JPH06141885A - Monoclonal antibody - Google Patents

Abstract

PURPOSE:To obtain the novel monoclonal antibody or its fragment having an ability for substantially neutralizing human immunodeficiency virus(HIV) by binding to a glucoprotein antigen (gp 120) existing on the outer coat membrane of the human immunodeficiency virus and having a mol.wt. of approximately 120000 dalton. CONSTITUTION:A synthetic peptide corresponding to the sixth-25th (NNTRKAIRVGPGRTLYATRR) of the amino acid sequence in the outer coat membrane glucoprotein PND (gp 120) of a separated virus originated from an HIV-infected patient is used as an immunogen to prepare a monoclonal antibody having a neutralization activity against plural strains including this virus. A gene fragment coding the variable region of the monoclonal antibody or the complementarity-determining group of the region is transduced into a human antibody gene to provide a chimera antibody or modified antibody having an HIV-resistant neutralization activity.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an immunological technique which provides a novel substance useful for prevention, treatment, or diagnosis of viral infection, and useful for biochemical and histological research. More specifically, human immunodeficiency virus (HI) recognized as a causative virus of acquired immunodeficiency syndrome (AIDS).
V) and a hybridoma that secretes the antibody. Further, it relates to a chimeric antibody and a modified antibody using a gene fragment encoding the variable region of the monoclonal antibody or a part thereof, and a method for preparing the antibody.

[0002]

BACKGROUND OF THE INVENTION HIV is a human retrovirus that is responsible for a range of diseases such as acquired immunodeficiency syndrome (AIDS) and AIDS-related syndrome (ARC). As is well known, the prototype of HIV is Human T-Lymphotropic Virus Typ (III).
e III; HTLV-III) and lymphoma disease-related virus (Lymphad
enopathy Associated Virus; LAV). Today, these diseases have become a major problem worldwide, but effective vaccines or robust treatments for them have not yet been provided.

The most characteristic hematological abnormality associated with AIDS is a functional and quantitative defect of helper / inducer T lymphocytes carrying the CD4 antigen on the cell surface. HIV
The immunodeficiency caused by various disorders causes various obstacles to the biological defense mechanism of the infected host (human), and for example, an opportunistic infection such as Karini pneumonia or a malignant tumor that is not normally observed such as Kaposi's sarcoma is frequently caused. Let Immunodeficiency due to HIV is progressive, irreversible, and has a very high mortality rate, which is estimated to reach 100% in several years.

In the first step of HIV infection of T cells, in the case of viral particle infection, the receptor CD
Viral particle binding to the four antigens occurs. On the other hand, HIV also spreads infections through cell-to-cell infections. That is, already infected cells and non-infected cells cause cell fusion, and especially in organs such as the brain and lymph nodes, syncytia (multinucleated giant cells) are formed. Such syncytia formation has also been observed in in vitro experimental systems.
It is said that the cause of the deficiency of CD4-positive cells is that T cells infected with HIV are susceptible to the cytotoxic effect caused by HIV.

HIV is this helper / inducer T
It is known that not only the cell group is infected, but also the monocyte / macrophage group is infected. In addition, most monocytes / macrophages and some T cells
It is also known that it is resistant to the cytotoxic effect caused by, retains the virus for a long time, and continues to produce the virus. In addition, in the serum of humans infected with HIV,
Antibodies against E. coli exist, but their neutralizing activity is generally known to be low (Weiss et al., Nature, 316 , p. 6).
9-72 (1985)).

As a structural protein antigen of HIV, the core (ga
g) The presence of antigens and envelope antigens is well known. The outer coat of HIV contains a 160-kilodalton precursor glycoprotein (gp160) and the 120-kilodalton (gp120) and 41-kilodalton (gp41) membrane glycoproteins present in its cleavage. . Among them, gp120
Is highly important from the following viewpoints. (1) Immunization of experimental animals with gp120 or certain fragments of gp120 yields polyclonal neutralizing antibodies. This means that gp120 is one of the target molecules for antibodies with at least virus neutralizing capacity (Lasky et al.
al., Science, 233 , p.209-212 (1986)). (2) In the first stage of HIV infection, gp120 binds to the viral receptor CD4 molecule. This means that gp120 is the most important molecule for HIV infection (McDougal et al., Science 231 , p. 3).
82-385 (1986)). (3) HIV-induced syncytium formation, that is, HIV cell-to-cell infection, is caused by gp120 and CD4 in uninfected cells.
Caused by direct interaction with the molecule (Lifsonet a
L., Nature, 323 , p.725-728 (1985)).

Various monoclonal antibodies against the constituent proteins of HTLV-III and LAV, for example, against p24 which is one of the core antigens inside the virus (Veronese
FD, Proc. Natl. Acad. Sci., USA 82 , p.5199-52
02 (1985)), for the pol gene product encoding viral reverse transcriptase (Veronese FD, Scien.
ce, 231 , p.1289-1291 (1986)), and for gp41, another constituent protein of the outer membrane (Veronese FD,
Science, 229 , p.1402-1405 (1985)) is known. However, none of these known monoclonal antibodies react with the gp120 antigen, which is important for the treatment and prevention of AIDS. On the contrary, it has been reported that immunization with purified LAV did not yield a monoclonal antibody capable of effectively neutralizing the gp120 antigen (Ch
assange J. et al., J. Immunol. 136 , p. 1442-1445 (1
985)).

Various attempts have been made to obtain a monoclonal antibody which has the ability to effectively neutralize the AIDS virus and is useful for the prevention and diagnosis of AIDS. A monoclonal antibody that reacts with the gp120 antigen was obtained using a synthetic peptide as an immunogen. The epitope recognized by this antibody was HI.
It was reported to be within the 503-532nd amino acid sequence of the outer coat of V (Chanh TC et al., Eur. J. Immun
ol. 16 , p. 1455-1468 (1986)). However, the reported binding activity of this antibody was weak both by Western blotting and by cell surface fluorescent staining. Furthermore, this report does not provide any proof of the existence of the neutralizing capacity of the monoclonal antibody.

In the above-mentioned situation, Matsushita et al. Reported that a monoclonal antibody (0.5%) capable of binding to gp120 of HTLV-III _B strain and strongly neutralizing the virus (0.5
β) was prepared (Matsushita et al., J. Virology, 6
2 , p. 2107-2114 (1988)). Here, the epitope recognized by this antibody is the third variable region (V3
Domain). This is amino acid number 303-338
Is a region corresponding to, and is a part of the loop structure formed by SS-bonding cysteine residues at the 303rd and 338th positions on both ends. Recently, the epitope recognized by this antibody is the principal neutralizing determinan.
t; PND) and is a major target for therapeutic antibody and vaccine development. Next, the present inventors linked the variable (V) region gene of the 0.5β antibody involved in antigen binding to the human IgG ₁ constant (C) region gene in order to convert it into a human antibody that can be clinically applied. Human chimeric antibody (C
β1) was prepared (Matsushita et al., AIDS Res., in
press, (1992)). In addition, as a result of carrying out a passive immunity test of chimpanzees using the human chimeric antibody Cβ1 in order to examine the efficacy in vivo, it was already reported that primary infection can be completely protected (EminiE.A. Et al., Nature, 355 ,
p.728 (1992)). Furthermore, H, which is considered to be epidemiologically high
A monoclonal antibody (μ5.5) having the ability to bind to the PND of gp120 of TLV-III _MN strain and strongly neutralize the virus.
, And μ39.1) were also produced and a patent application has already been filed (Japanese Patent Application No. 2-188300).

However, 0.5β is HTLV-III _B ,
HTLV-II, which is predominantly epidemiologic for μ39.1 and μ5.5 antibodies
Although it can neutralize the _IMN strain, there are many other clinically isolated viruses reported in HIV (Hattori et a
l., AIDS Res and Human Retroviruses, 7 , p.825, (19
91)), and all of them cannot be completely neutralized by these three antibodies.

On the other hand, there are some reports on neutralizing antibodies against constant regions that are well conserved among strains with epitopes other than PND, but all of them are polyclonal antibodies with low neutralizing activity (Chanh TC et al., EMBO J, 5 , p.30
65, (1986)) and monoclonal antibody (Dalgleish AG e
t al., Virology, 165 , p.209, (1988); Sun N. et a
L., J Virol., 63 , p. 3579, (1989)), and there was a problem in the prevention and treatment of AIDS.

