.K.; the reagents used in this Example were those manufactured by Takara Shuzo K.K. or Toyobo K.K.
unless otherwise mentioned).
3-2) Nucleic acid base sequence of mouse V region gene of C25 antibody Using SequenaseTM Ver. 2 kit manufactured by Toyobo K.K., the V region gene incorporated in pUCl8 was sequenced.
The thus obtained nucleic acid base sequences of C25 antibody are shown in Figs. l9 and 20. Amino acid sequences deduced from the nucleic acid base sequences are also shown in Figs.
19 and 20. The nucleic acid base sequence of C25 antibody m showed a rearrangement specific to the V region gene and formed an open reading frame (ORF) which allows for expres-sion.
3-3) Construction of gene expressing chimeric C25 antibody (CHC25, CLC25) In order to confirm that the isolated V region gene of C25 antibody is actually a gene coding for V region responsible for anti-HIV activity, a mouse-human chimeric antibody was prepared. For expression of a chimeric antibody, expression vectors, AG-x and AG-yl, ,having a 8-actin (AG) promoter were used. AG-x contains a human x chain constant region gene and a DHFR gene as a selection marker whereas AG-yl contains a human yl chain constant region gene and a neo gene as a selection marker. The V region of C25 antibody as prepared above was digested with HindIII and BamHI restriction enzymes and the obtained VH and VL fragments were incorporated into the HindIII-BamHI site of AG-yl and AG-x, respectively (CH~25 and CLC25).
3-4) Expression of chimeric C25 antibody (CC25) The chimeric C25 antibody gene constructed as mentioned above was tested for its antibody activity in a transient expressian system using COS7 cell [ATCCCRL 1651].
A mixture of CHC25 and CLC25 plasmid DNAs was introduced into COS7 cells using an electroporation device manufactured by Bio-Rad in accordance with the protocol of Bio-Rad, and the COS7 cells were cultured in DMEM medium containing 10$ fetal calf serum (GIBCO) . After three days, the culture supernatant was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using anti-human IgG or PND peptides derived from various HIVs. As a result, an expression product of the mixture of CHC25 and CLC25 plasmid DNAs could bind with the anti-human IgG. The reactivity with various PND peptides was compared with that of the original C25 antibody and thereby the expression product showed a reaction spectrum similar to that of the original C25 antibody. Furthermore, the neutralizing activity against HIV-MN strain was also tested,, and as a result, the expression product was found to inhibit viral infection by 100 at a minimum effective concentration of 1 ug/ml like the mouse C25 antibody. Accordingly, it was proved that the C25 antibody V region gene isolated as mentioned above is exactly a gene coding for V region of an antibody having a neutraliz-ing activity.
3-5) Preparation of a cell strain producing chimeric C25 antibody at high rate For preparing a stable plasma cell line producing chimeric C25 antibody (CC25), the above-mentioned plasmid DNAs, CLC25 and CHC 25, were linearized with PvuI, and CHO-DG44 cells and P3-653 cells were transformed with a mixture of the linearized DNAs and lipofectin. As in the temporal expression of the chimeric antibody, a culture supernatant of Neo-resistant DHFR-resistant cells where the genes are intro-duced was collected, and the activity of antibodies present ~in the culture supernatant was measured by ELISA method using an anti-human IgG and various PND peptides. An expression product by cotranfection with CLC25 and CHC25 plasmid DNAs bound with various PND peptides, and hence, this transformed cell was cloned. Furthermore, an amplification procedure for DHFR gene was repeated by adding MTX at a concentration of 4 to 32 x 10' M. As a result, a stable plasma cell line which is resistant to MTX and produces CC25 antibody at a level of 50 to 70 ~g/ml.
Example 4: Preparation of humanized C25 antibody (RC25) 4-1) Transplantation of CDRs of C25 antibody V region gene by PCR mutagenesis In order to investigate an important region for antigen binding among VH and VL regions of the cloned C25 antibody, CDR (complementarity determining) regions of C25 antibody were transplanted into a human V region. This was carried out in accordance with the method for preparing a humanized antibody (Japanese Patent First Publication No. 4-141095). CDR region of C25 antibody VH region was transplant-ed into VH region having a framework (FR) region of human subgroup II (NEW: donated by Dr. Bendig of U.K. MRC Collabora-tive Centre) whereas CDR region of C25 antibody VL region was transplanted into VL region having FR region of human x chain (REI: W.Palm and N.Hilscmann, Z.Physiol.Chem., 356, 167 (1975)). Specifically, this was conducted by PCR-mutagenesis wherein mutation is introduced by PCR (Saiki, R.G. et al., Science, 239, 487 (1988)) into the humanized antibody u5.5 or ,0.53 which the present inventors have previously prepared.
Figs: 21, 22 and 23 show the synthetic primers used for mutagenesis which are annealed to a PCR template, i.e. VH and VL regions of the humanized antibody.
The condition of PCR was 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute and 25 cycles were repeated.
In the case of VH, using VH gene of the humanized antibody X5.5 (Japanese Patent First Publication No. 4-152893) as a template and primers #1 and #2, the 5' site of the VH
gene was amplified (Fig. 21) . This was linked via the central BglII site to a gene fragment (Fig. 22) which is prepared by amplification with primers #3 and #4 using the VH gene of the humanized antibody 0.5J3 (Hum.Antibod.Hybridomas, 2, p124 (1991)) as a template. On the other hand, in case of VL, the 5' site of VL was amplified using #5 and M13-M4 primers and the 3' site of VL was amplified using primer #8 and M13-reverse primer, and the resulting amplified genes were linked together to form KpnI site, which site is self-annealed with synthetic DNAs. #6 and #7 (Fig. 23).
Thus, V regions of the humanized C25 antibody (RHC25 and RLC25, respectively: cf. SEQ ID N0:2 and SEQ ID N0: 4) were obtained. These humanized V region fragments were digested with HindTII and BamHI restriction enzymes as in preparation of the chimeric antibody (cf. Example 3) and the resulting VH and VL fragments were incorporated into the HindIII-BamHI site of AG-yl and AG-x, respectively. Thus, expression vectors for humanized C25 antibody (RHC25 and RLC25, respectively) were prepared.
rte:
l,~:w,~, 4-2) Expression of humanized C25 antibody (RC25) The activity of antibodies obtained by the thus prepared humanized antibody gene was examined in a transient expression system of the above-mentioned COS7 cells. As in the transient expression of the chimeric antibody, the culture supernatant of cells where the gene was introduced was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using an anti-human IgG or PND peptides derived from various HIVs. As a result, expression products of a mixture of RHC25 and RLC25 plasmid DNAs bound various PND peptides. Furthermore, the expression products were examined for the neutralizing activity against HIV-MN strain, and as a result, it was found that they inhibit the viral infection by 100 at a minimum effective concentration of 1 ~g/ml like C25 mouse antibody and the chimeric antibody. Accordingly, among the amino acid sequence of C25 antibody as shown in Figs. 19 and 20, the transplanted CDR regions are an important, region for exerting the anti-HIV activity, and hence, the gene coding for these regions is the most important gene for preparing a recombinant antibody.
4-3 ) Preparation of cell line producing humanized C25 antibody at high rate In order to prepare a stable plasma cell line producing the humanized C25 antibody (RC25), the above-mentioned plasmid DNAs RLC25 and RHC25 were linearized with s~ ~PvuI and the linearized DNAs, as a mixture with lipofectin, were used for transformation of CHO-DG44 cells and P3-653 cells. As in the case of the transient expression of the chimeric antibody, the culture supernatant of neo-resistant DHFR-resistant cells wherein the gene is introduced was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using an anti-human IgG and various PND peptides. An expression product by cotranfection with RLC25 and RHC25 plasmid DNAs bound with various PND peptides, and hence, this transformed cell was cloned. Furthermore, an amplification procedure for DHFR gene was repeated by adding MTX at a concentration of 4 to 32 x 10' M. As a result, a stable plasma cell line which is resistant to MTX and produces RC25 antibody at a level of 80 to 100 ~g/ml was prepared.
Example 5: Effector activity of chimeric and humanized C25 antibodies 5-1) Antibody dependent complement-mediated cytotoxicity (ACC) C25 antibody, chimeric C25 antibody (CC25), humanized C25 antibody (RC25) and normal human IgG (NHG) were diluted in RPMI1640 containing 5~ FCS to a final concentration of 0.1 to 50 ug/ml and each 50 ~1 was added to a 96-well plate. Then, H9 cells with continuous infection of HIV-MN
(2.5 x 105 cells; 100 ~1) and fresh human serum (30 ~1) were added and the plate was allowed to stand at 37°C for 1 hour.
After 1 hour; the cells were dyed with trypan blue and the numbers of living cells and of dead cells were counted.
~ r, As shown in Fig. 24, 10 ~g/ml of CC25 antibody and RC25 antibody destroyed about 70~ of the target cells whereas C25 antibody and NHG showed a low cytotoxicity. This proved that the chimeric and the humanized C25 antibodies had a strong ACC activity.
5-2) Antibody dependent cell-mediated cytotoxicity (ADCC) Cells with continuous infection of HIV-MN were established using CEM cells resistant to NK cells (CEM-NKR) and used as a target cell. The infected cells (3 x 106 cells) were suspended in RPMI1640 containing 10~ FCS (1 ml) and labelled with SICr for 90 minutes. The cells (104 cells) were inoculated on a 96-well plate and thereto were added each 0.1 to 10 ug/ml of C25 antibody, CC25 antibody, RC25 antibody and NHG. Then, normal human peripheral blood lymphocytes (5 x 105 cells ) were added and the plate was incubated for 4 hours .
Percentage of destroyed cells was obtained in the usual manner.
As shown in Fig. 25, under condition of effector cells / target cells = 50, 1 ~.g/ml of CC25 antibody and RC25 antibody destroyed about 50~ of the target cells whereas C25 antibody showed as low cytotoxicity as that of NHG. This revealed that C25 antibody and NHG showed a low cytotoxicity activity and proved that the chimeric and humanized C25 antibodies had a strong ADCC activity.
Example 6: Effectiveness of humanized C25 antibody (RC25) to viruses derived from patients 6-1) Binding property of RC25 antibody with viruses derived from patients Since it is known that HIV occurs as quasispecies of variant viruses in a single patient, in accordance with the procedures of Example 2 (2-5), a base sequence of PND region of viral RNA in plasma and of proviral DNA in peripheral blood mononuclear cells derived from anti-HIV antibody positive patients was analyzed with multiple clones per one specimen, and the binding property of RC25 antibody with recombinant PND
proteins prepared based on the obtained sequence was examined .
Table 5 shows the binding property of RC25 antibody with PNDs of peripheral blood mononuclear cells derived from various patients in comparison with HIV-IIIB type virus-specific chimeric antibody (C(31) and MN type virus-specific humanized antibody (R~5.5). As is clear from Table 5, RC25 antibody bound with the PND recombinant proteins derived from various patients at a high rate of 91 to 100.
