CA2138383A1 - Recombinant xylanases - Google Patents

Abstract

Recombinant xylanases are derived from anaerobic fungi, particularly Neocallimastix patriciarum. The enzymes are highly specific for xylans and have industrial value, particularly in the pulp and paper industries. Certain truncated forms of the enzymes, and enzymes encoded by truncated DNA sequences, are preferred for their high expression levels.

Description

WO 93~2~i693 ~ _ ~ v ~ ~S 5 PCI/GB93/01283 RECOMBINANT X~YLANASES

lhis inve~uon relates ~o recombinant xylanases derivable from an anaerobic fungus. ' Xylan, a major component of plant hemicelluloses, consists of a polymer of 1,4-lin~ed ,B-D-xylopyranose units substituted with mainly acetyl, arabinosyl and glu~uronosyl residues. Hardwood xylan is typically O-ace~yl~O-me~hylglucuronoxylarl with app~ tely ten percent of xylose units cY-1 ,2-linked :0 to a ~O-methylglucuronic acid side chain, and seve~r perrent of ~ylosl: resid~es ace~ylated at $he C-2 or C-3 positions. So~ood ~ylans ~e commonly aLrabino4-O-met~yl-glucuronoxylans ~ which more ~a~ tell percent of xylose units are su~s~imted with a-1,3-linked arabionfura~ose residues. A repertoire of microbialeDzymes act co-operauvely tO conve~ xylan to its consti~e~t simple sugars. Thesein~lude endo-,~-1,~xylanases (EC 3.2.1.8), ,B-xylosiaase (EC 3.2.1.37) and a series of eDzymes which cleave side~hain sugars (glycosidlases) or remove acetylgroups f~om the xylan backbone (De~ker R.F.H., and RicharLs. G.N., Adv.
Carbo~rydr. Chem. Biochem. 32: 277-352 (1976); ~3iely, Trends Biorec~tnol. 3:
286-29û (1985); Poutanen et al, "Accessory E~zymes In~olved in the Hydrolysis of Xyla~." In: En~mes in Biomass Conversion. ACS Syrn~astum Senes 460.
pp426436. Ed. G.F. Let~m. (1991)). Xylanolytic micro-organ~sms gen~rally e~press isoenzymic ~orms of xylanases which are encoded by multiple genes (Hazlewood et al, F7~MS Micro~ial. Le~. 51: 231-236 (19~8); Gilbert et al, J.
Gen. Microbiol. 134: 3239-3247 (1988); Clarke et al, F~kfS Microbiol. Le~. 83:
2s i 305-310 (1991)).

Some xylanases hydrolyse only xylan (Hall el al, Mol. Microbiol. 3: 1211-1219 (1989); Wong et al, Micro~iol. Rev. 52: 305-317 (1988). Many microorganisms that hydrolyse xylan also degrade cellulose. In view of the similari~y of the bond WO 93~2~693 .~ .~ 3 8 ~ 8 3 PCI /GB93/01283 cleaved (,B-1,4-glycosidic linkages), and the cross-specificity sometimes observed between cellulases and xylanases, the phylogenetic reladonships of these enzymesis an in~eresting question. Recently, sequence aligmnent and hydrophobic clusteranalysis have been utilised to assign plan~ cell wall hydrolases to eight enzymeS families (Henrissat et al, Gene 81: 83-95 (1989); Gilkes et al, Microbiol. Re~
303-315 (1991)). Xylanases showed no convincing sequence identity with cellulases suggesting that the two enzyme species evolved from distinct ancestral ge~es.

Many plant cell wall hydrolases consist of two distinct dom~ns; a cataly~ic domain (CD) linked by hydro~cyamino acidJproline-rich liDker sequeDces to a non~atalytic cellulose binding domain (CBD; Gilkes er al, Microbiol. Rev. 55: 303-315 (1991);Kellett et al, Biochem. J. 272: 369-376 (1990); Gilbert el al, Mol. Micr~iol. 4:759-767 (1990)). The precise role of the CBD is the subiect of much debau; in aerobic fungal cellulases the CBD plays a cntical rok in the enzymes' hydrolysisof ~crys~slline cellulose (Tomme et al, Eur. J. Biochem. 170: 575-581 (1988)).
~- ~ The ~ole of tbis domain in prokaryotic cellulases and xylanases is less certam ~.~
(FerD~ et al, Biochem. J. 269: 261-264 (1990)). In addition to their modular swcture, cellulases often cor~ain extended repeated sequences ~GiLt~es et al, Microbfol. Rev. 55: 303-315 (1991)). The precise role of these tandem repeats islargely unresolved.

Many cclluloly~c and hemicellulolytic pro~aryotes reside in the rumen of cows a~d sheep. ~y, anaerobic rumen fuD~gi have also been shown to degrade both 25 ~ I cellulose and ~cylan e~f~ciently (Orpin and Letcher Curr. Microbiol. 3: 121-124 (1979); Lowe et al, Appl. Environ. ~icrobiol. 53: 1216-1223 (1987)) and similar fuDgi reside in the alimentary ~acts of large herbivores (Orpin and Joblin, "Anaerobic fullgin. In: The Rumen Microbial Ecospstem, P.N. Hobson (Ed), ppl29-150, Elsevier, LoDdon (1988)). The cellulase complex of the rumen fungus Wo 93/2~693 ;~ PC~/GB93/01283 .-Neocallimastuc frontalis has been characte~ised by Wood e~ al, Biochen~stry and Genencs of Cellulose Degr~non: FEMS Symp. 43: 31-52 (1988). The lower eukaryote synthesises a large mul~ienzyme complex, of Mr 1-2 million~ which rapidly hydrolyses crystalline cellulose. The complex co~ s substaD~ial endoglucanase, and some ~-glucosidase ac~vity. The f~gus also synthesises an Avicelase, presumably a cellobiohydrolase. Another rumen fungus, NeocallimLstix pa~riciar~m, produces e~racellular enzymes which hydrolyse filter paper cellulose, AVICEL (a trade mark for microcrystalline cellulose) and xylan (Williams and O~pin ~zn. J. Microbiol. 33: 41842S (1987)). None of these en~ymes has been ` charactesised. Limited informa~on on Neocalfi = genes encoding plaIIt cell wall hydrolases has been described (Reymond et al, F~S Micr~iol. Lett. 77:
107-112 (1991)).

Xylans are found, iD associa~ion with lignin, in the primary and secondary cell walls of most plants. The associa~ion between xylan and lignin is the key to thecommercial potential of xylanases ~n, among other things, paper pulp processing.Sandoz Products Ltd in the USA have already conducted practical ~als using a cmde fungal xylanase to replace, at least partially, the amouDI of chloli~e and chloriDe~eri~ed compo~ds no~mally used to bleach the ob3ectionable brown lig~in~enved residues in the treasment of wood pulp in the production of paper a~d ot~er wood~erived products. The chlorine re~ents of prescr~ day wood pulping plants are such th~t each plan~ may ~ave its own chlorine dio~ide productisn unit.

The ad~rantages to the paper industry in avoiding the use of chlorine are clear:~nproveme~s in waste handling, operator safety and plant capital could be achieved if a suitable replacement for chlorine could be found. However, the paper industry is intensely compedtive, and profft margins are slim, so any chlorine replacemen~ must be capable of being produc~d reasonably economically wo 93/2~693 ~ ~ ~ 8 3 g ~ pcr/GB93/ol283 and must also, of course, be sufficiently effective to persuade pulp and paper rnamlfacturers of the benefits of its use.

The filll length cDNA and protein sequence of a xylanase from Neocallimas~
pamciarurn were available from the EMBL databanlc in Heidelberg, Germany, as of 5 May 1992 under the accession ~umber X65526. The xylanase was desigDated XYLA and the corresponding 8e~e ~ynA.

It has now been found that modified xylanases derived from individual xylanases - fNm anaerobic fungl, such as the XYLA enzyme from N. pamciarum, have proper~ies: which make them appropnate for industrial use, particularly in the manufacture of pulp and paper. It appears su~prisingly that truncation can enhance the expression of the enzyme.

- ~ 15 According ~o a ~lrst aspect of the present invention, there is provided a xylanase which has at least one~catalytic domain which is substan~ially homologous with axylanase of an anacrobu fuogus and which is not a full length natural xylanase.

Preferred catalylic dor~uls are iden~ical to catalytic domains of natural xylanases

2 o from a~erobic fungi. However, for the purpoæ of the present invenuon, a first sequence is substamially~ homologous with a second sequence if, for example, it shares its~biological acùvity and there is at least about 40% homology at the am~no acid ~lével; ~ so a ~cat~lytic domain of a xylanase of this aspect of the invention has at least about 40% homology with a catalytic domain of a na~ral xylanase of an , 25 j anaerobic f~nyus.i In general, it may be preferred for there to be at least 50%, 60~, 70~, 80~o or 90~O homology ~in increasing order of preference) between the - two amino acid sequences being compared. Homology may alternatively or addidoDally be assessed at the nucleic acid level. DNA encoding a first amino acid sequence may be substantialb homologous with and hybridise to DNA (which ; : .

SUBSTITUTE SHEET
ISA/EP

Wo 93/2s693 ~ pcr/GB93/ol283 ' may be cDNA or genomic DNA) which encodes a second ami~o acit sequence or would so hybridise but for the degeneracy of the ge~etic code. Hybridisauon co~ditions may be stnngen~, such as 65C in a salt soluuon of approximately 0.9 molar.
s Examples of a~aerobic fungi, which may be alime~tary tract (particularly rumen) fungi, in~lude: Neocallirnas~ix spp., such as N. patrici~nun, N. fronIalis, N.
hI~rleyensis and N. stan~horpensis; Sphaerom~nas spp., such as S. conununis;
Caecorrr~ces spp., such as C. equi; Parorrlyces spp., such as P. com~ nis, P. equi, P. d~nbon~ca, P. Ie~argicus and P. ma.; ~n~nonryces spp., such as P. elegans;
A~rorryces spp., such as A. m~c~oru~s and Orpinomyces spp., such as O. ~ovis and ~. joyonii.

C~ecorrgrces e~ui, PiromYces equi, Pirom~ces d~onica alld Piromyces m~ri are found in horses and not in the rumen of cattle like the other fungi listed above.
N~ocaU~ spp. are preferred. par~ctllarly N. pamciarum.

~ylan~ases i~ accordance with the inYenuon may have a high specific ac~vity. Thes;pecific activity may be sign~ficantly higher than that of bacterially derived xyla~ases and may for e~ample be a~ least 1000, 2000, 3000, 4000, 4S00, S000 or even 5~ U/mg protein, in increasing order of preference. (A unit of xylanase acdvity is defined as the quan~ity of eDzyme releas~g 1 ~mole of product, measured as xylose equivalen~s, in 1 mimlte at 37C.). More pa~cularly, xylanases in accordance with this aspect of the invention may be sig~ificandy 25 ' better expressed than naoural XYLA is e~pressed by N. patnciarum: expression may be at least 10 fold improved or preferably at least 100 fold improved over the wild type enzyme.

wo 93/2~693 21~ ~ 3 8 3 pcr/GB93/ol283 .. .

Xylanases in accord~ce with the invenuon may have the ability tO degrade xylan at high efficiency. At le~t 0.1, and preferably at least 0.~ or even 0.75 g reducing sugar may be produced per g xylan subs~ate.

s Xyl~n~es in accordance with ~he inven~ion may have no signif1ca~t residu~lac~ivity against cellulose, in contlast tO maIly hlOWIl xylanases. This property is particularly useful in th~ application of the inve~tion to the pulp ~d paper industry, as the en~yme can remove xylan and dissocia~e lignin from ylant fibre without damaging cellulose fibre.

Xylanases in accordance with the invention may have at least ~wo catalytic doma~ns. The arrangement of the catalytic domains m~y be as in a wild type xylanase enzyme, or they may be arranged in an ar~ficial configura~ion to increase or otherwise improve the xylanoly~ic activity of the énzyme.
A par~cularly preferred xylanase as a source of cataly~ic domains for use in theinven~on, is that derived from l`leocallim~snx p~riciamrn and designated XYLA;
it has the following proper~es:

~ (i) a specific acdvi~ of 5980 U/mg protein for the purified eDzyme when p~epared by the following protocol:

Host cells (E. col~XL1 Blue haroouring a plasmid expressing the enzyme) are harvested by centrifugation ~nd resuspended in 50mM
2S i Tris-HCl buffer~ pH 8.0, and the cytoplasmic frac~ion prepared as described by Clarlce et al, (F7~MS Microbiol. Le~rs. 83 305-310 (1991)). Xylanase, precipitated by ~he addition of ammonium sulphate (0.39 glml), is redissolved in 10 mM Tris-HCl buffer, pH
8Ø After dialysis against three changes of the same buffer. the Wo 93/2s693 pcr/GB93/ol283 xylanase is substan~ially purified by anion~xchange chrom~graphy on DEAE-Triacryl M esseD~ially as described by Hall et al. (Mol.
Microbiol. 3 1211-1219 (1989)).

(ii) ~he abili~ to degrade xylan at high efficie~cy, releasing O.9g o~ reducing sugar per g of the substraæ;

(iii) IlO signifiunt residual acdvity against cellulose (as detelmined by no detectable release of rcducing sugar from carooxymethyl cellulose.
barley ,~-glucan, lamiIlann or liche~an); and (iv) two eatalytic domains.

The s~c~re of mature X~YI,A may be represe~ as follows (from the N-te~ to the C-~ermiIIus):

C~T1 -I,INK1-CAT2-LINK2-CTR1 -CTR2 wherein:
- CAT1 r~presen~s a f~ catalytic domai~, having the sequeD~e:
2~ RlIVGN
GQTQHKGVADGYSYElWLDNTGGSGSMnGSGATFKAEWN
ASVNRGNFL~GLDFGSQK XATDYSYIGLDYTATYRQTG
SASGNSRLCVYGW~:QNRGYQ G~PLVEYYI~DWVDWVPDA
QGRMVI~GAQY~FQMDHT GPlINGGSE1-~KQYFSV'RQQ
! KRTSGHl'rVSDHFKEWAKQG WGIGNLYEVAI~AEGWQS$~
IADVI~DVYl~QKGSNPAP;
CAT2 represents a second catalytic domain ha~.~ing the seque~ce K
FT~GNGQNQHKGV'NDGFSYEIWLDNTGGNGSMl'LGSGATF

wo 93/2~693 ~ ~ 3 ~ ~ PCr/GB93/01283 KAEWNAA~VN~GNFLAR~GLDFGSQKKATDYDYIGLDYAAT
YKQTASASGNSRL(:~VYGWFQ NRGLNGVPLVEYYIIEDWVD
WVPDAQGKMV~GAQY~F QMDHTGPIING~SETFKQYF
SVRQQKRTSGHII VSDHFKE WAKQGWGIGNLYEVALNAEG
WQSSG~IADV~LDVYT~KG SSPA;
LINKl represe~ts a f~ linker having the sequence:
TSTGT~IPSSSAGGSTANGK;
LINK2 represents a second linker ~ving the sequence:
TSAAPRlTrR~TKSLPTNYNK;
0 CTRl represeats a first C-terminal repeat hav~llg the sequence:
CSARITAQGYKCCSDPNCVVYYI~DGTWG~NDWCGCG;
and C1~2 represents a second C-termi~l repeat having the sequence:
~EQCSS~TSQGYKCCSDPNCVVFY~DDGKWGVENNDWC
~: 15 G~&F.

All these pamal sequences can be seen ~ SEQ ID NO: 1 and SEQ ID NO: 2.

The stmcn~e of xyla~ases from other ~robic fuDgi may be broadly similar, but of course the precise sequences of the components will generally be different, unless ~he sou~ce organ~sm is very closely related to N. pamc~ m. It may not be ~ecessary for the endrety of the sequence of each region (particularly the catalytic domains~ to be present for acdvity; in the present invention, although t~e ennren~r of a catalytic domain may be presen~, it is sufflcient for the active portioa ' of the catalytic domaill to be presen~ (that is to say, the catalytic domain must be functioDaily prcse~t).

The tWO catalytic domains can be seen to be vesy similar to each other but not ide~ucal. Tbe difference between them gives an indicauon of the degree of Wo 93/2~693 pcr/GB93/o1283 ..

g homology to a natural sequence that is par~cularly preferred. Th~ two C-terminalrepeats can also be seen to be similar to each other (but less so than the two catalytic domains). The difference between them gives an indication of the degree of homologg which is still highly preferred. The precise sequence of the two s linker sequences may not be particularly important; all that ~s necessary is that ~he spatial arranganent of the catalytic domain(s) is such as to enable them to function effec~ively ~and preferably optimally).
:
Plefened embodiments of the invention comprise a catalytic domain which is 10 subs~ially honnologous with at least o~e of CATl and CAT2 and are missing at least part of the amino acid sequeDce do = (ie towards the C-te~nus) of CAr At least part of CIR2 may be missing; aiternatively or (preferably) additionally, at least pa~ of CI Rl may be missing.

5~ P~ embodhnems of ~cyl~scs in accordance w~th thc invention include those h chidin~ (a~d preferably consisung essen~hlly of) the following regions:
"~

A. CAT1-LlMKl~AT2-LINK2-CTR1(=ted) (eg pNX3);
B. CAI I~LINKI-CAT2-l~N3C2(=~ed) (eg pNX4);
;G.~ CAT2-LlNK2(tn~d) (eg pNX5);
D. ~ CAT1-l~Cl(t~unca~d) (eg pNX6);
E.~ ~ CAIl(t~iDt~)~- ~ (cg pNX7);
F. ~ INKl(imncs~ C~ CIR2 (eg pNX8);
,, - - ~ ~
. G. TlNKl(~uncated~AT2-LINK2-CIR1(tnmcau:d) (egpNX9);
H. IlNK1(=t~) CAT2(truncated) `(cg pNX10).

- (The plasmid designa~ions ~ brackets refer to plasmids ~n the examples whose : ~ ~
exprcssion products are ~c xylaD,ases shown.) Sign~l sequences may initially be present but will preferably be abseM in the final molecule. Structures C, F, G and

3 0 H arc prefcrred and st~ucsures C, G and H are pardcularly prefcrred.

,~ .

WO 93/2~693 ~ 3 Pcr/GB93/0l283 En;zymes in accordance with the inven~ion may comprise a single CAT1 domain.
a single (:AT2 domain, or have two or more catalytic domiins, each of which indcpe~dently may be chosen from CAT1 and CAT2. It may be that substa~ally only catalytic doma~ns are present; a~d as indica~ed above it may be thal not all s of the na~ral catalyti~ dom~in sequences are essennal for ade~ate ac~ivity.

On the imma~re protein a signal pep~ide may be present; the sequence of the na~ral signal pepdde is:
AVAl~TVAKAQWGG&&ASAGQ.
0 lhis se~uence agam is shown in SEQ ID NO:l and SEQ ID NO:2.

Xylanases in accor~e with the in~enuon may be prepared by any~suitable m~. While bulk fermenta~ion of the source anaerobic f~s may be undem~en, and polypepude synthesis by the techniques of organic chemistry may 1~ be atsempted, the method of prepar~ion of choice will ge~erally involve recombi~ DNA technology. A xylanase as descnbed above will therefore for pr~ference be the expression product of heterologous xylanase~ncoding DNA ~n a host cell.

