JPH07507928A - recombinant cellulase - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] recombinant cellulase field of invention The present invention provides recombinant cellulases derived from anaerobic fungi and recombinant cellulases. This invention relates to a manufacturing method and clones used in this method.

Background of the invention Cellulose is one of the most abundant polysaccharides in nature, with β-1° It consists of a polymer of glucose linked by 4-glucosidic bonds. simple Converting cellulose to sugars gI (cellobiose and glucose) requires at least There are also two types of hydrolases: internal β- 1゜Endoglucanases and cellulose that hydrolyze 4-glucoside bonds Exoglucanases that cleave cellobiosyl units from the non-reducing end of the gas chain (mainly cellobiohydrolases). Kin structure similar to cellulose Ran consists of a backbone of β-1,4=linked xylose units. β-1,4-quino The enzymatic cleavage of the roside bond is performed by endo-β-1,4-xylanases (xylanases). ze). These three types of enzymes are usually independent proteins. They exist separately and each has its own unique substrate specificity.

Many endoglucanases only cleave internal β-1,4-glucosidic bonds. Rapid depolymerization of a model substrate, carboquinomethylcellulose (CM-cellulose) while cellobiohydrolases produce crystalline cellulose and methylambellifer. Can hydrolyze lyr cellobioside (MUC), CM-cellulose It has no or almost no opening polymerization activity against. as well as many xyla Nases exclusively attack β-1,4-quinoloside bonds. However, all Not all polysaccharide hydrolases have strict substrate specificity. stomach.

Similarities in the chemical properties of the substrates lead to differences between the two types of cellulose as well as cells. Cross-specificity occurs between kinrases and kinrases. from bacteria Many of the loaned cellulases have some degree of quinnalolite activity (usually less than 1%). (Salirachi et al., 1999). 0 Niyagoo et al. 1990: Haselurado et al. 1990: Flint et al. 1991; Giller et al., 1987).

Recent studies based on partial enzyme purification have shown that preanaerobic fungi such as Neocharimus T. frontulisis produces polyfunctional polysaccharide hydrolases. (Gomez de Segura and Febre, 1991; Su and Kalb, 1991). Functional polysaccharide hide Lorases are genetically linked to anterior tube bacteria to enhance their ability to degrade lignocellulose. Of particular interest in child propagation. Endoglucanase, cellobiohydrolase and Simultaneous enhancement of cellulose and xylanase activity is due to cellulose and It would promote the fragmentation of the complex structure of gnocellulose. This is an enzymatic reaction of a complex speed-limiting problems that often occur when only one of the Probably.

Cellulose and hemicellulose (mainly quinolanes) are the main components of ruminant food. It accounts for 50 to 80% of plant tissue. Although we have made effective use of plant feed, In many cases, cellulolite enzymes and xylanella, which are microorganisms that live in the forestomach, Depends on the production of light enzymes. Cellulose in the forestomach compared to other components in food and hemicellulose degradation is relatively slow and incomplete. or 30% (Dehority, 1991). That is, using recombinant DNA technology Introducing the plant polysaccharide hydrolase gene into microorganisms in the forestomach There is economic value in further enhancing the ability to decompose plant fibers. Located around the front cylinder Genes encoding highly active enzymes that can degrade crystalline cellulose Isolation of offspring is considered to be one of the key steps in achieving this goal. .

In the past decade, isolation of cellulase genes from preorganisms has focused on bacteria. It was Most of the cellulases cloned from anterior tube bacteria are crystalline cellulose. had little or no effect on depletion of water (Robinson and Chamlis). , 1989: Hazelurad et al., 1990; Berger et al., 1989; Romanique et al. , 1989: Flint et al., 1989). However, a few cloned cellular enzymes have shown some important activity towards this substrate (Kabikioli and Watson, 1991: Howard and White, 1988).

The anaerobic fungus Neocallimastyscus batorinoarum isolated from the foreground of sheep is Grows on cellulose as the only hydrocarbon source with high activity against ululose degradation (Olpin and Mushi. 1989: Williams and Orl. Pin, 1987).

Molecular biological research on fungal cellulases has mainly been conducted in aerobic fungi. (Nyemaker et al., 1983; Terry et al., 1983; Cheno et al., 1999) 87: Sims et al. 1988; Azebet et al. 1990). These studies are based on aerobic fungi The complexity, structure, and regularity of cellolases have been clarified. However, bacteria Information on the successful purification of individual cellulolite enzymes from cellolase complexes of Studies of the molecular properties of cellolase in anaerobic fungi have been hampered by the lack of information. vinegar i.e. antibodies or proteins for the design of oligonucleotide probes. Preparation of clone sequences was not possible.

Other prior art forming the background of the invention prior to the present invention is as follows: (i) Ray Mond et al. TEMS Microbiology Letters (1991) 107-112 + (if) Olpin et al., Current Microbiology-Vol, 3 (1979) p. p121-124゜ (tFi) Mountfort and Anyaa “The Rolls of Proto” “Sia and Menta in Luminand Guijiesun” (1989) Nambul Busokus (Australia).

(V) Lobera, Applied and Environmental Microbiology G June 1987 pp 1210-1215 and (vi) Loebera, Applied and Environmental Microbiology Noyune 1 Genomic library established at 987 pp. 1216-1223° This is achieved by isolating enzymatically active lawns of the same species. however A cellulase gene from a bacterial genome library with functional expression of this cellulase Approaches for gene isolation are usually not possible. This means that fungi are eukaryotic microorganisms. Because there is. Most eukaryotic genes contain introns, and E. coli contains introns. Unable to carry out post-transcriptional modification of mRNAs to splice trons stomach. Therefore, enzymatically acting proteins are usually obtained from fungal genome libraries. It cannot be synthesized in the clones that are used.

This cDNA, A-clone approach overcomes the problem of post-transcriptional modification in E. coli. can be used to. However, cellulases in fungi are usually lycodylated, and glycosylation is often the biological process of many glycosylation enzymes. required for biological activity. E. coli lacks a glycosylation mechanism There is. This problem arises if a cloned gene is transferred to a eukaryotic microorganism such as yeast. If possible, it will be resolved. Biologically active from cDNA clones in E. coli Other problems often encountered in obtaining proteins such as The gene contains a translation stop codon upstream of the translation start codon; synthesized a cloned protein from a translation starting point provided in a vector. and (ii) synthesis of the cloned protein is inhibited by the fusion protein. The biological effects of cloned proteins are often adversely affected by vector-derived fusion peptides.

Therefore, conventionally in this field, differential or cross-hybrid Deinyon, using antibody probes or oligonucleotide probes in fungal polysaccharides. For isolation of callide hydrolase cDNA or genomic DNA clones I've used it for. Reports related to this technique include Raymond et al., Terry et al. ; Noemarker et al., supra; Nomus et al., supra; Moro Tree and Grand FEMS; Microbiology Letters 51 217-224 (1988): and The above-mentioned Azebet et al. However, these methods are very time consuming and Isolation of enzymatically acting clones is often an intensive two-step cloning operation. need for. Fungi for antibodies or oligonucleotide probes Purification of the cellulase is also necessary. This is usually done in public using the approach described above. It takes more than a year to obtain a functional enzymatic clone.

Expression of E. coli / Expression of fungal cellulase cDNAs using stems Isolation has not been reported prior to the present invention. This is probably at least partially invalid. Generate enzymatically active cellulase clones by using appropriate expression vectors. This seems to be because they failed to do so. Expression vector system selection is important . Cloning enzymes using plasmid expression vectors such as pUC vectors When incorporated into cells, cellular This makes it difficult to screen for clones. bacteriophage vec Regarding the release of cloned enzymes into cellulose/agar media by cell lysis, It is advantageous. However, commonly used batataeri phage expression vectors , λgtll and its derivatives at the C-terminus of LacZ peptide. It has polyclonal sites. LacZ-pec fused to cloning enzyme Most of the tides often have a negative effect on cloning enzyme activity.