Table 5 HIV-infected Binding rate of neutralizing antibody individuals RC25 Ru5.5 C 1 YHI 91$(11/12) 8(1/12) 0(0/12) ASA 100(7/7) 0(0/7) 0(0/7) HHA 100(46/46) 69(32/46) 0(0/46) MNI 100$(24/24) 91(22/24) 0(0/24) KMO 92(12/13) 53(7/13) 0(0/13) MOK 100(24/24) 100(24/24) 0(0/24) 6-2 ) Neutralizing RC25 antibody viruses derived activity of to rom patient plasma RC25 antibody (2 mg/ml; 5 ul) was reacted with the patient plasma (50 ~1) used in the above 6-1 at room tempera-ture for 30 minutes. Culture was started by adding a mixture of RC25 antibody and plasma to normal human peripheral blood mononuclear cell system (50 ~l) wherein CD8-positive cells were removed with anti-CD8 antibody-bound magnetic beads (manufactured by Dinal) in ten times higher amount than that of the mononuclear cells in order to enhance production of viruses and, after activation with 10 ~g/ml of phytohemagglutinin for three days, the. mononuclear cells were cultured in a culture medium containing interleukin-2 for 4 days. After four days, the cells were washed with fresh medium and then culture was continued while collection of supernatant and culture exchange were conducted at an interval of 5 to 7 days. A concentration of HIV-1 p24 antigen in the collected culture supernatant was measured using a kit for detecting HIV antigen (manufactured by Dinabbott). In all the tested cases where viral infection from patient plasma to normal human peripheral blood mononuclear cells occurred, as shown in Fig. 26, HIV-IIIB type virus-specific chimeric antibody (CJ~1) and MN type virus-specific humanized antibody (R~5.5) used as a control antibody were ineffective, but the group in which R25 antibody was added showed less than detection limit of p24 antigen production, and thereby an apparent effect of RC25 antibody to inhibit infection was confirmed.
v3 6-3 ) Neutralizing activity of RC25 antibody to viruses derived from peripheral blood mononuclear cells of patients Mononuclear cells were prepared from the above-mentioned patient peripheral blood ( 20 to 40 ml ) , CD8-positive cells were removed by the above-mentioned procedure in order to enhance production of viruses, and then the cells were cultured in the presence of anti-CD3 monoclonal antibody (0.5 ~g/ml) for 3 to 5 days to produce viruses. Culture was further continued in the presence of 60, 120 and 240 ug/ml of RC25 antibody while collection of supernatant and culture exchange were conducted at an interval of 5 to 7 days, and a concentration of HIV-1 p24 antigen in the culture supernatant was measured as mentioned hereinabove. In all the tested cases using peripheral blood mononuclear cells of patients showing more than 90~ binding of RC25 antibody with the PND
proteins prepared based on proviral DNA in peripheral blood mononuclear cells, RC25 antibody inhibited production of viral antigen in a concentration dependent manner as shown in Figs.
27 to 30.
6-4 ) Neutralizing activity of RC25 antibody to viruses derived from peripheral blood mononuclear cells from patients after reconstitution of CD8 The above test procedures for confirming the effectiveness of the present invention, which mimic in vivo style of HIV infection by activating latent proviruses in infected cells of patients to induce viral infection, were ~~'! ~ conducted under quite severe conditions wherein CD8-positive a~
cells were removed and viral activation was artificially introduced by the anti-CD3 antibody. Accordingly, RC25 antibody which was proven to be extremely effective in the test procedures is expected, if clinically applied to patients, to be much more effective than in the test proce-dures.
Thus, the same test procedures mentioned hereinabove were conducted with reconstitution of one tenth amount of the removed CD8-positive cells at the addition of the antibody.
As a result, as shown in Fig. 31, an effective concentration of RC25 antibody was reduced to as low as 30 ~g/ml, suggesting that RC25 antibody is quite effective in clinical application.
HIV is a highly variable virus which infects a single patient as quasispecies of variant viruses having a different amino acid sequences. In order to exert treating efficacy even to such quasispecies of variant viruses, it is essential to identify a conserved region among HIV strains and establish a neutralizing antibody which recognizes said conserved region. V3-PND region of HIV is an important site which induces a strong neutralizing antibody and a monoclonal antibody to PND-Tip region comprising the conserved sequence GPGR is believed to have a broad neutralization spectrum.
The present inventors have established a novel method for immunization which allows for efficient preparation of the neutralizing monoclonal antibody recognizing the region ,~v '::'conserved among each strain, and have established C25 monoclonal antibody which neutralizes many HIV strains isolated from infected individuals. Furthermore, by humaniz-ation of said antibody, the antibody was reduced in antigenic-ity in humans and endowed with the ability to destroy infected cells in Fc region dependent manner. Furthermore, contrary to the conventional HIV neutralizing antibodies which showed effectiveness only to a single virus isolated in a laboratory, the antibody of the present invention was confirmed to be apparently effective to quasispecies of many variant viruses within the body of a patient due to its broad neutralization spectrum. Accordingly, the antibody of the present invention can respond to diversity and variability of various HIVs and can be clinically applicable as a medicament for prevention, treatment or diagnosis of HIV.
215'~~7~
SEQUENCE LISTING
SEQ ID N0: 1 SEQUENCE LENGTH: 355 SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: cDNA to genomic RNA
ORIGINAL SOURCE
ORGANISM: mouse .
SEQUENCE
Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Thr Ser Val Lys Met Phe Cys Lys Ala Ala Gly Tyr Thr Phe Thr Asn Ser Trp Ile Gly Trp Phe Arg Gln Arg Pro Gly His Gly Leu Glu Trp Ile Gly Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr _ 215'874 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys g5 90 95 Ser Arg Gly Ile Pro Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser SEQ ID N0: 2 SEQUENCE LENGTH: 354 SEQUENCE TYPE: nucleic acid STR.ANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: other nucleic acid (modified nucleic acid) ORIGINAL. SOURCE
ORGANISM: mouse and human SEQUENCE
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Ser _ 2157874 Trp Ile Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly Lys Ala Thr Met Thr Ala Asp Thr Ser Thr Asn Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ser Arg Gly Ile Pro Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser SEQ ID N0: 3 SEQUENCE LENGTH: 340 SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: cDNA to genomic RNA
ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
GAC ATT GTG ATG ACA CAG TCT CCA TCC TCC CTG ACT GTG ACA GCA GGA
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly GAG AAG GTC ACT ATG AGC TGC AAG TCC AGT CAG AGT CTG TTA AAC AGT
Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 . 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Gly Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Glu Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys SEQ ID N0: 4 SEQUENCE LENGTH: 339 215'~87~
SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: other nucleic acid (modified nucleic acid) ORIGINAL SOURCE
ORGANISM: mouse and human SEQUENC E
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 , 15 Asp Arg Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro ~ys Leu Leu Ile Tyr Trp Ala Ser Thr Gly Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Asn 215'874 Asp Tyr Ser Tyr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys SEQ ID NO: 5 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Xaa Gly Pro Xaa Arg Xaa SEQ ID N0: 6 SEQUENCE.LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Xaa Gly Pro Gly Arg Ala SEQ ID N0: 7 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Ile Gly Pro Gly Arg Xaa SEQ ID N0: 8 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Val Gly Pro Gly Arg Thr SEQ ID N0: 9 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
_ 2f 57874 Val Gly Pro Gly Arg Ser SEQ ID N0: 10 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Ile Gly Pro Ala Arg Ala SEQ ID N0: 11 SEQUENCE LENGTH: 5 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT, intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Asn Ser Trp Ile Gly SEQ ID N0: 12 SEQUENCE LENGTH: 17 SEQUENCE TYPE: amino acid . 2~.~ X874 TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly SEQ ID N0: 13 SEQUENCE LENGTH: 9 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Gly Ile Pro Gly Tyr Ala Met Asp Tyr SEQ ID N0: 14 SEQUENCE LENGTH: 17 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
L~ys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr SEQ ID N0: 15 SEQUENCE LENGTH: 7 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE-Trp Ala Ser Thr Gly Glu Ser SEQ ID N0: 16 SEQUENCE LENGTH: 9 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment _ 215'874 ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Gln Asn Asp Tyr Ser Tyr Pro Trp Thr
which includes GPGR sequence. Then, the second and the following immunizations are conducted sequentially with another HIV strains which also contain GPGR sequence of PND
region in common but have different amino acid sequences at the side of the N and C termini from those of the HIV strain used for the first immunization. An antigen for immunization includes a viral particle, an infected cell, a purified gp120, gp120 with a suitable treatment (e. g., with enzymatic treat-ment), or a peptide synthesized based on the amino acid sequence of PND region and a derivative thereof etc. Among these, a synthetic peptide comprising an amino acid sequence of PND region or a conjugate thereof with a serum albumin or keyhole limpet hemocyanin (KLH) etc. are preferable for inducing immunization which is limited within PND region. A
mouse used for immunization includes BAI,B/c, C57BL/6, C3H/HeN, and_F1 mouse therefrom. Immunization is conducted using 20 to 200 ~g of an antigen per one mouse (4 to 8 weeks old, weighing 20 to 30 g) four to seven times with an interval of 1 to 2 weeks.
With such immunization procedure, as a result of a booster effect of the second and the following immunizations, antibody-producing cells which produce an antibody that recognizes an overlapping region of the antigens used for the first, the second and the following immunizations, i.e. PND-Tip region, should increase in a population of antibody-producing cells which are induced within the living body of the immunized animal. Spleen cells of this immunized mouse can be used as a material for cell fusion in order to efficiently produce the desired antibody-producing cells.
Without using a cell fusion technique, monoclonal antibody-producing cells may be produced by another method which comprises transforming B cells from HIV-infected patients with Epstein-Barr virus (EBV), and converting said antibody-producing cells into monoclonal antibody-producible one. However, this method is not suitable for the method of the present invention since the source of antibody-producing cells is peripheral blood in the case of the method of the present invention, and hence, the materials are hardly available. In addition, this method is not an efficient method since most of the neutralizing antibodiesfound in HIV-infected individuals are strain-specific antibodies whereas antibodies recognizing the above-mentioned PND-Tip region are quite rare. On the contrary; a hybridoma method is advantageous in that it employs an experimental animal such as a mouse to allow for an immunogen being readily available and for devising the above-mentioned immunization procedure. Accordingly, for positively inducing the desired monoclonal antibody-producing cells (recognizing PND-Tip region), a hybridoma method can effi-ciently be used in the present invention.
In the drawings:
Fig. 1 shows reactivity between anti-serum obtained from mouse sequentially immunized with multiple PND
_ g -peptides (SP-1, SP-17, SP-11, SP-12, SP-14, SP-30) and each of V3 peptides.
Fig. 2 shows reactivity between anti-serum obtained from mouse sequentially immunized with a single PND
peptide (SP-1) and each of V3 peptides.
Fig. 3 shows activity of the monoclonal antibody C25 of the present invention and of the strain-specific neutralizing antibodies u5.5, oc64 to inhibit infection of various HIV variants ( infection by cell-free viruses and cell-to-cell infection).
Fig. 4 shows reactivity of C25 antibody with various PND peptides.
Fig. 5 shows reactivity of X5.5 antibody with various PND peptides.
Fig. 6 shows reactivity of C25 antibody with each of ten nonapeptides which are obtained by deleting each of one amino acid from decapeptides IHIGPGRAFY derived from MN, IRVGPGRAIY
derived from NI54-2 and IRVGPGRTLY derived from NI53.
Fig. 7 shows reactivity of C25 antibody with overlapped peptide groups comprising 3 to 10 amino acids (a series of peptides having an amino acid sequence shifted one by one from the N terminus) which are prepared based on the MN-derived peptide IHIGPGRAFY.
Fig. 8 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 1st amino acid ( I ) in the MN-derived peptide IHIGPGRAFY with other amino '°,~cids .
_ 9 _ Fig. 9 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 2nd amino acid ( H ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 10 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 3rd amino acid ( I ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 11 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 4th amino acid ( G ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 12 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 5th amino acid ( P ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 13 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 6th amino acid (G) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 14 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 7th amino acid ( R ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 15 shows reactivity of C25 antibody with _''.~decapeptides which are obtained by substituting the 8th amino - to -acid (A) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 16 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 9th amino acid ( F ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 17 shows reactivity of C25 antibody with decapeptides which are obtained by substituting the 10th amino acid ( Y ) in the MN-derived peptide IHIGPGRAFY with other amino acids.
Fig. 18 shows reactivity between consensus PND
peptides derived from HIV-infected individuals in Japan and C25 antibody in comparison with those of X5.5 and cc64.