Acco~ to a secoDd aspect of ~he invenrion, there is provided an isolæd or recombinant DNA molecule encoding a xylaDase which has a catalytic domain subs~ally homologous with a xylanase of an aIlaerobic fungus, pro~ded that the DNA mola:ule does not comp~ise a filll length copy of Danlral mRNA encoding the xylanase.
cDNA (apparently comprising a ~11 length copy of mRNA) encoding a xyla~ase of Neocaflimast7~c~ron~alis has been described by ~eymond et al, FEMS Microbiol.Lett. 77: 107-112 (1991), but no expression was reported.

wo 93/25693 ~ 5 pcr/GB93/ol2x3 Althaugh a filll length copy of natural mRNA is not presen~ in DNA m acco~dance with this aspect of the invention. it should be understood that the invention is not limuted to truncated cDNAs. It is contemplated that some or all of the introns (if any) ~laturally present in the corresponding wild type gene may be present.
However, at least some sequence that is present in the full length cDNA is absent in DNA in accordance with this aspect of the inven~ion. It should also be understood that this aspect of the invention encompasses DNAs encoding full leng~ ~ylanases; the abscnt portion of the DNA may be (and in some embodiments preferably is) in the 3' and/or 5' uDuanslated reg~ons. Substantially full ~leng~h or tru~ated xylanases may therefore be produccd from DNA in acco~ce with this aspect of the invendon which (a) is sub ~ntially missing the 3' un~anslàted region, or (b) is substaD~ally missing thc 5' untranslated region or (c) is subs~lly ~missing both the 3' and 5' untranslated regions.

15~ A~ ll b~b~cDNA encod~g a ~ylaDase of an anacrobic fungus (taking the ~ynA
genc of N. pa~ricianun as the prototype) may have the following struc~re:

5'~r-sig^ca~l-linkl-cat2-linY2-ctrl-ctJ2-3'utr, wherein ~ 5'utr~esentsa5'a~anslatedregion;
sig cncodes a signal pepdde;
catl encodcs a ftrst ca~alytic domain;
kl cncodes a first lin~er scquence;
cat2 encodes a second catalytic domain;
! '; 2S I iink~2 c~odes a second li~er sequencc;
ctrl encodes a first C-terminal repeat;
ctr2 encodes a second C-te~inal repeat; and 3'utr represents a 3' untranslated region.

`

WO 93/2~;693 PCI'/GB93/01283 Genomic sequences may have one or more introns interspersed within the above stru~e. In the xynA ge~e eneod~g the XYLA eDzyme of N. parnciarum. the various DNA segme~s have the following se~uesces:

3~utr:
TTTTA~TATATCP.ATCTCTAA m A m ~l~TAGG ~ TAAP ~ TAAATATAAT
AAATATTAGAGAGTA~TP~T~TAAAAACI~AAGAAATTTAAAAACG m A m AGTTAT m TTT~ACTGGTT~AAA~AAAAATAA~AA~CAAAATTAATAAAEATATTTTTGAAAAAT~TT
GA~TT~G~AAAAA;

sig:
ATGA~AACTATTAAATTCTTTTTCGCAGTAGCTATTGCAACTGTTG
CTA~G CCCAATGG&GTGGAGGTGGTGCCTCTGCTGGTCAA;

cat1:
AGATTAACCGTCGGTAATG
GTCAAACCCAACA$AAGGGTGTAGCTGATGGTTACAGTTATGAAATCTGGTTAG~TAACA
CCGGTGGT~vTGGTTCTATGACTCTCGGTAGTGGTGCAACCTTCAAGGCTGAATGGAATG
CATCTGTTAACCGTGGTAACTTCCTTGCCCGTCGTGGTCTTGACTTCGGTTCTCAAAAGA
AG&CAACCGATT~CAGCTACATTGGATTGGATTAT~CTGCAACTTACAGACAAACTGG~A
GCGCAAGTGGTAACTCCCGTCTCTGTGTAT~CGGTTGG~TCCAAAACCGTGGAGTTCAAG
GTGSTCCATTGGT~GAASACTACATCATTGAAGATTGGGTTGACTGGGTTCCAGATGCAC
AAGGTAGAATGGTAACCAl~GATGGAG CAAT~TA1~GAT m CCAAATGGATCACACTG
GTCCL~CTASC~ATGGTGGTAGTGAAACCTSTAAGCaATACTTCAGTGTCCGTCaACAAA
AGAGAACTTCTGGTCATATT~CTGTCTCAGATCACTTTA~GGAATGGGCC~AACAAGGTT
GGGGTATTG&TAACCTSTATGAAGTTGCTTTG~ACGCCGAA&GTTGGCAAAGTAGTGGTA
TAGCTG~TGTCACCAAGTTAGATGTTTACAcaACCcAAAAAG~TTCTAATCCTGCCCCT;

li~l:
ACCTCCACTGGTACTGTTCCAAGCAGTTCTGCTGGTGGAAGTACTGCC~ATGGTAAA;

, cat2:
AAGT
TTACTGTCGGTAATGGACAAAACCAACATAAGGGTGTCAACGATGGTTTCAGTTATGAAA
TeTGGTTAGATAACACTGGTGGTAACGGSTCTATGACSCTCGGTAGTGGTGCAACTTTCA
AGGCTGAA$G&AATG QGCTGTTAACCGT&GT~ACTTCCTTGCCCGTCGTGGTCTTGACT
TCGGTTCTCAAAAG`AAGGCAACCGATTACGACTACATTGGATTAGATTATGCTGCTACTT
AC~AACAAACTGCCAGTGCAAGTGGTAACTCCCGTCTCTGTGTATACGGATGVTTCCAAA

wo 93/25693 2 t 3 8 3 8 3 pcrJGB93~ol283 --13- !

ACCGTGGACTTAATGGCGTTCCTTTAGTAGAATACT~C~TCATTGAAGATTGGGTTGACT
GGGTTCCAGATGCACAAGGAAAAATGGTAACCA~TGATGGAGCTCAATATAAGATTTTCC
AAATGGATCACACTGGTCC~ACTATCAATGGTGGTAGTGAAACCTTTAAGCAATA~CTTCA
GTGTCCGTCAACAAAAGAGAACTTCTGGTCATATTACTGTCT QGATCACTTTAAGGAAT
S GGGCCAAACAAGGTTGGGGTATTGGTAACCTTTATGAAGTTGCTTTGAACGCCGAAGGTT
GGCAAAGTAGTGGTGTTGCTGATGTCACCTTATTAGATGTTTACACAACTCC~AAGGGTT
CT~GTCCAGCC;

li~Lk2:
ACCTCTGCCGCTCCTCGTACTACT~CCCGTACT~CTACTCGTACCAAGTCTCTTCCA~CC
AATTACAATAAG;

ctri: :
TGTTCTGCTAGAATTACTGCTCAAGGTTACAAGTGTTGSAGCGATCC~AATTGTGTTGTT
TA A QCTGATGAGGATGGTACCTG~GGTGTTG~AAACAACGACTGGTGTGGTTGTGGT;

ctr2:
~ GTTGAACAATGTTCrSCCAAGATCACTTCTCAAGGTTACAAGTGTTGTAGCGATCCAAAT ., ~ : :
TGCGSSCrSSTCTA QCTGATGACGATGGTAAATGGG~TGTTG~UU~ACAACGACTGGTGT
GGSTGTGGTTTC; and 5 ' ut~:
TAAGCAGTAAAATACTA~TTAATAA
,,.,- ` : _ ~GAAAAAmA
25~ ~ GAAAA$TTTA
AA$C~:-UU_Irr~U~ A~G~y~GTAAA~AAAAATGAAAGAATTATGAAAAATTA
AAA$GTdUU~rr~U~ ~r~CAAA~IG$AAGAAAAATAAAGAAT$~sAAAAAAAATA
AACAATTATGAAAAACCCAAA$GTAAAC~A~VA O~:U~ ~o~ ~AAAAAAAAA
- ~:
3 0 (Note ~at thc first three nucleotides of the 5'u~r segment consnnlte a stop codon, which will generally be present.) 'rhe use of (less than the ~otality of) these DNA segmcnts, or sequences substandally homologous with them. is preferred in this aspect of the inYention.3 5 Prefe~ed embodirnents correspond generally to the preferred embodiments of the xylanases per se in accordance with ~he first aspect of the invention, but with the WO 93/25693 ;~ pcr/GE~93~ol283 !
-1~

added considerauons that (a) it may be prefe~Ted for a DNA sequence encoding a pep~ide signal se~uence to be present andfor (b) it may be preferred for one or both of the un~anslated regions to be tn~cated or absent. Par~cular embodimen~s of this aspeet of the inveD~ion include those including (and preferably consis~ing s essentially of, apart from vector~erived sequen~es) the follow~ng segments:

a. 5'~r-sig-ca~l-fin~l-cat2~ ¢-ctrl(~ca~d) (eg pNX3);
b. 5'u~r-sig-catl-lin~l-cat2-lir~ runcated) (eg pNX4);
c. Iin~l(~at~)-c~t2-link2(~uncated) (eg pNX5);
io d. 5'u~r-sig-ca~l-linkl(tn~ated) (eg pNX6);
e. 5'u~r-sig-ca~l(tluDsa~ed) (eg pNX7);
f. Iin~l(truncated)-cat2-link2-ctrl-ctJ2-3'utr (eg pNX8);
g. Iin~l(tTuDcated)-~ link2-ctrl(tn~cated) ~eg pNX9);
h. Iinkl(truncated)-c~t2(trunca~ed) (eg pNXlO).
I S
(The plasmid designations in braclce~s refer to plasmids in the examples including the DNA sequences shown.) S~uc~res c, f, g and h are preferred and s~c~es : ~ ~ c, g and h are par~icularly preferred.

Rccombina~t DNA in accordance with the inven~ion may be i~ the form of a vector. T~c vector may for example be a pl~d, cosmid or phage. Vectors will frequon~dy include one or more selec~able mar~ers to enable selecdon of cells d (or transfom~ed: the terms are used interchangeably in this specifilcation) with them ~nd, preferably, to enable selection of cells har~ounng - 25; I vectors in~orpora~ng heterologous DNA. Appropria~e start and stop signals will gencrally be present. Additionally, if the vector is intended for expression.
sufficiem regulatory sequences to drive expression will be present. Vectors not including r~gulatory sequences are useful as cloning veetors; and. of course exp~ession vectors may also be useful as cloning vectors.

Wo 93/25693 i'' 1 ~ ~ 3 ~ 3 PCI/GB93/01283 .. ,. :

CloDing vectors can be introduced ~to E. coli or another suitable host which facilitate their manipu~ation. According to a~o~er aspect Gt' the inve~ion, there is there~ore pro~ided a host cell transfected or transformed with DNA as described ::
above.
DNA in accordance with the inven~ion can be prepared by any convenient method invol~ring coupling together successive nucleo~des, and/or ligating oligo- and~or poly-mlcleoudes, including in vitro processes, but recombinant DNA technology forms the method of choice. `
' ' Xylanase-enc~ng DNA may be cloned from a DNA li~rary, which may be prepared from one of the abovc fungi. The libIary may be genomic, but ? cDNA
library may be easier ~o prepare and work with, particularly if steps are talcen ~o enhance the likelihood of the presence of xylanase-encoding cDNA in the cDNA
libra~r.

Cultivation of a chosen fungus, such as N. pa~riciarum, may proceed anaerobically in an appropriate cul~re medium co~ rumen fluid; the sole or predomi~a~t carbon source may be ~cylan so as to promote xylanase e~pression a~d. hence, to 2 0 cause an ~crease ~ the amouIlt of xy~se~ncoding RNA. However, culdvationin the preseDce.of xylan is n~t essen~ial, and the carbon source may i~stead be a cellulose, such as the microcrystalline cetlulose sold under the trade mark A~CEL.

After cul~ivadon of the fungus, total RNA may be extracted in a~y suitable ;
ma~me~. Fungal cells may be harvested by filtration a~d subsequently lysed in appropriate cell lysis buffer by mecbanical disruption. A suitable RNA preseningcompound. such as guanidinium thiocyanate. may also be added to the fungal cellsto reduce or prevent RNase-mediated digestion. Total RNA may subsequently be isolated from the resulting homogenate by any suitable technique such as by WO 93/25693 ~ X 3 PCI`JGB93/01283 :

-1~

ul~acentrifuga~ion through a CsCl2 cushion or as described in Sambrook et al.
Molecular Cloning: A ~ n~r~ztory Mamlal, 2nd Edi~ion, Cold ~pring Harbor.
New York: Cold Spring Har'oor Laboratory Press (1989).

Another method for prepara~ion of total fungal RNA in addition to ~hat describedabove may be based on or ad~pted from the procedure described ~ Puissam and Houdebine Bio-Tec~ni4ues 148-149 (1990). In this metho~, total fu~gal RNA can be isolated from the above homogenate by extrac~on with phenol/chloroform at pH

4 to remove DNA and assoshted protein. The resulung crude RNA was further o p~ied by washing ~vith lithium chloride-urea solu~cion.

A suitable ~her ~chDique for fungal RNA ex~action is that of Teen et al. (Anal.
Biochem. 164 60 67 (1987)).

15 ~ Once total RNA has been e~tracted, by whichever method, poly-A+ mRNA may : then be is~lated from the total RNA, for example by affini~r chromatography on a compoutld cont~ining multiple thymidine or uracil residues, to which the poly-A
~ail of the mRNA can bind. Examples of suitable compounds include oligo-dT
cellulose arld poly-U SEPHADEX . Poly-A+ mRNA ca~ then be eluted by a suitable buffer.
.:
A cDNA e~pression library m~y then be construc~ed using a sta~dard technique b~ on co~lr~sion of the poly^A+ mRNA to cDNA by reverse ~anscriptase While it is possibk to collstruct a genomic lib~ary, a cl)NA library is prefer~ed because it avoids ~ny difficulties which may be caused by the presence of introns ~n the fungal genomic DNA. The first s~and of cDNA may be sy~thesised using r~everse transcriptase and the second s~and may be synthesised using any suitable DNA~irected DNA polymerase such as Escherichia coli DNA polymerase I (E
~o~i p~l I).

r~ ~ U ~J ~J J ~
Wo 93/2~693 pcr/GB93/ol283 , The cDNA may subsequently be fractionated to a suitable size and may be ligated to a suitable vector which is preferably a phage vector such as ~ZAP, ~ZAPII or ~gt 11. Suitable kits for ~he purpose are available from Stratagene. Fur~er or alte~auve guidance may bc had from Reymond et al ~ MS Microbiol. Lett. 17 s 107-112 (1991)) whichdetails the preparation of a cDNA library from N. fron~a~is.
The resulting cI)NA library may then be amplified after packaging in vf~o, usingany suitable host bacterial cell such as an appropnate stra~n of E. coli.

Thc scree~Dg of xylanase positive :recombinant clones may be carned out by any suitable technique, which may be based on hydrolysis of xylan. In this procedurethe clones may be grown on culture media incorporaung xylan and hydrolysis may be detected by the preseDce of xylanase-posidve pla~ues suitably assisted by a able colour i~icalor. Methods for selecting xylanase+ clones are described in ,.
ranlre. Two examples are Clarke e~ al. (~S Microbiol. Lett. 83 305-310 (1991)) and Teathet and Wood (,4ppl. Enuron. Microbiol. 43 777-800 (1982)).

posiuve recombinant cloncs may then be purified (that is to say a pla~ue may be con~eed to a bac~rial colony) by well established procedures. Suitable .~
tecb~iqu~ ca~ be found: i~ Sambrook a al (1989) (IOC. Cil.), but it would be usual : 2 o s~npb to follow the rPni~fs~er's insn~bo~ in whichever kit was being used and tbe~ cDNA insert in: the clones tDay the~l bc excised into a vector of choice, , ~, . ~ - . ~ .
such as pBLuEscR~pTsK(-) to Dame only one e~cample. Other suitable plasmids can be used for ~ubcloning; examples~:include thc pUC p~smids and plasmids derived fro~n them. as describcd in Sambrook a al, Molec~lar Cloning: A L~ora~ory ~ Manual, 2~d edidon, Cold Spring Harbor,, Ncw York: Cold Spring Harbor - Laboratory Prcss (1989~. ExpressioD vec~ors (particularb plasmids) in wh~ch the xylanase-encoding DNA is under the control of an appropriate promoter may also be fonned by ligadon and transformed and transfected into a suitable expression host. :Examples of suitablc exprcssion vectorS include thc pUC senes (which havc WO 93J~5693 ~ .l 3 8 3 8 3 P~r~GBg3lnl283 ~ .

~e lac~7 promoter), the pMTL series (which also have the lac~ promoter and pBLuEs~uPr (which has both the lac~D promoler and the T7 promoter).

The na~re of the promoter is not in general believed to be particularly crincal and will depend on the expression host and the conditions under which expression is desired. As indicated above, a sui~able example for a bac~erial expression host such as E. coli is the lacZ promoter. Alternauve promoters for bacterial hosts include the bacteriophage T7 promoter.

It may not be necessary to purify recombinant xylanases from their expression hos1:s. While ~. coli as a host cell ~nay be suitable for application of ~e xylanase of the inve~non in pulp manufacture, it will be appreciated that other host cells could be used such as g~am positive bacteria inclusive of Bacillu3 sub~is, or lactic acid bacteria. Alternatively a eu~aryotic e~pression host may be used; an example lS would be yeast (such as Sacch~ror~ces cerevisiae).
' Host cells expressing xylanases as described above andJor harbour~ng DNA
se~uences as described above (whether for expression or other~vise) themselves constitute a further aspect of the i~ven~ion. Also included in t~e invention are2 o methods of prepar~ng a host cell, in which xylanase-encoding DNA is transformed or ~ansfected into a cell, and methods of producing a~xylanase, in which expression hosts are cultivated to e~press xyla~ase~ncoding DNA.

Depending on the na~e of the host cell, it may be preferred for recombinant 2s I DNA in accorda~ce with the invendon to include a signal sequence. Either a host-specific sigDal sequence may be included or, for expression in eukaryotes, the enzyme's own signal sequencc may be used. A translational s~t site adapud for or preferred by the expression host may be provided; however, the protein!s own translational star~ site may be ade~uate or even in some circumstances preferred.

wo 93/2~693 pcr/GB93/ol283 -19- ' Recombina~ xylanase eDzyme from an expression host may then be characterised.
Principal feanlres that have been ascerlained for certain embodirnents of the invention are as follows:

S (i) the cloned xylanase has a very high specific ac~ivity (5980 U/mg protein of the purified enzyme); this is in con~ast to many cloned xylanases from bac~eria which have been reported so far;
(ii) the enzyme is able to degrade xylan at ex~aordinarily high effic}ency, releasing O.9g of reducing sugar per g of the substrate.;
0 (iii) the enzyme has no residual activity again cellulose? while many other xylanases possess some cellulase activity; and (iv) the enzyme contains t~vo catalytic domains, which m~y have po~mial for const~uction of a highly efficien~ ~ylanase-producmg clone by nber genetic maDipuladon of the xyla~ase cDNA.
l~e high specific activi~ of the full length cloned xylanase (he einafter refe~red to as xyl~se A) (5980 U/mg prouin of the purified enzyme) is an intnnsic p~op~;y of this fu~gal xylanase. HoweYer, the expression level of the presem coDs~ua cf ~nA cDNA in pBluescript vec~or (pNX1) is reladvely low in E. coli, accou~g for 0.3b of soluble protein synthes1sed by E. coli cells. Generally sp~g, the; expression of the cloned gene at the level of ~ 10% of total cellularE. cali protcin is anainable.