Raymond et al. (1991) mentioned above reported that the anaerobic bacterium N. frontalis Molecular cloning of the lysancalide hydrolase (i.e. cellulase) gene Attempts are described. In this reference, derived from N frontalis Clones from the cDNA library were cloned into Trichoderma lizei exocellobiotics. hybridizer to the DNA probe-encoding portion of the hydrolase (CBHI) gene. I did it. However, this was later confirmed by Raymond et al. A special cDNA clone obtained from I was exposed in my personal communication that I didn't code it.

In addition, Raymond et al.'s paper demonstrates the production of biologically active enzymes from these clones. The law is not stated.

Disclosure of invention The purpose of the present invention is to provide a recombinant cellulase from anaerobic prostyloid fungi; This is a commercial product related to the hydrolysis of cellulose or cellulose derivatives containing plant cell walls. It can be used commercially.

Another object of the invention is to provide anaerobic cellulase encoding recombinant cellulases of the invention. An object of the present invention is to provide a method for cloning cellorase cDNAQ from protocyst fungi. Ru.

Yet another object of the present invention is to obtain cellulase clones produced in the above method. The aim is to provide the same kind of products. The cloning method of the present invention includes the following steps. i) Cultivation of anaerobic anterior tube fungi; (11) Isolating total RNA from the culture in step (1); (iii) Step (1) of isolating polyA mRNA from total RNA.

(iv) Step of constructing cDNA expression library (V) λZAP, λZAP bacteriophage selected from Ir or vectors with similar properties; Step of ligating cDNAQ to the current vector: (vi) Detecting cellulose hydrolyzate Spread cellulase-positive recombinant clones in cellulose-containing medium by cleaning and (vii) purifying cellulase-positive recombinant clones. The process of doing.

Concerning the preparation of recombinant cellulases from anaerobic fungi, especially fungi of the gastrointestinal region. The above step (i) may be performed by culturing as described below. these bacteria The species are strictly anaerobes, such as Neocallimastys butlinarum, Neocallimastys frontalis, Neocallimastys fraiennos , Neocallimastyx stantrupensis , Sphaeromonas communis , Canicomyces equi, Piromyces communis, Piromyces equi, Piromyces S. danbonii, Pyromyces retalgicus, Pyromyces mai, Ruminomyces elegans, Aeromonas mucronatus, Orpinomyces bovis and O. Examples include Lupinomyces yoyonii. Regarding the above-mentioned anaerobic digestive Miyagi fungi, crabs Comyces equi, Piromyces equi, Piromyces zumbonica and Piromyces Seth Mai is discovered by a horse. In other words, these fungi, like the other fungi mentioned above, are found in cows. It is not something that depends on the previous statement.

Cultivation may be carried out in a suitable medium containing forestomach fluid or Avicel as a carbon source. Anaerobic in the first containing cellulose (i.e. in the form of microcrystalline cellulose) It may be done under certain conditions. After culturing the fungi, gold RNA may be obtained by any suitable method. .

That is, first, fungal cells are lysed by mechanical disruption in a suitable cell lysis buffer. .

Appropriate RNA protection compounds are added into the fungal cells to otherwise attack the fungal RNA. Maintains RNA integrity by degrading RNAases that would You may. This total RNA is then converted to CsC12 or sample Molecular Cloning, Laboratory Manual Second Edition / Con Cold Spring Harbor Laboratory Press (1989 ) through other means as described in It may be isolated from a homogeneous body. An alternative method for preparing National 1 RNA to the above method is Buisant and the like described in Biotechnics 148-149 (1990) The method described in Houdebein or Komczynskiy and Thatch (1987) ) may also be used. In this alternative method, total fungal RNA is obtained from the homogenate described above. Extract with phenol chloroform at pH 4 to remove DNA and associated proteins. It may be isolated by removing. The obtained total RNA was further purified with lithium chloride-urine. It may be isolated by washing with an elementary solution.

Poly(A) mRNA is then transferred to a wide variety of molecules such as oligo(dT) cellulose. may be isolated from RNA by affinity chromatography on compounds containing residues. stomach.

Instead, a variety of compounds containing uranium residues, such as poly(U)-Sephadex, can be used. A compound may also be used. Poly(A) mRNA is then purified with a suitable buffer. It may also be eluted from an affinity column.

The cDNA expression library was then subjected to cD using reverse transcriptase of poly(A) mRNA. It may be constructed using standard techniques based on conversion to NA. The first string of cDNA Lands may be synthesized using reverse transcriptase, and the second strand of cDNA can be synthesized using reverse transcriptase. - It may be synthesized using coli DNA polymerase I. The cDNA is then extracted into a suitable Bacteriophage expression vectors, preferably λZA It may be linked to P or λZAPTI. This CDNA library is then - in vitro using suitable host bacterial cells such as E. coli strains. The cells may be propagated after being grown. Bacteriophage expression vector in step (V) The selection of vectors is important as such expression vectors have the following characteristics: (1) It has an E. coli promoter. (11) It has a translation start codon. (iii) have a reposonal piering site: (iv) ) The biological effects of cloned proteins are usually determined by fusion peptides derived from vectors. Vector-derived molten peptides cannot be used because they are adversely affected by should be made smaller. Therefore, the bacteriophage expression vector The local site is as in λZAPII (N-terminal of 1acZ peptide) Properly located in the eggplant.

If the expression vector is used as described above, it will contain biologically active enzymes. The chances of this happening will increase significantly. As described below, there are many aspects of the present invention. Isolation of enzymatically acting cellulase clones demonstrates the utility of this approach. I will clarify. As far as we know, this is a cellulase cDNA clone with enzymatic activity. of E. coli recombinant bacteriophage using an expression vector as described above. We believe this is the first to be isolated from an anaerobic fungus based on expression. λZAP and λZAP11 are examples of such expression vectors.

Therefore, for λZAPt or λZAPII, "vectors with similar properties" The term "genus" refers to expressions having the known characteristics (i), (ii), (iii) and (iv). It includes within its scope the current vectors.

Regarding fusion protein expression, such fusion proteins can be screened with antibody probes. The λZAPI supplied by the producer may only be lean. It is clear from the product summary with I vector. λZAPI + vector Screening or biological screening of clones with enzymatic activity on suitable substrates There is a clear expectation that it can be used for direct screening based on the activity of did not exist. It is possible that the present invention is true in bacterial host cells such as E. coli. If shown to contain expression of cDNA of nuclear origin (i.e. of fungal origin) This enhances the novelty of the present invention.

Screening for cellulase-positive recombinant clones is based on cellulose hydrolysis. This may be done by any suitable technique. In this method, the clones are cellulose Hydrolysis may be grown on medium supplemented with a suitable color indicator. cellulase suitably assisted by - detected by the presence of a positive break. Good too. The cellulase-positive recombinant clones were then purified and the cDNA in the clones The A insert may be excised into pBluescript (SK(-)). Appropriate The E. coli promoter may be used in the expression vectors described above. suitable professional The motors are 1acZ, Tac, Bacteriofano T7 and la■bda Contains Pt.

Recombinant cellulases may be characterized as follows (this is based on the main characteristics identified): is: (i) The cloned celA enzyme is highly active in crystalline and amorphous cellulases. Has specific activity. The optimum pH and temperature for cellulose hydrolysis are respectively pH 5 and 40°C.

(11) The cloned celD enzyme is an endoglucanase, cellobiohydrolase It is a multifunctional cellulase with high activity of enzyme and xylanase. cellulose The optimum pH and temperature for gas hydrolysis are pH 5 and 40°C, respectively.