Fig. 19 shows nucleic acid and amino acid sequences of H chain variable region of C25 antibody.
Fig. 20 shows nucleic acid and amino acid sequences of L chain variable region of C25 antibody.
Fig. 21 shows a nucleic acid sequence at the 5' terminus of a gene of H chain variable region of humanized C25 antibody (RC25) and an amino acid sequence at the N terminus thereof.
Fig. 22 shows a nucleic acid sequence at the 3' terminus of a gene of H chain variable region of humanized C25 antibody (RC25) and an amino acid sequence at the C terminus thereof.
Fig. 23 shows a nucleic acid and amino acid sequence of L chain variable region of humanized C25 antibody (RC25).
Fig. 24 shows antibody dependent complement-mediated cytotoxicity (ACC) of humanized C25 antibody (RC25) against HIV-infected cells in comparison with those of C25 antibody and normal human immunoglobulin.
Fig. 25 shows antibody dependent cell-mediated cytotoxicity (ADCC) of humanized C25 antibody (RC25) against HIV-infected cells in comparison with. those of C25 antibody and normal human immunoglobulin.
Fig. 26 shows a neutralizing activity of humanized C25 antibody (RC25 ) against virus derived from plasma obtained from HIV-infected patient (YHI).
Fig. 27 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (ASA).
Fig. 28 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (HHA).
Fig. 29 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (MNI).
Fig. 30 shows a neutralizing activity of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (MOK).
Fig . 31 shows decrease in an effective concentration of humanized C25 antibody (RC25) against virus derived from mononuclear cells in peripheral blood obtained from HIV-infected patient (KMO) after reconstitution of CD8.
Fig. 1 shows reactivity, of a serum of mouse immunized in accordance with the above-mentioned procedure with various PND region peptides. That is, anti-serum obtained from mouse immunized sequentially with multiple PND
peptides, each having GPGR sequence in common but a different remaining amino acid sequence, reacted all the PND peptides used for immunization. More surprisingly, said anti-serum reacted not only with the peptides used for immunization but also with other PND peptides comprising GPGR sequence in common . It also reacted strongly with the peptide ( SP-30 ) comprising 5 repeats of the amino acid sequence GPGR which is common in the immunogenic PND peptides. It was further confirmed that this anti-serum could neutralize many HIV
strains.
On the contrary, as shown in Fig. 2, anti-serum obtained from mouse immunized 5 to 6 times with a single peptide (SP-1) reacted with the immunogenic PND peptide but ~'' tshowed a low reactivity with other PND peptides. Reactivity with the synthetic GPGR peptide was also studied but it hardly reacted. That is, such a mouse immunized with a single peptide showed merely a response of a strain-specific antibody even with hyperimmunization.
This reveals that such a mouse immunized sequentially with several different PND peptides of HIV induced anti-PND-Tip antibody having a broad neutralizing spectrum against various HIV strains. Therefore, it was expected that cell fusion with spleen cells from this mouse could efficiently prepare cells which produce monoclonal.antibody having a broad neutralization spectrum.
A hybridoma is prepared in accordance with the procedures by Kohler and Milstein (Nature 256, p.495 (1975)).
A myeloma cell preferably includes MOPC-21NS/1 (Nature 256, p.495 (1975)), SP2/0-Agl4 (Nature 276, p.269 (1979)), p3X63Ag8-U1 (Eur. J. Immunol. 6, p.511 (1976)), p3X63-Ag8 (Nature, 256, p.495 (1975)), p3X63-Ag8.653 (J. Immunol. 123, p. 1548 { 1979 ) ) , etc . Spleen cells and myeloma cells are mixed together at a ratio of 1:1 to 10:1. Fusion is conducted in a phosphate buffer (pH 7.2 to 7.4) containing NaCl (about 0.850 and polyethylene glycol having a molecular weight of 1, 000 to 6, 000 . Fusion is conducted by incubating the mixture of both cells at 35 to 37°C for 1 to 5 minutes. Selection of fused cells (hybridomas) is made by selecting growing cells using a basal medium containing hypoxanthine (1.3 to 1.4 mg/dl), aminopterin (18 to 20 ul/dl), thymidine (375 to 4,000 [,_~ul/dl), streptomycin (50 to 100 ~g/ml), penicillin (50 to 100 Units/ml ) , glutamine ( 3 . 5 to 4 . 0 g/1 ) and fetal calf serum ( 10 to 20$). The basal medium includes those which are generally used for culture of animal cells, such as RPMI1640 medium, Eagle MEM medium, etc. Cloning of fused cells is conducted at least twice by a limiting dilution method.
Another important aspect to be considered in preparing a monoclonal antibody is what kind of antibodies produced by a hybridoma should be selected. That is, cell fusion provides many hybridomas, but among these, hybridomas producing a desired antibody must be,cloned. Selection is usually made by using a reactivity with HIV strains employed in laboratories such as HIV-MN or a neutralizing epitope, PND
peptide, derived therefrom, as an index. However, such strains are those subcultured in vitro, and hence, do not always reflect HIV strains actually occurring within the living body of patients. Since an object of the present invention is to drive away HIV strains which are present within the body of patients and actually epidemic, selection of a hybridoma producing a neutralizing antibody for this purpose is preferably conducted by using HIV strains derived from infected patients . Therefore, a gene coding for an amino acid sequence of PND region is directly isolated from HIV-infected individuals and expressed in E. coli. Using the reactivity with this recombinant PND peptide as an index, selection of a desired hybridoma is conducted to select a hybridoma producing a monoclonal antibody which binds to HIV
.. '.ky present within the body of patients. Furthermore, in order ?'e' to establish an antibody having a broad neutralization spec-trum, recombinant PND peptides are prepared from as many HIV-infected individuals as possible, and an antibody capable of reacting with most of these peptides is selected.
Employing the above-mentioned method, the present inventors have established a monoclonal antibody C25 which broadly neutralizes various HIV variants. C25 antibody strongly inhibited infection by cell-free viruses and cell-to-cell infection in vitro. C25 antibody reacted with most peptides used as an immunogen and neutralized many additional HIV strains, suggesting that an epitope recognized by this antibody is a region conserved among strains, i.e. GPGR and surroundings thereof.
As a result of detailed analysis of epitopes using synthetic peptides, C25 antibody of the present invention was found to react with a series of peptides comprising the following amino acid sequence at around PND-Tip in PND region:
Xal-Gly-Pro-Xa2-Arg-Xa3 wherein Xal is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr Xa2is Gly or Ala Xa3is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr.
Furthermore, C25 antibody of the present invention was found to react with the peptides:
Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val, Tyr;
Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp, Tyr;
Val-Gly-Pro-Gly-Arg-Thr;
Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala.
That is, C25 antibody of the present invention recognized an epitope formed by six amino acids comprising GPGR as a core and each one amino acid adjacent thereto at the N and C termini.
Based on the above observation, it was confirmed that C25 antibody has a broad neutralization spectrum since it recognized a highly conserved amino acid sequence within PND region of HIV and inhibited many HIV infections.
Then, the present inventors have examined usefulness of .C25 antibody in actual clinical usage by studying a neutralization spectrum of C25 antibody against HIVs derived from actual HIV-infected individuals.
Clinical usefulness means, first of all, what range of actually epidemic HIV variants C25 antibody can bind to and neutralize. In this respect, PND region of HIV variants present within the living body of each infected individual is first studied to determine an amino acid sequence of HIV
having the highest frequency as a consensus sequence, and ._ !reactivity between PND peptides having said sequence and C25 antibody was studied. As a result, C25 antibody reacted with about 80$ of the consensus peptides of HIV variants derived from each patient. Viewing that the strain-specific neutral-izing monoclonal antibody X5.5 previously established by the present inventors showed a binding rate of 30~, C25 antibody was found to have quite a broad neutralization spectrum.
A second aspect of clinical usefulness is to what range of variants it is effective among quasispecies of HIV
variants occurring in a single patient. When an amino acid sequence of viral variants occurring in a respective HIV-infected individual is determined, they do not have a completely identical amino acid sequence, but quasispecies of viral variants having a slightly diverse amino acid sequence infect a patient. Accordingly, for driving away all the infected viruses from the living body by administering an antibody as a medicament, the antibody must react with most HIV variants occurring in a patient. In this respect, reactivity between C25 antibody and PND region peptides isolated from a single patient was determined. When the strain-specific antibody u5.5 was used, there remained in the living body several HIV variants which did not reacted with the antibody. On the contrary, C25 antibody could react with all or most HIV variants occurring in an infected individual.
As mentioned above, it was revealed that C25 antibody of the present invention is a monoclonal antibody which recognizes a highly conserved PND-Tip region of PND
;,'region and shows a strong neutralizing activity, and hence, can sufficiently cope with the diversity of HIV. In fact, C25 antibody reacted with a majority of HIV variants occurring in the living body of infected individuals, and hence, has much clinical usefulness, suggesting clinical applicability of said antibody.
A representative hybridoma producing the monoclonal antibody C25 of the present invention has been deposited at National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology with the accession number of FERM BP-4561 in accordance with the Budapest Treaty on February 10, 1994.
Although C25 antibody of the present invention has a broad neutralization spectrum and is suggested to be clinically useful as mentioned above, since it is a mouse-derived antibody, its administration to humans is actually impossible from the viewpoint of safety (induction of antigenicity) or effectiveness(shortening of a half-life). Therefore, it is necessary to modify C25 antibody to a molecule having an amino acid sequence of a human antibody without altering an antigen-binding capacity by using a genetic engineering technique.
In order to prepare a so-called chimeric or humanized antibody wherein the antigen-binding site of C25 antibody is linked to a human antibody constant region, a variable (V) region gene of C25 antibody was firstly cloned and a base sequence and an amino acid sequence coded thereby were determined.
~:
A V region gene can be isolated by a usual gene manipulation technique. For example, it can be isolated by cloning a V region gene from a chromosomal DNA of a cell in accordance with the conventional method (for example, see T.
Maniatis, "Molecular Cloning" Cold Spring Harbor Lab. (1982)) or by synthesizing cDNA from mRNA materials of a cell in accordance with the conventional method (for example, D.M.Glover ed. "DNA cloning Vol. I" IRL press (1985)) and cloning a V region gene. In either procedure, as a probe for cloning a V region gene, DNA probes synthesized with reference to the nucleic acid base sequence of a mouse immunoglobulin gene which has already been reported (for example, Sakano et al., Nature, 286, p.676 (1980); E.E.Max et al., J.Biol.Chem., 256, p5116, (1981)) can be utilized. Cloning using PCR
(polymerase chain reaction) can also be conducted (R.Orlandi et al., Proc. Natl. Acad. Sci. USA, 86, 3833 (1989); W.D.Huse et al., Science, 246, 1275 (1989)).
Using the above procedures; a variable region gene of C25 antibody was isolated and the base and amino acid sequences were analyzed, and as a result, it was found that the variable region of C25 antibody has quite a novel sequence different from those of antibodies which hitherto have been reported . CDRl to CDR3 regions in Figs . 19 and 20 are regions which actually bind to an antigen, and a sequence thereof is assumed to be closely related to a broad neutralization spectrum of C25 antibody.
n~
In this respect, there were prepared a chimeric antibody gene by linking a gene fragment coding for an amino acid sequence of the regions to the upstream of a gene fragment of a human antibody constant region, or a humanized C25 antibody gene by transplanting the above-mentioned CDR
regions alone at CDRs of a human antibody variable region.
These genes were expressed and expression products were analyzed for their properties, and as a result, it was found that the chimeric and humanized C25 antibodies had a neutral-ization spectrum equivalent to that of mouse C25 antibody.