[0012]

The object of the present invention is to prevent HI from being neutralized by the previously reported neutralizing antibodies.
The purpose of the present invention is to provide a monoclonal antibody capable of substantially neutralizing V and a hybridoma capable of producing the antibody, and to cope with the diversity of isolated viruses derived from HIV-infected persons. A further object of the present invention is to provide a human-type antibody that is clinically applicable and a method for preparing the same, since the monoclonal antibody is a mouse-derived antibody that is difficult to apply to humans. Here, the term neutralization is due to the inhibition of cell free infection of HIV particles and / or the interaction of gp120 with CD4.
V means the prevention of cell-to-cell infection such as syncytia formation between infected and uninfected cells.

[0013]

According to the present invention, a novel monoclonal antibody having the ability to bind to the PND of HIV gp120 that cannot be neutralized by known neutralizing HIV antibodies and to substantially neutralize the virus, or a novel monoclonal antibody thereof is provided. Fragments are provided.
Hereinafter, the monoclonal antibody of the present invention and a method for preparing the same will be outlined.

The monoclonal antibody according to the present invention is H
Suitable synthetic peptides prepared based on the amino acid sequences of clinically isolated viral proteins from infected individuals other than TLV-III _B and HTLV-III _MN , preferably the PND of gp120 below.
Mice were immunized with a synthetic peptide corresponding to a part of the amino acid sequences 6 to 25 (described in the sequence listing, SEQ ID NO: 3 where the amino acid number of N-terminal Cys is 1), and the resulting spleen cells were isolated. For example, it can be prepared by fusing with mouse myeloma cells, selecting cells that react with the synthetic peptide from the obtained hybridomas, and culturing the cells. Asn-Asn-Thr-Arg-Lys-Ala-Ile-Arg-Val-Gly-Pro-Gly-Ar
After g-Thr-Leu-Tyr-Ala-Thr-Arg-Arg, the amino acid number of PND of HIV gp120 is N of PND.
The Cys on the end side is expressed as 1.

Regarding the preparation of this hybridoma, Ko
Based on the method of hler and Milstein (Nature, 256, p.495 (1975)). As the antigen, a synthetic peptide prepared on the basis of the amino acid sequence of the viral protein is preferably used, but an immunizing antigen obtained by another method can be used as well. As the immunizing mouse, BALB / c mouse, F1 mouse of BALB / c mouse and other mouse, etc. are used. Immunization is 1 mouse (4-8 weeks old, 20-30
For g), 20 to 200 μg of the antigen is used, and every 2 to 3 weeks, 3 to 6 times. The breeding of mice and the collection of spleen cells follow conventional methods.

As myeloma cells, MOPC-21NS / 1 (N
ature, 256 , p495 (1975)), SP2 / 0-Ag14 (Nature, 27
6 , p.269 (1979)), p3X63Ag8-U1 (Eur.J.Immunol. 6 , p.
511 (1976)), p3X63-Ag8 (Nature, 256 , p.495 (197
5)), p3X63-Ag8.653 (J.Immunol. 123 , p.1548 (197
9)) and the like are preferably used. Spleen cells and myeloma cells were mixed at a ratio of 1: 1 to 10: 1 and fusion was performed using NaCl (about 0.85
%), Dimethyl sulfoxide (10 to 20 v / v%), and polyethylene glycol having a molecular weight of 1,000 to 6,000 in a phosphate buffer (pH 7.2 to 7.4). Fusion is performed by incubating a mixture of both cells at 35-37 ° C for 1-5 minutes. The selection of fused cells (hybridomas) is hypoxanthine (1.3 to 1.4 mg / dl), aminopterin (18 to 20 μg / dl), thymidine (375 to 4,000 μl / dl), streptomycin (50 to 100 μg / ml), penicillin. (50-10
0 unit / ml), glutamine (3.5 ~ 4.0g / l), fetal bovine serum (1
Basal medium containing 0-20%) is used to select for growing cells. As the basal medium, RPMI1640 medium, Eagle's MEM medium and the like which are generally used for culturing animal cells are used. The fused cells are cloned at least three times by the limiting dilution method.

When the hybridoma is cultured in the same manner as in the culture of normal animal cells, the antibody of the present invention can be obtained in the medium as a result. For example, 2 to 5 × 10 ⁶ hybridomas were treated with streptomycin (50 to 100 μg / ml), penicillin (50 to 100 units / ml), glutamine (3.5 to 4.0 g / l),
RPMI 1640 medium containing fetal bovine serum (10-20%) 10-
Using 20 ml, in a flask in the presence of 5% CO ₂ , at 35 to 37 ° C., 3
Antibody is secreted into the culture medium by culturing for ~ 7 days,
Accumulated. Further, the antibody of the present invention can be accumulated in ascites by transplanting the hybridoma into the abdominal cavity of a pristane-treated nude mouse or BALB / c mouse and allowing it to grow. That is, 0.5 to 1 ml of pristane was inoculated into the abdominal cavity of these mice, and 5 to 10 ⁶ to 1 × 10 ⁷ hybridomas were transplanted to the abdominal cavity in the second to third weeks. Ascites usually accumulates after 7 to 10 days and is collected. Monoclonal antibodies in the culture and ascites are purified by means of affinity chromatography using Affigel Protein A MAPS-II kit (BIO-RAD).

The obtained monoclonal antibody was Arg-Ile-Gly-Pro-Gly-Arg in the PND of gp120 on the outer coat of HIV.
Alternatively, it was revealed that HIV containing any amino acid sequence of Arg-Val-Gly-Pro-Gly-Arg can be substantially neutralized. In detail, it has the following properties. (a) Ig
(B) has the ability to neutralize HIV containing an amino acid sequence consisting of a combination of (b) the PND of HIV gp120 PNDs consisting of a combination of the following amino acids: ₉ = Arg, Lys, Ser, Ile, Glu, Pro, Gln, Gly, Me
t, Thr X ₁₀ = Lys, Arg, Asn, Gln X ₁₁ = Ser, Gly, Arg, His, Lys, Ala X ₁₂ = Ile, Leu, Met, Thr, Val, Glu, Phe X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Val, Asn, Thr, Arg, Lys, Pro, Ser, Trp X ₂₀ = Phe, Ile, Val, Leu, Tyr, Trp, Thr, Ser, His X ₂₁ = Tyr, Val, His, Leu, Phe, Arg, Ser, Met, Ile X ₂₂ = Thr, Ala, Val, Gln, Tyr, Ser (c) Having the ability to prevent viral particles from infecting CD4-positive cells by binding to the surface of HIV particles containing them, and (d) binding to the surface of cells infected with HIV containing the above amino acid sequence. Has the ability to block syncytia formation induced by infected and uninfected cells.

The monoclonal antibody of the present invention is HI
The 9th to 22nd amino acid sequences of PND of V gp120 have the ability to neutralize HIV containing an amino acid sequence consisting of a combination selected from the following amino acid sequences. X ₉ = Arg, Ser, Lys X ₁₀ = Lys, Arg X ₁₁ = Gly, Ala X ₁₂ = Ile X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Thr X ₂₀ = Val, Ile, Leu X ₂₁ = Tyr, Met, Leu X ₂₂ = Thr, Ala, Gln, Ser

That is, the monoclonal antibody according to the present invention is used for HIV cell-to-cell infection such as syncytium formation.
cell infection and / or HIV infection (cell fre
e infection) can be strongly prevented. Therefore, the monoclonal antibody according to the present invention can be used for the prevention and treatment of AIDS. It is also useful for suppressing the AIDS virus growth in human hosts.
Since the monoclonal antibody according to the present invention has a strong neutralizing activity against HIV, it is possible to prevent infection of non-infected T cells with the virus. A typical example of the hybridoma producing the monoclonal antibody of the present invention is
It has been deposited at the Institute of Microbial Science and Technology, Institute of Industrial Science and Technology (MICRO) under the accession number Micromachine Lab. No. 12973 (FERM P-12973).

The monoclonal antibody obtained by the present invention is derived from mouse, but the mouse antibody has side effects (when the mouse monoclonal antibody is administered to human, it may cause side effects such as anaphylactic shock and serum disease as a heterologous protein. It is difficult to apply it clinically in view of the above), and finally, the use of human monoclonal antibody is preferable. However, the hybridoma method and Epstei
n In the preparation of human monoclonal antibodies by transformation with Barr Virus, there are many problems to overcome in the preparation of antibodies with the desired specificity, and it is very difficult in practice compared to the preparation of mouse monoclonal antibodies. Accompanied by.