, Trun~ated fonns of ~ynA cDNA may be prepared by the use of restric~on ! enzymes.- S~ome truncated forms, including that in the plasmid designated pNX~, ;~; produce se-reral hundred-fold higher xylanase acdvity than pNXl. One explanadon - ~ for this obscrvadon Is that is a result of the utilisation of LacZ transladon initiation sequence for the synthesis of the truDcated xylanase A. Another explanadon is that avoidance of AT-rich regio~s may result in higher expression levels; a theory is . .

WO 93/25693 PCI~/GB93J012~3 'r~

!

that t}3e m~NA degrad~ng ae~ivity of RNase E is the rale limiting step in protein sym~ sis, and ~hat RNase E has a preference for AT-rich regions of mRNA. It is possible ta further increase its e~pression level in E. coli by using a slronger promoter, such as Bacteriop~age T7 promoter.
-~
Reco~binant xylanase A (XYLA~ purified from ~:schenchia coli ha~bou~i~g xynA.
had an Mr7 Of 53000 and hydrolysed oat spelt ~cylan to xylobiose and xylose. TheeDzyme did not hydrolyse any cellulosic substrates. Fhe nucleoude sequence of xynA reYealed a single ope~ reading frame of 1821 bp coding for a prouin of Mr 66192. The predicted primary s~uc~re of XYLA comprised of an N-terminal signal pep~de followed by a ~25 amino acid repeated sequence, which was sepatated from a tar:dem 40 residue C-terminal repeat by a threonine/proline lin~er sequence. The large N-terminal reiterated regioDs consisted of dis~inct ca~ytic doma~s Yvhich displayed similar substrate specifici~ies to the full lenglh enzyme.
Xylanases in accordance with the inven~ion h~Ye a number of applications in the food, feed, and pulp and paper andustries. The use of xylanases described hereiniIl these indus~ies is included ~vithin the scope of the in~rention.

2 o Dealing first with the food indus~y, certain proper~ies of dough a~d its resultant baked products are dependent on the pentosaII and starch content of the flour used.
- These properties include the tex~re, volume and staling of bread. The use of xylanase could modify ba~d products to provide goods of poten~ial commercial value. Among the propesnes that can be modifled by ~cylanase ~ ent is the } I 2s ! specific volume of bread. The increase in specific volume is enhanced further when amylase is added in combination with xylanase. One of the factors conlribuu~lg to this effect is the wate~-binding capacity of carbohydrates. The invenuon provides dough including a xylanase as described herein.

wo 93/2~693 ~ ~ pcr/GB93/ol283 In the anim~l feed industry, the use of en~ne supplementa~ion to ~mprovc feed for chicks was repo~ed as early as 1957. More rece~ results suggest that, ~n certain grains such as whea~, and pamcularly rye, it is the pentosans in the endos~e~m that are mainly responsible for poor nutrient uptake and sticky droppings from the chicks. Both problems appear to result from the high viscosity of the undigested ~entosans. This hampers the diffusion of nutrients and binds water to make excreta watery. The problems can be alleviated using xylanase prepara~ions. Xylanase action can improve both the weigh~ gain of chicks and their feed conversion efficiency. It appears that ~cylanase supplementation could be used to improve the nutritional value of rye, so as to promote ~he use of this grain in chick feed. The effectiveness of this trea~nent may be dependent on thevariety of rye. The invention provides the use of xylanase in chick feed and grain for these purposes.
.

In the pulp i~dustry, dissolving pulps are purified celluloses used for making viscose rayons, cellulose esters and cellulose ethers. They are derived from - - ~ prehydrolysed kraft pulps or acid sulphate pulps. Their processing is characterised by the derivadsadon of the cellulose at one stage, the derivative being soluble in corasnon solvents and thus permimng the formation of fibres, films and plastics.Impurides in the cellulose hamper derivatisa~ion and thus lead to insolubles tha~
block orifices in sprayers or foIm defects in the final product. Furthelmore, certain xylan ~mpurities can lead to colour, h~e a~d the~mal instability in acetate products. Xylanases may thus have a role to play in removing impurities, and theuse of ~ylanases described herein for this purpose is comprehended withi~ the - 25 ' invention. i The pre~leaching of kraft pulp using cellulase-free xylanase has been identified as one of the biotechnologies most li~cely to be accepted in the pulp and paper industry in the near future, but only if suitable xylanases become available. The W093/25693 ~ ~ 3 ~ 3 83 pcr/GB93/ol283 lcraf~ (also k~own as aLkal~ne or sulpb~te) process h~s become the predom~t pulpmg technology in Car~ada because i~ produces stTong wood fibr~s and because the chemicals used are recovered and recycled. Kraft pulps, par~icularly those derived ~rom sofnYoods, are rela~ively difficult to bleach. A sequence of stagesS using elemental GhlOri~le and chlorine-co~t~g compounds is traditionallyrequ~d to bleach these pulps effectiYely to the desired filll brightness of ~ 90% .
The bleaching process, particlllarly when using elememal cblorine, products chloro organics that have tradidonally been discharged ~rom the bleach plant with the waste water. However, both public demand and legislated regulations are presen~ly pressurizing pulp mills to reduce or elirninate the emissio~ of these pollutams. The pulp and paper indus~y is considering the implementadon of various alternative technologies in order to reduce the enviromnental impact of its miLls. These options include xylanase prebleaching of kra~t pulp. Xylanases in accordance with the present ~ven~ion are particularly well suited to this purpose.
It is beliewd that the xylanases of the present invention are par~icularly applicable to the paper a~d pulp industry. While it is appreciated that the use of e~nes will never replace chemicals completely, there is pressure heing exe~ed by ~hoseconce~d with the environment to reduce the use of chemicals. There are also 2 o practical reasons for reducing the use of chem~cals in the paper and pulp i~dustry.

Pulping plants usually generate their o~n supplies of chlor~e and chloaine dio~cide on site, and this can limit capaci~r as well as being pote~rially hazardous. Treating the paper pulp (eg kraft pulp) to remove lig~n involves the use of chlorine, NaOH, }I2O2 and chloriI~e dioxide. Sandoz in the USA have co~ducted practical tnals using the~r CARTA~YME product, which is a fungal xylanase (crude), active at 30^55C, pH 3 to 5, and conuins 2 ~cylanases, and have fou~d that a 25-33 reducuon in chlorine is possi~le using lU xylanase/gm pulp. Also the product is brighter than when chemicals alone are used. Another advantage of the xylanase WO 93/2~;693 ~ PCI`/GB93/01283 i ` .. .

is that it is specific whereas chemicals can attack the cellulose at low lignin contents, leading to reduced ~lbre strength and other undesirable physical character¢~ics. lt is therefore clear that xylanases could become more i~nportant in pulp bleaching and recombinant ones particularly so because of their specificity and high yield. It is believed tha~ lignin is bonded to hemicellulose, and if the hemiceUulose (xylan) is depolymerised the lignin may be partially disassociated from cellulose and subsequently washed out. At present, however, some chemical rr= may still be necessary. The main points about xylanase of the present invennon, with respect to commercial us ~e, are (i) its very high specific activity and hip levd of expression would make it economical to produce on a large scale and (ii) its lack of cellulase activity make it particularly useful where it is necessary to remove xylan specifically as applied to the paper malcing and te~ctile industry. ;~-.
~ It is also belicved that the xyianase of the invention could find a valuable 15~ ; ~ a,ppiication in ~he sugar ind;us~y and in reiation to the ~eatment of bagasse or other prociucts containing xylan for more efficie~ disposal.

It was pr~ously mentioned ~hat the protein sequence of XYLA and the DNA
sequ ce~ of ~nA~were made available on S May 1992 on the EMBL database 20 ~ ~ under accasion number X65526. This availability may not constitute effective pnor art~in ~the jurisciicuons of all of the states designated in this application. For ~ose jurWic~ons~where the EMBL database entry does no~ consdtute effective prior art, notice is hereby given that the invendon is and will be defined more broadly~ tban as indicated above. In particular, the invendon may then be seen to , 25 I reside in the follo~ving further aspects:

a xylanase which has at least one catalydc domain which is substantially homologous with a xylanase of an anaerobic fungus; the xylanase may be a full length natural xylanase of an anaerobic fungus; and SU BSTITUTE SH EET
ISAJEP

tJ t! ~
wo 93/2~693 pcrJGB93tol283 . : , -2~

an isolated or recombinan2 DNA molecule encoding a xylanase which has a catalytic domain substantially homologous with a xylanase of an a~aerobic fi~gus, provided that if the DNA molecule is cDNA encodi~lg a xylanase of Neocallimasrxfronlalis ~hen the DNA molecule is opera~ively coupled to a promoter; the DNA molecule may compnse a full len~h copy of na~ral mRNA encoding the xylanase.

It will be ~pparent from the ~or~going that the invention ~cludes within its scope not only the recomb~ ~ylanase deseribed above but also ~cyla~ases derived from 0 othe~ anaerobic fungi as described above which may be prepared by the methods - descnbed herein. The inven~ion also includes withi~ its scope ally mutam derived from N. pa nczarum or s~s denved from N. patrician~m by se~ecdo~ or gene ~ansfer.

The inve~ion also includes withi~ its scope (ij DNA sequences derived from pNX1, pNX4, pNX5, pNX6, pNX8, pNX9 a~d pNX10 a~ld DNA se~ue~ces capable of hybridising thereto;
~o (ii) a DNA coDstruct coD~aining a :l)NA se~ue~ce as in (i) operably linked to regulatory regions capable of direc~g the e~pr~ssion or over~xpression of a polypeptide ~a~ring xylanase acuvi~ in a suitable exprcssion host;
(iii) a transformed microbial host capable of the expressio~ or over-2S expression of a fungal xylanase containing an expression CQ~lStnlCt as in (u);
(iv) a poly~ep~ide having xylanase activity produced by expression using a microbial host as in (iii);
(v) amino acid se~uence as shown in Figu~e 4 including Wo 93t25693 pcr/GB93/ol283 ,::

componen~s A, B, C and D and am~no acid sequences dersved from this ~cylanase; alld ~vi~ plasn~ids descnbed in Fi~e 1.

The invemion also includes within its scope a method of prepara~ion of a xylanase from F coli b~o~g ~he recom~inant plasmids as shown in Figure 1.

Each prefe~Ted fea~re described above with referen~e to one aspec~ of the inven~io~ is equally pre~erred, m~ns mutandis, for each o~her aspect.
l~he in~emion will now be illu~ated by the following examples. Tne examples refer to the accompanying dra~gs, in which: .

FIGURE 1 ~s a res~ricuon map of recom~inant pl~ds co~taining ~ynA.
The posi~ons of the cleavage sites of EcoRI ~), Ssd (S), ScaI (Sc), ~paI
: ~ ~p), ~nI (K), XhoI (X), SmaI (Sm), PvuII (Pv), NaeI (Na), NruI (Nr), StuI (St) and Hindm (H) a~ shown. Res~icuon sites of mul~iple cloning rcgions or vectors iD paren~hesis bave been des~oyed. Mul~ple clo~ing r~gions of vectors, designated by ~, are denved from pSKtS), pMTL20(20) ~ p~l22(2~ re~ively. The solid line ~vith an arrow shows the extcD~ and orie~tauon of the xynA open ~eading ~ame. Construction of the deledon ~utants of ~nA is deta~ed below. The phenotypes of E. cofi s~ains har~ouring the recombinant plasmids are sho~rn.

i FIGURES 2A and 2B show the purificadon of XYLA. SDSIPAGE of XYLA purified from cell-free e~ctract E. coli XLl-Blue harbouring pNX1 (A) or pNX5(B). I~ne 1 contained XYIA punfied ~y anion exchange chromatography, lane 2 contained cell-free extract from E. cofi harbouring pNXl or pNX5 and lane 3 (B only) conuined cell-free ex~act from F. coli .

f, ~
wo 93J25693 pcr/Gs93/o 1283 2~

con~ning pBluescript SK. Gels depicted in A and B co~ained 10% (w/v) or 1~ % (w/v) polyacrylamide, respec~ively. Pm~ein s~es are shown in kD.
de~uced from the marker proteins which are high (Figure 2A~ or low (Figure ~B) molecular weight m~rkers from Sigma.
FIGURE 3 shows the effect of purified XYLA on the specific YiSCosity of soluble xylan (0.5%) in PC buffer, pH 6.5 a~ 37C. Specific viscosity (a and reduc~g sugars (~) were measured as descnbed below.

0 FIC~URE 4 ShOWS the P~ S~ O~ XYI.A. ~he tWO hOmO1OgOUS
CatalYtiC dOmainS, deSi~ A and B, tOgether With the dUF~Iiea~d C
term~ SeqUe~CeS (C a~d D~ are bO~Cd.

FIGURE S ShOWS the alignmen~ Of hOmO1OgOUS r:~OnS Of N. PamCian~m XYLA and PrOkarYOte XYlanaSeS. T~e e~YmeS COmPared Were aS fO11OWS:
B. p~ralus XY1anaSe A (XYLAB; PUh~ et al, F~S Lett. 171: 197-201 ~1984)~, B. circulans XY1anaSe (XYLBC; Yang er al, Nucl. AQdS ReS. 16:
7178 (1988)) and ~. acetobr~ylicum ~:ylaDase B ~ ~CA; ZappC et al., Nucl. Acids Res. 18 2179 (1990)). Residues which show ide~itY or similarity in all pnmary sequences compared are boxed. The positions of the first and last residues of homologous IegiQIlS, in ~heir respec~ive primary sequences, are sho~.

PIGURE 6 shows the struc~re of plasmid pNXl.
2s F~GURE 7 shows the clo~ing and characterisa~on of Neocallimas~x :
pa riciarum xylanase A encoding cDNA.

wo 93~256g3 21 3 8 3 8 3 PCI/GB93/01283 .

EXAMPLE 1 - PreDara~ion of pNX1 1.1 Microbial strains. vectors and culture media The a~aerobic fi~ngus Neocallimam~ pamc~ (~y~e species) was isolated from a sbeep rumen by Orpin, C.G., and Munn, E.A., Trans. Br. Mycol. Soc. 86: 178-181 (1986). Host strains for cDNA cloning were E. coli PLK-F' and XLl-B~ue.
E. co~i s~ JM83 was used for characterisation o~ the xylanase+ cl)NA clones.

The vectors were AZAPII, pBLIJESCR~s~(-) (Stra~agene), pMTI~0, pMTL22 and p~3 (Cham~ers et al, Gene 68: 139-149 (1988)). N. patrtcianun cul~re was mai~ed in a medium containing 10~ mmen fluid as described by Kemp et al, J. Gen. Mtcrobiol. 130: 27-37 (1984)). E. coli straJns were grown in L-broth (Sambrook et al, Molecular Cloning. A Laboratory M~, 2nd ediuon. Cold - ~ Spnng Harbor, New York: Cold Spring Ha~bor I~boratory Press (1989). The recombinam phage were grosqn in E. coli strains using NZY med~rn according to Stratagene's ins~ucuons.

1.2 ~ral recomb~ant DNA~çchniq~es Agaroso-gel elec~phoresis, transforma~ion of E. coli and modifica~on of DNA
using reslrictioD c~es and T4 DNA ligase were as described by Gilbert et al., J. Gen. Micrabiol. 134 3239-3247 (1988). I~rge amoun~ of plasmid DNA was ex~ d from & coa by ~rij lysis' and subse~ueD~ CsCI density-gradient cen~ifbgadon (1ewell, D.B., and Heli ski, D.R., Proc. Natl. Acad. Sci. USA 62:
1159-1166 (1969j). The rapid boiling method of Holmes, D.S., alld Quigley, M., ' Anal. Biochem. 114: 93-197 (1981) and the al~aline lysis method of Birn~oim, Hl. and Doly, J., Nucl. Acids Res. 7: 1513-1523 (1979) wcre employed to isolate plasmid for rapid restricuon analysis and nuclcotide se~uencing, respecuvely.
Northcrn hybridisadon was as described by Gilbcrt et al, J. Bactenol. 161: 314-320 (1985)~
;~

~ ~ 8 .~X~
Wo 93/2~693 pcr/GB93/ol~83 ,~, -2~-1.3 Cultivation of rumen a~erobic fun~us. N. Datriciar~m . patr~czanun was grown in a rumen fluid~ontaining medium (K;emp et al, J.
Gen. Microbiol. 130: 27-37 (1984)) in the presence of 1 æ AVICEL at 3gC and anaerobic conditions for 48hr ~Alter~ative culture media7 su~h as described by s Philips, M.W., and Gordon, G.L.R., Appl. Emnron. Microbiol. 55: 1695-1702 (1989) and Lowe et al, J. G~n. Microbiol. 131: 2225-2229 (1985), ca~ be used.

1.4 Total RNA isolation Ihe frozen mycelia were ground to fime powder under liqnid nitlogen with a mor~ar and pestle. 5-10 vol of ~idinium thiocyanate solu~ion (4M guanidiniurn :~
thiocyanatc, 0.5% sodium laurylsarcosine, 2SmM sodium citrate, pH 7.0, 1mM
EDTA and 0. lM ,B- mercaptoethan~l) was added to the frozen mycelial powder and the mi~re was homogenised for 5 min with a mortar and pes~e and for a fu~her 2 min at filll speed using a Polytron homogeniser. Total RNA was ~solated from the homogenate by ultr~centrifugation through a CsC1 cushion (Sambrook e~ al, :
Molecu~ar Clorung. A Laboratory Mon~lal, 2nd edi~ion. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press (1989). (Alternative me~od for preparadon of total fungal RNA, such as ada~tation of the procedure described byPuissa~t, C., and Houdebine, L.M., Bio-Techniques 148-149 (1990), ca~ be us~d).
;~
1.5 Pdv A+ mRNA purifica~ion - Poly A~ rnRNA ~vas purified from the to~al RNA by Oligo (dT) cellulose chromatography (Sambrook a al, Moleculw CIQning. A L;a~oratory Man~ nd edidon. Cold Spring Harbor, New York: Cold Spring Harbor I,aboratory Press ~ (1989). :

1.6 Cons~uction of a cDNA e~D~lb~amctarum The cDNA library was cons~ucted. using S~atagene's ~ZAP cDNA svnthesis kit.
basically ac ording to the mar~fac~urer's instructions.