Among other things, the fact that the humanized C25 antibody, wherein CDR regions alone were transplanted, reacted with PND
means that, among V region of.an antibody, CDRs are just the most important amino acid for binding. In addition, said antibody reacted only with an anti-human IgG but not with anti-mouse IgG, revealing that said antibody shows an antigenicity as a human antibody. Accordingly, it was suggested that, when administered to humans, the chimeric and humanized C25 antibodies do not provoke severe antigenicity.
Another advantage of the chimeric and humanized antibodies is that they have an effector activity due to a constant region of a human antibody such as an antibody dependent complement-mediated cytotoxicity (ACC) and an antibody dependent cell-mediated cytotoxicity (ADCC). As mentioned hereinabove, C25 antibody inhibits infection by cell-free HIV viruses or cell-to-cell infection. However, in addition to this, whether it can destroy infected cells is ~:~ ~rz ~a r another important factor for a medicament. Generally, an antibody alone cannot kill and destroy infected cells but can destroy infected cells via complement or effector cells having FcR. It is a constant region where an antibody binds to the complement or FcR (Mol.Immunol, 22, p161 (1985)).
In this respect, ACC and ADCC activities of the chimeric and humanized C25 antibodies of the present invention based on the antibody constant region were examined. As a result, the chimeric and humanized C25 antibodies significant-ly destroyed cells with continuous ,HIV infection in the presence of complement or effector cells. This suggests that the chimeric or humanized C25 antibody of the present invention can not only inhibit infection by free viral particles or a viral antigen on the surface of infected cells but also destroy infected cells.
As mentioned hereinabove, HIV variants actually occurring in HIV-infected patients do not have a completely identical amino acid sequence but they are quasispecies of many variants having different amino acid sequence. Accord-ingly, for driving away infected viruses from the living body by administering an antibody for treating purpose, the antibody should neutralize most of the quasispecies of variants. In this respect, said humanized C25 antibody was tested for a neutralizing activity against viruses derived from plasma and peripheral blood mononuclear cells from patients and as a result, apparently showed a neutralizing ,"activity against many viruses derived from the patient. This '.
revealed that said humanized C25 antibody is clinically useful against actual patients.
As mentioned above, the present inventors have prepared the monoclonal antibody C25 which is capable of broadly neutralizing many kinds of HIV strains from infected individuals. Furthermore, humanization of said antibody could decrease antigenicity in humans and confer an effector activity such as destruction of infected cells. Thus, the present invention provides an antibody useful for prevention, treatment and diagnosis of HIV infection.
Example 1: Preparation of monoclonal antibody 1-1) Preparation of antigen (synthetic PND peptide) Synthetic PND peptides corresponding to the amino acid Nos. 303-322 of gp120 as shown in Table 1 were used as an antigen for immunization and an antigen for assay.
Table 1 Synthetic PND Isolated HIV Amino acid sequence peptides strains SP-10 NI63-1 NN'IRKRVTMGPGRVYYTTGE-C
S P-17 N I 18 NNTRE~tITIGPGRVYYTTGE-C
SP-20 NI63-2 NN'IRRGIRIGPGRAFYATDK-C
For chemical synthesis of the above peptides, ABI430A peptide synthesizer (Applied Biosystem) was used. As s.', a result, a crude product was obtained. The peptide was removed from the resin by the TFMSA method and then purified by a reverse high performance liquid chromatography (HPLC).
Purification by a reverse HPLC was repeated three times and the obtained fractions were collected.
Then, each of the obtained synthetic peptides was lyophilized and bound with KLH to prepare a peptide-KLH
conjugate. First, each of the above peptides (10 mg) was dissolved in 10 mM PBS (pH 7.0; 2 ml) and thereto was added a solution of dimethylformamide (MBS type crosslinking agent) ( 40 mg/100 ~1 ) and the mixture was stirred at room temperature for 30 minutes. The reaction solution was then washed three times with dichloromethane (2 ml) and the obtained aqueous layer was separated (Solution A) . Separately, KLH (20 mg) was dissolved in 0.2 M Tris-HC1 (pH 8.6, 8M urea) (5 ml) and thereto was added dithiothreitol (DTT) and the mixture was stirred at room temperature for 1 hour. To the reaction solution was added 10~ trichloroacetic acid (3 ml). The precipitate was filtered by suction, washed with distilled water ( 2 ml ) , and then dissolved in 20 mM NaPB (pH 7 . 0 6M
urea) (5 ml) (Solution B). Solutions A and B were mixed together and the mixture was stirred at room temperature for 3 hours. The reaction product was dialyzed and then lyophi-lized.
As mentioned above, PND peptide and PND peptide-KLH
conjugate were prepared and used as an antigen for immuniza-'A''~,~ tion and an antigen for assay.
1-2) Immunization of mouse By way of example, immunization with the synthetic peptides prepared as mentioned above is shown hereinbelow but the order of the peptides for immunization can be varied.
BALB/c and C3H/HeN mice of 4 to 8 weeks old were used. Immunization was conducted by five intraperitoneal inoculations and one following intravenous inoculation.
That is, there were made intraperitoneal (i.p.) administration of SP-1-KLH in the presence of Freund's complete adjuvant on Day 0; i.p. administration of SP-17-ICHL in the presence of Freund's incomplete adjuvant on Day 7; i.p. administration of SP-11-KHL in the presence of Freund's incomplete adjuvant on Day 14; i.p. administration of SP-12-KHL in the presence of Freund's incomplete adjuvant on Day 21; i.p. administration of SP-14-KHL in the presence of Freund's incomplete adjuvant on Day 28; and intravenous administration of SP-30-KLH in the absence of adjuvant on Day 35.
1-3.) Measurement of antibody titer in anti-serum of immunized mice This was conducted by EIA method. The synthetic peptide antigen (2 ug/ml) prepared as mentioned above was added to a 96-well microtiter plate at 100 ul/well and the plate was incubated at 4°C overnight to immobilize the antigen. Thereto was further added 1~ BSA (bovine serum albumin) solution (150 ul) and the plate was incubated in the same way for masking. To the thus prepared antigen-immobi-~lized plate were added hybridomas obtained by a cell fusion method or a culture supernatant of hybridomas after cloning.
After incubating the plate at 4°C for 1.5 hours, it is washed three times with 0.1~ TweenTM20/PBS and then a solution of peroxidase-labelled anti-mouse immunoglobulin antibody (manufactured by Kappel; 5,000 times dilution) was added thereto at 100 ul/well. After incubating the plate at 4°C for 1 hour, it was washed five times with 0.1$ Tween20/PBS. Then, a solution of TMBZ substrate was added to develop a color reaction by a conventional procedure and an absorbance at a wave length of 450 nm was measured.
As is clear from Fig. 1, the anti-serum obtained after final immunization reacted all the peptides SP-1, SP-17, SP-11, SP-12, SP-14 and SP-30. Surprisingly, the anti-serum reacted not only with the peptides used for immunization but also with PND peptides SP-6, SP-9 and SP-20, derived from other HIV strains. In contrast, when a mouse is immunized with a single peptide SP-1 five to six times, the obtained anti-serum was highly reactive with the immunogenic peptide ( SP-1 ) but showed a lower reactivity with other peptides ( Fig .
2). As to the reactivity with SP-30, the anti-serum of the mouse immunized with a single peptide hardly reacted with this peptide (Fig. 2) whereas the anti-serum of the mouse immunized with different PND peptides showed strong reactivity ( Fig . 1 ) .
A neutralization test was also conducted for anti-sera, and as a result, it was found that the anti-serum of the mouse immunized with SP-1 alone could neutralize only HIV-MN strain ,a ~S~hereas the anti-serum of the mouse immunized with many kinds of PND peptides could neutralize many HIV strains. This revealed that the immunized mouse induced an anti-GPGR
antibody having a broad neutralization spectrum against various HIV strains. The anti-serum was also confirmed to neutralize various HIV strains. Therefore, a cell fusion was conducted using spleen cells of this mouse.
1-4) Cell fusion and culture of hybridomas Three days after the final immunization, spleen cells were collected from the mouse by the conventional procedure.
The spleen cells were mixed with myeloma cells p3X63Ag8-U1 at a ratio of cell number, 1:5, and the mixture was subjected to centrifugation (1,200 r.p.m. for 5 minutes) to remove supernatant. After loosening the precipitated cell lump sufficiently, a polyethylene glycol solution (polyethyl-ene glycol-4000 (2 g), RPIM1640 (2 ml)) (1 ml) was added thereto while stirring. The mixture was incubated at 37°C for minutes, and then RPMI1640 was added slowly to the mixture to give a total volume of 50 ml. After centrifugation (900 r . p . m . for 5 minutes ) , the supernatant was removed and the cells were loosened mildly. Thereto was added a normal medium (RPMI-1640 medium supplemented with 10~ fetal calf serum) (100 ml) and the cells were mildly suspended using a measuring pipet.
The suspension was poured into each well of a 24 well culture plate (at 1 ml/well), and culture was conducted q in an incubator containing 5~ carbonic acid gas at 37°C for 24 hours. Then, 1 ml/well of an HAT medium (a normal medium supplemented with hypoxanthine (1.3 to 1.4 mg/dl), thymidine (345 to 4,000 ~1/dl) and aminopterin (18 ~1/dl)) was added to the plate and culture was further continued for 24 hours.
Thereafter, the culture supernatant (1 ml) was exchanged with the same volume of the HAT medium at an interval of 24 hours for 2 days and culture was conducted for 10 to 14 days in the same manner.
For each well where fused cells (about 300 cells) were observed to grow in the, shape of colony, the culture supernatant (1 ml) was exchanged with the same volume of an HT medium (the above HAT medium devoid of aminopterin) and thereafter the same exchange was conducted at an interval of 24 hours for 2 days. After culture on the HT medium for 3 to 4 days, a portion of the culture supernatant was taken and a desired hybridoma was selected by the screening method as mentioned hereinbelow.
1-5.) Screening of hybridoma Selection of a desired hybridoma was made by a combination of the following EIA method and the Western blotting method. The thus selected clone was measured for its neutralizing activity.
(1) EIA method To a 96-well microtest plate were added the synthetic PND peptide antigens prepared as mentioned above or PND peptides expressed in E.coli as described in Examples 2 '~:(2-5) (protein concentration: 1 to 10 ~g/ml) at 100 ~.1/well, ,.
and the plate was incubated at 4 °C overnight to immobilize the peptide. Thereto was further added 1$ BSA (bovine serum albumin) solution (150 ~1) and the plate was incubated in the same manner for masking. To the thus prepared antigen-immobilized plate were added the hybridomas or the culture supernatant of the hybridomas after cloning. After incubating the plate at 4°C for 1.5 hours, the plate was washed three times with 0.1~ Tween20/PBS and a solution of peroxidase-labelled anti-mouse immunoglobulin antibody (manufactured by Kappel; 5,000 times dilution) (100 ~1/well) was added to the plate. After incubating the plate at 4°C for 1 hour, the plate was washed five times with 0.1~ Tween20/PBS. Then, a solution of TMBZ substrate was added to develop a color reaction by the conventional procedure and an absorbance at a wave length of 450 nm was measured. Hybridomas which commonly react with a group of peptides whose GPGR sequence in PND
region is conserved are selected and cloned. Hybridoma clones after cloning were also selected in the same manner.
(2) Western blotting method This method was conducted in accordance with Towbin et al. (Proc.Natl.Acad.Sci.U.S.A., 76, p.4350 (1979)).
Viral particles of laboratory strains such as HIV-MN, HIV-LAV or HIV-RF or of clinically isolated strains such as NI61, NI23, NI54-2, NI53, NI18 or NI63, or PND peptides expressed in E.coli as described in Examples 2 (2-5), were prepared. The prepared viral particles or peptides were subjected to electrophoresis using 10$ SDS-PAGE, the gel was transferred to a nitrocellulose membrane to transfer the viruses to said membrane, and the membrane was cut with 0.4 to 0.5 cm width. Each strip was immersed into the culture supernatant of the hybridomas and incubated overnight.