(City) celD cDNA is cleaved and encoded into three catalytically active domains. It's okay. Each domain contains endoglucanases, cellobiohydrolases and quinohydrolases. It has lanase activity and cellulose-binding capacity.

(iv) Recombinant celA and celD enzymes are also highly sensitive to lichenan. It has high activity.

(v) The combination of celA and celD enzymes hydrolyzes crystalline cellulose. solution can be achieved more effectively.

Description of preferred embodiments patriciarum (1986) and in the laboratory under selection on a lignocellulosic substrate. Cultivated for years. The medium for culture of N. patrinoarum was previously reported. (Kembu et al., 1984). Microcrystalline cellulose (Avicel) as a single carbon source It was used as The host strain for cDNA cloning was E. coli PLK-F or or XL 1-Blue, manufactured by Stratagene. Purchased from. strains of E. coli in L-broth (Sambrock et al., 1989). I grew it. Purchased λZAPII Vector from Stratadiene, Seller's Description Culture the recombinant phages using E. coli meat and freeze the cells using a mortar and pestle. It was ground to a fine powder under nitrogen.

The powdered bacterial cells were mixed with a guanidium thiocyanate solution (4M guanidium thiocyanate). 0.5% (w/v) sarconone lauryl sulfate, 25mM sodium citrate (pH 7,0), 1mM-EDTA and 0.1M-β-mercaptoethanol ) and homogenize with a mortar and pestle for 5 minutes, then further homogenize with a polytron. Homogenize for 2 minutes at full speed. Total cellular RNA was extracted from homogenate, CsC1 Ultracentrifugation (Sambrock et al., 1989) or with the following modifications: It was isolated by either the method of Komaknonsky and Thatch. Guanidinochi onoanate/phenol/chloroform extraction and 2-propanol precipitation. After the first step, the resulting RNA pellet was dissolved in LiCl/urea solution (6M = urea , 3M-LicI, 1mM-EDTA, pH 7,6). suspension 4 The mixture was shaken at ℃ for 1 to 2 hours to remove contaminating proteins and DNA. Centrifugal minute After separation, the RNA pellet was washed once with LiC1/urea solution at 75% (V/V). Wash briefly twice with tanol and add 110mM-)Lis/HC]/1mM-ED. TA, dissolved in pH 80. RNA was further extracted with phenol/chloroform and It was purified by precipitation and ethanol precipitation. Poly(A)” RNA into oligo(dT)-cell Selection was made by lowose chromatography (Sambrock et al., 1989).

Common recombinant DNA techniques DNA isolation, restriction enzyme digestion, ligation, transformation and RNA production. Lobe preparation was essentially based on the method described by Sambrock et al. (1989). I followed him.

Construction and screening of N batori/arum cDNA library double-stranded cDNA N batoriculture cultured for 48 hours on medium containing 1% (W/V) Avicel. ZAP-cDNA synthesis kit was synthesized from mRNA isolated from Arum Ligate with (Stratadiene) λZAPI+ based on the seller's instructions. Ta. A cDNA library of 106 recombinants was obtained. Recombinant phages were added to 05% ( W/V) carboxymethylcellulose (CM-cellulose), 1mm MUC or is a 0.7% (W/V') soft agar table containing any substance from 01% quinolane. Screening was carried out by spreading it into the surface layer and examining the cellulose dissolving activity.

lQmM-isopropyl β-D-thiogalactobiransod (I PTG: 1 An inducer of acZp-regulated gene expression) was also included. CM -Hydrolysis of cellulose is carried out using the Congo red staining method (Tacer and Wood, 198 2). Hydrolysis of MUC can be tested by fluorescence under UV light. Ru. The inserted cDNA in the CM-cellulose positive phage is according to Stratadiene's theory. For the generation of p-bluesbrict (SK-) by in vivo excision according to the present invention. Collected more.

Construction of deletion mutants Deletion of celD cDNA can be done by removing the cDNA fragment with restriction enzymes or by or by digestion with exonuclease III (Sambrock et al., 1989). generated. The truncated ce ID insert cDNA is mapped with restriction enzymes. or by partial sequencing of the nucleotides at the end of the insert. 2 single-stranded plasmid DNA, basically based on the Stratadiene protocol. It was prepared using The obtained DNA was extracted using the dithioxynucleotide method (Tipper and Richa). Sequencing was performed using the following method (Dodson, 1987).

The λ DNA of the southern hybridase cellulase-positive clone was , was purified by the Ravid Minibre Valley/Con method shown below. Is it a liquid culture? One milliliter of the phage lysate was treated with RNase A (10 μg/ml) and Proteinase K ( 1 mg/ml) for 3 hours at 37°C, followed by phenol/quenching. Extracted with loloform. DNA was precipitated with ethanol, and EcoRl and Xho The cDNA cloning site was digested with 1% agarose gel electrophoresis. and plotted on Hybond N membrane (Amaan Yam). Ta. Hybridization and signal detection were as previously reported (que and Morris, 1992), prepared from the 3' region deleted cDNA, and dioxygenated. This was performed using an RNA probe labeled with nin. Hybridization is 50 50% (V/V) formamide, 0.8M NaCL, 50mM phosphoric acid at °C Sodium (pH 7.2), 4mM-EDTA.

0.2% (w/v) SDS, 5x Denhard Soto solution, 1 m 11 = 1 2 mg yeast RNA, 0.2 mg herring sperm DNA per ml (LX The Dennod solution was 0.002%, 2% Lanalbumin, 0.002% Ficoll, 0.00%. 02% polyvinylpyrrololidone) This was done using Takagentomi washing in 0.1xSSC10.1% (W/V) SDS (IXSSC is 0.15M-NaCl, 15mM-sodium citrate), 6 Recombination carried out at 8°C E. coli cells harboring the plasmid were incubated in LB medium for 1. Cultures were grown until the end of logarithmic phase in the presence of mM IPTG. Scrub the crude cell lysate. It was prepared according to the method of Ruth et al. (1987). Preparation of enzymes for standard quantitative assays The product was heated at 39°C for 30 to 60 minutes with the following substances: 205% (w/v) CM-cellulose. (low viscosity, Sigma), 1% (W/v) amorphous cellulose (H, PO2) swollen, Avicel), 1% (w/v) Avicel (Merck), 0.05% (w/v) p-nitrophenyl cellobioside (pNPC, Sigma), p-nito Lophenyl glucopyranoside (pNPG, Sigma), 0.25% (w/v) 50mM containing Tossbelt barley quincean (Sigma) and 0.4% lichenan. It was incubated in sodium citrate (pH 5,7). cellulose, lyke Reducing sugars released from naan or golden orchid were measured by the method of Revell (1972). did. The p-nitrophenyl group released from the p-nitrophenyl derivative is It was measured by the method of Kund et al. (1988). with non-recombinant pBluescript Control lysate prepared from cells of E. coli XL 1-Blue strain It was used as The concentration of Tan 1 is determined by Bio-Rad Protein Ansei Kit I. The dye binding assay was performed using I and according to the vendor's instructions. 0. Contains 2% (w/v) CM-cellulose, lichenan, laminarin or quinolane 0.8% (W/V) agarose gel plate or 50m containing 1mM MUC Qualitative assays were performed in M sodium citrate pH 5.7. hydrolysis zone was detected as described above.

Appearance of cellulose binding canopy of cloned cellulase To preserve the cell lysate, add 200 μl of previously washed 5% (w/v) aliquots. Sustained at 0°C with 5QmM sodium citrate (pH 5,7) containing Bicelle The cells were incubated for 1 hour with shaking. Remove unbound rampant by centrifugation. Then, the Avicel pellet was dissolved in 50mM sodium citrate (pH 5,7) for 3 hours. Washed twice. Bound cellulase was assayed for its enzymatic activity as described above. .