~ J ~
wo 93/2~693 Pcr/Cl~93/01283 The procedure is described briefly as follows: Poly A+ mRNA was conven:ed to the first strand cDNA by reverse transcrip~ase, using XhoI linker - oligo (dT) primer and 5-methyl dCTP. Double-s~anded cI)NA was synthesised from the f~st-strand cDNA by the actio~ of RNase H and DNA polyme~se I. After blun~ing cDNA ends, the cDNA was ligated with EcoF~ adaptor, phosphorylated and digested with XhoI to c~eate cDNA with EcoRl site at 5' region and XhoI siteat 3' region. The cDNA was size-fracdonated by 1% low-melting point agarose gel electro-phoresis and 1.2-8 Kb sizes of the cDNA were recovered by phenol exlIac~ion (Sambrook et al, Molecular Cloning. A r~horatory Manual. 2nd io edition. Cold Spr~ng Harbor, New Yo;lc: Cold Spnng ~arbor Laboratory Press (1989)). The size-fractionated cI)NA ~as then ligated to she Eco~ll~oI digested ~ZAPII vector (other expression vectors can be used).

Ihe cDNA library was pac~aged in vitro and amplified using E. coli PLK-F' as 1~ pla~ing cells.
,~
1.7 Screenin~ xvlanase-~03itive recombinant bacteriopha~e clones Recainbinant phagc were grow~ inE. coli ~1-Blue in 0.7~ top agar containing 0.196~ xylan and iOmM isopropyl~ D-thiogalactopyranoside (IPTG, an inducer for LacZ promo~r con~rolled gene cxprcssion). After overnight incubadon at 37C, 0.5 ~i Congo red soluuon was ad~ over the top agar. Af~er incubauon at RT for 15~min, the unbound dye was ~emovcd by washing with lM NaCl. Xylanase-p~oducing ~phage plaques were sur~un~ by yellow haloes against a red .
bacl~ground.

The xy!anase-posiuve recombinant phage were purifled to homogeneity by replating and rescreening the phage as above for 2-3 times~

;

wo 93/25693 ~ ~ ~ 8 ~ 8 ~ PCI/GB93/01283 , .. . .

The cDNA inser~s in xylanase-positive ph~ge were excised into pBLuEscR~r SK-using VCS-M13 helper phage.

1.8 Xvla~.~se and related~nrrme assavs s The enzyme ex~acts from E. coli narbour~ng xylanase-positive recombinant plasmids were prepared as described by Kellett et al, Biochem. J. 272: 369-376 (lg90).

The en~ymes were assayed for hydrolysis of ~ylan or other subs~ates at 37C In SOmM potassium phosphate /12mM citric acid buffer, pH 6.5 and the reducing sugars released from xylan or other plant polysaceharides (carboxyme~hyl cellulose, barley ,~-glucaD, laminann, lichenan) were measured as described by Kellett et al, Biochem. J. 272: 369-376 (1990) and Hazlewood e~ al, J. Gen.
Mictobiol. 136: 2089-2097 (1990). Assays for activities against artificial 1 5 substrates~methylumbelliferyl-,B-D-cellobiosidelnethylumbelliferyl-~B-D-glucoside, methylumbeiliferyl-,~-D-xyloside and ~ni~ophenyl-,B-D-xyloside) were described by Hazlewood et al, J. Gen. Microbiol. 136: 2089-2097 (1990).

1.9 NA se~ucncin~
Plasmid ONA, dens~rcd by alkali, was neu~alised and further purified by spin dialysis (Murphy, G., and Kavanagh, T., Nucl. Acid Res. 16: 5198 (1988)).
.
; Seque~i~g of the resultant DNA was based on thq protocol recommended by the ma~f= of the Sequenase DNA seque~cing kit (USA, CleYelan~, OH).
Overlapping sequences were ge~erated by cloning appropsiate restricdon fragments!i, 25 , into pMll~based vectors. Sequences vere compiled and ordered using the computer pro~ams describcd by Staden, R., Nucl. Acids. Res. 16: 3673-3694 (1980). The complete sequence of the cDNA contained in the plasmid designated pNXl was determined in both strands. The xylanase~ncoding gene contained in the plasmid was designated xynA and the gene product, the xylanase enzyme itself, 3 o was designated XYLA.

wo 93J2~693 PCr~GB93/01283 , ....

!

E~AMPLE 2 - Constluction of pNX4~ a Deletion Mutant of ~NXl (x~tnA) ;: ; pNXl was linearised by Xhol and the 3' region of ~ynA cDNA was removed by ~al-31 digestion (Hall, J., and Gilbert, H.J., Mol. Gen. Genet. 213: 112-117 (1988)). After blunt ending, the m~d cDNA was excised from pNX1 by oEU diges~ion and cloned into l~coRIlSmaI digesled pMTL22 vector.

EXA~E 3 - Consm~aon of DNXS. a Deletion Mutant of pNX1 (xvnA) ~ 720bp~5~1/N~ agm~ was~ ~excised from p~ and cloned into pMTI20 ~or. Ihis resultcd-in a higbly expressi~g clone, in which the enzyme e~cpression1 evds~were some b~ln~ higher tha~ for pNXl.

4~- Cor~o~of ~NX6. a~ Deletion~Mucmt of ~NXl (x~nA) .

w~ c~ by ~cleaving; :pNXl; with: EcoPllScaI: and cloning the

5 -:~i of pN~8. a Deletion Mutaffl of nNXl fxvnA) It XI ~ded~S d~to:o~ain 1.3~b fragment which was clod so~ saj~e~ in phase with the L~cZ ATG
a~ ~ clone ~which the c ~ lcvcl~was: app~imaely~fifteen times that of pNXl.

6 ~- Coffon of ~NX9. a Deletion M~tant of ~X1 (xvnA) PNX8~was;~cut with ~MI (1 ~ si~ in vector polylinlter) and the i~sert f~agment, after elecDelu~n was~ digesled w~ RsQI (culs iD the~ PT linker region of the gene) tO

Wo 93/2~693 2 ~ 3 ~ 3 8 3 P~/GX~93/01283 produce a -700bp fra~en~ which was cloned i~to pMTI~0 which had been CUt with B~mI and StuI. Ihis resulted in a highly~xpressing clone (much bet~er than clone con~g pNX8) with second cata~ytic domain in frame with veclor LacZ
N-tesm~us.

EXAMPLE 7 - Construction of pNX10. a Deletion Mutant of ~X1 (xvn~A) pNX8 was digested with Kpnl and the f~agment (-850bp) was ligated in~o ~;DnI-cut- pMT~0. This clone also e~pressed well but the protei~ expressed con~s some io residu~s at the carbo~y end, which when removed allow for the high level e~pression observed for pNX9.

E~LE 8 - Purification and amino acid sequencin~ of the N-terminus of xvlanase A
1~ ;
E. coli XL1-Blue harbou~ing pNX1 or pNX5 was cul~ured for 16 hours in LB
bro~h con~aining ampicillin (1OOug/ml). Cells, hanrested by centrifugation. werere~nded in 50mM TrislHCl buffer, pH 8.0 and the cytop}asmic fraction ~- ~ prepared as described previously (Clarlce e~ al, F7~MSMicro~ol. Lett. 83: 305-310 2 0 (1991)). XylaDase, precipitated by the addi~on of ammonium sulphate (0.39glml), was rcdissolved in 10mM TrisiHCl buffer, pH 8Ø After dialysing against 3 cha~ges of the same buffer, the xylanase was substansially purified by anion ex hange chromatography on DEAE-Tnsacryl M essentially as descAbed by Poole et al, Mol. Gen. Genet. 223: 217-223 (1990).

The xylanase (designated XYLA) purifled from cell-free ex~act of E. coli XLl-Blue harbouring pNX1 was fracdonaud by SDS/PAGE and electroblotted onto PROBLOT membrane (Applied Biosystems Inc). N-terminal sequence was determined by automated Edman se~uencing using a 470 gas-phase sequenator wo 93/2s693 21 3 8 3 8 ~ pcr/GB93/ol283 e~uipped with a 120A on-line phenylthiohydantoin analyser (Applied Biosystems Inc: Hu~apillar e~ al, Methods ~:r~mol. 91: 399~13 (1983)).

EX~MPLE 9 - Summarv of Isolation of xynA
'~
A cDNA library consisting of 106 clones was co~uc~ed using m~NA isolated from N. p~riciarurn cells gro~n with AvIcEL as sole car~on source. Thirty one recombi~ant bacteriop~ages which hydrolysed xylan were ideD~ified after screen~ng 5 ~ 104 clones from the library, and 16 strongly xyla~ase-positive phage were isola~ed for ~er characterisation. Restrictio~ mapping and hybridisa~ion data indicated ~at all the xylanase- posinve rccombinan~s con~a;ned cDNA sequences - derived from the same mRNA species. A restric~on map of the largest cI)NA
se~uence cncod~ng a fimctioDal xylanase, desig~a~ ~;ynA, is shown in Figure l.
A nucleic acid probe consis~ng of 1.7kb of the 5~ region of xynA, hybridised to a single 2.5kb Neocallimastix ~A species. This suggests that the longest xynA
cDNA ~isolatcd is almost full leng~.

EXAh~LE 10 - ~5~ ~ A

The cDNA se~cnces encoding Neoca~i~r~s~ix xylanases were excised from ~ZAPII and rescued in E. coli XL1-Bllle as recombinanrs of psLuEscR~r SK.
Xyla~ase acdvity expresscd by the recombina~t strain harbollring the plasmid pN~l, which c~ the longest fo~m of x~nA,was found predominantly in the cell-free cxtract, indicating that the enzyme was ~ot efficiently secreted by E. coli.
2S i The xylanase, designated xylanase A (XYLA), was purif~ed to near homogeneity (>90~ pure3. Purified mA had a specific acdvity of 5980 Utmg protein, compared to the cell free ex~act value of 16 U/mg protein. This indicates ~hat XYLA consists of 0.3% of soluble protein synthesised by E. coti cells har~ouri~gpNX1. The purifled enzyme bad an Mr f 53000 (Figure 2) and a~ N-tenninal WO 93/2s693 ~ 1 3 ~ ~ S 3 PCr/GB93/01283 -3~

se~uen~ of IATVAKAQWGG&GAS. XYLA hydrolysed ~ylan but exhibited no ac~ivity against carbo~ymethyl cellulose, barley ~B-glucan, l~, lichenan or the artiflCial substra~s ~methyl-umbelliferyl-,B-D-xyloside and p-ni~ophenyl-,B-D-~ylopyranoside (Table 1).
S

'rhe enzyme activity of purified xylanase A from ~. coli b~t)ousing pNX1 ~xynA
cDNA) plasmid.

_ Substrate Acti~ity1 Units/mg protan ~ . ; -Barley ,B glucan 7 _ , O _ ¦
Carbo~ymethylcellulose 0 ~ . ..
Xylan 5980 Xylobiose 0 I -- _ _ ~I
¦ p-Nitrophcny! ,B D xylobioside (PNX) 0 ¦¦
¦ Mcthylumbelliferyl ,B D-cellobioside (MUC) _ _ 4-Methylum~elliferyl ,B-D-glucoside (MUG) O
4-Mcth~rlumbelliferyl ,B-D-xylosite (MUX) 0 ..., , , .. , ", ", . . , ", _ 2 0 lOne unit of XYLA releases 1 ~Lmole of product per mimlte.

The eDzymc at~ ed soluble xyla~ in a man~er typical of an endo~ 1,~xylanase (EC 3.1.2.8~, promoting a rapid decline in viscosity (Pigure 3) and releasing 8~3mg of reducing sugar per g of substrau. Analysis of the hydrolysis products by HPLC revealed that XYLA liberated approx~ tely equal amounts of xylobiose and xylose. No disac~harides con~g arabinose, the major side~hain sugar of oat spelt ~ylan, were detected among the reaction productc. sugges~ing that the WO ~3~25693 PCr/GB93/01283 . .

enzyme does not hydrolyse glycosidic linkages ~nvolving xylose un~ts linked to side chain sugars.

E~k~E U - Nucleotde seguence S
The 2.3~b Neocallim~stix cDNA deri~ved from pNXl was se~uenced ~n both s~ands (Accession number X65526 in EMBL/Genbank/DDBJ Nucleotide Sequence Data Libraries). Transla~ion of the nucleoade se~ ce reYealed a single open reading frame (ORF) of 1821 bp encoding a polypeptide of Mr66192. The dedu~d primary s~uc~re of the ellcode~ p~otein is shown in Figure 4. The N-te~minal 15 residues of recombinant XY~A, purified from E. coli, e~hibi~ed a perfect match with amino acids 12 to 26 of the translated seque~e. The assig~ent of the proposed translation ini~iation codon was based on the follo~g obse~vadoDs: (i) there are not ATG sequences upstream of the C)RF; (ii) ~ladonal stop codons are in all 3 reading frames ups~eam of the putadve ~ladonal star~ codon. I~specdon of the nuc~eo~ide sequen~ the YiCiIliey of .

: ~ the putanve ATG start codo~ did not reveal any alternative se~uences which could act as ~a~slatioDal start codon i~l E. coli. It is likely, therefore, that transladonal initiation of the ~nA occurs at the same codon in the enteric bactermm and anaerobic fungus. This is despite the fact that lower eukaryote mRNAs do not confain ribosome bi~ding se~uences which coDform to the correspoDding E. coli seq~lence. P~ably the seq~ence AGA, 7bp ups~eam of the ATG start codon, acts as v~ ribosome bi~ding seque~ in the bacterium. Transcripdon i~iuation of ~nA in E. coli is presumably at the ~rector's lacZp as subcloning of the xynAi cDNA, on a 2~3 kb EcoRI-XhoI res~iction fragment, i~to pM'rL22, generated a recombina~ plasmid (pNX2) which did not direct a funcdonal xyla~ase~ The vector's l~cZp is a~ the 3' of xynA in pNX2. Although XYLA is not secre~ed by E. coli. r~e deduc~d N-telminal region of the xylanase coDfoIms to that of a signal peptide: compnsi~g of an N-terminal hydrophilic basic region followed by a 3 0 sequence of 23 predominantly hydrophobic or neu~al amino acids.

Wo 93/2S693 ~ .3 pcr/GB93/ol283 ,~;. .~

-3~

The G ~ C contem of the xynA ORF was 43.4%, compared to 10.7% for ~he S' and. 3' n~n-coding regions (excluding the 3' polyA tail). The overall G + C
conten~ of Neoc~f~irn~ DNA is appro~cimately 15 % (Billon-Grand et a~ MS
Micro~iol. Lett. 82: 267-270 (1991)), indica~i~g that non-protein coding regionsof the ge~ome are generally very A ~ T-rich. The bias in codon utilisation in ~ynA is evident from the absen~e of 14 of the 61 ~ aeid codons. There is a marked preference for T in the third posi~on ( - 50% of all codons end ~ T) and an e~cclusion of G in the wobble posi~on. Apart from ATG and TGG, which are the sole codons for Met and Trp respecnYely, only 3 codons con~ain G in the third posi~on; AAG, GAG and l~G.

I~ec~ion of the deduced p~ s~re of ma~re XYLA revealed several interes~g fea~res. Between residues 255-265 and 491-Sl9 are regions rich ~n proline and hydroxy amino acids. Ma~y cellulases and xylanases consist of multiple doma3ns ~vhich are linked by sequeDces rich in prolineJhydro~y amino acids (G~ et al, Microbiol. Rev. S~: 303-315 (1991)). The presence of 2 such ~li~er se~uences" in XYLA suggests that the enzyme consists of at least 3 dis~inct do~. The Neocallim~s xylanase, in addition to complising of linker regions, also coD~ns a 225 amino acid repeated seque~ce a~ the N-~e~ninus. and a C-terminal 40 residue reiterated domain (Figure 4). There is no obvious se~uence conservation betwoen the large and small rcpeaoed regions. The two N-terminal ~ted se~uences exhibited 91.6% and 95.6% identi1:y and similarity~
~vely. The 40 amino acid reite~ated region displayed 82.9~ and 95.1%
iden~ity and similarity, respec~rely. DNA encoding the two r~peated regions also, showed sequence ideD~ity, with the 699 bp and 120 bp reiterated sequences e~hibiting 92.7% and 90.8% identity, respectively.

wo 93/2~693 ~ l ~ v P ! r~ ~ PCrJGB93/01283 . :

E~EAMPLE 12 - Homolo~r Snldies Hydrophobic cluster analysis has shown that cellulæes and xylanases can be grouped in~o n~ne enzyme families. Proteins within a family are s~uc~rally S related a~d haYe probably evolved from a commo~ ances~al gene (Henrissat et al, Gene 81: 83-95 (1989)). Comparison of X~A with se~ ces in the SWISS-PROT database revealed homology ~etween the fungal enzyme and BaciUus punu-lis xylaD~se A (;F~ et al, FEBS Lett. 171: 197-201 (1984)), Bacillus cir~ans xyla~ase (Yang et al, Nucl. Aci~ ~es. 16: 7178 (1988)), Clostndium 0 aceto~ m xylanase B (Zappe et al, Nucl. Acids Res 18: 2179 (1990)) aIld ~he N-terminal region of the m~ti~om~nRununococc~ aaens ~ylanase (Zhang & ~l~t, Mol. Microbiol. 6: 1013-1019 (199~)). l'he degree of homology be~reen these enzymes a~d N. pa~riaan m XYI~ is shown in Figure 5.

- 15 It is intexs~ing to note that only the large repeated sequence of XYLA exhibited homology wi~ other hemicellulases; the C-terminal reiterated region showed no identinf with proteins in the d~tabase. ~ suggests tha~ XYL~ has a modular s~uc~re in which the N-terminal region coDstioltes the catalytic domain.

2o E and funcuon of XYLA

To invesdgate ~he assemon that the N-t~ r~peated sequence coDs~tuted the catalytic domain of XYLA, 5' and 3' regioDs of xynA were deleted, or subcloned into appropriate vectors, and the capacity of ~he resultant xynA derivatives to 2 5 i express a fu~cdonal xylanase was evaluated. A truncated fo~m of ;~ynA in which 291 bp of the 3' region encoding the 40 amino acid C-termi~al repeat, had been deleted, still encoded a functional xylanase. The predicted Mr f the encoded enzyme was 53000. This is similar to the size of XYLA purified from E. coli har~ouring pNX1. Thus. the recombinant xylanase synthesised from the full-WO 93/2~693 ~! ~ 3 8 3 ~ ~ P~/GB93/01283 length ge~e by the enteric bacterium could also lack the C-te~minal repeated se~e. Supporl for this view is provided by the fact that several multidomain cellulases and xylanases are particularly sensi~ive ~o proteoly~ic clea~age within the lin3~er sequences ~Tomme et al, Eur. J. Biochem. 170: 575-581 (1988); Gilkes el al, ~. Biol. Chem. 263: 10401-10407 (1988), L~cluding a Pseudor~wnas xylanase, expressed by E. coli which was substan~ally cleaved within the serine-rich linker sequences (Hall et al, Mol. Microbiol. 3: 1211-1219 (1989)). A more substantial 3' deletion (pNX6), extending for 1011 bp did not affect the capacity of xynA todirect the synthesis of a fun~oDal xylanase. However, removal of 1324 bp from the 3' reg~on of ~ynA res~lted in the synthesis of an i~active derivadve of XYLA.
These data suggest that the N-terminal 270 residues of the ~. pa~ a~m xylanase folds into a utalytically active enzyme. To dete~mine whether both N-te~minal reiurated se~uences, fold into fuD~tional xylaDases, the 720 bp Sc~ NruI-- res~iction fragment (NmI cleaves in the multiple cloni~g region of pNX4) was cloned iD~opMTI~0 to generate pNX5, in whichtruncated~ynA was inphase with the vec20rs lacZ' translation initia~ion codon (Figure l). E. coli ba~our~g pNX5expressed 15 times more XYLA compared to a clone harbouring full Iength ;~ynA.
: This elevadon in the e~pression of the fungal enzyme, is presumably a result of the utilisa~ion of an E. ~oli translation ini~ation sequence in xynA encoded by 2 0 pNX5. ~ purified from cell-free extract of (E. coli conta~n~ng pNX5 had an ~$ of 26000 (Figu~e 2B). These data confirm that the reite~ated N-termiDal 225 residues co~stitute disti~lct ca~alytic domains. IDtercs~ingly, a fi~ther increase in xylanase ac~nty was achieYed by dele~ion of a few ami~o residues from the C-terminLlS of the second catalytic domain to generate pNX9.