Thereafter, the strips were washed three times with PBS and incubated in 1:750 dilution of a biotin-labelled anti-mouse IgG (manufactured by TAGO) for 2 hours. After washing the strips three times with PBS, they were immersed into an avidin coupled with horseradish peroxidase (manufactured by Sigma) (1:1000 dilution) and incubated for 1 hour. After washing the strips three times with PBS, a color reaction was developed with a coloring agent using 4-chloro-1-naphthol (manufactured by Bio-Rad) and the hybridomas were selected and cloned which commonly reacted with bands of the viral gp120 and the PND
peptides expressed in E . coli whose GPGR sequence in PND region is conserved. Hybridoma clones after cloning were also selected in the same manner.
(3)_Measurement of neutralizing activity For measurement of neutralizing activity, various laboratory viruses having respective PND amino acid sequence and various viruses isolated from patients and a culture supernatant of the viruses after cloning were used as a viral source (104'5 to 105 TCIDSO) . Cloning of the viruses was made by a limiting dilution method, or a plaque method in CD4-HeLa cells.
First, the viral solution adjusted to 10 TCIDso/50 ~1 and a culture supernatant of the hybridoma clone or purified ascites (50 ~1) (with various dilutions) were inoculated onto a 96-well flat.bottom plate and the plate was incubated at 37°C for 1 hour. Then, 104 cells/100 ~1/well of MT4 cells (suspended in RPMI1640 medium containing 10~ FCS, L-glutamine 3.5 to 4.0 g/1, penicillin 50 U/ml and streptomy-cin 50 ul/ml) were added and cultured for 5 days.
Neutralizing activity was evaluated based on whether an antibody inhibits syncytium formation occurring upon infection or not. A neutralization titer was expressed as a minimum effective concentration of an antibody which inhibits the syncytium formation by 100.
A hybridoma producing the monoclonal antibody C25 was obtained by the above-mentioned selection method.
1-6) Preparation of C25 monoclonal antibody To pristan-treated SPF female mouse (BALB/c, C3H~HeN, and F1 mouse thereof) of 8 weeks old, 5 x 106 cells/mouse of the hybridoma C25 antibody strain obtained in the above 1-5 was administered intraperitoneally. After 10 to 21 days, ascitic cancer was induced. Ascites was taken out of mice and, after removing solid components by centrifugation at 3000 r.p.m. for 5 minutes, purified by affinity chromatog-raphy using AffigelTM Protein A MAPS-II kit (manufactured by Bio-Rad).
Example 2: Analysis of properties of C25 monoclonal antibody ~..ys,~:
2-1) Activity of C25 antibody to neutralize virus A neutralizing activity of C25 antibody against HIV
was analyzed using various HIV strains. Fig. 3 shows viral strains used and an amino acid sequence of PND region of the viruses. A neutralization test was conducted as shown in Example 1. As a control, monoclonal antibodies X5.5 which neutralizes HIV-MN strain in a strain-specific manner and cc64 which neutralizes NI53 strain in a strain-specific manner were used and compared with C25 antibody.
The left side of Fig. 3 shows a minimum effective concentration (~g/ml) of antibodies which inhibit infection of cell-free viruses by 100. The neutralizing activity of C25 antibody is almost the same as those of X5.5 or cx64, and hence, is quite strong. As to specificity to HIV strains, C25 antibody neutralized much more HIV strains as compared to the strain-specific antibodies such as u5.5 or oc64, revealing a broad neutralization spectrum of C25 antibody.
The right side of Fig. 3 shows a minimum effective concentration of antibodies which inhibit a cell-to-cell infection of infected cells by more than 80~. An inhibitory activity of C25 antibody against cell-to-cell infection is also almost the same as those of u5.5 or oc64, and hence, is quite strong. C25 antibody inhibited cell-to-cell infection of much more HIV strains as compared to the strain-specific antibodies such as X5.5 or c~c64, revealing a broad neutraliza-tion spectrum of C25 antibody.
r v~'~-i''~eo ,,'~'=2) Reactivity with various synthetic peptides The neutralization test revealed that C25 antibody had a broad neutralization spectrum. Then, how C25 antibody reacts with various PND peptides (comprising 20 amino acids) shown in Example 1 (1-1) was examined by EIA method.
As is clear from Fig. 4, C25 antibody reacted with SP-1, SP-6, SP-9, SP-11, SP-12, SP-20, and SP-30. This suggested that C25 antibody recognized PND-Tip region, a consensus sequence of the peptides. On the contrary, the strain-specific antibody X5.5 bound only with the antigen used for immunization, SP-1, but did not react with other peptides (Fig. 5).
2-3) Analysis of epitope recognized by C25 antibody Since it was suggested that the epitope recognized by C25 antibody is located in Tip sequence around GPGR in PND
region, the recognized epitope was identified in accordance with the following method.
(1) Binding test with PND peptides which is devoid of a specific amino acid The above experiment 2-2 revealed that C25 antibody reacts with the peptides SP-1 (YNKRKRIHIGPGRAFYTTKN-C) derived from HIV-MN strain, SP-12 (NNTKKAIRVGPGRTLYATRR-C) derived from NI53, and SP-11 (NNTRKGIRVGPGRAIYATEK-C) derived from NI54-2. By synthesizing peptides devoid of either one of amino acids of these peptides and examining the reactivity of the resulting peptides with C25 antibody, specific amino acids which contribute to the binding will be clarified. According-~.;ly, each ten nonapeptide which is devoid of either one of amino acid from the decapeptides, IHIGPGRAFY derived from MN
strain and IRVGPGRTLY derived from NI53 strain, both decapeptides being known to bind to C25 antibody, were synthesized on a polyethylene rod and were tested for reactivity with C25 antibody (Fig. 6).
In the case of IHIGPGRAFY derived from HIV-MN strain, the peptides devoid of the 3rd to 8th amino acids, I, G, P, G, R and A, hardly react with C25 antibody. In case of IRVGPGRTLY derived from NI53 strain, the peptides devoid of the 3rd to 8th amino acids, V, G, P, G., R and T, do not react with C25 antibody. Furthermore, in case of IRVGPGRAIY derived from NI54-2 strain, the peptides devoid of the 3rd to 8th amino acids, V, G, P, G, R and A, did not react with C25 antibody.
These results revealed that the sequence IGPGRA is indispensable for binding of C25 antibody with HIV-MN strain, the sequence VGPGRT for binding with NI63 strain, and the sequence VGPGRA for binding with NI54-2 strain, suggesting that six amino acids comprising a GPGR core and each one amino acid adjacent to both sides of said core is an epitope recognized by C25 antibody.
(2) Binding test with overlapped hexapeptides Then, based on the peptide IHIGPGRAFY derived from HIV-MN strain with which C25 antibody reacts, a group of overlapped peptides comprising 3 to 10 amino acids (a series of peptides which have an amino acid sequence shifted one by ''~~~ne from the N terminus) were synthesized on a solid phase as in (1). The reactivity between these peptide groups and C25 antibody was examined by EIA, and a possible portion as an epitope was assessed (Fig. 7).
As a result, C25 antibody had a low reactivity with shorter peptides of less than a pentapeptide but showed a sufficient reactivity with longer peptides of more than a hexapeptide. Among these overlapped hexapeptides, the peptide which showed the strongest reaction was IGPGRA and the peptide whose reactivity comes second was GPGRAF. However, HIGPGR and PGRAFY showed an extremely decreased .reactivity, suggesting that the epitope recognized by C25 antibody is the six amino acid sequence, IGPGRA, like the result shown in (1).
2-4) Amino acid substitution analysis In order to investigate neutralization broadness (neutralization spectrum) of C25 antibody to HIV variants, the reactivity with PND peptides prepared by serially replacing each amino acid with either one of the other 19 amino acids was examined (Figs. 8 to 17). By way of example, the decapeptide IHIGPGRAFY derived from HIV-MN strain was used herein for substitution.
When G1, P and R in IIHIzGIPGZRAFY were replaced with other amino acids, C25 antibody hardly bound to these peptides. C25 antibody reacted strongly with a peptide wherein the 6th GZ is replaced with A, and hence, it was found that GZ
can be replaced with A. Accordingly, the amino acids which most contribute to the binding were considered to be GPGR.
r ; 4.~ ';
IZ located at the N terminal side of GPGR could be replaced with A, L, M, N, P, Q, S, T, V and Y, whereas A located at the C terminal side of GPGR could be replaced with every amino acid other than P. This proved that the amino acids located at both sides of GPGR are not crucial but contribute to the binding to some extent. Even after replacement of I1, H, F and Y, which are located biased more to the N and C termini, with other amino acids, the peptides maintained the reactivity with C25 antibody.
The results of the above experiments 2-3 and 2-4 proved that C25 antibody recognized the epitope formed by six amino acids comprising GPGR as a binding core and each one amino acid adjacent to both sides thereof as shown below.
In addition, the results of the amino acid substitu-tion analysis in 2-4 revealed that C25 antibody could cope with the following many amino acid variances:
(1) Xal-Gly-Pro-Gly-Arg-Ala wherein Xal is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr;
(2) Ile-Gly-Pro-Gly-Arg-Xa2 wherein Xa2 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr;
(3) Val-Gly-Pro-Gly-Arg-Thr;
(4) Val-Gly-Pro-Gly-Arg-Ser;
(5) Ile-Gly-Pro-Ala-Arg-Ala.
2-5 ) Reactivity of C25 antibody with PND peptides derived from viruses of infected individuals Then, the reactivity of C25 antibody with HIV
actually occurring within the living body of HIV-infected individuals was examined by the following method.
First, peripheral blood lymphocytes (PBL) of HIV-infected individuals were suspended in 1 x RSB buffer and thereto were added SDS (final concentration 1~), Proteinase K ( final concentration 1 mg/ml ) , and the mixture was incubated at 37°C for 2 hours. Then, phenol extraction and ethanol precipitation procedures were repeated to give DNAs (genomic DNAs) having a high molecular weight. Also, HIV particles were precipitated from serum of infected individuals and cDNAs were synthesized with a reverse transcriptase. Using these DNAs having a high molecular weight or cDNAs as a template, gp120/PND region of HIV in infected patients were amplified using the following primers A and C.
Primer A; (5')GCCGGATCCACACATGGAATTAGGCCAGTA(3') Primer B; (3')AGTCCTCCCCTGGGTCTTTAAACTGACGTCTCG(5') Amplification was carried out using Taq polymerase for 30 to 35 cycles.
The thus obtained amplified DNA fragments were cloned into pUCl8 plasmid and the amplified DNA fragments were sequenced by a dideoxy method. Furthermore, the cloned DNA
fragments were incorporated into pUEX2 expression vector and E.coli was transfected with this vector and subjected to heat induction at 42°C for expression. The expressed protein in .q the form of a fused protein with j3-galactosidase was purified from the inclusion in E.coli as follows. E.coli cells which undertook expression were destroyed with glass beads and then treated with lysozyme (final concentration 0.1 mg/ml) at 4°C
and the precipitates obtained from centrifugation were treated with TritonTM X-100(final concentration 0.5~). The precipi-tates obtained from centrifugation were solubilized with 8M
urea and then reacted with C25 antibody. The binding property was confirmed by the EIA method and the Western blotting method as described in Example 1 (1-5).
Fig. 18 shows an amino acid sequence of PND region of HIVs which occur most frequently in patients and the reactivity of C25 antibody therewith. C25 antibody bound with the consensus sequences derived from twenty five patients among thirty HIV-infected individuals examined herein. That is, the binding spectrum of C25 antibody was as broad as 83~.
On the contrary, the strain-specific monoclonal antibodies, X5.5 or cz64, had a spectrum of only about 30~.