As a method for overcoming these problems and preparing a human antibody that can be applied clinically, preparation of a chimeric monoclonal antibody is considered. This is because the specificity of the antibody, that is, the V region involved in antigen binding has a mouse antibody-derived amino acid sequence and the constant region has an amino acid sequence derived from a human antibody, and the gene recombination technology is applied. It is produced by doing. Further, in order to further reduce the antigenicity of the mouse antibody molecule to humans, only the complementarity determining regions (CDR1 to CDR3), which are important sites for determining the binding ability of the antibody molecule, among the amino acid sequences of the V region are used in the mouse. It is also an effective means to prepare a modified antibody in which the amino acid sequence is derived from the antibody and the rest is derived from the human antibody.

Isolation of the V region gene and determination of the amino acid sequence are indispensable for producing the above-described recombinant antibody molecule. Generally, a large number of V region constituent genes exist in the V region gene of an antibody. For example, the V gene group of the H chain V region that determines the specificity of a mouse antibody has at least 100 different genes, the D gene group has 11 or more genes, and the J gene group has 4 genes. Similarly, the V gene group of the Vκ chain has about 300 or more genes, and the J gene group has 4 genes.

The V region gene can be isolated by conventional gene manipulation techniques. For example, the chromosome D of the cell
From NA (eg, T. Maniatis "Molecular Cloni
ng "Cold Spring Harbor Lab. (1982)) or a method using the mRNA of the cell as a material (for example, DMGlover edit" DN).
CDNA by A cloning Vol.I "IRL press (1985))
Is used to clone the V region gene.
Both of these methods have been reported as nucleobase sequences of mouse immunoglobulin genes as probes for V region gene cloning (for example, Sakano et al., Nature, 28).
6, p676, (1980); EEMax et al., J. Biol. Chem., 256, p511.
6, (1981)) and a DNA probe or the like synthesized according to the method described above can be used. Also, cloning using PCR (polymerase chain reaction) is possible (R. Orlando,
et al., Proc. Natl. Acad. Sci. USA, 86, 3833 (198
9); WD Huse, et al., Science, 246, 1275 (198
9)).

Anti-HI cloned in this way
The amino acid sequences of the H chain and L chain of the V region of the V neutralizing monoclonal antibody and the nucleotide sequences encoding them are shown in FIGS. 6 and 7. As a result of the gene analysis of these sequences, the gene fragment of the present invention encoding the anti-HIV antibody V region has the following specific gene sequence: (H chain) (a) Thr -Phe-Gly-Met-Gly-Val-Ser (b) His-Ile-Tyr-Trp-Asp-Asp-Asp-Lys-His-Tyr-Asn-Pr
o-Ser-Leu-Lys-Ser (c) Arg-Val-Phe-Tyr-Gly-Asn-Ser-Asp-Phe-Met-Asp-Hi
The L-chain-encoding gene contains (a) Lys-Ser-Ser-Gln-Ser-Leu-Leu-Asn-Ser- Gly-Asn-Gl
n-Lys-Asn-Tyr-Leu-Ala (b) Gly-Ala-Ser-The-Arg-Glu-Ser (c) Gln-Asn-Asp-His-Ser-Phe-Pro-Leu-Thr amino acid sequence It has been found that it is characterized by having a gene sequence which encodes Such three kinds of amino acid sequences contained in each of the above H chain and L chain are considered to be important amino acid sequences that determine the binding ability of the antibody molecule, and such amino acid sequences have a neutralizing activity against HIV. It was considered to be closely related to the function of the antibody molecule. That is, the general analysis of antibody genes reported by Kabat et al. (Sequences of Prote
ins of Immunological Interest, 4th.ed.US Depar
tment of Health and Human Services (1987)), the above-mentioned amino acid sequence is the sequence of the complementarity determining regions (CDR1 to CDR3) of the variable region that determines the antibody activity of the anti-HIV antibody of the present invention. Was found.

As described above, it becomes possible to prepare a recombinant antibody having a neutralizing activity against HIV based on the nucleic acid sequence encoding the above-mentioned amino acid sequence provided by the present invention. That is, based on the method described in JP-A-60-155132 and JP-A-61-47500, which describe the method for preparing a chimeric antibody, the downstream of the gene fragment encoding the H chain variable region shown in SEQ ID NO: 1 in the Sequence Listing. A gene encoding an anti-HIV chimeric antibody H chain in which a gene fragment encoding a human antibody H chain constant region is ligated to, an expression vector having a promoter upstream thereof, and the L chain variable region of SEQ ID NO: 2 in the Sequence Listing Of the human antibody downstream of the gene fragment encoding
Anti-HI to which a gene fragment encoding a chain constant region is ligated
An anti-HIV chimeric antibody can be obtained by constructing an expression vector having a gene encoding a V chimeric antibody L chain and a promoter upstream thereof and expressing these in animal cells. In addition, based on the method described in Japanese Patent Laid-Open No. 4-41095, which describes a method for producing a modified antibody, synthetic DNAs and the like are prepared so that only the complementarity determining regions encode the above amino acid sequences, and these encode human antibodies. It becomes possible to prepare an anti-HIV modified antibody by transplanting it into the gene.

The thus-prepared recombinant anti-HIV antibody of the present invention is characterized by having the following sequences (CDR1 to CDR3) as complementarity determining regions of its H chain variable region (sequence listing). Nos. 4 to 6). (H chain) CDR1: Thr-Phe-Gly-Met-Gly-Val-Ser CDR2: His-Ile-Tyr-Trp-Asp-Asp-Asp-Lys-His-Tyr-Asn-
Pro-Ser-Leu-Lys-Ser CDR3: Arg-Val-Phe-Tyr-Gly-Asn-Ser-Asp-Phe-Met-Asp-
His is also characterized by having the following sequences (CDR1 to CDR3) as complementarity determining regions of the L chain variable region (described in SEQ ID NOs: 7 to 9 in the sequence listing). (L chain) CDR1: Lys-Ser-Ser-Gln-Ser-Leu-Leu-Asn-Ser-Gly-Asn-
Gln-Lys-Asn-Tyr-Leu-Ala CDR2: Gly-Ala-Ser-The-Arg-Glu-Ser CDR3: Gln-Asn-Asp-His-Ser-Phe-Pro-Leu-Thr

Furthermore, the inventors of the present invention, when preparing a modified antibody, as described so far, rather than recombining only the above-mentioned complementarity determining region with a mouse-derived amino acid sequence, the complementarity The frame (F
It was found that even a part of the R region can be recombined with a mouse-derived sequence to obtain a recombinant antibody that maintains the original antibody activity. The amino acid sequences of the H chain V region and L chain V region of the anti-HIV modified antibody of the present invention are shown in SEQ ID NOs: 10 and 11 of the Sequence Listing. Hereinafter, the present invention will be described along with examples in order to deepen the understanding thereof, but the present invention is not limited to these examples.

[0029]

【Example】

Example 1: Preparation of monoclonal antibody (1) Preparation of antigen Preparation of virus HIV used in this example was isolated and prepared by the following method. First, peripheral blood lymphocytes were separated from blood (20 to 40 ml) collected from each patient by a standard method, and then peripheral blood lymphocytes from a normal person who had been stimulated and cultured with phytohemoaglutinin (PHA) for 4 days were used. And add 50
The culture supernatant, which was cultured for 7 to 21 days in the presence of U / ml interleukin 2 (IL-2), was used as a virus solution (hereinafter, this clinical isolate derived from an infected person is referred to as NI-53 strain). Also, HTLV-II
I _B, III _MN and III for _RF strain sustained production producing these viruses cells _{CEM / III B, H9 / III} MN, U937 / III
_The culture supernatant obtained by culturing _RF was used as the virus solution.