To investigate the subs~ate specificities of the N- and C-terminal catalytic domains, the capacity of the xylanases, encoded by pNX6 and pNX5, to cleave plant stn2cmral polysaccharides were assessed. The e~zymes cleaved only xylan.
releasing xylobios~ and xylose in similar proportior~ to that of full-length XYLA.

Wo 93/~693 pcr/GB93/ol283 -Thus, ~oth ca~lytic domains displayed the same subst~te specificities as full-length XYLA.

Although many cellulases and xylanases consist of muldple dom;~ins, ce~B from s Caldocell~m saccharo~yncum (Saul etaf, Appl. Environ. Microbio~. ~6: 3117-3124 (1990)) is the only pre~rious example of aII enzyme co~g 2 distinct cataly~ic domams. ~ enzyme consists of an N-terminal e~coglucanase and a C-terminal endoglucanase which belong to dffle~ent enzyme families. Thus, the ge~e e~g ceJB probably arose through the fusion of two discrete cellulase genes.
This inventionprovides evidence that fungal ~cylanases can also consist of multiple ca~aly~c domains. In contrast to the celB gene, ~ynA is clearly a result of tandem duplication of an ancestral gene. It is not apparent what sele~dve advantage thegcnc duplication confers on the anaerobic fungus. Is it simply a mechanism for - inc~sing the expression of XYLA catalydc domains? As this is the first dcscnpdon OI an = bic fungal ~ylanase, it is un~lcar whether muldple catalytic domains are a common feature of lower euka~yote hemicellulas._s.
''' '.

' '' ' WO 93/25693 2 ~ 3 8 3 8 3 PCI'/GB93~01283 ,` ;, .

SEQUENCE LISTING

~1) GENERAL INFORMATION:
(i) APPLICANT:
~A) NAME: Harry John GILBERT
tB) ST~EET: 16 Kells Gardens, Low Fell, (C) CITY: Gate~head ~D) STATE: Tyne and Wear ~E) COUNTRY: United Ringdom (F) POSTAL CODE (ZIP): NE9 5XS
~A) NAME: Geoffrey Peter HAZLEWOOD
(B) STREET: 109A Duchess Drive (C) CITY: Newmarket (D) STAT~: Suffolk (E) COUNTRY: United Kingdom (F) POSTAL CODE ~ZIP): CB8 8AL
(ii) TITLE OF INVENTION: Recombinant Xylanases (iii) NUM8ER OF SEQUENCES: 18 (iv) COMPUTER ~EADP~3LE FORM:
3.5" MS-DOS FLOPPY DISK CONTAINING ASCII FILE (93 01283.AS~C) (v) CURRENT APPLICATION DATA:
APPLICATION NUMBER: WO PCT/GB93/01283 (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2338 ba~e pairs (8) TYPE: nucleic acid ~C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
~iii) HYPOTHETICAL: NO
(iii) ANTI-SE~SE: NO
(vi) ORIGINA~ SOURCE:
- ~A) ORGANISM: Neocallimastix patriciarum (B) STRAIN: (type specie~) (iX) EEAl'URE:
(A) NAME/REY: CDS
(B) LOCATION: 195..2018 ~D) OT~ER INFOXMATION: /function= "Xylanolytic enzyme"
/prod~ct= "XYLA"
/standard name~ "Xylanase"
( ix) PEATURE:
(A) NAME/ Æ Y: sig peptide (B) LOCATION: 195..281 ( ix) E~T~
(A) NAME/KEY: mat peptide ~B) LOC~TION: 282..2018 (ix) FEATURE:
(A) NAME/REY: mlsc feature ~B) LOCATION: 282..959 (D) OTHER INFORMATION: /label, C~Tl .5UBSrlTUTE SHEET

W O 93/25693 P ~ /GB93/01283 -. ;- ..

/note- '!lst catalytic domainU
(ix) FEAT~RE:
~A) NAMEtKEY: mi~c_feature ~B) LOCATION: 1017..1691 (D) OTEER INFOKMA~ION: /label= CAT2 /note~ "2nd catalytic domain"
~ixl FE~T~RE:
(A) NAME/KEY~ misc ~eature ~9) LOCATION: 1764..1883 (D) OTEER INFOKMATION: /label= TRl /note~ "lst C-terminal repeat"
(ix) FEAT~RE:
IA~ N~ME~REY misc feature ~B) ~OCATION: 1884..2015 ~D) OTEER INFOKMATION: /label= ~TK2 /note~ "2nd C-termlnal repeat~
iX) E~T~JRE:
(A) N~MEJXEY: misc feature (B) ~OCATION: 1..2338 (D) OT~ER INFORMATION: /label= pNXl insert (ix) FEAT~RE: ~-(A) NAMæ/XEY: misc feature (~) LO Q TION: 1..2338 (D) OT9SR INFORMATION: /label= pNX2 insert /note~ "PNX2 insert is in reverse orientation to pNXl i~sert~ ;
~ix) FEAT~RE:
(A) NAME/~EY misc feature ;:
(8) LQCATION: 1..1847 (D) Ol~K INFORMA~ION /label- pNX3 insert ~ iX)' F~l~:
-:~ (A) NAME/~EY mi~c feature (B) ~OC~TION: 1..1725 (D) OTRER INFORMATION: /label= pNX4 insert (ix) FEATURE:
(A) NAME/XEY: misc feature (B) LOC~TION: 1002..1725 - (D~ 058$-K INFORMATION: /label~ pNXS insert (ix) FEAT~R~:
~A) NAME~XEY: misc feature (B) LOC~TION: 1..1001 (D) OTHER INFORMATION: /label~ pNX6 insert ! ( iX) FEAT~X~:
(A) NAME/REY: misc feature (B) LOr~ION: 1..690 (D~ OT~E-K INFORMA~ION: /label- pNX7 insert (ix) FEATURE: , (A) NAME~KEY: misc feature (B) ~OCATION: 1002..2338 (D) O$XE-K INFORMA~ION: /label= pNX8 in~ert (ix) FEAT~RS:
(A) NAME/XEY: misc feature (B) LOC~TION: 1002..1847 (D) OT~ER INFORMATION: /label= pNX9_inser~
.

WO 9312~;693 ~ 1 ~ 8 3 fi 3 PCI`/GB93/01283 lix~ FEAToRE:
(A) NWME~KEY: misc_feature ~B) LOCA`rION: 1002..1709 (D) OTh~K INFORMATION: /la~el= pNX10 in~ert [xi) SEQ~ENCE DESCRIPTION: SEQ ID NO: 1:
TTT~ATTATA TCAAT CTA A m ~TT m TTA5&AAAAA AATAAAAAAA TAAATATAAT 60 AAATATTAGA G~GTAATATT TAAAAACAAA GAAA m AAA AACG m ATT TAGTTATTTT 120 TTTTA GGT TAb~AaAAAA ATAAAAAACA AAATTAATAA AGATAT m T GAAAAATATT 180 G~ATT~GAA~ AAAA ATG AGA ACT ATT AAA TTC TTT TTC GCA GTA GCT ATT 230 Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile .
GCA ACT GTT GCT A~G GCC CAA TGG GGT GGA GGT GGT GCC TCT GCT GGT 2 7 8 Ala Shr Val Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly -15 -10: -5 Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gln His Lys Gly Val Ala Asp Gly Tyr Ser Tyr Glu Ile Trp Leu Asp Asn Shr Gly Gly Ser Gly Ser Met ~hr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp As~ Ala : ~ 35 40 45 ~TC$ GTS AAC CGT GGT AAC TTC CTT GCC CGT CGT GGT CTT GAC TTC GGT 470 Ser~Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp Tyr Thr Ala Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly Asn Ser Arg Leu Cys 80 ~ ~5 90 95 GT~ TAC GGT TGG TTC CAA AAC CGT GGA GTT CAA GGT GTT CCA TTG GTA 614 Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val GAA TAC TAC ATC ATT GAA GAT TGG GTT GAC TGG GTT CCA GAT GCA, CAA 662 Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln I~5 i 120 125 GGT AGA ATG GTA ACC ATT GAT GGA GCT CAA T~T AAG ATT T$C CAA ATG 710 Gly Arg Met Val T~r I~e Asp Gly Ala G1A Tyr ~ys Ile Phe Gln Met GAT CAC ACT GGT C Q ACT ATC AAT GGT GGT AG$ GAA ACC TTT AAG CAA 758 Asp His Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln TAC TTC AGT GTC CGT CAA CAA AAG AGA AC$ TC$ GGT CAT ATT ACT GTC 806 Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val -CA GAT C~C m AAG GAA TGG GCC AAA CAA GGT TGG GGT ATT GGT AAC 8S4 WO 93/25693 h i d ~ PCT/GB93/0l283 43- :
Ser Asp ~is Phe Lys Glu Trp Ala Ly~ Gln Gly Trp Gly Ile Gly A~n laO 185 190 CTT TAT GAA GTT GCT TTG AAC GCC GA~ GGT TGG CAA AGT AGT GGT ATA 902 Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile GCT GAT GTC ACC AAG TTA GAT GTT TAC AC~ ACC CAA AAA GGT TCT AAT 950 Ala Asp Val Thr Ly~ Leu Asp Val Tyr Thr Thr Gln Lys Gly Ser Asn ., CCT GCC CCT ACC TCC ACT GGT ACT GTT CCA AGC AGT TCT GCT GGT ~GA 99 e Pro Ala Pro Thr Ser Thr Gly Thr Val Pro Ser Ser Ser Ala Gly Gly AGT ACT GCC AAT GGT A~A AAG TTT ACT GTC GGT AAT GGA CAA AAC CAA 1046 ~.
Ser Thr Ala Asn Gly Ly-~ Lys Phe Thr Val Gly Asn Gly Gln Asn Gln CAT AAG GGT GTC A~C GAT GGT TTC AGT TAT GAA ATC TGG TTA GAT AAC 1094 His Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu A~p Asn A GGT GGT AAC GGT TCT ATG ACT CTC GGT AGT GGT GCA ACT TTG AAG 1142Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys 2?5 280 285 Ala Glu Trp Asn Ala Ala Val Asn Arg Gly A~n Phe keu Ala Arg Arg GGT CST GAC TTC GGT TCT CAA AAG AAG GCA ACC GAT TAC GAC T~C ATT 1238 Gly Leu A~p Phe Gly Ser Gln Lys Ly~ Ala Thr Asp Tyr Asp Tyr Ile GGA TTA GAT TAT GCT GCT ACT TAC AAA CAA ACT GCC AGT GCA ~GT GGT 1286 Gly Leu Asp Tyr Ala Ala Thr ~yr Lys Gln Thr Ala Ser Ala Ser Gly AAC TCC CGT CTC TGT GTA TAC GGA TGG TTC CA~ AAC CGT GGA CTT AAT 1334 Asn Ser Arg Leu Cvs Val Tyr Gly Trp Phe Gln Asn Arg Gly ~eu Asn 340 . 345 350 GGC G$T CCT TTA GTA GAA TAC TAC ATC ATT GAA GAT TGG GTT GAC TGG 1382 Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val ~sp Trp GTT CCA GAT GCA C~A GGA AAA ATG GT~ ACC ATT GAT GGA GCT CAA TAT 1430 `:
Val Pro Asp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln ~yr Lys Ile Phe Gln Met Asp ~is Thr Gly Pro Thr Ile Asn Gly Gly Ser 385 390 ~95 Glu Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly 420 425. 430 Trp Gly Ile Gly A~n Leu Tyr Glu Val Ala Leu Asn ~la Glu Gly Trp 435 440 445 ~:

WO 93/2~693 ~ PCr/GB93/01283 44- ' CA~ AGT AGT GGT GT~ GCT GAT GTC ACC TTA TTA GAT GTT TAC ACA AC$ 1670 Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu ~sp Val Tyr Thr Thr 4s~ 455 ~60 CCA AAG GGT TCT AGT CCA GCC ACC TCT GCC GCT ccr CGT ACT ACT ACC ~. 17la Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Axg Thr Thr Thr CGT ACT ACT ACT CGT ACC AAG TCT CTT CC~ ACC AAT TAC AAT AAG TGT 1766 Arg Thr Thr Thr Arg Thr Lys Ser Leu Pro Th~ Asn Tyr As~ Ly.s Cys TCT GCT AGA ATT ACT GCT CAA GGT TAC A~G TGT TGT AGC GAT CCA AAT 1814 Ser Ala Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn TGT GTT GTT TAC TAC ACT GAT GAG GAT GGT ACC TGG GGT GTT GAA AAC l B 6 2 Cys Val Val Tyr Tyr Thr Asp Glu Asp Gly Thr Trp Gly Val Glu Asn Asn Asp Trp Cys Gly Cys Gly Val Glu Gln Cy~ Ser Ser Lys Ile Thr TCT CAA GGT TAC AAG TGT TGT AGC GA~ CC~ AAT TGC GTT GTT TTC TAC 1958 Ser Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cys Val Val Phe Tyr AC~ GAT GAC GA~ GGT AAA TGG GGT GTT GAA AAC AAC GAC TGG TGT GGT 2 0 06Thr Asp Asp Asp Gly Lys Trp Gly Val Glu Asn ~sn Asp Trp Cys Gly 560 55~ 5~0 575 TGT GGT lTC TA1~GCAGTAA AA~ACTAATT A~TAAAAAAT T~TTA 2 0 55 Cys Gly Phe TG~AAAm AAAm~A Am~AA~ ATTATGAAAA AmAAAm AAAAATTTAA2115 A~ ACT~ m~GTAAAA AATTAlU.~GAA TTATTGA~ TTTTAAA~GT AAAAAm~ 2175 A~ATACAAA mGT~APAA AAPATGAAAG AATTATGAAA AATTAAAATG l'AAPAGTTTA 2235 AAA~AT~CAA ATTTGTAAGA ~AAP,Ti~AAGA ATTATAA~A A~AT~AAGAA Tr~TGAA~ 2295 CCC~AATGTA A~ A~ A~ AAA 2338 2 ) INFORMATION FOR SEQ ID NO: 2:
( i ) SE:Q~JENOE t~Cl~ISTICS:
~A) ~JGT~: 6 0 7 am~o acids ~B) TYPE: amino acid (D) TOPO~O~Y: linear (ii) MOLECUIE TYPE: protein ~xi) SEQ~ENOE DESCRIPTION: SEQ ID NO: 2:

Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile Ala Thr Val Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr 'Jal Gly Asn Gly Gln Thr Gln ~is Lys Gly Val Ala Asp Gly Tyr Ser ~ -~ v ~
WO 93~2~693 PCI/GB93/01283 ...

Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Ser Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ser Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Ser 5}~ Ile Gly Leu Asp Tvr Thr Ala Thr Tyr Arg Gl~ Thr Gly Ser Ala Ser Gly Asn Ser Arg Leu Cys Yal Tyr Gly Trp Phe Gln ~sn Arg Gly Val Gln Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln Gly ~rg Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met Asp Hiq Thr Gly Pro Thr Ile ~sn Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Val lS0 155 160 Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp Hi~ Phe Lys Glu Trp Ala Lys Gln Gly Trp Gly Ile Gly Asn Leu Tyr Glu Val 180 185 190 lg5 Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile Ala Asp Val Thr Lys Leu Asp Val Tyr Thr Thr Gln Lys Gly Ser Asn Pro Ala Pro Thr Ser Thr Gly Thr Val Pro Ser Ser Ser Ala Gly Gly Ser Thr Ala Asn 230 23~ 240 Gly Ly~ Lys Phe Thr Val Gly Asn Gly Gln As~ Gln ~is Lys Gly Val Asn ~Sp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg &ly Leu Asp Phe 295 ' 300 305 Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly Leu Asp Tyr Ala Ala Thr Tyr Lys ~1~ Thr Ala Ser Ala Ser Gly Asn Ser Arg Leu Cy9 Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn Gly Val Pro Leu 'lal Glu Tyr T~r Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala WO 93/25693 PCI/GB93~01283 , ~.

Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met Asp ~is 5hr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Val Arg Gl~ Gln Ly~ Arg Thr Ser Gly Hiq Ile Thr Val Ser Asp ~is Phe Lys Glu Trp Ala Lys Gln Gly Trp Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asip Val Thr Leu Leu Asp Val Tyr Thr Thr Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg Thr Thr Thr Arg Thr Ly~ Ser Leu Pro Thr As~ Tyr As~ Lys Cys Ser Ala Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asp Pro A_n Cy3 Val Val Tyr Tyr Thr Asp &lu Asp Gly Thr Trp Gly Val Glu ~n Asn Asp Trp CY-Q
52~ 525 530 Gly Cys Gly Val Glu Gln Cys Ser Ser ~y5 Ile Thr Ser Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cy9 Val Val Phe Tyr Thr Asp Asp Asp GIy Lys Trp Gly Val Glu Asn Asn Asp Trp Cys Gly Cy~ Giy Phe ~ : 565 570 575 ,- , ,:
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SE~ENCE = ISTICS:
(A) ~ENGTR: 184~ base pairs tB) TYPE: nucleic acid ~C): 5 ~ EDNESS: double (D) ~OPO~OGY: ll~ear . `-: ~ ~ii) MOLEC~LE TYPE: cDN~

~ix) F ~ TaRE:
~A) NAME~KEY: CDS
(B) LOCAT~ON: 195..1847 ~ixl FEAT~RE:
~A) ~ /XEY: sig_peptide :
(B~ ~OC~TION: 195..281 : ~ix) FEAT~RE:
~A) NAME~KEY: misc feature ~B) LOCATION: 1..1847 ~D) OT9ER INFORMATION: /label~ pNX3 insert : ~ tx1l SEQUENOE DESCRIPTION: SEQ ID NO: 3:

~ J v ~J ~
WO 93/25693 PCliGB93/01283 !