When viruses in an HIV-infected individual were examined for their amino acid sequence, they do not show a completely identical sequence but they infect a patient as quasispecies of viruses having a somewhat different amino acid sequence. To drive away viruses from the living body of infected individuals by administration of an antibody, the antibody must react with most of HIVs present within the living body of the patient . Tables 2 and 3 show the reactivity s ~ .~h:.
of C25 antibody with PND region peptides derived from HIVs isolated from a single patient.
Table 2 HIV clone No. of Amino acid sequence C25 u5.5 analysis of PND
HIV-MN - YNKRKRIHIGPGRAFYTTKNIIG
TIW-Ol 7 N-T--S-P----------GE--- + -TIW-02 4 N-T--S-P----------GEV-- + -TIW-09 1 N-T--G-P----------GE--- + -Binding rate (~) 100 0~
(12/12) (0/12) Table 3 .
HIV clone No. of Amino acid sequence C25 u5.5 analysis of PND
HIV-MN - YNKRKRIHIGPGRAFYTTKNIIG
NI230-1 3 N-T--S------------GE--- + +
NI230-4 1 N-T--S------------GE-M- + +
NI230-8 2 N-T--G-Y------V---ER--- + -NI230-7 1 N-T--G-Y------V---GR--- + _ NI230-5 1 N-T--G-Y------V---ER--- + -Binding rate (~) 100 50~
(8/8) (4/8) In the case of the patient TIW, C25 antibody bound all the HIVs whereas u5.5 bound none of HIVs (Table 2). In case the infected individual NI230, C25 antibody could bind all the HIVs whereas there remained some HIVs with which the antibody u5.5 could not react (Table 3). Table 4 summarizes results obtained from such 13 HIV-infected individuals. C25 antibody showed a reactivity at a high rate in almost all the infected individuals, wherein 100 reactivity was shown in 8 individu als, and more than 90~ reactivity was shown in as many as 11 r y individuals. On the contrary, the strain-specific u5.5 antibody showed a low reactivity wherein more than 90$
reactivity was shown in only one individual. These proved that C25 antibody could sufficiently cope with a high variability of HIVs and hence could actually be clinically applicable.
Table 4 HIV-infected Bidinct rate of neutralizing antibody ($~
individuals C25 ,-u5.5-NI56 100$(11/11) 100$(11/11) KMO 92$(12/13) ~ 46$(6/13) TI 93$(14/15) 20$(3/15) TIW 100$(12/12) 0$(0/12) YHI 92$(11/12) 0$(0/12) HHA 100$(35/35) 60$(21/35) NI229 75$(6/8) 0$(0/8) NI230 100$(8/8) 50$(4/8) NI334 100$(8/8) 25$(2/8) NI373 100$(10/10) 0$(0/10) NI252 100$(11/11) 0$(0/11) NI380 82$(9/11) 46$(5/11) NI382 100$(11/11) 0$(0/11) No. of applica- 8(11) 1(1) ble patientsl Note 1) Number of patients having an antibody binding rate of 100$
The number in the parenthesis shows number of patients having an antibody binding rate of more than 90$.
Example 3: Preparation of chimeric C25 antibody (CC25) 3-1) Isolation of V region gene of C25 antibody Isolation of a gene coding for mouse immunoglobulin variable (V) region was carried out as mentioned hereinbelow.
Whole RNAs were extracted from C25 cells in accordance with A
a , conventional procedure [Glober ed. "DNA cloning Vol. 1"
IRL press (1985)] and a single-stranded cDNA was synthesized using cDNA Synthesis System Plus (Amersham). Using this single-stranded cDNA as a template, a polymerase chain reaction (PCR) was carried out using DNA primers synthesized based on the nucleic acid base sequence of V region and J
region as classified by Kabat et al. (Sequences of Proteins of Immunological Interest 4th ed. , Public Health Service, NIH, Washington DC, 1987). HindIII and BamHI sites were included in the V region primer and J region primer, respectively. PCR
was conducted in accordance with the protocol of CETUS. That is, each 100 pmol of the primers were used and PCR reagents were a kit from CETUS. The PCR conditions were 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute, and PCR was conducted for 25 cycles. After PCR, the obtained DNA
fragments were subcloned into HIncII site of pUCl8 (manufac-tured by Takara Shuzo K.K.; the reagents used in this Example were those manufactured by Takara Shuzo K.K. or Toyobo K.K.
unless otherwise mentioned).
3-2) Nucleic acid base sequence of mouse V region gene of C25 antibody Using SequenaseTM Ver. 2 kit manufactured by Toyobo K.K., the V region gene incorporated in pUCl8 was sequenced.
The thus obtained nucleic acid base sequences of C25 antibody are shown in Figs. l9 and 20. Amino acid sequences deduced from the nucleic acid base sequences are also shown in Figs.
19 and 20. The nucleic acid base sequence of C25 antibody m showed a rearrangement specific to the V region gene and formed an open reading frame (ORF) which allows for expres-sion.
3-3) Construction of gene expressing chimeric C25 antibody (CHC25, CLC25) In order to confirm that the isolated V region gene of C25 antibody is actually a gene coding for V region responsible for anti-HIV activity, a mouse-human chimeric antibody was prepared. For expression of a chimeric antibody, expression vectors, AG-x and AG-yl, ,having a 8-actin (AG) promoter were used. AG-x contains a human x chain constant region gene and a DHFR gene as a selection marker whereas AG-yl contains a human yl chain constant region gene and a neo gene as a selection marker. The V region of C25 antibody as prepared above was digested with HindIII and BamHI restriction enzymes and the obtained VH and VL fragments were incorporated into the HindIII-BamHI site of AG-yl and AG-x, respectively (CH~25 and CLC25).
3-4) Expression of chimeric C25 antibody (CC25) The chimeric C25 antibody gene constructed as mentioned above was tested for its antibody activity in a transient expressian system using COS7 cell [ATCCCRL 1651].
A mixture of CHC25 and CLC25 plasmid DNAs was introduced into COS7 cells using an electroporation device manufactured by Bio-Rad in accordance with the protocol of Bio-Rad, and the COS7 cells were cultured in DMEM medium containing 10$ fetal calf serum (GIBCO) . After three days, the culture supernatant was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using anti-human IgG or PND peptides derived from various HIVs. As a result, an expression product of the mixture of CHC25 and CLC25 plasmid DNAs could bind with the anti-human IgG. The reactivity with various PND peptides was compared with that of the original C25 antibody and thereby the expression product showed a reaction spectrum similar to that of the original C25 antibody. Furthermore, the neutralizing activity against HIV-MN strain was also tested,, and as a result, the expression product was found to inhibit viral infection by 100 at a minimum effective concentration of 1 ug/ml like the mouse C25 antibody. Accordingly, it was proved that the C25 antibody V region gene isolated as mentioned above is exactly a gene coding for V region of an antibody having a neutraliz-ing activity.
3-5) Preparation of a cell strain producing chimeric C25 antibody at high rate For preparing a stable plasma cell line producing chimeric C25 antibody (CC25), the above-mentioned plasmid DNAs, CLC25 and CHC 25, were linearized with PvuI, and CHO-DG44 cells and P3-653 cells were transformed with a mixture of the linearized DNAs and lipofectin. As in the temporal expression of the chimeric antibody, a culture supernatant of Neo-resistant DHFR-resistant cells where the genes are intro-duced was collected, and the activity of antibodies present ~in the culture supernatant was measured by ELISA method using an anti-human IgG and various PND peptides. An expression product by cotranfection with CLC25 and CHC25 plasmid DNAs bound with various PND peptides, and hence, this transformed cell was cloned. Furthermore, an amplification procedure for DHFR gene was repeated by adding MTX at a concentration of 4 to 32 x 10' M. As a result, a stable plasma cell line which is resistant to MTX and produces CC25 antibody at a level of 50 to 70 ~g/ml.
Example 4: Preparation of humanized C25 antibody (RC25) 4-1) Transplantation of CDRs of C25 antibody V region gene by PCR mutagenesis In order to investigate an important region for antigen binding among VH and VL regions of the cloned C25 antibody, CDR (complementarity determining) regions of C25 antibody were transplanted into a human V region. This was carried out in accordance with the method for preparing a humanized antibody (Japanese Patent First Publication No. 4-141095). CDR region of C25 antibody VH region was transplant-ed into VH region having a framework (FR) region of human subgroup II (NEW: donated by Dr. Bendig of U.K. MRC Collabora-tive Centre) whereas CDR region of C25 antibody VL region was transplanted into VL region having FR region of human x chain (REI: W.Palm and N.Hilscmann, Z.Physiol.Chem., 356, 167 (1975)). Specifically, this was conducted by PCR-mutagenesis wherein mutation is introduced by PCR (Saiki, R.G. et al., Science, 239, 487 (1988)) into the humanized antibody u5.5 or ,0.53 which the present inventors have previously prepared.
Figs: 21, 22 and 23 show the synthetic primers used for mutagenesis which are annealed to a PCR template, i.e. VH and VL regions of the humanized antibody.
The condition of PCR was 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute and 25 cycles were repeated.
In the case of VH, using VH gene of the humanized antibody X5.5 (Japanese Patent First Publication No. 4-152893) as a template and primers #1 and #2, the 5' site of the VH
gene was amplified (Fig. 21) . This was linked via the central BglII site to a gene fragment (Fig. 22) which is prepared by amplification with primers #3 and #4 using the VH gene of the humanized antibody 0.5J3 (Hum.Antibod.Hybridomas, 2, p124 (1991)) as a template. On the other hand, in case of VL, the 5' site of VL was amplified using #5 and M13-M4 primers and the 3' site of VL was amplified using primer #8 and M13-reverse primer, and the resulting amplified genes were linked together to form KpnI site, which site is self-annealed with synthetic DNAs. #6 and #7 (Fig. 23).
Thus, V regions of the humanized C25 antibody (RHC25 and RLC25, respectively: cf. SEQ ID N0:2 and SEQ ID N0: 4) were obtained. These humanized V region fragments were digested with HindTII and BamHI restriction enzymes as in preparation of the chimeric antibody (cf. Example 3) and the resulting VH and VL fragments were incorporated into the HindIII-BamHI site of AG-yl and AG-x, respectively. Thus, expression vectors for humanized C25 antibody (RHC25 and RLC25, respectively) were prepared.
rte:
l,~:w,~, 4-2) Expression of humanized C25 antibody (RC25) The activity of antibodies obtained by the thus prepared humanized antibody gene was examined in a transient expression system of the above-mentioned COS7 cells. As in the transient expression of the chimeric antibody, the culture supernatant of cells where the gene was introduced was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using an anti-human IgG or PND peptides derived from various HIVs. As a result, expression products of a mixture of RHC25 and RLC25 plasmid DNAs bound various PND peptides. Furthermore, the expression products were examined for the neutralizing activity against HIV-MN strain, and as a result, it was found that they inhibit the viral infection by 100 at a minimum effective concentration of 1 ~g/ml like C25 mouse antibody and the chimeric antibody. Accordingly, among the amino acid sequence of C25 antibody as shown in Figs. 19 and 20, the transplanted CDR regions are an important, region for exerting the anti-HIV activity, and hence, the gene coding for these regions is the most important gene for preparing a recombinant antibody.
4-3 ) Preparation of cell line producing humanized C25 antibody at high rate In order to prepare a stable plasma cell line producing the humanized C25 antibody (RC25), the above-mentioned plasmid DNAs RLC25 and RHC25 were linearized with s~ ~PvuI and the linearized DNAs, as a mixture with lipofectin, were used for transformation of CHO-DG44 cells and P3-653 cells. As in the case of the transient expression of the chimeric antibody, the culture supernatant of neo-resistant DHFR-resistant cells wherein the gene is introduced was collected and the activity of antibodies present in the culture supernatant was measured by ELISA method using an anti-human IgG and various PND peptides. An expression product by cotranfection with RLC25 and RHC25 plasmid DNAs bound with various PND peptides, and hence, this transformed cell was cloned. Furthermore, an amplification procedure for DHFR gene was repeated by adding MTX at a concentration of 4 to 32 x 10' M. As a result, a stable plasma cell line which is resistant to MTX and produces RC25 antibody at a level of 80 to 100 ~g/ml was prepared.