Synthetic Peptide Synthetic peptide (NNTRKAIRVGPG) corresponding to the 6th to 25th amino acid sequences of NI-53 strain outer coat glycoprotein gp120.
RTLYATRR (described in SEQ ID NO: 3 in the sequence listing) was used as an immunogen and an assay antigen. An ABI430A peptide synthesizer (Applied Biosystems) was used for the chemical synthesis of the above peptides. As a result, a crude product was obtained, and trifluoromethanesulfonic acid (TFMSA) was obtained.
The peptide was cleaved from the resin by the method and then purified by reverse phase high performance liquid chromatography (HPLC). Purification by reverse phase HPLC was repeated 3 times, and the obtained peak fractions were collected and analyzed for amino acids.
Based on the agreement with the amino acid composition of the -53 strain, it was determined to be a synthetic peptide of NI-53 strain gp120 having the above-mentioned desired sequence.
Next, the obtained synthetic peptide (SP-12) was lyophilized and coupled with KLH (keyhole limpet hemocyanin) as a carrier for immunization to prepare a peptide-KLH conjugate. First, 10 mg of the above peptide was added to 10 mM PBS (p
H7.0) was dissolved in 2 ml, MBS type cross-linking agent in dimethylformamide (40 mg / 100 μl) was added, and the mixture was stirred at room temperature for 30 minutes. Next, the reaction solution was washed 3 times with 2 ml of dichloromethane, and the obtained aqueous layer was separated (solution A). On the other hand, KLH
Dissolve 20 mg in 5 ml of 0.2 M Tris-HCl (pH 8.6, 8 M urea), add dithiothreitol (DTT), and add 1 at room temperature.
Stir for hours. 3 ml of 10% trichloroacetic acid was added to the reaction solution, and the precipitate was suction filtered and washed with 2 ml of distilled water, then 20
It was dissolved in 5 ml of mM NaPB (pH 7.0, 6M urea) (solution B). Solution A and solution B were mixed and stirred at room temperature for 3 hours,
The reaction product was dialyzed and then freeze-dried. The NI-53 strain gp120 synthetic peptide and the peptide-KLH conjugate were prepared as described above and used as the antigen for immunization and the antigen for assay.

Preparation of recombinantly expressed peptide of gp120V3 domain of clinically isolated virus (region corresponding to gp120 amino acid No. 247-370) HIV-infected peripheral blood lymphocytes (PBL) were suspended in 1 × RSB buffer and SDS (final). Concentration 1%), Protei
nase K (final concentration 1 mg / ml) was added and incubated at 37 ° C for 2 hours. Then, phenol extraction and ethanol precipitation were repeated to obtain high molecular weight DNA (genomic DNA). Using this high molecular weight DNA as a template and the following A and C primers, clinically isolated virus NI-53 strain gp120 V
PCR of 3 domains (amino acids 247-370) according to the standard method
Amplified by the method. A primer; (5 ') GCCGGATCCACACATGGAATTAGGCCAGTA
(3 ') C primer; (3') AGTCCTCCCCTGGGTCTTTAAACTGACGTCTCG
(5 ') amplification was performed using Taq polymerase for 30 to 35 cycles.

The amplified DNA fragment thus obtained was cloned with the pUC18 plasmid, and the amplified DNA fragment was sequenced by the dideoxy method. Furthermore, this cloned DNA fragment was added to pU
It was incorporated into an EX2 expression vector, transfected into E. coli, and subjected to heat induction at 42 ° C for expression. The expressed gp120V3 domain of the NI-53 strain (amino acid No. 247-37
0) is a fusion protein with β-galactosidase,
The following purification was performed as an E. coli inclusion body. After crushing the expressed Escherichia coli with glass beads, lysozyme treatment (final concentration 0.1 mg / ml) was performed at 4 ° C., and the obtained centrifugal precipitate was treated with Triton X-100 (final concentration 0.5%). . The obtained centrifugal precipitate was solubilized in 8M urea and used as an immunizing antigen and an assay antigen.

(2) Immunization of mouse As an example, immunization with the synthetic peptide prepared above is shown below. A group of 4-8 week old BALB / c mice was used. Immunization is to be performed three times by the intraperitoneal route and then once by the intravenous route. On the 0th day, in the presence of Freund's complete adjuvant, on the 14th day in the presence of Freund's incomplete adjuvant, 28 days. In the presence of Freund's incomplete adjuvant and on the 42nd day in the absence of adjuvant.
100 μg of synthetic peptide and synthetic peptide prepared above-
The KLH conjugate antigen mixture was inoculated.

(3) Cell fusion and culture of hybridoma Three days after the final immunization, spleen cells were collected from mice by a conventional method. Spleen cells were mixed with myeloma cells p3X63Ag8-U1 at a ratio of 1 to 5 cells and centrifuged (1,200 rpm /
After 5 minutes), the supernatant was removed, and the precipitated cell mass was thoroughly loosened. Then, with stirring, 1 ml of a mixed solution (polyethylene glycol-4000 (2 g), MEM (2 ml), dimethyl sulfoxide).
Added to. After incubating for 5 minutes at 37 ° C., MEM was slowly added so that the total amount of the solution was 50 ml. After centrifugation (900 rpm./5 minutes), the supernatant was removed and the cells were loosely loosened. To this, 100 ml of normal medium (RPMI-1640 medium plus 10% fetal calf serum) was added, and the cells were gently suspended using a measuring pipette.

Dispense the suspension into a 24-well culture plate (1
2 ml at a temperature of 37 ℃ in an incubator containing 5% carbon dioxide gas.
Cultured for 4 hours. Next, 1 ml / well of HAT medium (hypoxanthine (1 × 10 ⁻⁴ M) and thymidine (1.5 × 10 ⁻³ M) were added to normal medium).
And aminopterin (4 × 10 ⁻⁷ M) were added and the cells were further cultured for 24 hours. Thereafter, every 24 hours for 2 days, 1 ml of the culture supernatant was replaced with the same amount of HT medium (except for aminopterin from the HAT medium), and the cells were cultured for 10 to 14 days in the same manner as above.

Fused cells (about 300
1 ml of the culture supernatant was replaced with the same amount of the HT medium, and then the same replacement was performed every 24 hours for 2 days. After culturing in HT medium for 3 to 4 days, a part of the culture supernatant was collected and the target hybridoma was selected by the screening method described below.

(4) Screening of hybridomas The desired hybridomas were selected by combining the following EIA method and Western blotting method. The neutralizing activity of the clones thus selected was measured.

EIA method To a 96-well microtest plate, 100 μl / well of synthetic peptide antigen or purified gp120 antigen or recombinant peptide (protein concentration 2 μg / ml) prepared as described above was added and incubated at 4 ° C. overnight. By doing so, it was solid-phased. Furthermore, 1% BSA (bovine serum albumin) solution
150 μl was added and incubated in the same manner for masking. The thus prepared antigen-immobilized plate was added with the culture supernatant of the hybridoma obtained by the cell fusion method and the hybridoma after cloning, and
After incubating at ℃ for 1.5 hours, 0.1% Tween20 / PBS
Wash 3 times with 100 μl of peroxidase-labeled anti-mouse immunoglobulin antibody solution (Kappel, 5,000-fold diluted)
l / hole added. After incubating at 4 ℃ for 1 hour, 0.1% Twe
After washing 5 times with en20 / PBS, TMBZ substrate solution was added and color was developed by a conventional method, and the absorbance was measured at a wavelength of 450 nm.
It was measured at. Thus, a hybridoma clone that strongly reacts only with the synthetic peptide derived from the NI-53 strain and does not react with the synthetic peptide derived from HTLV-III _MN was selected.

Western blotting method This was carried out according to the method of Tobin et al. (Towbin et al., P
roc. Natl. Acad. Sci. USA, 76 , p. 4350 (1979)).
NI-53 purified virus was prepared by the method described in the literature (Science, 224 p.
497 (1984)), this was electrophoresed using 12% SDS-PAGE, the gel was placed on a nitrocellulose membrane to transfer the virus onto the membrane, and the membrane was cut to a width of 0.4 to 0.5 cm. . Each strip was immersed in the hybridoma culture supernatant and incubated overnight. Then, the strips were washed 3 times with PBS, and then 1: 750 of biotin-labeled anti-mouse IgG (TAGO) was used.
Incubated in the diluted solution for 2 hours. The strips were washed 3 times with PBS, dipped in avidin (manufactured by Sigma) conjugated with horseradish peroxidase (1: 1000 dilution), and kept warm for 1 hour. After washing three times with PBS, color is developed with a color-developing reagent (Bio-Rad) using 4-chloro-1-naphthol, and NI-53gp120.
A hybridoma showing a colored band of was selected and cloned. The hybridoma clones after cloning were also selected by the same method.