TTTT~TSATA TGAA$CTA A m ATTTTT TTAGGAAAAA AATAAA~AAA TAAATATAAT 60 AAATATTAGA GAGT~ATATT TAAAAACAAA GA~A m AAA AACGTTTATT TAGTTASTTT 120 TTTTACTGGT TA~h~AAAAA ATAA~AAACA AAATTAATAA AGATATTTST GAAAAATATT ~ 180 GAATTAGAAA AAAA ATG AGA ACT ATT AAA TTC m TTC GCA GTA GCT ATT 230 Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile GCA ACT GTT GCT AAG GCC CAA TGG GGT GGA GGT GGT GCC TCT GCT GGT 27 a Ala Thr Val Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly CAA AGA TTA ACC GTC GGT AAT GGT CA~ ACC CAA CAT AAG GGT GTA GCT 326 Gln Arg Leu Thr Yal Gly Asn G}y Gln Thr Gln His Lys Gly Val Ala GAT G~T TAC AGT TAT GAA ATC TGG TTA GAT AAC ACC GGT GGT AGT GGT 374 Asp Gly Tyr Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly G}y Ser Gly Ser Met Thr Leu G}y Ser Gly Ala Thr Phe ~ys Ala Glu Trp As~ Ala Ser Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp Tyr Thr 9S lO0 105 GCA ACT TAC AGA CAA ~CT GGT AGC GCA AGT GGT AAC TCC CGT CTC TGT 566 Ala Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly Asn Ser Arg ~eu Cys 110 llS 120 G$A TAC GGT TGG TTC CAA AAC CGT GGA GTT CAA GGT GTT CCA TTG GTA 614 Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val GAA TAC TAC-ATC ATT GA~ GAT TGG GTT GAC TGG GTT CCA GAT GCA CAA 662 Glu Tyr Tyr Ile Ilç Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln 145 lS0 lSS
-GG~ AG~ ATG GTA ACC ATT GAT GGA GCT Q A TAT A~G ATT TTC CAA ATG 710 Gly Arg Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met A9~ Hls Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln 175 190 l~S
TAC TTC AGT GTC CGT CAA CAA AAG AGA ACT TCT GG~ CAT ATT ACT GTC 806 Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val 190 l9S 200 TCA GAT CAC m AAG GAA TGG GCC AAA C~A GGT TGG GGT ATT GGT AAC ~54 Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly Trp Gly Ile Gly Asn ~eu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile J v W 0 93/25693 P ~ /GB93/01283 i . ~

-48^
GCT GAT GTC ~CC AAG TTA GAT GTT TAC ACA ACC CAA AAA GGT TCT AAT 950 Ala Asp Val Thr Lys Leu Asp Val Tyr Thr Thr Gln Lys Gly Ser Asn 2~0 245 250 CCT GCC CCT ACC TCC ACT GGT ACT GTT CCA AGC AGT TCT GCT GGT GGA ~ 998 Pro Ala Pro Thr Ser Thr Gly Thr Val Pro Ser Ser Ser Ala Gly Gly AGT A GCC ~AT GGT AAA AAG TTT ACT GTC GGT AAT GGA CAA AAC CAA 1046 Ser Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Çly:Gln Asn Gl~

His Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn ACT GGT GGT AA,C GGT TCT ATG ACT CTC GGT AGT GGT GCA ACT TTC AAG 1142 Thr Gly Gly Asn Gly Ser Met Thr Leu GIy Ser Gly Ala Thr Phe Lys :305 : 310 315 GCT GAA TGG AAT GCA~GCT GTT AAC CGT GGT AAC TTC CTT GCC CGT CGT 1190 Ala Glu Trp Asn Ala Ala Val Asn Arg Gly As~ Phe Leu Ala Ar~ Arg GGT CTT GAC TTC GGT TCT CAA AAG AAG GCA ACC GAT TAC GAC ~AC ATT 1238 :' Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile ., - ~ 335 .: 340 345 GGA TTA :~TAT~GCT GCT ACT TAC AAA CAA ACT GCC AGT GCA AGT GGT 1286 Gly:~Leu:~Asp~yr~Ala:;Xla Thr Tyr Lys Gln Thr Ala Ser:Ala Ser Gly ,~

AAC~TCC CGT:CTC:::TGT GTA:TAC GG~ TGG TTC CAA AAC CGT GGA CTT AAT 1334 Asn:Ser~Arg Leu Cys~Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn 365~ 370` ' 375 380 GGC GTT CCT TTA GTA~GAA TAC TAC ATC ATT GAA GA$ TGG GTT GAC TGG 1382 Gly Val Pro Leu:Val~Glu Tyr Tyr~;Ile Ile G}u Asp Trp Val Asp Trp 385 :390 39$
GT~ CA~GAT:~:G,CA~CAA~GGA:AA~::ATG 6TA ACC ATT GAT GGA GCT CA~ TAT 1430 ~;
Va~::Pro~ Gly Lys Mee Val5`~Thr Ile Asp Gly Ala Gln Tyr AAG:~A~T~TC'~CAA ASG:,GAT-~CAC~ACT:'GGT:CCA ACT ATC AAT GGT GGT AGT 1478 Lys~Ile Phe: Gln~Met Asp~Hi~ Thr~;Gly Pro Ths Ile Asn Gly Gly Ser '415~ 42~0 ~: 425 GAA ACC:TTT AAG CAA TAC~TC~AGT GTC CGT CAA CAA AAG AGA ACT ~C~ 1526 Glu Shr Phe Lys Gln ~yr Phe Ser:Val Arg Gln Gln Lys Arg Thr Ser "
GGT CAT!ATT ACT GTC TCA GAT CAC m AAG GAA TGG GCC AAA CAA GGS~ llS74 ~ Gly His Ile Thr Yal Ser Asp His Phe Lys Glu Trp Ala ~ys Gln Gly "~ 445 , 450 455 460 : TGG GGT ATT ~GGT AAC CTT ~AT GAA GTT GCT TTG AAC GCC GAA GGT TGG 1622 :T:p Gly Ile Gly~sn Leù Tyr~Glu Val Ala Leu Asn Ala Glu Gly Tr,p ,, ,.,., ,, :
CAA AGT AGT~ GGT GTr GCT GAT GTC ACC TTA TTA GAT GTT TAC ACA ACT 1670 : Gl~ Ser Ser:Gly Yal Ala Asp Val Thr ~eu Leu Agp Val Tyr Thr Shr 4~80 : 485 490 CCZ MG GGT TCT:AGT CCA GCC ACC TCT GCC GCT CCT CGT ACT ACT ACC 1718 : P~o Lys:Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg-Thr Thr Thr WO 93/~i693 P~/GB93/0~283 CGT ACT ACT ACT CGT ACC AAG TCT CTT CCA A~C AA~ TAC AAT A~G TGT 1766 Arg Thr Thr Thr Arg Thr Lys Ser Leu Pro Thr Asn Tyr Asn Lys Cys TCT GCT AGA ATT ACT GCT CAA GGT TAC AAG TGT TGT AGC GAT CCA AAT ~ 1814 Ser Ala Arg Ile Thr Ala Gl~ Gly Tyr Ly~ Cys Cys Ser Asp Pro Asn TGT GTT GT~ TA~ T~C ACT GAT GAG GAT GGT ACC 1847 Cys Val Val Tyr Tyr Thr Asp Glu Asp Gly Thr (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQ~EN OE CXARACTERISTICS:
~A) LEN~TX: 551 amino acids 5B~ TYPE: amino acid ~D) TOPOLOGY: li~ear ~ii) MOLEC~E TYPE: protein ~xi) SEQ~ENCE DESC~IPTION: SEQ ID NO: 4:
Met Arg Thr Tle Lys Ph~ Phe Phe Ala Val Ala Ile Ala ~hr Val Ala1 5 10 15 Lys Ala Gl~ Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gln His Lys Gly Val Ala Asp Gly Tvr Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Ser Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ser Val Asn Ary ~: Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp Tyr Thr Ala Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly A~n Ser Arg Leu Cys Val Tyr Gly Trp : 115 120 125 Phe G1~ Asn Arg Gly Val Gln Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln Gly Arg Met Val 145 15C lSS 160 Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met Asp ~is Thr Gly Pro Thr Ile As~ Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Val lB0 185 190 Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp His Phe 'ys Glu Trp ~la Lys Gln Gly Trp Gly Ile Gly ~sn Leu Tyr Glu Val WO 93/25693 2 :~ 3 8 3 8 3 PCI`/GB93/01283 Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile Ala Asp Val-Thr Lys Leu Asp Val Tyr Thr Thr Gln Lys Gly Ser Asn Pro Ala Pro Thr Ser Thr Gly Thr 'Jal Pro Ser Ser Ser Ala Gly Gly Ser Thr Ala Asn Gly Lys Ly~ Phe Thr Val Gly Asn Gly Gln Asn Gl~ His Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Asn 290 2g5 300 Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Ly~ Ala Glu Trp Asn 305 310 3i5 320 Ala Ala Val As~ Arg Gly Asn Phe Leu Ala Arg Arg Gly L~u Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr ~sp Tyr Ile Gly Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly As3 Ser Arg Leu Cys Val Tyr Gly Srp Phe Gln Asn Arg Gly Leu Asn Gly Val Pro Leu ~al Glu Tyr Tyr Ile Ila Glu Asp Trp Val Asp Trp Val Pro Asp Ala 385- ~ 390 395 400 : ~ , Gln~Gly Lys~Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln 405 : 4I0 415 ; Met Xsp~His Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr ~ . 435 : ~4~40: 44S
-~ ; Val Ser ~sp His Phe ~y~Glu Trp Ala.Lys Gl~ Gly Trp Gly Ile Gly ~450 : ~ 455 460 Asn~eu Tyr;Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly 465 : ~ 470 ~ 475 480 :: Val Ala Asp Val Thr Leu ~eu Asp Val Tyr Thr Thr Pro Lyq Gly Ser ; I~ . Ser;Pro Ala Thr ser Ala Ala Pro Arg Thr Thr Thr Arg Thr ThF Thr - : : Arg TXr Ly9 Ser Leu Pro Thr Asn Tyr Asn Lys Cy8 Ser Ala Arg Ile -~ : . 515 520 525 ~ .
:~ Thr Ala Gln Gly Tyr Lys Cys Cy~ Ser Asp Pro Asn Cys Val Val Tyr :~: : Tyr Thx Asp Glu Asp Gly Thr :545 550 2~ INFORMATION FOR SEQ I3 NO: 5:
~ (i) SEQ~ENCE CXARACTERISTICS:
::~.(A) LENGT~: 1725 base pairs W093/25693 1 ~ ~ PCI`/GB93/01283 (B) TYPE: nucleic acid ~C~ STRANDEDNESS: double ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: cDN~

(ix) FEAT~RE:
~A) NAME/XEY: CDS
(B) LOC~TION: 195..1?24 (ix) FEATURE:
(A) NAME/KEY: sig ~eptide ~ LOCATION: 195..281 (ix) FE~T~RE:
(A) NAME/~EY: misc feature (B) LOCATION: 1..172S
~D) OTEER INFO~MATION: /label= pNX4 in~ert ~xi) SE~EI~CE DESCRIPT$0N: SEQ ID NO: 5:
TTTTATTATA TCAATCTCTA A m ATT m TTAGGA~AAA AATAAAAAAA T~AATATAAT 60 AAASASSAGA GAGTAATATT TAAAAAC~AA GAAA m A~A AACG m ~TT TAGTTATTTT 120 :~ S m ACSGGT TA~AAAhAA~ ASA~AAAACA A~ASSAATAA AGATATTTTT GALAAATATT 180 GAATTAGAAA AAAA ATG AGA ACT ATT AAA TTC m TTC GCA GTA GCT ATT 230 Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile ~ ~ 1 S 10 GCA~:ACT:GTT:GCT~AAG~GCC CAA SGG GGT GGA GGT GGT GCC TCT GCT GGT 278 Ala~T~r~Val Ala Lys:Ala~Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gl~ ~is Lys Gly Val Ala ~ ~: 30 35 40 GAT~GGT TAC AGT TAT GAA ATC TGG TTA GAT AAC ACC GGT GGT AGT GGT 374 Asp~Gly Tyr;;Ser~Tyr~Glsu Ile Trp Leu A~p Asn Thr Gly Gly Ser Gly Ser:Met Thr Leu:Gly:Ser Gly Ala Thr Phe Ly~ Ala Glu Trp Asn Ala Ser Val Asn Arg Gly Asn Phe ~eu Ala Arg Arg Gly Leu Asp Phe Gly a o ~5 90 $CT CAA AAG AAG GCA ACC GAT TAC AGC TAC ATT GGA TTG GAT TAT ACT 518 : Ser Gln Lys Lys Ala Thr Asp Tyr Ser Tyr Ile Gly Leu A~p Tyr Thr ~:~ -: 95 100 105 ~:. GCA ACS TAC AGA CA~ ACT GGT AGC GCA AGT GGT AAC TCC CGT C$C TGT 566 ~-~ Ala Thr Tyr Arg Gln Thr G}y Ser Ala Ser Gly Asn Ser Arg Leu Cy9 . : 110 llS 120 .
: GTA TAC GGT TGG TTC C~A AAC CGT GGA GTT C~A GGT GTT CCA TTG GT~ 614 Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val W093~2~;693 ~ k ~ PCl~/GB93/01283 !

Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln 145 lS0 155 GGT AGA ATG GTA ACC ATT GAT GGA GCT CAA TAT AAG ATT TTC CAA ATG ~ 710 Gly Arg Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met As~ His Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Yal Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val 190 l~S 200 TCA GAT CAC m AAG GAA TGG GCC AAA CAA GGT TGG GGT ATT GGT AAC 854 Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly Tr2 Gly Ile Gly Asn ~.~ TAT GAA GTT GCT TTG AAC GCC GAA GGT TGG CAA AGT AGT GGT ATA 902 Leu Tyr Glu Yal Ala Leu Asn Ala Glu Gly Trp Gln Sex Ser Gly Ile Ala Asp Val Thr Lys Leu Asp Val Tyr Thr Thr Gln Lys Gly Ser Asn CCT:GCC CCT ACC TCC ACT GGT ACT GTT CCA M C AGT TCT GCT GGT GGA 998 Pro Ala Pro Thr Ser Thr Gly Thr Va} Pro Ser Ser Ser Ala Gly Gly :255 260 : 265 AGT ACT GCC:~AAS GGT AAA AAG m ACT GTC GGT AAT GGA CAA AAC CAA 1046 Ser Thr Ala:Asn Gly ~ys Ly~ Phe Thr Val Gly Asn Gly Gln Asn Gln : 270 275 280 His Lys Gly Val Aan Asp Gly Phe Ser Tyr Glu ~}e Trp Leu Asp Asn ACT GGT G¢T A~C GGT TCT ATG ACT CTC GGT AGT GGT GCA ACT TTC AAG 1142 Thr Gly.Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys GCT GAA TGG AAS GCA GCT G~T AAC CGT GGT AAC TTC CTT GCC CGT CGT llgO
Ala Glu Trp Asn Ala Aia Val Asn Arg Gly A~n Phe Leu Ala Arg Arg : 320 325 330 Gly Leu ~sp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile r~GA TTA G~T TAT GCT GCT ACT TAC AAA CAA ACT GCC AGT GCA AGT GGT 1286 Gly Leu Asp Tyr Ala Ala Thr Syr Lys Gln Thr Ala Ser Ala Ser Gly AAC TCC CGT CTC TGT GTA TAC GGA TGG TTC CAA AAC CGT GGA C~T AAT 1334 Asn Ser ~rg Leu Cy3 Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn 36~ 370 375 380 Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp GTT CCA GAT GCA CAA GGA AAA ATG GTA ACC ATT GAT GGA GCT C~A TAT 1430 'Jal Pro Asp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr WO 93125693 ~ PCI`/GB93/01283 , AAG ~TT TTC CAA A$G GAT CAC ACT GGT CCA ACT ATC AAT GGT GGT AGT 1478 Lys Ile Phe Gln MeC Asp ~is Thr Gly Pro Thr Ile Asn Gly Gly Ser GAA ACC TTT AAG CAA TAC TTC AG$ GTC CGT CAA CA~ AAG AGA ACT TCT 1526 Glu Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Ly~ Arg Thr Ser GGT CAT ATT ACT GTC TC~ GAT CAC TTT AAG GAA TGG GCC AAA CAA GGT 1574 Gly Xis Ile Thr Val Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly TGG GGT ATT GGT AAC CTT TAT GA~ GTT GCT TTG AAC GCC GAA GGT TGG 1622 Trp aly Ile Gly Asn ~eu Tyr Glu Val Ala Leu A~n Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr 480 4~5 490 Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr CGT ACT A ~1725 Arg Thr ~2) DNFORMATION FOR SEQ ID NO: 6:
~i) SEQ~ENCE CEARACTERISTICS:
~A) ~ENGT~: 510 amino acids ~8) SYPE: amino acid D) SOPO~OGY: linear ; ~ ~ii) MOLECU1E TYPE: protein ~xi) SEQ~ENOE DESCRIPTION: SEQ ID NO: 6:
Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile Ala Thr Val Ala -~ 1 5 , 10 15 ~: Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gln His Lys Gly Val Ala A~p Gly Tyr Ser Tyr 51u Ile Trp Leu Asp Asn Thr Gly Gly Ser Gly Ser Met ~hr Leu Gly Ser Gly Ala Thr Phe Lys Alà Glu Trp Asn Ala Ser Val Asn Arg ao Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp Tyr Thr Ala Thr ~yr Arg Gln Thr Gly Ser Ala Ser Gly Asn Ser Arg Leu Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val Glu Tyr Tyr Ile WO 93/2~693 2 t 3 8 3 ~ 3 PCI'/GB93/01283 ,. ;

-54- !
Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln Gly Arg Met Val 14S lS0 155 160 hr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met Asp His Thr Gly l~S 170 175 ro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys Gln Tyr Phe Ser Val laO 185 190 Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly Trp Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile Ala Asp Val Thr ys Leu Asp Val Tys Thr Thr Gln Lys Gly Ser Asn Pro Ala Pro Thr er Thr Gly Thr Yal Pro Ser Ser Ser Ala Gly Gly Ser Thr Ala ~sn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gl~ His Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Ly~ Ala Glu Trp Asn la AIa Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe ly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly A~n Ser Arg Leu Cy8 Val Tyr Gly Trp Ph~ Gln Asn Arg Gly Leu A~ Gly Val Pro Leu 370 3~5 380 Val Glu Tyr Tyr Ile Ile Glu Asp ~rp Val Asp Trp Val Pro Asp Ala ln Gly Lys Met Val Thr Ile ~sp Gly Ala Gln ryr Lys Ile Phe Gln 405 410 ~15 Met Asp His Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys ~ 1 420 425 430 Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly ~i9 Ile Thr Val Ser Asp ~is Phe Lys Glu Trp Ala Lys Gln Gly Trp Gly Ile Gly Asn ~eu ~yr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly 4~5 470 475 480 Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro Lys Gly Ser ~85 490 495 WO 93/2~693 PCI/GB93/01283 `

Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg Thr (2) I~FORMATION FOR SEQ ID NO: 7:
(i) SEQ~E~OE CXARACTERISTICS:
tA~ LENGT~: 724 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D~ TOPOLOGY: linear (ii) MOLEC~LE TYPE: cDNA

(ix) FEAT~RE:
(A) NAMEtXEY: CDS
(B) LOCATION: 1..723 ~ix) FEA$~RE:
(A) NhME/~EY: misc feature (~) LOCATION: 1.. 724 . , (D) OTXER INFORMATION: /label_ pNX5 insert (xi) SEQ~ENCE DESCRIPTION: SEQ TD NO: 7:
ACS GCC AAT GGT AAA A~G TTT A~T GTC GGT AAT GGA C~A AAC CAA CAT 48 Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln ~is AAG GG$ G$C AAC G~$ GGT $TC AGT TAT GAA ATC TGG $TA GAT AhC ACT 96 - Lys: Gly Val Asn Asp G}y Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr GGT GGT AAC GGT $CT ATG ACT CTC GGT AGT GGT GCA ACT TTC AAG GCT 144 Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala GAA TGG AAT GCA GCT GTT AAC CG$ GGT AAC TTC CTT GCC CGT CGT GGS 192 Glu $sp Asn A}a ~la Val Asn Arg Gly A3n Phe Leu Ala Arg Arg Gly CTT GAC T$C GGT TCT CAA AAG AAG GCA ACC GAT TAC GAC $AC ATT G&A 240 Leu Asp Phe Gly Ser Gln Ly~ Lys Ala Thr Asp Tyr Asp Tyr Ile Gly 65 70 ~5 B0 $TA GAT $A$ GC$ GC$ AC$ $AC AAA CAA ACT GCC AG$ GCA AGT GGT AAC 288 Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala 5er Ala Ser Gly Asn :85 : 90 95 TCC CGT CTC TG$ GTA $AC GGA TGG TTC CAA AAC CGT GGA CTT AAT GGC 336 Ser Arg Leu Cy~ Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn Gly 100, 105 ' ~ 110 ~TT CCT T$A GTA GAA TAC T~C ATC AT$ GAA GA$ TGG GTT GAC TG& GTT 384 Val Pro Lou Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val CCA GA$ GCA CAA GGA AAA ATG G$A ACC ATT GA$ GGA GCT CAA TAT AAG 432 Pro Asp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys A$T TTC CAA ATG GAT CAC ACS GGT CCA AC$ ATC AAT GGT GGT AGT GAA 480 Ile Phe Gln Met Asp ~is Thr Gly Pro Thr Ile As~ Gly Gly Ser Glu 145 150 lS5 160 WO 93/2~;693 PCI'~GB93/01283 .. ..