Example 5: Effector activity of chimeric and humanized C25 antibodies 5-1) Antibody dependent complement-mediated cytotoxicity (ACC) C25 antibody, chimeric C25 antibody (CC25), humanized C25 antibody (RC25) and normal human IgG (NHG) were diluted in RPMI1640 containing 5~ FCS to a final concentration of 0.1 to 50 ug/ml and each 50 ~1 was added to a 96-well plate. Then, H9 cells with continuous infection of HIV-MN
(2.5 x 105 cells; 100 ~1) and fresh human serum (30 ~1) were added and the plate was allowed to stand at 37°C for 1 hour.
After 1 hour; the cells were dyed with trypan blue and the numbers of living cells and of dead cells were counted.
~ r, As shown in Fig. 24, 10 ~g/ml of CC25 antibody and RC25 antibody destroyed about 70~ of the target cells whereas C25 antibody and NHG showed a low cytotoxicity. This proved that the chimeric and the humanized C25 antibodies had a strong ACC activity.
5-2) Antibody dependent cell-mediated cytotoxicity (ADCC) Cells with continuous infection of HIV-MN were established using CEM cells resistant to NK cells (CEM-NKR) and used as a target cell. The infected cells (3 x 106 cells) were suspended in RPMI1640 containing 10~ FCS (1 ml) and labelled with SICr for 90 minutes. The cells (104 cells) were inoculated on a 96-well plate and thereto were added each 0.1 to 10 ug/ml of C25 antibody, CC25 antibody, RC25 antibody and NHG. Then, normal human peripheral blood lymphocytes (5 x 105 cells ) were added and the plate was incubated for 4 hours .
Percentage of destroyed cells was obtained in the usual manner.
As shown in Fig. 25, under condition of effector cells / target cells = 50, 1 ~.g/ml of CC25 antibody and RC25 antibody destroyed about 50~ of the target cells whereas C25 antibody showed as low cytotoxicity as that of NHG. This revealed that C25 antibody and NHG showed a low cytotoxicity activity and proved that the chimeric and humanized C25 antibodies had a strong ADCC activity.
Example 6: Effectiveness of humanized C25 antibody (RC25) to viruses derived from patients 6-1) Binding property of RC25 antibody with viruses derived from patients Since it is known that HIV occurs as quasispecies of variant viruses in a single patient, in accordance with the procedures of Example 2 (2-5), a base sequence of PND region of viral RNA in plasma and of proviral DNA in peripheral blood mononuclear cells derived from anti-HIV antibody positive patients was analyzed with multiple clones per one specimen, and the binding property of RC25 antibody with recombinant PND
proteins prepared based on the obtained sequence was examined .
Table 5 shows the binding property of RC25 antibody with PNDs of peripheral blood mononuclear cells derived from various patients in comparison with HIV-IIIB type virus-specific chimeric antibody (C(31) and MN type virus-specific humanized antibody (R~5.5). As is clear from Table 5, RC25 antibody bound with the PND recombinant proteins derived from various patients at a high rate of 91 to 100.
Table 5 HIV-infected Binding rate of neutralizing antibody individuals RC25 Ru5.5 C 1 YHI 91$(11/12) 8(1/12) 0(0/12) ASA 100(7/7) 0(0/7) 0(0/7) HHA 100(46/46) 69(32/46) 0(0/46) MNI 100$(24/24) 91(22/24) 0(0/24) KMO 92(12/13) 53(7/13) 0(0/13) MOK 100(24/24) 100(24/24) 0(0/24) 6-2 ) Neutralizing RC25 antibody viruses derived activity of to rom patient plasma RC25 antibody (2 mg/ml; 5 ul) was reacted with the patient plasma (50 ~1) used in the above 6-1 at room tempera-ture for 30 minutes. Culture was started by adding a mixture of RC25 antibody and plasma to normal human peripheral blood mononuclear cell system (50 ~l) wherein CD8-positive cells were removed with anti-CD8 antibody-bound magnetic beads (manufactured by Dinal) in ten times higher amount than that of the mononuclear cells in order to enhance production of viruses and, after activation with 10 ~g/ml of phytohemagglutinin for three days, the. mononuclear cells were cultured in a culture medium containing interleukin-2 for 4 days. After four days, the cells were washed with fresh medium and then culture was continued while collection of supernatant and culture exchange were conducted at an interval of 5 to 7 days. A concentration of HIV-1 p24 antigen in the collected culture supernatant was measured using a kit for detecting HIV antigen (manufactured by Dinabbott). In all the tested cases where viral infection from patient plasma to normal human peripheral blood mononuclear cells occurred, as shown in Fig. 26, HIV-IIIB type virus-specific chimeric antibody (CJ~1) and MN type virus-specific humanized antibody (R~5.5) used as a control antibody were ineffective, but the group in which R25 antibody was added showed less than detection limit of p24 antigen production, and thereby an apparent effect of RC25 antibody to inhibit infection was confirmed.
v3 6-3 ) Neutralizing activity of RC25 antibody to viruses derived from peripheral blood mononuclear cells of patients Mononuclear cells were prepared from the above-mentioned patient peripheral blood ( 20 to 40 ml ) , CD8-positive cells were removed by the above-mentioned procedure in order to enhance production of viruses, and then the cells were cultured in the presence of anti-CD3 monoclonal antibody (0.5 ~g/ml) for 3 to 5 days to produce viruses. Culture was further continued in the presence of 60, 120 and 240 ug/ml of RC25 antibody while collection of supernatant and culture exchange were conducted at an interval of 5 to 7 days, and a concentration of HIV-1 p24 antigen in the culture supernatant was measured as mentioned hereinabove. In all the tested cases using peripheral blood mononuclear cells of patients showing more than 90~ binding of RC25 antibody with the PND
proteins prepared based on proviral DNA in peripheral blood mononuclear cells, RC25 antibody inhibited production of viral antigen in a concentration dependent manner as shown in Figs.
27 to 30.
6-4 ) Neutralizing activity of RC25 antibody to viruses derived from peripheral blood mononuclear cells from patients after reconstitution of CD8 The above test procedures for confirming the effectiveness of the present invention, which mimic in vivo style of HIV infection by activating latent proviruses in infected cells of patients to induce viral infection, were ~~'! ~ conducted under quite severe conditions wherein CD8-positive a~
cells were removed and viral activation was artificially introduced by the anti-CD3 antibody. Accordingly, RC25 antibody which was proven to be extremely effective in the test procedures is expected, if clinically applied to patients, to be much more effective than in the test proce-dures.
Thus, the same test procedures mentioned hereinabove were conducted with reconstitution of one tenth amount of the removed CD8-positive cells at the addition of the antibody.
As a result, as shown in Fig. 31, an effective concentration of RC25 antibody was reduced to as low as 30 ~g/ml, suggesting that RC25 antibody is quite effective in clinical application.
HIV is a highly variable virus which infects a single patient as quasispecies of variant viruses having a different amino acid sequences. In order to exert treating efficacy even to such quasispecies of variant viruses, it is essential to identify a conserved region among HIV strains and establish a neutralizing antibody which recognizes said conserved region. V3-PND region of HIV is an important site which induces a strong neutralizing antibody and a monoclonal antibody to PND-Tip region comprising the conserved sequence GPGR is believed to have a broad neutralization spectrum.
The present inventors have established a novel method for immunization which allows for efficient preparation of the neutralizing monoclonal antibody recognizing the region ,~v '::'conserved among each strain, and have established C25 monoclonal antibody which neutralizes many HIV strains isolated from infected individuals. Furthermore, by humaniz-ation of said antibody, the antibody was reduced in antigenic-ity in humans and endowed with the ability to destroy infected cells in Fc region dependent manner. Furthermore, contrary to the conventional HIV neutralizing antibodies which showed effectiveness only to a single virus isolated in a laboratory, the antibody of the present invention was confirmed to be apparently effective to quasispecies of many variant viruses within the body of a patient due to its broad neutralization spectrum. Accordingly, the antibody of the present invention can respond to diversity and variability of various HIVs and can be clinically applicable as a medicament for prevention, treatment or diagnosis of HIV.
215'~~7~
SEQUENCE LISTING
SEQ ID N0: 1 SEQUENCE LENGTH: 355 SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: cDNA to genomic RNA
ORIGINAL SOURCE
ORGANISM: mouse .
SEQUENCE
Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Thr Ser Val Lys Met Phe Cys Lys Ala Ala Gly Tyr Thr Phe Thr Asn Ser Trp Ile Gly Trp Phe Arg Gln Arg Pro Gly His Gly Leu Glu Trp Ile Gly Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr _ 215'874 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys g5 90 95 Ser Arg Gly Ile Pro Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser SEQ ID N0: 2 SEQUENCE LENGTH: 354 SEQUENCE TYPE: nucleic acid STR.ANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: other nucleic acid (modified nucleic acid) ORIGINAL. SOURCE
ORGANISM: mouse and human SEQUENCE
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Ser _ 2157874 Trp Ile Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly Lys Ala Thr Met Thr Ala Asp Thr Ser Thr Asn Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ser Arg Gly Ile Pro Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser SEQ ID N0: 3 SEQUENCE LENGTH: 340 SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: cDNA to genomic RNA
ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
GAC ATT GTG ATG ACA CAG TCT CCA TCC TCC CTG ACT GTG ACA GCA GGA
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly GAG AAG GTC ACT ATG AGC TGC AAG TCC AGT CAG AGT CTG TTA AAC AGT
Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 . 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Gly Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Glu Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys SEQ ID N0: 4 SEQUENCE LENGTH: 339 215'~87~
SEQUENCE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: other nucleic acid (modified nucleic acid) ORIGINAL SOURCE
ORGANISM: mouse and human SEQUENC E
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 , 15 Asp Arg Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro ~ys Leu Leu Ile Tyr Trp Ala Ser Thr Gly Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Asn 215'874 Asp Tyr Ser Tyr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys SEQ ID NO: 5 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Xaa Gly Pro Xaa Arg Xaa SEQ ID N0: 6 SEQUENCE.LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Xaa Gly Pro Gly Arg Ala SEQ ID N0: 7 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Ile Gly Pro Gly Arg Xaa SEQ ID N0: 8 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Val Gly Pro Gly Arg Thr SEQ ID N0: 9 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
_ 2f 57874 Val Gly Pro Gly Arg Ser SEQ ID N0: 10 SEQUENCE LENGTH: 6 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide ORIGINAL SOURCE
ORGANISM: human immunodeficiency virus SEQUENCE
Ile Gly Pro Ala Arg Ala SEQ ID N0: 11 SEQUENCE LENGTH: 5 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT, intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Asn Ser Trp Ile Gly SEQ ID N0: 12 SEQUENCE LENGTH: 17 SEQUENCE TYPE: amino acid . 2~.~ X874 TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly SEQ ID N0: 13 SEQUENCE LENGTH: 9 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Gly Ile Pro Gly Tyr Ala Met Asp Tyr SEQ ID N0: 14 SEQUENCE LENGTH: 17 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
L~ys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr SEQ ID N0: 15 SEQUENCE LENGTH: 7 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE-Trp Ala Ser Thr Gly Glu Ser SEQ ID N0: 16 SEQUENCE LENGTH: 9 SEQUENCE TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: peptide FRAGMENT: intermediate fragment _ 215'874 ORIGINAL SOURCE
ORGANISM: mouse SEQUENCE
Gln Asn Asp Tyr Ser Tyr Pro Trp Thr
Claims (19)
1. A monoclonal antibody produced by the hybridoma deposited with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology and having the accession number of FERM BP-4561, or a fragment thereof which has an ability to neutralize HIV having an epitope, to which said monoclonal antibody binds, defined by the amino acid sequence of Xa1-Gly-Pro-Xa2-Arg-Xa3 wherein Xa1 is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr;
Xa2 is Gly or Ala; Xa3 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr within the principal neutralization domain (PND) in the third variable region (V3) of glycoprotein antigen having a molecular weight of about 1.2 x 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV).