Neutralizing activity measurement method For the neutralizing activity measurement, culture supernatants of isolated viruses from patients having each PND amino acid sequence and cloned viruses thereof were used as virus stock solutions (10 ^4.5 to 10 ⁵ TCID ₅₀ ). . Cloning of viruses is carried out by the limiting dilution method,
Alternatively, the plaque method with cells of CD4-HeLa was used. With respect to the isolated virus and its cloned virus, the amino acid sequence of PND was confirmed again by the PCR-sequencing method described in Example 1 (1) Preparation of antigen.

Regarding the measurement of neutralizing activity against cell-free virus infection (cell-free virus infection), first,
Inoculate a 96-well flat-bottomed plate with the virus solution prepared to 10TCID _50/50 μl and ₅₀ μl of hybridoma clone culture supernatant or ascites purified solution (various serial dilutions),
Incubated at 0 ° C for 1 hour. Then, add MT4 cells to 1
0 ⁴ pieces / 100 μl / hole (5% FCS, L-glutamine 3.5 to 4.0
g / l, penicillin 50 U / ml and streptomycin 50 μg / m
suspended in RPMI1640 medium containing 1), and added 5
Cultured for a day. Then, the neutralizing activity was determined by whether or not the antibody suppresses syncytium formation that occurs during infection. In addition, the neutralizing titer is in syncytia formation.
Expressed as the lowest effective concentration of antibody that inhibits 100%.

Next, regarding the inhibitory activity of cell-to-cell infection by HIV persistently producing cells, first,
Effector cells (HUT) prepared at 10 ³ to 10 ⁴ cells / 50 μl / well
78 / NI53 cells and the like) and 50 μl of hybridoma clone culture supernatant or ascites purified solution (various serial dilutions) were seeded in a 96-well flat bottom plate and incubated at 37 ° C. for 30 minutes. Then, target MT4 cells 5 ×
10 ⁴ cells / 100 μl / well were added, and the cells were cultured at 37 ° C. for 24 hours. Then, the neutralizing activity was judged depending on whether or not the antibody suppresses the syncytium formation of MT4 cells as the target cells. The neutralizing titer was expressed as the minimum effective concentration of an antibody that suppresses syncytium formation due to cell-to-cell infection by infected cells by 80%. A hybridoma (α64) producing the desired monoclonal antibody was obtained by the above selection method.

(5) Production of Monoclonal Antibody Using α64 5 × 10 ⁶ hybridoma α64 strains obtained in the above-described example were injected intraperitoneally into each pristane-treated 8-week-old Balb / c female mouse. Was administered to Ascites cancer was induced after 10 to 21 days. Ascites was collected from the mouse, 3000r.pm/
After removing the solid component by centrifugation for 5 minutes, it was purified by affinity chromatography using an Affigel Protein A MAPS-II kit (Bio-Rad).

Example 2: Characteristic analysis of α64 antibody (1) Neutralizing property of α64 antibody The neutralizing property of α64 antibody was examined. The method is described in Example 1 (4) Hybridoma screening screening method. The results are shown in Table 1.

[0045]

[Table 1] 1. Minimum effective concentration of antibody that inhibits cell-to-cell infection by infected cells by 80% (μg / ml) 2. Minimum effective concentration of antibody that inhibits virus infection by 100% (μg / ml)

The column on the right shows the lowest effective concentration of the antibody that completely inhibits the virus infection by each mutant strain. The control 0.5β antibody had a specific neutralizing activity against the III _B / LAV strain, and the μ5.5 antibody and μ3 antibody
On the contrary, the 9.1 antibody was infected with the III _MN strain by 0.5 μg / ml and 31
It was a neutralizing antibody specific to the III _MN strain that inhibited 100% at a concentration of μg / ml and did not inhibit other III _B and III _RF strains. On the other hand, the α64 antibody cannot inhibit III _{M N} , III _B / LAV, and III _RF strains, but the isolated virus NI-53 strain derived from an HIV-infected person is 100% at a concentration of 2 μg / ml. It was confirmed to inhibit. Although not shown here, other clinically isolated viruses such as NI-61 strain and KM-03 strain (Hattori et al., AIDS Res.
S. and Human Retroviruses, 7, p825, (1991)) were also 100% inhibited at the concentrations of 12.8 μg / ml and 10.9 μg / ml, respectively.

The left column shows the minimum effective concentration of the antibody that inhibits 80% of the cell-to-cell infection by each infected cell, but the control 0.5β antibody is III _B / LAV.
Shows neutralizing activity specific to infected cells, μ5.5 antibody and μ39.
1 antibody caused 16 μm of cell-to-cell infection by III _MN- infected cells.
It inhibited at concentrations of g / ml and 63 μg / ml, but did not inhibit intercellular infection by cells infected with other III _B and III _RF strains. Again α
64 antibody induces cell-to-cell infection with NI-53 strain infected cells at 16 μg / m
It was inhibited at a concentration of l. That is, it was revealed that the neutralizing antibody specific to the clinically isolated virus NI-53 strain is also effective in inhibiting cell-to-cell infection by infected cells.

(2) Reactivity with Infected Cell-Derived gp120 (Western Blotting Method) Western blotting was carried out to examine the reactivity of α64 antibody with the infected cell-derived outer coat protein gp120. HUT78 / NI-53 cell lysate was used as an antigen.
The method is shown in the section of Western blotting method of the hybridoma screening in Example 1 (4) described above. Strip A is positive for human HI
V antibody-positive serum was used, and a gp120 band is observed in this portion. Strip B is for HTLV-III _MN strain
A μ5.5 monoclonal antibody capable of binding to gp120 and strongly neutralizing the virus was used, but it does not recognize gp120 of NI-53-infected cells. In contrast, the α64 antibody (strip C) according to the present invention clearly shows NI-53.
It was found that the infected cells recognized gp120 (Fig. 1).

(3) Epitope mapping with α64 antibody Using the Epitope Scanning Kit (Cambridge Research Biochemicals), the hexapeptides of PND (major neutralization region) of NI-53 as shown below were analyzed. Synthesized. Then, EIA was performed between these hexapeptides and the α64 antibody, and the results are shown in Table 2. In addition, the recognized epitopes are summarized in FIG.

[0050]

[Table 2]

From Table 2 and FIG. 2, clinically isolated virus NI-5
Α64 antibody, which has a strong neutralizing activity against 3 strains, shows reactivity with two types of hexapeptides, RVGPGR and VGPGRT,
In particular, it was confirmed that RVGPGR was strongly recognized. From the above results, it was revealed that the neutralizing epitope of α64 antibody is the RVGPGR sequence.

(4) PND (principal) derived from various HIV mutants
Neutralizing determinant) Reactivity with synthetic peptides As various synthetic peptides, HTLV-III _MN , HTLV-III
_RF and the respective PND synthetic peptides from clinical isolates were used. The amino acid sequence of the PND synthetic peptide used is shown in FIG. Then, the method is the same as the first embodiment described above.
(4) It is shown in the section of EIA method for screening of hybridoma. As shown in FIG. 4, α64 antibody did not react with III _MN- derived peptide and III _RF- derived peptide, but among the synthetic peptides derived from clinically isolated virus, SP-12 (NI-53 strain-derived peptide used as an immunogen). ) In addition to SP-6
It was shown that the antibody strongly reacts with (NI-61 strain-derived peptide) and SP-11 (NI54-2 strain-derived peptide).

(5) Binding Properties with PND Recombinantly Expressed Peptides Derived from Various HIV Variants The binding properties and neutralizing activity of α64 antibody were examined. The method was carried out in the same manner as in the section of preparation of recombinant isolated peptide of gp120V3 domain of clinically isolated virus in Example 1 (1) Preparation of antigen. The results are shown in Fig. 5.