5~

Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly C~T ATT ACT GTC TCA GAT CAC TTT AAG GAA TGG GCC A~A CAA GGT TGG .~ s 7 6 .
Hiq Ile Thr Val Ser Asp ~i9 Phe Lys Glu Trp Ala Ly~ Gln Gly Trp 180 185 190 .

Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro AAG G&T TCr AGT CCA GCC. ACC T~T GCC GCT CCT CGr ACr ACT ACC CGT 720 Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Th~ Thr Arg :

Thr ( 2 ) INFORMATION FOR SEQ ID NO: 8:
~i) SEQu~:;NOE C~ACTE~ISTICS: -`
(A) LENGT~: 241 amino acid~
lB) TYRE: ami.no acid (D~ TOPOLOGY: 1 inear MOLEC~E TYPE: protein ~xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln His ys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala ~hr Phe Lys Ala Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu A~p Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly eu As~ Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly Asn er Arg Leu Cy~ Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln Gly Lys Met Val Thr Ile A~3p Gly Ala Gln Tyr Lys 130 135 . 140 Ile Phe Gln Met Asp His Thr Gly Prc~ Thr Ile Asn Gly Gly Ser Glu WO 9312~693 PCI/GB93/01283 :-i !

Thr Phe Ly-~ Zln Tyr Phe Ser Val Arg Gln Gl~ Lys Arg Thx Ser Gly His Ile Thr Val Ser Asp His Phe Lyq Glu Trp Ala Lys Gln Gly Trp 180 lB5 190 Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg Thr ~2~ INFORMATION FOR SEQ ID NO: 9:
(i) SEQ~ENOE CHARAC~E~ISTICS:
~A) LENGT~: 1001 base pairs (B) TYPE: nucleic acid (C) ST~ANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECU~E TYPE: cDN~

( ix) FEAl~
tA) NA~OE/~Y: CDS
~B) LOCATION: 195..1001 ( ix) FEATtJR~
~A) NAMEJ~EY: sig peptide (B) LQCA~ION: 195..281 ( ix) FEAT~RE:
:: ~A) NAME~XEY: mis~ feature : (B) ~OC~T~ON: 1.. 1001 ~D) O ~ INFORMATION: /label~ pNX6 insert ~xi) SEQUENCE DESCR~PTION: SEQ ID NO: 9:
m TATTaTA TCAATCTCTA A m aTSTTT TT~GGAAAAA AATAAAAAAA TAAATATAAT 60 : A~A5A55~G~ G~GS~aSASS TAAAAACAAA G~A m AAA AACG m ATT T~GTTATSTT 120 TTTSACTGGT T~AAAAAAAA ~TAAAAAACA AAA~T~TAA AGA~AT m T GAAAAATATT 180 GAATTAGAAA AAAA ATG AGA ACT ATT AAA TTC m TTG GCA GTA GCT ATT 230 Met Arg Thr Ile Lys Phe Phe Pha Ala Val Ala Ile GCA ACS GTT GCT AAG GCC C~A TGG GGT GGA GGT GGT GCC TCT GCT GGT 278 Ala Thr Val Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly lS 20 25 C~A AGA TTA ACC GTC GGT AAT GGT CAA ACC CAA CAT AAG GGT GTA GCT 326 Gln Arg Leu Thr Val Gly Asn Gly Gln ~hr Gln His Lys Gly Val Ala Asp Gly Tyr Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Ser ~ly WO 93/2~693 2 ~l 3 8 3 8 3 PCI`/GB93/01283 5~ :
TCT ATG ACT CTC GGS AGT GGT GCA ACC TTG AAG GC~ GAA TGG AAS GC~ 422 Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala TCT G~T AAC CGT GGT AAC TTC Cll- GCC CGT CGT GGT CrT G~C ~TC GGT 470 Ser Val ~sn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly 80 ~5 90 TCT C~A AAG AAC GC~ ACC GAT TAC AGC TAC ATT GGA TTG GAT TAT ACT 518 Ser Gln Lyq Ly~ Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp Tyr Thr GCA ACT TAC AGA CAA ACT G~T AGC GCA AGT GGT AAC TCC CGT CTC TGT 566 Ala Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly A~n Ser Arg Leu Cys GTA TAC GGT TGG TTC CAA AAC CGT GGA GTT CAA GGT GTT CCA TTG GTA 614 ;Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gl~ ~ly Val Pro Leu Val :::

GAA TAC TAC ATC ATT GAA GAT TGG GTT GAC TGG GTT CCA GAT GC~ CAA 662 Glu Tyr Tyr Ile Ile Glu Asp Trp Val AYP Trp Val Pro Asp Ala Gln Gly Arg Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met GAT CAC ACT GGT CC~ ACT ATC AAT GGT GGT AGT GAA ACC TTT AAG CAA 758 Asp ~is Ths Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Ly3 Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val 190 ~95 200 TCA GAT CAC TTT ~AG GAA TGG GCC A~A CAA GGT TGG GGT ATT GGT AAC 854 Ser Asp His Phe Lys Glu Trp Ala Lys Gln Gly ~rp Gly Ile Gly A~n C~T TAT GAA GTT GCT TTG AAC GCC GAA GGT TGG CAA AGT AGT GGT ATA 902 ;Leu Tyr Glu Val Ala ~eu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile Ala Asp Val Thr Lys Leu Asp Val Tyr Thr Thr Gln ~ys Gly Ser Asn 240 . 245 250 CCT GCC CCT ACC TCC ACT GGT ACT GTT CCA AG~ AGT TCT GCT GGT GGA 998 Pro Ala Pro Thr Ser Thr Gly Thr Val ~ro Ser Ser Ser Ala Gly Gly AGT ~ 1001 Ser ( 2 ) INFORMASIO~ FOR SEQ ID NO: 10:

i ) SEQm :NOE C~RAC~E~ISTICS:
(A) LENG~ 269 amino ac~ ds ~B) 5'YPE: amino acid :~
~D) TO~OT OGY: linear ii ) MO~EC~E TYPE: protein ~xi) SEQ~ENOE DESC}~IPTION: SEQ ID NO: 10:

WO 93/2~693 ;~ ~¦ 3 8 ~ 8 ~ PCI`/GB93/01283 Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile Ala Thr Val Ala ys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gln Hi~ Lys Gly Val Ala Asp Gly Tyr Ser Tyr Glu Ile Trp Leu Asp Asr. Thr Gly Gly Ser Gly Ser Met Thr Leu C0 ;5 60 Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ser Val Asn Arg

7~ 75 80 ly Asn Phe Leu Ala Arg AIg Gly Leu Asp Phe Gly Ser Gln Ly~ Lys la Thr Asp Tyr Ser Tys Ile Gly Leu Asp Tyr Thr ~la Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly Asn Ser Arg Leu Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln Gly Arg Met Val hr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met Asp Hi~ Thr Gly ro Thr Ile A n Gly 51y Ser Glu Thr Phe Ly~ Gl~ ~yr Phe Ser Val 180 185 l9Q
Arg Gln Gl~ Lys Arg Thr Ser Gly HiC Ile Thr Val Ser Asp His Phe 1~5 200 205 Lys Glu Trp Ala Ly~ Gln Gly Trp Gly Ile Gly Asn Leu Tyr Glu Val 210 ~ 215 2~0 A13 Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Ile Ala Asp Val Thr 22~ 230 235 240 Lys Leu Asp Val Iyr Thr Thr Gl~ ~ys Gly Ser Asn Pro Ala Pro Thr er Shr Gly ~hr Val Pro Ser Ser Ser Ala Gly Gly Ser (2) INFORMA~ION FOR SEQ ID NO~
ti) SEQ~EN OE OEARACT$~ISTICS:
(At LENGTH: 690 base pairs (B) TYPE: nucleic acid (C) ST~ANDEDNESS: double ~D) TOPOEOGY: linear (ii) MOLEC~E TYPE: cDNA

~ix) FE~T~RS:
~A) NAME/KEY: CDS
(B) LOC~TION: 195..6a9 ( ixt Fl~ATtJ~E: .

WO 93/2~693 PCI'/GB93/01283 ~A) N~MEIKEY: sig pepcide (B) LOCATION: 195..281 (ix) FEAT~RE:
(A) N~ME/KEY: misc_feature ~B~ LOCATION: 1..690 (D) OT~E~ INFORMATION: /label= p~X7_insert (xi) SEQ~ENOE DESCRIPTION: SEQ ID NO~
TTTTATTATA TC~ATCTCTA ATTTATTTTT TTAGGAAAA~ AATAAAAAAA TA~AT~TAAT 60 AAATATTAGA GAGTA~T~TT TAAAAACAAA GAAATTTAAA A~CGTTTATT TAGTTATTTT 120 TTTT~CTGGT TAiA~;AAAA ATAAAAAACA AAATTAATAA AGATA5TTTT G~AAAATATT 180 Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile Ala Thr 'Jal Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gln Thr Gln Hi~ Lys Gly Val Ala G,AT GGT TAC AGT TAT GAA ATC TGG TTA GAT AAC ACC GGT GGT AGT GGT 374 A~p Gly Tyr Ser Tyr Glu 'le Trp Leu Asp Asn Thr Gly Gly Ser Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala TCT GTT AAC CGT GGT A~C TTC ~TT GCC CGT CGT GGT CTT GAC TTC GGT 470 Ser Val Asn Ary Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly 80 85 go TCT CAA ~AG AAG GCA ACC GAT TAC AGC TAC ATT GGA TTG GAT TAT ACT 518 Ser Gln Lys Ly~ Ala Thr Asp Tyr Ser Tyr Ile Gly Leu Asp ~yr Thr Ala Thr Tyr Arg Gln Thr Gly Ser Ala Ser Gly As~ 5er Arg Le~ Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val , Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro Asp Ala Gln - Gly Arg Met Val Thr Ile Asp Gly Ala ~2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQ~ENCE C~ARACTERISTICS:
(A) LENGT~. 165 amïno acids ~B) TYPE: ami~o acid WO 93t2~693 -- PCr/GB93/01283 `

(D) TOPOLOGY: li~ear (ii~ MOLECULE TYPE: proeein (xi) SEQ~ENCE DESCRIPTION: SEQ ID NO: 12:
Met Arg Thr Ile Lys Phe Phe Phe Ala Val Ala Ile Ala Thr Val Ala Lys Ala Gln Trp Gly Gly Gly Gly Ala Ser Ala Gly Gln Arg Leu Thr Val Gly Asn Gly Gl~ Thr Gln ~is Ly~ Gly Val Ala Asp Gly Tyr Ser ~0 45 Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Ser Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ser Val Asn Arg ao Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp ~yr Ser Tyr Ile Gly Leu Asp Tyr Thr Ala Tbr ~yr Arg Gln Thr Gly Ser Ala Ser Gly Asn Ser Arg Leu Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Val Gln Gly Val Pro Leu Val Glu Tyr Tyr Ile IIe Glu Asp Trp Val Asp Trp Yal Pro Asp Ala Gl~ Gly Arg Met Val : 145 150 15S 160 Thr Ile Asp Gly Ala -~ 165 (2) INFO~MATION FOR SEQ ID NO: 13:
~i) SEQUENOE OEARAC~ERISTICS:
~A~ LENGTH: 1337 ~a~e pairs ~B7 TYPE~ nucleic acid : (C) S~RANDED~ESS: double (D~ TOPO~OGY: linear ~ii) MO~E~I.E TYPE: cDNA

( iX ) E~ L ~J~CE:
(A) NP.ME/XEY: CDS
(B ) LOCATION : 1. .1014 ~ix) EEAT~RE: :
: (A) ~ME/~EY: misc feature ~B ) I.OCATSON : 1. .13 3 7 (D~ OT~ ~:NFORMP.TSON: /label~ pNX8 insert .
~xi~ SEQOENCE DESCRIPTION: SEQ ID NO: 13:
ACT GCC AAT Gt;T AAA AAG m ACT GTC GGT AAT GGA CAA A~C CAA CAT 4 8 Ths Ala Asn Gly Lys Lys Phe Thr Val Gly ~sn Gly Gln Asn Gln His h1d A~
WO g3/2~693 PCI'/GB93/01283 ~;; . .~

~62-AAG GGT GTC AAC GAT GGT TTC AGT TAT G~A ATC TGG TTh GAT AAC ACT 96 Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr 20 25 3a Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala GAA TGG AAT GCA GCT GTT AAC CGT GGT AAC TTC CTT GCC CGT CG~ GGT 192 Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly CTT GAC TTC GGT TCT CAA AAG AAG GCA ACC G~T TAC GAC TAC ATT GGA 240 Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr A~p Tyr Asp Tyr Ile Gly ~TA GAT TAT GCT GCT ACT TAC A~A CAA ACT GCC AGT GCA AGT GGT AAC 288 Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly As~

TCC CGT CTC TGT GTA TAC GG~ TGG TTC CAA AAC CGT G~A CTT A~T GGC 336 Ser ~rg Leu Cys Val Tyr Gly Trp Phe ~ln As~ Arg Gly Leu Asn Gly lQ0 lOS 110 Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val llS 120 125 Pro Asp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys ATT TTC CAA ATG GAT CAC ACT GGT CCA ACT ATC AAT GGT GGT AG~ GAA 480 Ile Phe Gln Met Asp HtS Shr Gly Pro Thr Ile Asn ~ly Gly Ser Glu ACC TTT AAG CAA TAC TTC AGT GTC GGT CA~ CAA AAG AGA ACT TCT GGT -528 T~r Phe ~ys Gln Syr Phe Ser Val Arg Gln Gl~ Lys Arg Thr Ser Gly CAT ATT ACT GSC TCA GAT CAC TTT AAG GAA TGG GCC AAA C~A GGT TGG 576 His Ile Th~ Val Ser Asp Hi9 Phe Ly~ Glu Trp Ala Lys Gl~ Gly Trp GGT A~T G~T AAC CTT TAT GAA GTT GCT TTG AAC GCC GAA GGT TGG CAA 624 Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln 19~ 200 205 Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro AAG GGT TCT AGT CC~ GCC ACC TCT GCC GCT CCT CGT ACT ACT ACC CGT 720 Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg ACS ACT ACT CGT ACC AAG TCT CTT C Q ACC ~AT TAC AAT AAG TGT TCT 768 Thr Thr Thr Arg Thr ~y~ Ser Leu Pro Thr Asn Tyr Asn Lys Cys Ser GCT AGA ATT A GCT C~A GGT TAC AAG TGT TGT AGC GAT CCA AAT TGT 816 Ala Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cy9 Val Val Tyr Tyr Thr Asp Glu Asp Gly Thr Trp Gly Val Glu Asn As~

WO 93/25693 PCI`/GB93/01283 GAC TGG TGT GGT TGT GGT GTT GAA CAA TGT TCT TCC AAG ATC ACT TCr 912 Asp Trp Cy~ Gly Cys Gly Val Glu Gln Cy9 Ser Ser Lys Ile Thr Ser CAA GGT ~C AAG TGT TGT AGC GAT CCA AAT TGC Gl~ GTT TTC TAC ACT 960 Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cys Val Val Phe Tyr Thr GAT GAC GPT GGT ~A TGG GGT GTT GAA AAC AAC GAC TGG TGT GGT TGT 100 Asp Asp Asp Gly Lys Trp Gly Val Glu Asn Asn Asp Trp Cys Gly Cys GGT TTC TA ~ G~AA AATACTAATT AATI~AAAAAT TAAAGAATl~A TGAA~m 1064 Gly Phe ADATS ~ AA ASTSAAAAGA ASTASG~IAA AmA~Am A~AAmAA AAAA~ACT~A 1124 SZlG ~ A A ~ GAA SSASSGAAAA T m AAATGT A~AAATST~A AAAATAC~AA llB4 m GSA~AA A~AASG~AAG AI~SSASGi~AA A ~ AASG TAP~AGTTTA AAAAATACAP~ 1244 A m GSAAGA AliAAsAPAGA ASSASAAIUA AMS~ TTATGAAA~ CC~AATGTA 1304 A A A ~ AA Aa ~ AA ~ : 1337 2 ~ OPMASION~FOR SEQ ID~NO:~14 SE~ E C~S~LIST~CS
(A`) ~ ;338~afQi~o aci~

t-ii ~ YPE ~ protein (x~ S ~ DESC~IPSTON~:~ SEQ ID NO: 14: ~
T-hr Al- Asn Gly Lys Ly-~Phe~Thr Val Gly Asn Gly Gln Asn Gl ~is ~.' Ly-~Gly~Yal~,Asn.,~ Gly~Phe Ser~Tyr Glu Ile Trp Leu Asp Asn Thr `~., Gly'Gly~A5n~ 5er~Met~Thr~;Leu Gly~Ser Gly:Ala Thr Phe Lys Ala Glu~ rp`Asn~:Ala~Ala,Val~;~ n~Arg~Gly-Asn Phe~ ~eu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly l, Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala S~r Al? Ser Gly Asn Ser Arg ;L-u Cy Val Tyr Gly Irp Phe Gln Asn Arg Gly Leu Asn Gly Val:Pro::Leu:Val Glu Tyr ~yr Ile Ile Glu Asp Trp Val Asp Trp Val :115~ 20 125 Pro Asp~Ala~Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys ..
0~ 135 140 Ile~Ph-~ Gln Met Asp~His Th,r Gly Pro Thr Ile Asn Gly Gly Ser Glu ,, ~ .
~ - :
:

WO 93/25693 ;~ PC~/GB93/012~3 , . ~ . ~ .
!