Cloned cellulases were used to analyze hydrolysis products of cellulosic substrates. Spin the crude lysate containing E. coli using a Centricon 1 condenser (Amicon). - Dialyzed to remove small molecules. The dialyzed enzyme preparation was diluted with 1% (w/v) Abi cells or cellodextrin with 3-6 glucose units (2 mg/m Incubate at 39°C in 50mM sodium citrate (pH 5,7) containing Incubated. Testing cellodextrin intermediates and final hydrolysis products Samples were incubated for five incubation times (30 min, 1 h, 2 h, 4 complete as well as partial digests, aliquoted at 30 hours and 30 hours). Use an appropriate amount of enzyme to obtain. Hydrolysis production of cellulosic substrates The sample was prepared using a gel plate and ethyl acetate/water/methanol (3:3) was used as the eluent. : 4 (volume ratio)).

The sugar level W on the plate was determined as described by Lake and Gutdwin (1976). Standard cellodextrin (Merck) visualized by spraying with phenylamine reagent. It was used as a standard for identification.

Results and analysis Isolation of cellulase cDNA from N. patolinarum cDNA expression library c The DNA library was incubated with N, Nokuto, which was cultured with Avicel as the sole hydrocarbon source. Prepared from poly(A)' RNA isolated from Lin arum, λZAPII vector It was constructed in E. coli using . The library is first subjected to endoglucanase activity. The cells were screened for sexual expression on CM cellulose plates. from library After screening 4X10' plaques of 200 CM-cellulose positive A plaque was identified. The cellobiohydra of this CM-cellulose positive clone The enzyme activity was first examined using MUC plates, and then the recombinant bacteriophage 7-no. The cellulase in the supernatant of the lysate was absorbed by Avicel, and after incubation at 39°C for 3 hours. Investigate the hydrolysis ability of microcrystalline cellulose by assaying the reducing sugars released in (See Cellulose Binding Assay in Methods). 11 bacteria Phage clones showed activity against Avicel as well as CM-cellulose and M Both UC plates showed large hydrolysis zones. These 11 clones I then tested the solubility of quinilla on a quinilla plate and everything was positive. It was sex.

When the selected clones were analyzed by restriction enzyme mapping, 11 clones were found. 10 clones (inserted cDNA size ranges from 1.6 kb to 3.9 kb) ) shared the same restriction pattern. The restriction enzyme map of the longest cDNA sequence is The name Ce ID (pCNP4) is shown in FIG. Any other clone The one with a 70kb insertion part is named celE, and this has the same restriction as ce ID. In addition to the limit turn, there are two 1.15 kb internal EcoR1-EcoR1 flags. It has a cDNA of 1.7 Kbp (Fig. 1). Ce with 3’ region deletion Cross/X hybridization using a nucleic acid probe prepared from ID cDNA In the engine analysis, CeID strongly hybridized to Ce1E. Therefore, 10 The clones were obtained from the same gene, and the celE clone was derived from the celD It can be seen that these are related cDNAs.

Pool of CM-cellulose positive clones containing three other types of cellulase cDNAs isolated by restriction enzyme mapping and cross/X hybridization enzymes from did. cDNAs of three cellulases (longest cDNA insert for each type) ce IA (2,0kb), Ce IB (1,7kb) and CeI c (1,6 Kb), and the restriction enzyme map is shown in Figure 2. cDNA The 3゛ region of the insert is digested with Xho] and the enzyme at the upstream restriction site (Figure 2). Using nucleic acid probes prepared from CeIA and Ce1C clones removed by Southern hybridization analysis revealed three cDNA inserts. It was found that these did not cross/) hybridize with each other (Figure 3).

Similarly, using strict conditions, Ce ID is celA, celB and celc It did not hybridize with.

Properties of recombinant cellulase enzymes The substrate specificity of these recombinant enzymes was tested for various cellulosic substrates and quintessence. This was further analyzed by quantitative measurement of the activity. As shown in Table 1, ce ID fermentation MU had the highest activity against 0M cellulose, but crystalline cellulose and MU Amorphous cells also for C and p-nitrophenyl cellobioside (pNPC) It had high activity similar to that for loin, so cellulose had iohydrase-like activity. It also had The enzyme is methylumbelliferin, a substrate for β-glucondase. against lugluconod (MUG) and p-nitrophenyl glucoside (pNPG). showed no activity. The other cellulosic substrate tested was lichenan (β-1 mixture of glucans containing ゜4 and β-1,3 bonds) and laminarin (mainly β-1,3-glucan). ce ID enzyme has very high activity Table 1) shows a large hydrolysis zone in the agarose containing lichenan. No hydrolysis zone was formed on the gel plate but not on the laminarin plate ( Figure 4). This is because the decomposition of lichenan is done by cleaving β-1,4-bonds. Show that. Interestingly, high xylanase activity was also observed in celD. Ta. Analysis of the hydrolysis products by TLC revealed that the celD enzyme Splitting phosphorus (containing 3-5 glucose units) into glucose and cellobiose I found out that I can understand it. Its catalytic method on these cellulosic substrates is , a typical endoglucanase (i.e. β-1,4-glucoat at random position) (See Figure 5). However, microcrystalline cellulose The hydrolysis product of gas is mainly cellobiose, which contains trace amounts of glucose. (Fig. 5), indicating cellobiohydrolase activity. This is truly It is clearly a multifunctional plant polysaccharide degrading enzyme. many centers Although lulases and xylanases exhibit pleiotropic substrate specificities, most The second substrate shows only residual activity (usually 1%) (Salirachi et al. 1990, Yagoo et al., 1990: Hazelurad et al. 1990; Flint et al., 19 91: Taylor et al., 1987). The substrate specificity of the celE enzyme is different from that of the celD enzyme. Although the same, its activity is about 4 times lower. The enzyme encoded by ce IA is It has properties of cellobiohydrolase. of coagulant and amorphous cellulose Shows very high activity in hydrolysis, but relatively low activity towards CM-cellulose. It has low activity (Table 1). celA! The cellobiohydrase-like properties of the original human-7,b<ce>released from cellobiose or avicel by IA enzyme This was further confirmed by the fact that it was the only product that ce IA enzyme also has very high activity against lichenan and no activity against laminarin. Not shown. The properties of celB and celc enzymes are similar to endoglucanases. (Table 1 and Figure 6).

The pH and temperature suitable for ceIA and celD enzymes are shown in FIGS. 7 and 8. cell A and celD enzymes from pH 4.5 to pH 8.5, preferably from pH 5 to 7. It was active among The thermostability of these enzymes was tested at temperatures between 30°C and 70°C. did. The ce IA and ce ID enzymes had favorable activity at 30°C to 50°C.

The recombinant enzyme is active against the hydrolysis of Avicel at 39°C for at least 21 hours. The properties were maintained (Figures 9 and 10). Abysse with ce IA or ce ID enzyme The rate of hydrolysis was not proportional to the amount of enzyme tested (Figures 9 and 9). 10). However, the combination of celA and celD enzymes allows Since better hydrolysis was observed when the enzyme was used twice Complementary effects of lA and celD enzymes are suggested.

Recombinant xylanase can be prepared according to the method of the invention using the experimental protocols substantially described above. It was confirmed that it can be manufactured using One of such xylanases is pNX- What is called Tac has the DNA structure shown in Figure 16, and the DNA structure shown in Figure 17. It has an array. .

Combination of recombinant xylanase such as pNX-tAc and celA and celD enzymes The combination is carried out in a crude cellulosic matrix containing lignin and hemicellulose components. exhibit synergistic or synergistic effects in relation to the biological activity of This activity is shown in Table 2.