(6) Analysis of binding properties with PND recombinant expressed peptide The binding properties between α64 antibody and PND recombinant peptides derived from various HIV mutant strains were examined. As a result, as shown in FIGS. The α64 antibody of the invention has RVGPGR or R
It showed binding (neutralizing) activity to recombinant expressed peptides in which any amino acid sequence of IGPGR was conserved, but bound (neutralizing) to recombinant expressed peptides having other amino acid sequences. It was revealed that it showed no activity. Therefore, based on this result, the binding (neutralization) spectrum of α64 antibody is summarized as follows:
It was revealed that the α64 antibody of the present invention has the ability to neutralize HIV containing an amino acid sequence consisting of a combination selected from the following amino acids. X ₉ = Arg, Ser, Lys X ₁₀ = Lys, Arg X ₁₁ = Gly, Ala X ₁₂ = Ile X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Thr X ₂₀ = Val, Ile, Leu X ₂₁ = Tyr, Met, Leu X ₂₂ = Thr, Ala, Gln, Ser

Furthermore, the neutralizing epitope of the α64 antibody (RVGP
Amino acids near the GR or RIGPGR sequence)
Of 245 isolates from HIV-infected individuals (LaRosa GJ et al., Science, 249 , p932).
(1990)), the α64 antibody of the present invention can also neutralize HIV containing an amino acid sequence consisting of a combination selected from the following amino acids. X ₉ = Arg, Lys, Ser, Ile, Glu, Pro, Gln, Gly, Me
t, Thr X ₁₀ = Lys, Arg, Asn, Gln X ₁₁ = Ser, Gly, Arg, His, Lys, Ala X ₁₂ = Ile, Leu, Met, Thr, Val, Glu, Phe X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Val, Asn, Thr, Arg, Lys, Pro, Ser, Trp X ₂₀ = Phe, Ile, Val, Leu, Tyr, Trp, Thr, Ser, His X ₂₁ = Tyr, Val, His, Leu, Phe, Arg, Ser, Met, Ile X ₂₂ = Thr, Ala, Val, Gln, Tyr, Ser

Example 3: α64 chimera antibody (1) Isolation of α64 antibody mouse V region gene The mouse immunoglobulin variable (V) region gene was isolated as follows. α64 cells from conventional method (DM
Edited by Glover "DNA cloning Vol.I" IRL press (1985))
The total RNA was extracted according to the method described above, and single-stranded cDNA was synthesized using the cDNA synthesis system plus (Amersham). Using this single-stranded cDNA as a template, Kabat et al. (Sequences
of Proteins of Immunological Interest 4th ed., Pu
Polymerase chain reaction (PCR) was carried out using a DNA primer synthesized based on the nucleobase sequences of the classified V region and J region of Blic Health Service, NIH, Washington DC, 1987). HindIII and BamHI sites are added to the V region primer and J region primer, respectively. PCR was performed according to the protocol of Cetus. That is, both of these primers are 100 pm
The PCR reagent used was a kit from Cetus. PCR conditions are 94 ° C 1 minute, 55 ° C 1 minute, 72 ° C 1 minute
Twenty-five cycles were performed. After PCR, the obtained DNA fragment is pUC
18 (manufactured by Takara Shuzo; the reagents used in the following examples were Takara Shuzo or Toyobo unless otherwise specified) Hi
Subcloned into the ncII site.

(2) Nucleotide sequence of α64 antibody mouse V region gene The V region gene incorporated in pUC18 was sequenced using Sequenase Ver.2 kit from Toyobo. The α chain H chain V region (VH) and L chain V region (V
The nucleotide sequence of L) is shown in FIGS. 6 and 7. The amino acid sequences obtained from the nucleic acid base sequences are also shown in FIGS. 6 and 7. All α64 nucleobase sequences are V
The rearrangement peculiar to the region gene was caused, and the open reading frame (ORF) capable of expression was taken.

(3) Preparation of α64 Chimeric Antibody To confirm whether or not the isolated α64 antibody V region gene really encodes the V region responsible for anti-HIV activity, a mouse-human chimeric antibody was prepared. . Human cytomegalovirus (HCM) for expression of chimeric antibodies
V) enhancer and promoter (N. Whittle, et a
l., Protein Engineering, 1, 499 (1987)), which were used as expression vectors HCMV-κ and HCMV-γ1, respectively. HC
MV-κ has human κ chain constant region gene and dihydrofolate reductase (DHFR) gene as a selectable marker. HCMV-γ
1 is the human γ1 chain constant region gene and ne as a selection marker
o Have a gene. The α64V region prepared above was added to HindIII
Digested with BamHI restriction enzyme, and VH and VL gene fragments were incorporated into the HindIII-BamHI sites of HCMV-γ1 and HCMV-κ, respectively (CHα64 and CLα64).

(4) Expression of α64 chimeric antibody The antibody activity of the α64 chimeric antibody gene constructed as described above was examined in a temporary expression system using COS7 cells (ATCC CRL 1651). A mixture of CHα64 and CLα64 plasmid DNA was introduced into COS7 cells using an electroporation apparatus manufactured by Bio-Rad according to the protocol of Bio-Rad, and cultured in DMEM medium containing 10% fetal bovine serum (GIBCO). did. After 3 days, the culture supernatant was collected and the activity of the antibody present in the culture supernatant was measured by an ELISA method using anti-human IgG or SP-12 antigen peptide. As a result, CH
The expression product of the mixture of α64 and CLα64 plasmid DNA was SP-
It showed binding to 12 peptides. In addition, the isolated virus NI-
When the neutralizing activity against 53 strains was confirmed, it was confirmed that the virus was infected with virus at the lowest effective concentration of 2 μg / ml, similar to the mouse α64 antibody.
It was revealed to inhibit 0%. Therefore, it was confirmed that the above isolated α64 V region gene is definitely the gene encoding the V region of an antibody having neutralizing activity.

(5) Preparation of α64 Chimera Antibody High-Producing Cell Line In order to prepare a stable plasma cell line producing the α64 chimeric antibody (Cα64), the above-mentioned plasmid DNA CLα64 and CHα64 were prepared.
Linearize with PvuI, mix with lipofectin and mix with CHO
-Transformed into DG44 cells and P3-653 cells. Then, as in the case of temporary expression of the chimeric antibody, Neo resistance and DHF
The culture supernatant of R-resistant transgenic cells was collected and treated with anti-human IgG.
The activity of the antibody present in the culture supernatant was measured by the ELISA method using SP-12 peptide. Since the expression product of the co-transformation of CLα64 and CHα64 plasmid DNA bound to the SP-12 peptide, this transformed cell was cloned. Furthermore, the amplification operation of the DHFR gene was repeated by adding MTX in the concentration range of 4 to 32 × 10 ⁻⁷ M. As a result, a stable plasma cell line resistant to MTX and producing Cα64 at a level of 50 to 70 μg / ml was prepared.

Example 4: Anti-HIV modified antibody (1) Preparation of anti-HIV modified antibody In order to examine which region of the cloned VH and VL regions of α64 is important for antigen binding,
The CDR (complementarity determining) region of α64 was transplanted to the human V region. The method was in accordance with the method for producing a modified antibody described in JP-A-4-41095. The CDR region of the VH region of α64 is a VH region that has the FR (framework) region of human subgroup II (NEW: This is Dr. Ben of the MRC Collabrative Center in the UK.
transplanted to the one provided by dig) (Fig. 8), and α64 VL
The CDR region of the region is the VL region (RE region having the FR region of human κ chain).
I: W. Palm and N. Hilscmann Z. Physiol. Chem., 356,
167 (1975)) (Fig. 9).

Specifically, the modified antibody is an Amersham kit (Oligonucleotide-directed in vitro mutagenesi).
s system version 2 code RPN.1523) and PCR (Saiki,
RGet al., Science, 239, 487 (1988)) was combined and prepared according to the Amersham-PCR method. α64 VH, VL
The long chain nucleotides that encode the transplant site
Alternatively, after annealing to M13 DNA in which the V region gene of REI has been integrated, elongation of the DNA in a solution containing dCTPαS
Bind, cleave the template M13 DNA with NciI, Exonuclease
M13DN mutated by digestion of template DNA with III
A strand of A alone was obtained (up to this point, according to the protocol of Amersham's kit).

Furthermore, a universal primer (having a complementary sequence on the 5'side of UP: M13mp18) and a reverse primer (RSP: M13mp18) using the Exonuclease III digestion product as a template.
PCR was carried out using the same sequence as that of the 3'side). We used 20 pmol of each of these primers and the PCR reagents were
The one from CETUS was used. PCR conditions are 94 ° C for 1 minute,
25 cycles were performed at 55 ° C. for 1 minute and 72 ° C. for 1 minute.