Xa2 is Gly or Ala; Xa3 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr within the principal neutralization domain (PND) in the third variable region (V3) of glycoprotein antigen having a molecular weight of about 1.2 x 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV).
2. The monoclonal antibody or fragment thereof as set forth in claim 1, which has an ability to neutralize HIV
having an epitope, to which said monoclonal antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said principal neutralization domain (PND).
having an epitope, to which said monoclonal antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said principal neutralization domain (PND).
3. The monoclonal antibody or fragment thereof as set forth in claim 1 or 2, wherein an amino acid sequence of complementarity determining regions 1 to 3 (CDR1 to CDR3) of H
chain variable region has the following sequences:
CDR1: Asn Ser Trp Ile GIyCDR2:Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly CDR3: Gly Ile Pro Gly Tyr Ala Met Asp Tyr.
chain variable region has the following sequences:
CDR1: Asn Ser Trp Ile GIyCDR2:Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly CDR3: Gly Ile Pro Gly Tyr Ala Met Asp Tyr.
4. The monoclonal antibody or fragment thereof as set forth in claim 3 wherein an amino acid sequence of H chain variable region is the amino acid sequence as shown in SEQ ID
NO: 1.
NO: 1.
5. The monoclonal antibody or fragment thereof as set forth in claim 1 or 2, wherein an amino acid sequence of complementarity determining regions 1 to 3 (CDR1 to CDR3) of L
chain variable region has the following sequences:
CDR1: Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr CDR2: Trp Ala Ser Thr Gly Glu Ser CDR3: Gln Asn Asp Tyr Ser Tyr Pro Trp Thr.
chain variable region has the following sequences:
CDR1: Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr CDR2: Trp Ala Ser Thr Gly Glu Ser CDR3: Gln Asn Asp Tyr Ser Tyr Pro Trp Thr.
6. The monoclonal antibody or fragment thereof as set forth in claim 5 wherein an amino acid sequence of L chain variable region is the amino acid sequence as shown in SEQ ID
NO: 3.
NO: 3.
7. A process for preparing a monoclonal antibody produced by the hybridoma deposited with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology and having the accession number of FERM BP-4561 or a fragment thereof which has an ability to neutralize HIV having an epitope, to which said monoclonal antibody binds, defined by the amino acid sequence of Xa1-Gly-Pro-Xa2-Arg-Xa3 wherein Xa1 is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Xa2 is Gly or Ala; Xa3 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr within the principal neutralization domain (PND) in the third variable region (V3) of glycoprotein antigen having a molecular weight of about 1.2 × 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV); said process comprising. serially immunizing an animal with a plurality of peptides, each of said plurality of peptides comprising the Gly-Pro-Gly-Arg sequence in common but having different amino acid sequences in the flanking regions, removing spleen cells from said animal, fusing the spleen cells with myeloma cells to produce hybridoma cell lines, and screening the resultant hybridoma cell lines for hybridoma cell lines which produce said monoclonal antibody.
8. An H chain of recombinant anti-HIV antibody which has an ability to neutralize HIV having an epitope, to which said anti-HIV antibody binds, defined by the amino acid sequence of Xa1-Gly-Pro-Xa2-Arg-Xa3 wherein Xa1 is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Xa2 is Gly or Ala; Xa3 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr within the principal neutralization domain (PND) in the third variable region (V3) of glycoprotein antigen having a molecular weight of about 1.2 × 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV), wherein either the complementarity determining regions 1 to 3 (CDR1 to CDR3) and several amino acid residues in framework region in the vicinity of CDR1 to CDR3 or the whole variable region are derived from a mouse antibody produced by the hybridoma deposited with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology and having the accession number FERM BP-4561, and the rest of the H chain are derived from a human antibody.
9. The H chain of a recombinant anti-HIV antibody as set forth in claim 8, wherein said antibody has an ability to neutralize HIV having an epitope, to which said anti-HIV
antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said PND.
antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said PND.
10. The H chain of a recombinant anti-HIV antibody as set forth in claim 8 or 9, wherein an amino acid sequence of complementarity determining regions 1 to 3 (CDR1 to CDR3) of H chain variable region has the following sequences:
CDR1: Asn Ser Trp Ile Gly CDR2: Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly CDR3: Gly Ile Pro Gly Tyr Ala Met Asp Tyr.
CDR1: Asn Ser Trp Ile Gly CDR2: Asp Ile Tyr Pro Gly Gly Gly Tyr Thr Asn Tyr Asn Glu Ile Phe Lys Gly CDR3: Gly Ile Pro Gly Tyr Ala Met Asp Tyr.
11. The H chain of a recombinant anti-HIV antibody as set forth in claim 10, which is an H chain of a chimeric antibody, and wherein an amino acid sequence of H chain variable region is the amino acid sequence of amino acid Nos.
1 to 118 as described in SEQ ID NO: 1.
1 to 118 as described in SEQ ID NO: 1.
12. The H chain of a recombinant anti-HIV antibody as set forth in claim 10, which is an H chain of a humanized antibody, and wherein an amino acid sequence of H chain variable region is the amino acid sequence of amino acid Nos .
1 to 118 as described in SEQ ID NO: 2.
1 to 118 as described in SEQ ID NO: 2.
13. An L chain of a recombinant anti-HIV antibody which has an ability to neutralize HIV having an epitope, to which said anti-HIV antibody binds, defined by the amino acid sequence of Xa1-Gly-Pro-Xa2-Arg-Xa3 wherein Xa1 is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Xa2 is Gly or Ala; Xa3 is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr within the principal neutralization domain (PND) in the third variable region (V3) of glycoprotein antigen having a molecular weight of about 1.2 × 10 5 daltons (gp120) on a coating membrane of human immunodeficiency virus (HIV), wherein either the complementarity determining regions 1 to 3 (CDR1 to CDR3) and several amino acid residues in a framework region in the vicinity of CDR1 to CDR3 or the whole variable region are derived from a mouse antibody produced by the hybridoma deposited with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology and having the accession number FERM BP-4561, and the rest of the L chain are derived from a human antibody.
14. The L chain of a recombinant anti-HIV antibody as set forth in claim 13, wherein said antibody has an ability to neutralize HIV having an epitope, to which said anti-HIV
antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said PND.
antibody binds, defined by the amino acid sequences of Xaa-Gly-Pro-Gly-Arg-Ala wherein Xaa is Ala, Ile, Leu, Met, Asn, Pro, Gln, Ser, Thr, Val or Tyr; Ile-Gly-Pro-Gly-Arg-Xaa wherein Xaa is Ala, Cys, Asp, Glu, Gly, His, Ile, Lys, Leu, Met, Asn, Gln, Arg, Ser, Thr, Val, Trp or Tyr; Val-Gly-Pro-Gly-Arg-Thr; Val-Gly-Pro-Gly-Arg-Ser; or Ile-Gly-Pro-Ala-Arg-Ala within said PND.
15. The L chain of a recombinant anti-HIV antibody as set forth in claim 13 or 14, wherein an amino acid sequence of complementarity determining regions 1 to 3 (CDR1 to CDR3) of L chain variable region has the following sequences:
CDR1: Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr CDR2: Trp Ala Ser Thr Gly Glu Ser CDR3: Gln Asn Asp Tyr Ser Tyr Pro Trp Thr.
CDR1: Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asp Gln Lys Asn Tyr Leu Thr CDR2: Trp Ala Ser Thr Gly Glu Ser CDR3: Gln Asn Asp Tyr Ser Tyr Pro Trp Thr.
16. The L chain of a recombinant anti-HIV antibody as set forth in claim 15, which is an L chain of a chimeric antibody, and wherein an amino acid sequence of variable region is the amino acid sequence of amino acid Nos. 1 to 113 as described in SEQ ID NO: 3.
17. The L chain of a recombinant anti-HIV antibody as set forth in claim 15, which is an L chain of a humanized antibody, and wherein an amino acid sequence of variable region is the amino acid sequence of amino acid Nos. 1 to 113 as described in SEQ ID NO: 4.
18. A recombinant anti-HIV antibody which comprises the H chain of a recombinant anti-HIV antibody as set forth in claim 8 and the L chain of a recombinant anti-HIV antibody as set forth in claim 13.
19. A process for preparing an anti-HIV antibody which comprises constructing an expression vector capable of expressing the recombinant anti-HIV antibody as set forth in claim 18, expressing said expression vector in an animal cell and collecting said antibody.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP7891393 | 1993-03-11 | ||
JP78913/93 | 1993-03-11 | ||
PCT/JP1994/000371 WO1994020632A1 (en) | 1993-03-11 | 1994-03-09 | Anti-hiv monoclonal antibody |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2157874A1 CA2157874A1 (en) | 1994-09-15 |
CA2157874C true CA2157874C (en) | 2006-04-18 |
Family
ID=36250865
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002157874A Expired - Lifetime CA2157874C (en) | 1993-03-11 | 1994-03-09 | Anti-hiv monoclonal antibody |
Country Status (1)
Country | Link |
---|---|
CA (1) | CA2157874C (en) |
-
1994
- 1994-03-09 CA CA002157874A patent/CA2157874C/en not_active Expired - Lifetime
Also Published As
Publication number | Publication date |
---|---|
CA2157874A1 (en) | 1994-09-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0690132B1 (en) | Anti-hiv monoclonal antibody | |
AU668374B2 (en) | Reactive neutralizing human anti-GP120 recombinant antibody, DNA coding the same and use thereof | |
US20040259075A1 (en) | Broadly cross-reactive neutralizing antibodies against human immunodeficiency virus selected by env-cd4-co-receptor complexes | |
US5854400A (en) | Monoclonal antibodies which neutralize HIV-1 infection | |
KR100304333B1 (en) | Recombinant humanized anti-human immunodeficiency virus antibody | |
EP0678523B1 (en) | Recombinant anti-hiv antibody and preparation thereof | |
CA2094611C (en) | Hiv immunotherapeutics | |
EP0910659B1 (en) | Antibodies against a complex of cd4 and a chemokine receptor domain, and their use against hiv infections | |
EP0327000B1 (en) | Gene fragments coding for the variable region of an anti-hiv antibody, chimeric anti-hiv antibodies expressed using the same, and process for their preparation | |
WO1994028933A1 (en) | Bispecific human monoclonal antibodies specific for human immunodeficiency virus | |
JPH06141885A (en) | Monoclonal antibody | |
EP0523056A1 (en) | Neutralizing and/or adcc mediating monoclonal hiv antibody | |
EP0516135B1 (en) | Human immunodeficiency virus-related immune preparation | |
CA2157874C (en) | Anti-hiv monoclonal antibody | |
CN115160435A (en) | Bispecific anti-HIV-1 antibody | |
Nakamura et al. | Virolysis and in vitro neutralization of HIV-1 by humanized monoclonal antibody hNM-01 | |
JPH06125783A (en) | Recombinant anti-hiv antibody and its preparation | |
RU2134724C1 (en) | Humanized antibody and method of preparation thereof, polynucleotyl (versions), and hybridon cell line (versions) | |
KR100282576B1 (en) | Human Immunodeficiency Virus Immunotherapy | |
AU1891992A (en) | Chimeric immunoglobulin molecules |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |
Effective date: 20140310 |