Cellulose-binding capacity of ceIA and celD enzymes c The cellulose binding capacity of the elA and celD enzymes was previously Enzyme activity with and without absorption into crystalline cellulose (Avicel) Evaluated by comparative assays. After absorbing the enzyme into Avicel, the enzyme-group After rigorous washing of the quality complex, the amount of reducing sugar released from Avicel was 1 mg. of protein (crude cell lysate) per minute. However, when the enzyme was added without being absorbed first, 1 mg of protein was added. The amount was 243 μg per minute. High enzyme activity after this absorption and washing The high recovery rate (95%) indicates that the celD enzyme has a strong cellulose binding capacity. It is suggested that it has a city. cel after absorption into Avicel and washing The recovery rate of A enzyme activity was 77%, much lower than that of celD enzyme.

Cellulose binding capacity is the ability of enzymes to access this insoluble substrate. As a result of contact, we believe that it is very important to effectively decompose cellulose. It will be done.

ce ID enzyme functional domain To study the location of the catalytic and cellulose binding domains of the ce ID enzyme, to determine whether the diverse substrate specificities of enzymes are based on different catalytic domains. In order to clarify this, we performed a series of deletion analyzes of the celD cDNA. Shown in Figure 12 Similarly, the celD cDNA has each domain linked to the IacZ translation initiation codon of the vector. encodes three domains that exhibit catalytic activity when fused in frame with Can be cut. These are domain I (pCNP4.2) and domain I, respectively. I (pCNP4.4) and domain III (pCNP4.8). Ru. The domain I subclone construct was constructed in the 3° region of the ce ID cDNA. 2.75 kb fragment (Pvu I I I-Xho I fragment) Obtained by deleting . Domain II is 1. of the celD cDNA. Contains sequences from 15 Kb to 2.37 Kb, with domain III ranging from 2.3 Kb to 2.3 Kb. It contains up to 3.37 Kb of sequence. Domain II subclone construct (p CNP4.4) is a 1.15 kb Eco fragment at the 5° end of the ce ID cDNA. Excluding the RI-PvuI fragment, exonuclease I was added at the 3′ end. The domain IjI is obtained by performing digestion with II, and the domain IjI is the 5th and 3° region by exonuclease III digestion. interestingly , all three domains were extracted from the enzyme obtained from the uncut ceID cDNA. It has the same pattern of substrate specificity as originally identified. Furthermore, all three domain has cellulose binding capacity. suck on avisel The recovery rate of enzyme activity after aging and subsequent washing was between 70% and 80%. . This is slightly lower than that of the uncleaved ceID cDNA.

To determine the cDNA sequence of ceID (see Figure 13), a diagram of the structure of celD is shown. The solution is shown in Figure 14. Three catalytic domains deduced from nucleotide sequences The amino acid sequence is shown in Figure 15. In the uncleaved ce ID, the third catalytic domain is not translated because there is a translation stop codon at the end of the second domain.

Global functional analysis reveals novel properties of the CEID enzyme .

Some cellulases and xylanases are composed of two monofunctional catalytic domains. (Saulla, 1990; Gilbert et al., 1992) or - individual multifunctionality. It has a catalytic domain, but is a cDNA of polysancharide hydrolase. Encodes three multifunctional catalytic domains, and each catalytic domain is made of cellulose No example has been reported so far of having binding capacity.

Multifunctional enzymes exist in anterior shoulder fungi in complex structures with polysaccharide substrates. It is suitable for working in that natural environment. Usually natural motoga such as two Several types of polysancharide hydrolases have been assembled to act synergistically on It is necessary for the enzymes to form a multienzyme complex.

1. celD cDNA effectively processes both crystalline and amorphous cellulose. Encodes a highly active cellobiohydrolase that splits water.

2. celD cDNA contains endoglucanases, cellobiohydrolases and It has lanase activity and can degrade a wide range of cellulosic substances and quinolanes. encodes the active enzyme.

3. The cloned celD enzyme probably cooperates in the degradation of cellulose. Both endoglucanase and heptobiohydrase activities Because of its presence, it actively hydrolyzes crystalline cellulose.

4. The celD cDNA has three functional domains; each domain has a strong Rouleau sous binding capantee plus endoglucanase, cellobiotics Has ohydrolase and xylanase activities. cellulose binder Capacity is the result of adhering the enzyme to an insoluble substrate called cellulose, which increases its effectiveness. This is important in that it enables the decomposition of cellulose.

5. celA and celD enzymes have very high activity in hydrolyzing lichenan show Multifunctional enzymes can more effectively separate polysaccharide complexes present in plant materials. I can understand it. A large number of cloned cellulases have demonstrated specificity for various substrates. However, most of them have only traces of activity (usually <1%). Shown for Atsushi 2 substrate. Cellulase or xylanase genes, respectively. which co-contains three multifunctional catalytic domains with cellulose-binding capacity. There are no known examples of this being coded. Ce cloned within E. coli 1. The activity of A and ce ID enzymes can be increased using stronger promoters. obtain.

Potential applications of ceIA and ceID cDNAs in cellulose and hemicells Loin (mainly composed of xylan) is the most abundant natural resource on earth.

Cellulose alone accounts for approximately 40% of the total biomass, with an annual production of 4 x 10” tons. (Coghlan, 1985), which is -70 kg of cellulose per person. In 1983, Russochen et al. (198 3) is being calculated. Most plant materials contain 40-60% cellulose and Contains 15-30% hemicellulose (Detsker and Lindner, 1979) . Effective use of plant materials by ruminants such as sheep and orchids is therefore the first Cellulose decomposition by microorganisms living in the stomach (the expanded front shoulder of rebel animals) and production of xylanolytic enzymes. in the rumen compared to other components of the diet. The decomposition of cellulose and hemicellulose is relatively slow, about 30% It is calculated that there is only 7 (Dehority, 1991).

Therefore, the highly active plant polysancharide hydrolase gene can be extracted using recombinant DNA techniques. to induce microorganisms in the front shoulder and increase their plant fiber decomposition capacity. has great economic value. Crystalline cellulose and quincelain in the anterior shoulder environment Isolation of genes encoding highly active enzymes that degrade This is the key operation. celA and cel isolated from anterior shoulder anaerobes The D cDNA was used as a genetic material useful for transforming anterior shoulder bacteria. It has an advantage over other cellulase genes of origin other than the progeny.

Other possibilities for applying cellulase cDNA include cheap plant materials, e.g. For example, even lignocellulosic waste can be converted into commercially useful products such as ethanol, microorganisms for use in conversion to butanol, acetic acid, citric acid and antibiotics. It can also be used to transform industrial strains of plants. Recombinant cellulases are also used industrially. It can be used as a cellulase source for applications.

Industrial applications of recombinant cellulases celA and celD Cellulases are used in 16 important industries. It is one of the enzymes used for The current global market for these enzymes is 〉750 million. 10 million US dollars, with an annual growth rate of 5-10% by volume. Recombinant celD enzyme The availability of raw materials is as shown below.] In the beer brewing industry, beer It can be used to speed up the filtration rate of filters. Cellulase goes into wort and gels into beer It is added to break down β-glucan, which causes the formation of haze. This increases beer filtration speed.

2. To treat wastewater in the valve and paper industry, and the starch industry. use Enzymes can be added to wastewater recycling systems to remove cellulose residue from wastewater. Ru. Also used to facilitate drainage in paper manufacturing and newspaper deinking .

3. Can be used in food, medicine and cosmetics industries. Recent research has shown that partial Cellulose modified by enzymatic depolymerization is useful in these industrial products. It is known that

4 Other uses include clarifying fruit juices, processing vegetables, making bread, and preparing animal feed. may be used for manufacturing and research purposes.