After completion of PCR, the product was digested with BamHI / HindIII and integrated into the BamHI-HindIII site of pUC18, and DH5 α
(BRL) and the primary screening
Colonies were hybridized using the CDR primers used for mutation according to the Amersham kit protocol, and clones that had successfully mutated the CDRs were selected. Furthermore, as a secondary screening, 1
Plasmids were prepared from the clones obtained by the subsequent screening and sequenced using the Sequenase kit (Toyobo) to confirm that the CDR transplantation was successful.

Thus, the modified V region of α64 (RHα64, RLα64: see FIGS. 8 and 9, respectively) was obtained. These modified V region fragments were digested with HindIII and BamHI restriction enzymes in the same manner as in the production of chimeric antibody (see Example 3), and the VH and VL fragments were HindI of HCMV-γ1 and HCMV-κ, respectively.
Incorporated into the II-BamHI site. In this way, α64-modified antibody gene expression vectors (RHα64 and RLα6, respectively)
4) was prepared.

(2) Expression of anti-HIV modified antibody The antibody activity obtained by this modified α64 antibody gene was examined by the above-mentioned transient expression system in COS7 cells. The culture supernatant of the transgenic cells was collected in the same manner as in the case of transient expression of the chimeric antibody, and the activity of the antibody present in the culture supernatant was measured by the ELISA method using anti-human IgG or SP-12 peptide. As a result, the RHα64 and RLα64 plasmids
The expression product of the mixture of DNA bound to the SP-12 peptide. Furthermore, when the neutralizing activity against the isolated virus NI-53 strain was confirmed, it was 2 μg / m2 similarly to the α64 mouse antibody and the chimeric antibody.
It was found that the lowest effective concentration of l inhibited 100% of the viral infection. Therefore, α64 shown in FIG. 8 and FIG.
In the amino acid sequence of, the transplanted CDR region is an important region responsible for anti-HIV activity, and the genes encoding these regions are the most important genes in producing a recombinant antibody.

(3) Preparation of anti-HIV modified antibody high-producing cell line In order to prepare a stable plasma cell line producing a modified α64 antibody (Rα64), the above-mentioned plasmid DNAs RLα64 and RHα64 were added to Pv.
Linearize with uI and mix with Lipofectin to make CHO-D
The cells were transformed into G44 cells and P3-653 cells. Then, as in the case of the temporary expression of the chimeric antibody, Neo resistance and DHFR
Collect the culture supernatant of resistant transgenic cells, and use anti-human IgG and S
The activity of the antibody present in the culture supernatant was measured by the ELISA method using the P-12 peptide. Since the expression product of the co-transformation of RLα64 and RHα64 plasmid DNA bound to the SP-12 peptide, this transformed cell was cloned. Furthermore, the amplification operation of the DHFR gene was repeated by adding MTX in the concentration range of 4 to 32 × 10 ⁻⁷ M. As a result, a stable plasma cell line resistant to MTX and producing Rα64 at a level of 80 to 100 μg / ml was produced.

[0068]

EFFECTS OF THE INVENTION Considering the hypermutability of HIV and the process of human-to-human transmission, infection with HIV is more likely than that with HIV virus having a single nucleotide sequence.
It is more appropriate to think that it is caused by multiple subgroups of virus mutants having different partial base sequences. Two methods can be considered to deal with this. One is a method of using neutralizing antibodies against constant regions conserved among HIV strains, and the other is a method of mixing neutralizing antibodies having different strain-specific specificities. For the former,
Although there are several reports, all of them are polyclonal antibodies or monoclonal antibodies with low neutralizing activity and have low practicality in the treatment or prevention of AIDS. On the other hand, in the latter case, the value of 0.5 against the III _B strain prepared by the present inventors was used.
A human chimeric antibody for β, Cβ1, was reported to be able to completely protect against primary infection as a result of a chimpanzee passive immunization test (EA Emini et al., Nature, 355 , p.72).
8 (1992)). From this point, it is considered that the strain-specific antibody having a strong neutralizing activity is more practical in the treatment and prevention of AIDS. The present invention relates to making and its humanized of III _B strain, neutralizing antibody (0.5β, μ39.1 and μ5.5 antibody) against III _MN strain antibodies capable of neutralizing a wide clinical isolates that can not be neutralized Yes, and contributed to enhance the effect of this mixed type.

[0069]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 366 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: cDNA to genomic RNA Origin organism name: Mouse sequence CAG GTT ACT CTG AAA GAG TCT GGC CCT GGT ATA TTG CAG CCC TCC CAG 48 Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln 1 5 10 15 ACC CTC AGT CTG ACC TGT TCT TTC TCT GGG TTT TCA CTG AGC ACT TTT 96 Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Phe 20 25 30 GGT ATG GGT GTG AGC TGG ATT CGT CAG CCT TCA GGG AAG GTT CTG GAG 144 Gly Met Gly Val Ser Trp Ile Arg Gln Pro Ser Gly Lys Val Leu Glu 35 40 45 TGG CTG GCA CAC ATT TAT TGG GAT GAT GAC AAG CAC TAT AAC CCA TCC 192 Trp Leu Ala His Ile Tyr Trp Asp Asp Asp Lys His Tyr Asn Pro Ser 50 55 60 TTG AAG AGC CGA CTC ACA ATC TCC GAA GAT ACC TCC AAC AAT CAG GTA 240 Leu Lys Ser Arg Leu Thr Ile Ser Glu Asp Thr Ser Asn Asn Gln Val 65 70 75 80 TTC CTC AAG ATC ACC ACT GTG GAC ACT GCA GAT ACT GCC ACA TAC TAC 288 Phe Leu Lys Ile Thr Thr Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr 85 90 95 TGT GCT CGA AGG GTC TTC TAT GGT AAC TCC GAT TTT ATG GAC CAC TGG 336 Cys Ala Arg Arg Val Phe Tyr Gly Asn Ser Asp Phe Met Asp His Trp 100 105 110 GGT CAA GGA ACC TCA GTC ACC GTC TCC TCA 366 Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115 120

SEQ ID NO: 2 Sequence length: 339 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to genomic RNA Origin organism name: Mouse sequence GAC ATT GTG ATG ACA CAG TCT CCA TCC TCC CTG AGT GTG TCA GCA GGA 48 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Val Ser Ala Gly 1 5 10 15 GAG AAG GTC ACT ATG AGG TGC AAG TCC AGT CAG AGT CTG TTA AAC AGT 96 Glu Lys Val Thr Met Arg Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20 25 30 GGA AAT CAA AAG AAC TAC TTG GCC TGG TAC CAG CAG AAA CCA GGG CAG 144 Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Lys 35 40 45 CCT CCT AAA CTG TTG ATC TAC GGG GCA TCC ACT AGG GAA TCT GGG GTC 192 Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 CCT GAT CGC TTC ACA GGC AGT GGA TCT GGA ACC GAT TTC ACT CTT ACC 240 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 ATC AGC AGT GTG CAG GCT GAA GAC CTG GCA GTT TAT TAC TGT CAG AAT 288 Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn 85 90 95 GAT CAT AGT TTT CCG CTC ACG TTC GGT GCT GGG ACC AAG CTG GAG CTG 336 Asp His Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105 110 AAA 339 Lys

SEQ ID NO: 3 Sequence Length: 25 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Fragment: Intermediate Fragment Origin Biological Name: Human Immunodeficiency Virus (HIV) Sequence Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ala Ile Arg Val Gly Pro 1 5 10 15 Gly Arg Thr Leu Tyr Ala Thr Arg Arg Ile Ile Gly Asp Ile Arg Gln 20 25 30 Ala His Cys 35

SEQ ID NO: 4 Sequence length: 7 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment: Intermediate fragment Origin Biological name: Mouse

SEQ ID NO: 5 Sequence Length: 16 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Fragment: Intermediate Fragment Origin Biological Name: Mouse Sequence His Ile Tyr Trp Asp Asp Asp Lys His Tyr Asn Pro Ser Leu Lys Ser 55 60 65

SEQ ID NO: 6 Sequence length: 12 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment: Intermediate fragment Origin Biological name: Mouse

SEQ ID NO: 7 Sequence Length: 17 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Fragment: Intermediate Fragment Origin Biological Name: Mouse Sequence Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu 25 30 35 Ala 40

SEQ ID NO: 8 Sequence Length: 7 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Fragment: Intermediate Fragment Origin Biological Name: Mouse

SEQ ID NO: 9 Sequence Length: 9 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Fragment: Intermediate Fragment Origin Biological Name: Mouse