~ `~
Thr Phe Ly~ Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp ~is Phe Ly~ Glu Trp Ala Lys Gln Gly Tr~

Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu A~n Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro ~rg Thr Thr Th~ Arg 225 23~ 235 240 :
Thr T.~r Thr Arg Thr Lys Ser Leu Pro Thr Asn Tyr As~ Lys Cys Ser -Ala Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asp Pro As~ Cys 260 265 27~
Val Val Tyr Tyr Thr Asp Glu Asp Gly Thr Trp ~ly Val Glu Asn Asn Asp Trp Cys Gly Cys Gly Val Glu Gln Cys Ser Ser Ly~ Ile Thr Ser Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cys Val Val Phe Tyr Thr Asp ~sp Asp Gly Lys Trp Gly Val Glu Asn Asn As~ Trp Cys Gly Cys 325 330 ~35 Gly Phe ~2) IN~O~M~TION FO~ SEQ ID NO: 15:
(i) SEQ~ENCE CXARACTE~IS~ICS:
~A) ~ENGT~: 846 base pairs ~B) TYPE: nucleic acid ~C) STRANDED~ESS: double (D) TOP~OGY: linear ~ii) MO ~ CnL~ TYPE: cDNA

~iX~ =:
:: ~A) ~IME~XEY: CDS
~B) ~OCATION: 1..846 ix) F EAT~E:
A) NAMEJXEY: misc feature ~B) ~OCATION: 1..846 ~D) OT~ER INFORMATION: /la~el- pNX9 insert ~xi) SEOUE~OE DESCRIPTION: SEQ ID NO: 15:
ACT GCC AAT GGT AAA AAG TTT ACT GTC GG$ AAT GGA CA~ AAC CAA ~T 48 Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln ~is AAG GCT GTC AAC GAT GGT TTC AGT T~T GAA ATC TGG TT~ GAT AAC ACT 96 ~ys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr ~ J ~j V
WO 93/2~693 PCl/GB93/01283 GGT GGT AAC GGT TCT ATG ACT CTC GGT AGT GGT GCA ACT TTC AAG GCT i44Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala 3s 40 45 GAA TGG AAT GCA GCT GTT AAC CGT GGT AAC TTC CT$ GCC CGT CGT GGT 192Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly ~ :

CTT GAC TTC GGT TCT CAA AAG AAG GCA ACC GAT T~C GAC TAC ATT GGA 240Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly TTA GAT TAT GCT GCT ACT TAC AAA CAA ACT GCC AGT GCA AGT GGT AAC 288Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly Asn TCC CGT CTC TGT GTA TAC GGA TGG TTC CAA AAC CGT GGA CTT A~T GGC 336Ser Arg Leu Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu ~sn Gly 100 105 110 .`
GTT CCT TT~ GTA GAA TAC TAC ATC ATT GAA GAT TGG GTT GAC SGG GTT 384Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Yal Asp Trp Val CCA GAT GCA CAA GGA AAA ATG GTA ACC ATT GAT GGA GCT C~A TA~ AAG 432 :.
Pro Asp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys ATT TTC CAA ATG GAT CAC ACT GGT CCA ACT ATC AAT GGT GGT AGT GAA 480Ile~Phe Gln Met Asp ~is Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu 45 lS0 : 155 160 : ACC TTT AAG CAA TAC TTC AGT GTC CGT C~A CAA AAG AGA ACT TCT GGT 528 Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly CA~ ATT ACT GTC SCA GAT CAC TTT AAG GAA TGG GCC AAA CAA GGT TGG 576~is Ile Thr Val Ser~sp ~is Phe Lys Glu Trp Ala Lys Gln Gly Trp i-180 ~ 185 190 GGT~ATT GGT AAC CTT TAT GAA GTT GCT TTG AAC GCC GAA GGT TGG CAA 624ly~:Ile Gly Asn~Lou ~yr GLu Val Ala Leu Asn Ala Glu Gly Trp Gln ; l9S 200 . 205 Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro 210 . 215 220 AAG GGT TCT AGT CCA GCC ~ACC TCT GCC GCT CCT CGT ACT ACT ACC CGT 720~- Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg A ACT ACS CGS ACC AAG TCT ~TT CCA ACC AAS TAC AAT AAG TGT SCT 76B
Thr T~r Thr Arg Thr Lys Ser Leu Pro Thr Asn Tyr Asn Lys Cys Ser GCT AGA ATT ACT GCT CAA GGT TAC AAG TGT TGT AGC GAT CCA AAT TGS 816 `-a - Ala Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asp Pro Asn Cys GrT GTT TAC TAC ACT GAT GAG GAT GGT ACC 846 ~: Val Val Tyr Tyr Thr Asp Glu Asp Gly Thr ~: ~ 275 280 .

W O 93/25693 ~` P ~ /GB93/01283 '~.

(2) INFORM~TION FOR SEQ ID NO: 16:
~i) SEQ~ENCE CHARACT~RISTICS:
(A) LENGT~: 282 amlno acids (B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUEN OE DESCRIPTION: SEQ ID NO: 16:
Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln ~is Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly Asn as: so ss ~ .
Ser Arg ~eu~ cy9 Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu Asn Gly Val Pro Leu Val Glu Tyr Tyr I}e Ile Glu Asp Trp Val Asp Trp Val 115 ~ 120 125 :
Pro~Asp~Al:a Gln~Gly~Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Ly~
~130 ~ 5 140 : :Ile Phe Gln Met Asp ~i~: Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu Thr Phe Lys~Gln Tyr Phe Ser Val Arg Gln Gln ~y9 Arg Thr Ser Gly H~:s Ile Thr Val~Scr Asp ~i~ Phe Lys Glu Trp Ala Lyi3 Gln Gly Trp Gly~Ile Gly A~n Leu ~yr Glu Val Ala Leu Asn Ala 61u Gly Trp Gln ~ 200 ~ 205 , Ser Ser Gly Val Ala Asip Val Thr Leu Leu Asp Val Tyr Thr Thr Pro : 210 215 220 ,, ~ . ii . . . .
Ly~ Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg Thr Thr Thr Arg ~ 225 230 235 240 :~ . : Thr Thr Thr Arg Thr Lys Ser Leu Pro Thr Asn Tyr Asn Lys Cy9 Ser ALa Arg Ile Thr Ala Gln Gly Tyr Lys Cys Cys Ser Asip Pro Asn Cys : 260 265 270 Val Val Tyr Tyr Thr Asip Glu Asip Gly Thr ~

(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQ~ENCE C~RACTER~STICS:
(A) LENGT~: 708 ba~e pairs :
(B) TYPE: nucleic acid (C~ STRANDEDNESS: dauble tD) TOPOLOGY: linear (ii) MOLEC~LE TYPE: cDNA

(ix) FEAT~RE:
(A) N~ME/REY: CDS
(B) LOCATION: 1..708 (ix) FEATURE:
(A) NAMæ~REY: misc_feature (B) LOCATlON: 1..708 (D) Or~ INFORMATION: /label= pNX10 insert ~:
'~
(xi) SE9~ENCE DESCRIPTION: SEQ ID NO: 17:

Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln His Lys Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp A~n Thr Gly Gly Asn Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly --CTT GAC TTC GGT TCT CAA AAG A~G GCA ACC GAT TAC GAC TAC ATT GGA 240 Leu Asp Phe Gly Ser Gln Lys Ly3 Ala Thr Asp Tyr Asp Tyr Ile Gly Leu:Asp Tyr Ala Ala Thr Tyr Lys Gln T~r Ala Ser Ala Ser Qly Asn ~5 go 95 TCC CGT CTC TG$ GTA T~C GGA TGG TTC CAA AAC CGT GGA CTT AAT GGC 336 Ser Arg Leu Cys Val Tyr Gly Trp Phe Gln Asn Arg Gly Leu As~ Gly Val Prd ~eu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val Asp Trp Val Pro ASp Ala Gln Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys Ile Phe Gln Met A~p ~s Thr Gly Pro Thr ~le Asn Gly Gly Ser Glu ACC m AAG CAA SAC TTC AGT GTC CGT CA~ CAA AAG AGA ACT TCT GGT 528 Thr Phe Ly3 Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly WO 93/2~693 PCI`JGB93/01 283 I, -CAT ATT ACT GTC TCA GAT CAC ~TT A~G GAA TGG GCC AAA CAA GGT TGG 576 His Ile Thr Val Ser Asp His Phe Ly~ Glu Trp Ala Lys Gl~ Gly Trp 180 1~5 190 GGT ATT GGT AAC CTT TAT GAA GTT GCT TTG AAC GCC GAA GGT TGG C~A 624 Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu Asn Ala Glu Gly Trp Gln Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val ~yr Thr Thr Pro 210 215 ~20 Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg (2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQ~ENCE CHARACTERISTlCS:
(A) LENGTH: 236 amino acids ( B ) TYPE: ami~o acid (D) TOPOLOGY: linear (ii) MOLECUhE TYPE: protein (xi) SEQUEN OE DESCRIPT~ON: SEQ ID NO: 18:
Thr Ala Asn Gly Lys Lys Phe Thr Val Gly Asn Gly Gln Asn Gln His Ly~ Gly Val Asn Asp Gly Phe Ser Tyr Glu Ile Trp Leu Asp Asn Thr Gly Gly As~ Gly Ser Met Thr Leu Gly Ser Gly Ala Thr Phe Lys Ala ~ Glu Trp Asn Ala Ala Val Asn Arg Gly Asn Phe Leu Ala Arg Arg Gly -~ 50 55 60 Leu Asp Phe Gly Ser Gln Lys Lys Ala Thr Asp Tyr Asp Tyr Ile Gly ' 70 75 80 Leu Asp Tyr Ala Ala Thr Tyr Lys Gln Thr Ala Ser Ala Ser Gly Asn Ser Arg Leu Cy~ Val Tyr Gly Trp Phe Gl~ Asn Arg Gly Leu A_n Gly Val Pro Leu Val Glu Tyr Tyr Ile Ile Glu Asp Trp Val A_p Trp Val Pro Asp Ala Gl~ Gly Lys Met Val Thr Ile Asp Gly Ala Gln Tyr Lys ' ` 130 ; 135 1g0 Ile Phe Gln Met Asp His Thr Gly Pro Thr Ile Asn Gly Gly Ser Glu 14S 150 15~ 160 Thr Phe Lys Gln Tyr Phe Ser Val Arg Gln Gln Lys Arg Thr Ser Gly His Ile Thr Val Ser Asp ~is Phe Lys Glu Trp Ala Lyq Gln Gly Trp Gly Ile Gly Asn Leu Tyr Glu Val Ala Leu A~n Ala Glu Gly Trp Gln W 0 93/25693 ~ PC~r/CB93/01283 . -. :
. . .

Ser Ser Gly Val Ala Asp Val Thr Leu Leu Asp Val Tyr Thr Thr Pro Lys Gly Ser Ser Pro Ala Thr Ser Ala Ala Pro Arg ~. .
SU~RY OF SEO~ENCE LIST~NGS
SEQ ID NO: 1 pNXl DNA and coding region SEQ ID NO: 2 Protein sequence of SEQ ID NO: 1 SEQ ID NO: 3 pNX3 D~A and coding region SEQ ID NO: 4 Protein sequence of SEQ $D NO: 3 SEQ ID NO: S pNX4 DNA and cod~ng region SEQ ID NO: 6 Protein sequence of SEQ ID NO: S
SEQ ID NO: 7 pNXS DNA and coding region SEQ ID NO: 8 Protein sequence of SEQ ID NO: 7 SEQ ID NO: 9 pNX6 DNA and coding region SEQ ID NO: 10 Protein se~uence of SEQ ID NO: 9 SEQ ID NO: ll pNX7 DN~ and codL~g region SEQ ID NO: 12 Protein seguence of SEQ ID NO; 11 SEQ ID NO: 13 pNX8 DNA and coding region SEQ ID NO: 14 Protein sequence of SEQ ID NO: 13 SEQ ID NO: 15 pNX9 DNA and codi~g region SEQ ID NO: 16 Protein seouence of SEQ ID NO: 15 SEQ ID NO: 17 pNXI0 DNA and coding region SEQ ID NO: 18 Proeein seguence o~ SEQ ID NO: 17 : ,:

Claims (43)

1. A xylanase which has at least one catalytic domain which is substantially homologous with a xylanase of an anaerobic fungus and which is not a null lengthnatural xylanase.

2. A xylanase as claimed in claim 1, wherein the or each catalytic domain is identical to a catalytic domain of a natural xylanases from an anaerobic fungus.

3. A xylanase as claimed in claim 1 or 2, wherein the anaerobic fungus is a rumen fungus.

4. A xylanase as claimed in claim 3, wherein the rumen fungus is of the genus Neocallimastix.

5. A xylanase as claimed in claim 4, wherein the fungus is Neocallimastix parriciarum.

6. A xylanase as claimed in any one of claims 1 to 5, which is derived from a xylanase having the structure (from the N-terminus to the C-terminus):

wherein:
CAT1 represents a first catalytic domain.
CAT2 represents a second catalytic domain, LINK1 represents a first linker, LINK2 represents a second linker, CTR1 represents a first C-terminal repeat, and CTR2 represents a second C-terminal repeat.

7. A xylanase as claimed on claim 6, wherein CAT1 has a sequence which is identical or otherwise substantially homologous to the sequence:

.

8. A xylanase as claimed in claim 6 or 7, wherein CAT2 has a sequence which is identical or otherwise substantially homologous to the sequence;
.

9. A xylanase as claimed in claim 6, 7 or 8, wherein LINK1 has a sequence which is identical or otherwise substantially homologous to the sequence:
.

10. A xylanase as claimed in any one of claims 6 to 9, wherein LINK2 has a sequence which is identical or otherwise substantially homologous to the sequence:
.

11. A xylanase as claimed in any one of claims 6 to 10, wherein CTR1 has a sequence which is identical or otherwise substantially homologous to the sequence:
.

12. A xylanase as claimed in any one of claims 6 to 11, wherein CTR2 has a sequence which is identical or otherwise substantially homologous to the sequence:
.

13. A xylanase as claimed in any one of claims 6 to 12 comprising a catalytic domain which is substantially homologous with at least one of CAT1 and CAT2 and is missing at least part of the amino acid sequence downstream (ie towards the C-terminus) of CAT2.

14. A xylanase as claimed in claim 13, wherein at least part of CTR2 is missing.

15. A xylanase as claimed in claim 13 or 14, wherein at least part of CTR1 is missing.

16. A xylanase as claimed in any one of claims 6 to 15, which has the structure:
CAT1-LINK1-CAT2-LINK2-CTR1(truncated);
CAT1-LINK1-CAT2-LINK2(truncated);
LINK1(truncated)-CAT2-LINK2(truncated);
CAT1-LINK1(truncated);
CAT1(truncated);
LINK1(truncated)-CAT2-LINK2-CTR1-CTR2;
LINKl(truncated)-CAT2-LlNK2-CTR1(truncated); or LINK1(truncated)-CAT2(truncated).

17. A xylanase as claimed in claim 15, which has the structure:
LINK1(truncated)-CAT2-LINK2(truncated).

18. An isolated or recombinant DNA molecule encoding a xylanase which has a catalytic domain substantially homologous with a xylanase of an anaerobic fungus, provided that the DNA molecule does not comprise a full length copy of natural mRNA encoding the xylanase.

19. A DNA molecule as claimed in claim 18, wherein the absent portion, or one of the absent portions, of the DNA corresponds to the 3' and/or 5' untranslated region of the mRNA.

20. A DNA molecule as claimed in claim 18 or 19, which is derived from a DNA molecule having the following structure:

5'utr-sig-cat1-link1-cat2-link2-ctr2-ctr2-3'utr, wherein 5'utr represents a 5' untranslated region;
sig encodes a signal peptide;
cat1 encodes a first catalytic domain;
link1 encodes a first linker sequence;
cat2 encodes a second catalytic domain;
link2 encodes a second linker sequence;
ctr1 encodes a first C-terminal repeat;
ctr2 encodes a second C-terminal repeat; and 3'utr represents a 3' untranslated region.

21. A DNA sequence as claimed in claim 20, wherein the 3'utr segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
.

22. A DNA sequence as claimed in claim 20 or 21, wherein the sig segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
;

23. A DNA sequence as claimed in claim 20, 21 or 22, wherein the cat1 segment is a sequence which is identical to or otherwise substantially homologous with the following sequence:
.

24. A DNA sequence as claimed in any one of claims 20 to 23, wherein the link1 segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
;

25. A DNA sequence as claimed in any one of claims 20 to 24, wherein the cat2 segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
.

26. A DNA sequence as claimed in any one of claims 20 to 25, wherein the link2 segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
;

27. A DNA sequence as claimed in any one of claims 20 to 26, wherein the ctr1 segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
.

28. A DNA sequence as claimed in any one of claims 20 to 27, wherein the ctr2 segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:

.

29. A DNA sequence as claimed in any one of claims 20 to 28, wherein the 5'utr segment has a sequence which is identical to or otherwise substantially homologous with the following sequence:
.

30. A DNA sequence as claimed in any one of claims 18 to 29 encoding a xylanase as claimed in claim 1 to 17.

31. A DNA sequence as claimed in any one of claims 20 to 30 which comprises the following segments:
5'utr-sig-cat1-cat2-link2-ctr1(truncated);
5'utr-sig-cat1-link1-cat2-link2(truncated);
link1(truncated)-cat2-link2(truncated);
5'sig-cat1-link1(truncated);
5'utr-sig-cat1(truncated);
link1(truncated)-cat2-link2-ctr1-ctr2-3'utr, link1(truncated)-cat2-link2-ctrl(truncated);
link1(truncated)-cat2(truncated).

32. A DNA molecule as claimed in any one of claims 18 to 31, which is in the form of a vector.

33. A DNA molecule as claimed in claim 32, wherein the vector is a plasmid.

34. A DNA molecule as claimed in claim 32 or 33, wherein the vector is an expression vector.

35. A DNA molecule which is, or comprises the insert of, plasmid pNX3, pNX4, pNX5, pNX6, pNX7, pNX8, pNX9 or pNX10, as defined herein.

36. A DNA molecule which is, or comprises the insert of, plasmid pNX5.
pNX9 or pNX10, as defined herein.

37. A host cell transfected or transformed with a DNA molecule as claimed in any one of claims 18 to 36.

38. The use of a xylanase as claimed in any one of claims 1 to 17 in the modification of baked products.

39. The use of a xylanase as claimed in any one of claims 1 to 17 as an enzyme supplement for animal feed.

40. The use of a xylanase as claimed in any one of claims 1 to 17 as an impurity remover in pulp.

41. The use of a xylanase as claimed in any one of claims 1 to 17 in the prebleaching of kraft pulp.

42. A xylanase which has at least one catalytic domain which is substantially homologous with a xylanase of an anaerobic fungus.

43. An isolated or recombinant DNA molecule encoding a xylanase which has a catalytic domain substantially homologous with a xylanase of an anaerobic fungus, provided that if the DNA molecule is cDNA encoding a xylanase of Neocallimastix frontalis then the DNA molecule is operatively coupled to a promoter.