Using celA and celD as genetic materials for improving the utilization of cellulose Used to modify commercially important microorganisms 1 to increase plant fiber digestion in sheep and cattle Modify forestomach bacteria for advancement.

2 Modify the bacteria (lactic acid bacteria) added to the silo to change the microbial content from cellulosic material It stimulates the conversion of protein into nutrients, increasing the nutritional value in the silo and feeding it to the animals.

3. Modifying nitrogen-fixing bacteria in compost or plant residue to decompose cellulosic materials is improved so that it can be used as energy to support the growth of nitrogen-fixing bacteria.

4. Ethanos such as Satsuri Romyces cerebinoeus and Zymomonas mobilis Le-producing bacteria have been modified to convert cellulosic materials such as agricultural waste into industrial ethanol. convert it into a tool.

The scope of the present invention also includes the following - (i) celA, celB, cel c, DNA sequences obtained from celD and celE cDNA clones.

(ii) Standard hybridization/yong method of Sambrock et al. (1989) (i) containing a DNA sequence capable of hybridizing to (i) using DNA sequence: (iii) ce IASce IB, ce Ic with the properties described herein , ce ID and celE enzymes.

(iv) cDNA of celA, celB, celc, celD and celE A polypeptide having a more derived amino acid sequence.

The present invention may include the following compositions: celA, celB, celc, celD or celE enzymes combinations or mixtures of two, three or four of these; and quinolanase, such as Neocallimastys noctricialumuca. In combination with recombinant xylanase derived from 1.

Plasmid pcNP4.1 in E. coli strain XL1-Blue has an interface National Depository Australian Garment Analytical °To Laboratories on June 22, 1992 with identification number N92/27543. I entrust it to you.

Plasmid pcNP1 is available from the International Depository Austra 1 Noah To Government Analytical Laboratories (June 22, 1993) Deposited under number N93/28000.

The term "essentially" is used herein to refer to the arrays 70 to 70 shown in FIGS. It means having 100% homology. Also known as “Noh Ibridize” (In this case, the standard nucleic acid disclosed by Sambrock et al. (1989) Refers to the Eve 1 Nodai Zenyon method.

References.

BAUCIIOP, T., 1981, “For fiber digestion in the front shoulder. "Anaerobes", Agriculture and Environment, 339-3 48 BUGtlIN, P., 1990, “Molecules of cellulose decomposition” Biology”, Annual Review of Microbiology 44.219~ 248 BERGER, E, JONES, V, ^ ), JONES, D.

■) and Woods (foODs, D, R,) 1989. Closing of the endoglucanase (endo I) gene from C. fibrisolvens H17c. Loning and Sequencing”, Molecular and General Genetics 219.193-198 Kahiki t’J (CAVICCHIOLl, R,) (WATSON, K,) 1991, “Fibrobacter ・Molecular cloning of endoglucanase gene from Schunnogens RL , Expression and Analysis”, Applied and Environmental Microbiology Ology 57.359-365 Dehority (DEL (ORrTY, B^,) 1991, “Cells in the front shoulder "Lose Degradation" - Biosynthesis and Biological Degradation of Cellulose - edited by Hegler and Weimer Collection, pp. 327-351, Niney York, Marcel Detsker.

DESRPANDE et al. 1988 Methods in Enzomoro G-160, pp. 126-130.

Ergoryoku IJ- (EL-GOGARY, S), Lz’y (LEITE, A ,),'7') 5 o (CRIVELLARo.

0), EVELEIGB, D, E,)! :z Rudolly (EL-D ORRY, +1. ) 1989, ``Cellulose is sequestered by Trichoderma reesei''. ``Mechanisms that trigger expression of the Robiohydrolase I gene'', Pronodi National Academy of Sciences of the United Nations Ted Stein of America 86.6138-61410 Flint (F LINT, H, J), McPherson (McPl(ER3ON, C, A, ) and Bisset (J.) 1989, “Xylanase and β Ruminococcus fra encoding (1,3-11,4-)glucanase activity "Molecular Cloning of Genes from Befunens", Applied & Eng. Biological microbiology 55.1230-1233° Flint, McPherson and Martin (MARTIN, J.) 1991 , “obtained from the anterior shoulder cellulose-degrading bacterium, Ruminococcus flavifaenoens 17, "Expression of two xylanase genes cloned into pUc13", Journal ・Of General Microbiology 137.123-129゜Hong (FOOIIIG, E,), ha? Moto (RAIIAJIOTO, Ding,), n a Sei jr 7 (SHO3EYOV) O and Toy (001, R, H,) 19 1991, ``Endoglucanase gene from Clostridium cellulovorans. “Nucleic acid sequence and properties of engB”, Journal of General Microbiology 137, F29~l736゜GILBERT, B, J, ), Hazelurado (■^ZLEfOOD, G, P,), Laurie (LAURI E, J, L,), ORPIN (C, G,) and Que (XI,’ E, G, P,) 1992, [Preanaerobic bacterium, Neocallimastyscus pato Quinolanase A from Rhinoarum has two homologous catalytic domains. ” , Molecular Biology 6 (15).

2065~2072° GILKES (N, R,), Henrissat (IIENRI approved ^T, B,), Kill I〈-n (nirLBURN, D, G,), MILLER , R, C, JR, ), WARREN (R, A, J, ) 1991 , [Domains, sequence changes, functions and functions in microbial β-1,4 glucanases] Microbiological Review 55.303-3 15゜Gilkes, Warren, Miller and Kilburn 1988, “The Two Cellulos” A homologous protein with a cellulose-binding domain from Monas fuimicellulase. Influence on precise excision and catalysis by enzymes. ”, The Journal O B) Kuiological Chemistry 263.10401-10407゜Gomez ・De Ngu 5- (GOMEZ DE 5EGURA) and Feeple (FεV RE, M.) 1991, “Details from Neocallimastix frontalis” Cell wall hydrolases, production and regulation”, 4th International Mycological Conference ・Combres, 185゜GOYAL (GOYAL, ^), Gongyu (GO5H, B, ) Oyobi Eheleik (EVELEIGIl, D,) 1991, “Bacteria Cell ``Properties of Lase'', Biologies Technology 36. 37-50゜Hazeruura D, DAVIDSON (F, ), Lori, Romanietsk ( ROM^NlEC, M, P, M,) and Gilbert 1990. cel encoding endoglucanase of L. fibrisolvens strain^46 Cloning and sequencing of the A gene. ”, Journal of Fenechil Mai Crobiology 136.2089-2097゜Howard and White 1988 , “Ruminococcus alps into Enoerina corybacteriophage 8 Molecular cloning and expression of cellulase genes obtained from.