SEQ ID NO: 10 Sequence Length: 122 Sequence Type: Amino Acid Topology: Linear Sequence Type: Other Amino Acid (Synthetic Amino Acid) Origin Organism Name: Mouse and Human Sequence Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Arg Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Thr Phe Ser Thr Phe 20 25 30 Gly Met Gly Val Ser Trp Val Arg Gln Pro Pro Gly Arg Gly Leu Glu 35 40 45 Trp Ile Gly His Ile Tyr Trp Asp Asp Asp Lys His Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Met Ser Glu Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg Arg Val Phe Tyr Gly Asn Ser Asp Phe Met Asp His Trp 100 105 110 Gly Gln Gly Ser Leu Val Thr Val Ser Ser 115 120

SEQ ID NO: 11 Sequence Length: 114 Sequence Type: Amino Acid Topology: Linear Sequence Type: Other Amino Acid (Synthetic Amino Acid) Origin Organ Name: Mouse and Human Sequence Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Arg Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20 25 30 Gly Asn Gln lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys 35 40 45 Ala Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 65 70 75 80 Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Asn 85 90 95 Asp His Ser Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Leu Gln Ile 100 105 110 Thr Arg

[Brief description of drawings]

FIG. 1 Monoclonal antibody according to the present invention (α64 antibody)
Shows reactivity with the outer membrane glycoprotein gp120 derived from cells infected with HUT78 / NI-53 strain.

FIG. 2 Monoclonal antibody according to the present invention (α64 antibody)
Shows the epitope recognized by.

FIG. 3 Monoclonal antibody according to the present invention (α64 antibody)
3 shows the amino acid sequences of PND synthetic peptides derived from various HIV mutant strains used for the property analysis of A.

FIG. 4 Monoclonal antibody according to the present invention (α64 antibody)
Shows the reactivity with PND synthetic peptides derived from various HIV mutants of. The initial concentration of each antibody is 20 μg / ml.

FIG. 5: Monoclonal antibody (α64 antibody) according to the present invention
Shows the binding properties and neutralizing activity of various HIV mutants of.

FIG. 6 shows the nucleic acid sequence and amino acid sequence of the DNA fragment of the present invention encoding the H chain variable region of anti-HIV neutralizing antibody α64.

FIG. 7 shows the nucleic acid sequence and amino acid sequence of the DNA fragment of the present invention encoding the L chain variable region of anti-HIV neutralizing antibody α64.

FIG. 8 shows amino acid sequences of H chain variable regions of human antibody NEW, mouse α64 antibody and α64 modified antibody (RHα64).

FIG. 9 shows the amino acid sequences of the L chain variable region of human antibody REI, mouse α64 antibody, and α64 modified antibody (RLα64).

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location C12N 15/13 15/62 G01N 33/569 H 9015-2J 33/577 B 9015-2J (C12P 21 / 08 C12R 1:91) (72) Inventor Kazuhiko Kurumi 1161 Tsuruhaneda-cho, Kumamoto City, Kumamoto Prefecture (72) Inventor Yukio Tokiyoshi 3-14-19 Wakaba, Kumamoto City, Kumamoto Prefecture

Claims (12)

[Claims] 1. Arg-Ile-Gly-Pro-Gly-Arg within the main neutralizing region (PND) of a glycoprotein antigen (gp120) having a molecular weight of about 120,000 daltons on the outer coat of human immunodeficiency virus (HIV). Alternatively, a monoclonal antibody or a fragment thereof having the ability to neutralize HIV, which comprises any amino acid sequence of Arg-Val-Gly-Pro-Gly-Arg. 2. The monoclonal antibody or fragment thereof according to claim 1, which has the following properties. (a) is classified into IgG and κ, and (b) the 9th to 22nd amino acid sequence of PND of HIV gp120 has the ability to neutralize HIV containing an amino acid sequence consisting of a combination selected from the following amino acids. Has, X ₉ = Arg, Lys, Ser, Ile, Glu, Pro, Gln, Gly, Me
t, Thr X ₁₀ = Lys, Arg, Asn, Gln X ₁₁ = Ser, Gly, Arg, His, Lys, Ala X ₁₂ = Ile, Leu, Met, Thr, Val, Glu, Phe X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Val, Asn, Thr, Arg, Lys, Pro, Ser, Trp X ₂₀ = Phe, Ile, Val, Leu, Tyr, Trp, Thr, Ser, His X ₂₁ = Tyr, Val, His, Leu, Phe, Arg, Ser, Met, Ile X ₂₂ = Thr, Ala, Val, Gln, Tyr, Ser (c) Having the ability to prevent viral particles from infecting CD4-positive cells by binding to the surface of HIV particles containing them, and (d) binding to the surface of cells infected with HIV containing the above amino acid sequence. Has the ability to block syncytia formation induced by infected and uninfected cells. 3. Amino acid sequence 9 of PND of HIV gp120
The monoclonal antibody or fragment thereof according to claim 2, which has the ability to neutralize an isolated virus containing an amino acid sequence consisting of a combination selected from the following amino acids: X ₉ = Arg, Ser, Lys X ₁₀ = Lys, Arg X ₁₁ = Gly, Ala X ₁₂ = Ile X ₁₃ = Arg X ₁₄ = Ile, Val X ₁₅ = Gly X ₁₆ = Pro X ₁₇ = Gly X ₁₈ = Arg X ₁₉ = Ala, Thr X ₂₀ = Val, Ile, Leu X ₂₁ = Tyr, Met, Leu X ₂₂ = Thr, Ala, Gln, Ser 4. The Institute of Microbial Science and Technology, Institute of Industrial Science and Technology (Ministry of Industrial Science), has an acceptance number of Microsociety No. 12973 (FERM P-12973).
The monoclonal antibody or fragment thereof according to claims 1 to 3, which is prepared from the hybridoma deposited as above. 5. A complementarity determinant (CDR1 to CD in the H chain variable region)
The amino acid sequence of R3) is the following sequence:
The described monoclonal antibody or a fragment thereof. CDR1: Thr-Phe-Gly-Met-Gly-Val-Ser CDR2: His-Ile-Tyr-Trp-Asp-Asp-Asp-Lys-His-Tyr-Asn-
Pro-Ser-Leu-Lys-Ser CDR3: Arg-Val-Phe-Tyr-Gly-Asn-Ser-Asp-Phe-Met-Asp-
His 6. The monoclonal antibody or fragment thereof according to claim 1, wherein the amino acid sequence of the H chain variable region is the amino acid sequence of SEQ ID NO: 1 in Sequence Listing. 7. A complementarity determinant of the light chain variable region (CDR1 to CD
The amino acid sequence of R3) is the following sequence:
The described monoclonal antibody or a fragment thereof. CDR1: Lys-Ser-Ser-Gln-Ser-Leu-Leu-Asn-Ser-Gly-Asn-
Gln-Lys-Asn-Tyr-Leu-Ala CDR2: Gly-Ala-Ser-Thr-Arg-Glu-Ser CDR3: Gln-Asn-Asp-His-Ser-Phe-Pro-Leu-Thr 8. The monoclonal antibody or fragment thereof according to claim 1, wherein the amino acid sequence of the L chain variable region is the amino acid sequence of SEQ ID NO: 2 in Sequence Listing. 9. A genetically engineered antibody H chain comprising the mouse antibody-derived amino acid sequence and the human antibody-derived amino acid sequence according to claim 6, which is a complementarity determinant (CDR1) of the variable region.
~ CDR3) is the sequence according to claim 5, wherein the recombinant anti-HIV antibody H chain has a neutralizing activity against HIV. 10. A gene recombinant antibody L chain comprising the mouse antibody-derived amino acid sequence and the human antibody-derived amino acid sequence according to claim 8, wherein the variable region complementarity determinant (CD
A recombinant anti-HIV antibody L chain having HIV-neutralizing activity, characterized in that the amino acid sequence of R1 to CDR3) is the sequence according to claim 7. 11. Recombinant anti-HI according to claims 9 and 10.
A recombinant anti-HIV antibody consisting of a V antibody H chain and a recombinant anti-HIV antibody L chain. 12. A recombinant anti-HIV antibody comprising constructing an expression vector capable of expressing the recombinant anti-HIV antibody according to claim 11, expressing this in an animal cell, and recovering the antibody. Preparation method.