”, Applied and Environmental Microbiology 54.1 752~1755° Lake (LAKE, B, D,) and Goodwin (GOODfIN, 11.J) , ) 1976, "Lipids" - Chromatography and Electrophoresis - Volume 1, No. 4 Edition No. 345-366. Smith and the Seventh Engineer - Edited by Kins, Bath The Pitman Press Lever (LEvER, M,) 1972, Analytical Biochemistry Tree 47.273~279° Lee (Ll, X) and Claza (R, E,) 1991, Frac of cellulase from the fungus Neocallimastix frontalis EB188 Applied and Environmental Microbiology 57.3331~3336゜MEINKE, ^, Gilkes, Kiruba John, Miller and Bullen 1991, “Diversity in Endoglucanase B” 'Domain', Journal of Bacterology 173.7126-7135 ゜ Messner (MESSNER, R,) and KUBICEK (C,P) ,) "Adjustment of carbon sources in the formation of cellobiohydrolases I and II", App. Ride and Environmental Microbiology 57.630-6 35゜Orpin and Pan (MUNN, E, A,) 1986 Socus Patrinalm sp, nov,; a new creature that lives in a sheep device and plays 1 Neocallimastichus”, Transacnoyons of the Prittinyu Mycoloncal Society 86.178~180° Robson (ROBSON, L, M,) and + +') Varnish (CIIAilBL ISS, G, II,) 1989, “Cellulase derived from r-thin m”, Enzai M & Micro Vial Technology 11.626-644° ROMANTEC, M, P, Davidson, White, Goby Ruunod 1989, “Endo-β-1,4-glue of Ruminococcus alpine "Cloning of canase and xylanase genes", Letters in Apra. Ido bacteriolon-9,101~104° SAARLILAHTI (+1.7.), Anrisat (fl ENRIssAT, B,) and Barba (PALV^, E, T,) 199 Year 0, rcels: isolated from Erwinia carotovora subsub carotovora Gene 90.9-14° Sunblock (SAM) BROOK, J,), FRITS [1, E, F,), Maniati M^NIATIS, T)r Molecular Cloning: Laboratory Manual Al, 2nd Edition, Cold Spring Harbor Laboratory, New York. -・Press.

SAUL (D, J,), YILLIAMS, L , C,), Greening (GRYLIIIG, R, A,), Chi + L Ray (CHA MLEY, L, W,), Love (LOvE, D, R,), Verbquist (B ERGQUIST, P.L.) 1990, rcelB, an extremely thermophilic gene encoding a bifunctional cellulase of ``Rudocerum sanorolyticum'', a. Pride and Environmental Microbiology 56.3117 ~3124 Tsuyuwaltz (SCHfARZ, 1.H,), Schmming (SCHI IIMING, S.) and STAUDENBAUER , f, L.) 1987, “Cellulase genetics of Clostridium thermocellum. ``High level expression in E. coli of offspring'', Applied Microbiology. ology and biotechnology 27.50~56° TABO R, S.) and Richardson (RICIIAIIDSON, C.) 1987 , “DNA Sequence Using Modified Bacteriophage T7 DNA Polymerase 'Analysis', Pronordinges of the National Academy of Sci. Enth of United Stain of America 84.4767~ 4771° Tiller (TAYLOR, K^,), Crosby (CRO3BY, B), McGAVIN.

M), FORSBERG (C, f, ) and Thomas (T HOMAS, D., Y.) 1987. Encoded by the cel gene from the Cteroides succii sequence. “Properties of Doglucanase”, Applied and Environmental Micro. Biology 53.41~46° TEATHER (R, M,) and U In 1982, ``Measurement and measurement of cellulase-soluble bacteria obtained from Uno's apparatus.'' Use of Congo Red-Polysaccharide Interactions in Biochemistry and Analysis. ”, app Ride and Environmental Microbiological Mouth') -43,777~ 780° Tom (TOMME, P,), i<n TILBE (vAll TILBE) URGR, H,), Hedarin (PETTERSSON, G,), Pan Tam , ) A (VAM DAMME, J, ), Bump Kirkhope (VAND EKERCICIIOVE, J,), Knowles (KNOfLES, J,), TEERl, T, and CLAEYSSENS M.) 1988, “Cellulose dissolution system of Trichoderma resei QM9414 'Study of 'European Journal Biochemistry 170.575-5 81゜Pan Tilbeurg, Tom, Claesens, BHIKHA BIIAl, R,) and Pederlin (PETTERSSON, G,) 19 In 1986, ``Limited version of cellobiohydrolase obtained from Trichoderma reesei'' Protein Decomposition”, Fubinis Letters 204.223-227゜ Williams, and Olbin 1987, “Growing on a Range of Hydrocarbon Substrates” "Polysancharide-degrading enzymes produced in three types of anaerobic apparatus fungi", Canadaia Journal of Microbiology 33.418-426゜Wood, McCrae (McCRAE, S, 1.), Wilson (fILsON, C, A,), part (B[I^T, ni, M,) and bow (Got, LA) ( (1988). “Biochemistry and Genetics of Cellulose Degradation”, edited by Oberth, Belgium -, B and Miresoto, Noei pp. 31-52, Academic Press, mouth. 〉ton.

Que (XIIE, G, P,) and Morris (MORRrS, R,) 1992, "During the growth of mouse Birkingje cells, the glycoprotein Th on the surface of nerve cells Expression of y-1 does not follow the appearance of its mRNA. J1 Journal O Neurochemistry 58.430-440° Que, Orpin, Gobius (GOBIUS, K, S,), Aylward (^Y LWARD, J, H,) and SIMPSON, G, D,) 1 992, “Different cells of the anaerobic prophylaxis Neocallimastys butlinarum. Cloning and expression of the Enoelina coli cDNA. ",jar Null of Fenethyl Microbiology (in press).

YAGUE, E., Beguin and Oberth 1990, “Cell Clostridium thermocellum cellulase encoding cellulase Liquid acid sequence and deletion analysis of the cell gene. ”, Gene 89.61-67゜Table 1 Activity of cloned cellulase against various substrates celA celB cel c celD celE Cellulose 466 54 21 4929 1256 Apicel 196 1.4'0.9 179 50 amorphous + o-rus 187 4 6.2 20 812 ND Quinolane 0 0 0 466 124 Rikena ノ 136000 ND ND 14312 NDpNPG 0 0 0 0 0 pNPCO1, 3016980 MUG ND ND ND OND "Method" by preparing MUG ND Nll ND 944 150 crude cell lysate It was used to measure enzyme activity as described in . The given values are small (all three The r+mol product (released reducing sugars or p-nitrophs) phenol)min-'(tag protein)-1.

Table 2 Effects of celA and celD enzymes on the hydrolysis rate of natural plant materials and relative rate of hydrolysis Control 0056 pNX-tac xylanase 1.07CelA and Ce1D enzymes The rate of hydrolysis of plant fibers and the production of reducing sugars were calculated using the method of Lever (1972). It was measured by assay. Hydrolysis reaction was carried out using Setulia stems at 40℃ for 2 days. In time, an in vivo digestibility of 64.7% was achieved.

elE (ρCNP5) 1:　0EKI’　EK　OEK　X Fig, 1. Restriction enzyme map of Ce1D and CalE 8BCABC Fig. 3. Three types of cellulase cDNA insertions by Southern Bount analysis O-subhybridization celA (A), celB (B) and cel The plasmid containing c(C) was incubated with EcoRl and XhoI (cDNA clone). cutting tube) and fractionated on a 7-gallose gel 1% (W/V).

Guioxygenin-labeled RNA generated from 3'-region deletion cDNA or O-on ceIA’ probe used for hybridization, left plot; cel c'p-o-b, right b-o-b. Large arrow indicates hybridized cDNA insert Show that. The band indicated by the small arrow indicates that the RNA probe is located from the vector. It is a hybridized or O-ning vector because it contains part of the column. . The numbers in the margin indicate the size of the molecular marker (BStEII piece of λDNA) in kb. shows.

Fig. 4 Congo-specific celD enzyme activity towards lichenan and laminarin Red staining assay. 2ul of crude enzyme extract is described in "Methods" The cells were then inserted into an agarose plate containing Rinaken or Laminarin. I put it in the well. After incubating for 2 hours at 39°C, stain with Congo red. It was colored.

Substrate hydrolysis is indicated by a yellow beam on a red background around the well.

Fig. 5. Product fraction of cellulose compounds hydrolyzed by celD enzyme Analysis.

(a) crude cell susate was prepared from E. coli anchored plasmid pcNP4.1; Spinner using Centricon-10 tubes (7 microns) for low molecular weight compounds It was removed by iris. Add this enzyme preparation to cellodextrin: (cellotriol) (G3), cellotetraose (G4) and cellopentaose (G,) gml-’) or 1% (W/V) Avicel (C) as described in Methods. Incubated thoroughly. Describe the intermediate products of partial hydrolysis of cellodextrin. This is shown to help you understand. The hydrolysis products are shown on the TLC plate by their Rf values. did. Standard cellodextrin (S) is on the right, glucose (G1), cellobiol (G,), G, and G4 are shown, respectively. (b) For cellotetraose Description of the catalytic mode of the celD enzyme.

Product analysis. (a) Crude cell sate was transformed into a recombinant plasmid (celA%celB and Centricon-10 tubes (7 mm) Small molecules were removed by spin-dialysis using (Con). enzyme preparation cellodextrin (2mf genus J-1), cellotriose (Gs), cellotetra ose (G4) and seropentaose (G, ) or 1% (w/v) 7 Bicell (C) as described in Methods. product was fixed by TLC. Complete hydrolysis of cellodextrin by celA enzyme Figure 2 shows the solution and partial hydrolysis by celB and celc enzymes. standard Lodextrin (S) is shown on the far right. (b) Three types for cellotetraose Description of the catalytic mode of the cloned enzyme.

pH H Flg, 7 Effect of pH on the activity of recombinant cellulase Cellulase assay 50mM citric acid containing 1% 7 Bicell! T! in Na salt (pH 4-7) or 25 mkl Lithium C11 40'C1 in 50mM NaCl (pH 7,5-9,5) I went for 22 hours.

Temperature [”C] Temperature [”C] I went there for 22 hours.

pH5・-1-・; pH6-〇- Waiting time Between lg and 9. Time course of cellulase hydrolysis by cloned calA enzyme. Cellulase was incubated at 39°C in 50mM Na citrate (pH 6,0) containing cells. Hydrolysis was performed. celA enzyme (+12+1) was reacted with a final volume of 500+f. Added to things.

F　ig,　10　Process of cellulase hydrolysis by turned-on celD enzyme 1 Cellular cells were grown at 39°C in 50mM Na citrate (pH 6,0) containing 7% Bicelle. hydrolysis of the enzyme was carried out. celD enzyme (1-+2p1) to a final volume of 500+A ’ was added to the reaction mixture.

O 2.5μm 6.0μ+ 25#L+ 2-5μm 25μm each each enzyme Phenotype 7 Bicell, CB゛cellulose binding.

4081　M cough v＾AntAACTCGAG3.9Kb (Capital) β-galactosigase α-peptide N-terminal 3597 Minoshun Catalyst Cellular a catalytic domain (containing only endoglucanases from bacteria) Separating each of the serine, threonine, and protein O-phosphorus-rich linker sequence m’M’T? Kidney 7jkXXVnA’Cu=”)”Dl”H4F,”2tLt: UN(D:Jk* indicates limited identity with the terminal domain.

’--AT-rich 3° untranslated sequence and transcribed into poly-minator Figur e14. Neocallimastyscus batholinoflume celD nucleotide sequence Characteristics of e@LD domL/2 translated sequence sequence ffi! ! 11mm o 24 00 Figure153゜ ceLD city m112 translated sequence FigureIsco.

ceLD6-12 translated sequence Figure 15*.

ceLD戊eL　/　2 translated sequence Figure 15; a.

cwlDam112 translated sequence Array range 1 tQ 14) 7 Figure 15b.

FiHurc 1513 C DingGTCCGTCAACAAAGAGAGAACTTCTCGTCADing＾DingDingA CTGTCrCAGATCAC’rTTkAGGAADING S V RQ Q K RT S G M X T V S D HF K EGGGCCAAAGAA GCTr to GGTATTCG'TAACCTTTrAdingcAAGTrcCTTr GA^CGCCGAAGGrTWAKQ to tJGIcNLYEVALNAE to G GCAAA(:TACTGTGTTGCTGAdingGTCACCrTATTAG AτGTTTACAACAACTCCAAAGGGτding%4QSSCVADVTL LDVYTTP) CG6917 denatured xylanase cDNA in pNX-Tac International Sequence Search Report 1--186 PCT/AU931011307 1---1w-self-N.

International investigation report FCr/AU53 hearts! Fo+mPCT/L3&? l0(-Ilsan aemahcc+Xjuly1mlce Continuation of p17+h front page (51) Int, C1,6 identification symbol Internal office reference number Cl2N 9/42 8 827-4B //(C12N 15109 ZNA C12R1:01) (C12N 1/21 C12R1:19) (C12N 9/42 C12R1:19) (81) Specified times EP (AT, BE, CH, DE.

DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE) , 0A (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN.

TD, TG), AT, AU, BB, BG, BR, BY.

CA, CH, CZ, DE, DK, ES, FI, GB, HU, JP, KP, KR, KZ, LK, LU, MG, MN, MW, NL, NO, NZ, PL, PT, R O, R.U.

SD, SE, SK, UA, US, VN I C12R1:01) (72) Inventor Olpin, Colin George UK, Sea and -24 Nisef , 12 Petersfield Road, Duxford, Cambridge (72) Inventor Aylward, James Harrison Commonwealth of Australia 40 67 Queensland, Brisbane, St Lucia, Carmody Road 6am (72) Inventor: Gobius, Kari Stevens Commonwealth of Australia 4076 346 Waterford Road, Wacoal, Eensland, Brisbane number

Claims (37)

[Claims] 1. The following steps: (i) Culture of anaerobic forestomach fungi; (ii) isolating total RNA from the culture in step (i); (iii) (ii) obtaining polyA mRNA from total RNA; (iv) generating cDNA; constructing the current library; (v) λZAP, λZAPII or similar cDNA into a bacteriophage expression vector selected from vectors with high quality. Step of linking group A; (vi) cells by detecting cellulase hydrolyzate Techniques for screening cellulase-positive recombinant clones in a medium containing cellulase and (vii) purifying cellulase-positive recombinant clones. A method for cloning cellulase clones from anaerobic proventriculus fungi. 2. The method according to claim 1, wherein the expression vector is λZAPII. 3. Detection of oxygen hydrolysis using a color indicator, Congo Red. 2. The method according to claim 1, wherein the method is carried out by: 4. After producing a cellulase-positive clone, assist in inserting cDNA into this clone. The method according to claim 1, wherein the pBluescript SK(-) is excised using a phage. Law. 5. 5. The method of claim 4, wherein the auxiliary phage is R408 auxiliary phage. 6. A cellulase-positive recombinant clone produced by the method of claim 1. 7. N. Biologically active cells in E. coli derived from Patriciarum A recombinant cellulase clone containing cDNA having the property of producing lulase. 8. Australian Government Analytical Laboratories 1 E. coli strain X deposited on June 22, 992 under accession number N92/27543 Recombinant cellulase clone pCNP4.1 in L1-Blue. 9. 13 containing a DNA sequence that can hybridize thereto. A DNA sequence essentially corresponding to the amazing pCNP4.1 cellulase cDNA nce. 10. Essentially the amino acid sequence of pCNP4.1 cellulase as shown in Figure 15. containing polypeptides. 11. A cellulase produced from the recombinant cellulase clone of claim 6. 12. A cellulase produced from the recombinant cellulase clone of claim 7. 13. E. coli host cells contain crystalline and amorphous cellulose and other cel produced from recombinant cellulase cDNA constructs with cellulose substrates A enzyme. 14. as endoglucanases, cellobiohydrolases and xylanases The celD enzyme is a multifunctional cellulase with activity. 15. Expression of polypeptides with cellulase activity in suitable expression hosts 10. A DNA sequence according to claim 9 operably linked to a region of regularity that can be directed. DNA structure containing columns. 16. Expressing a fungal cellulase comprising the cellulase structure of claim 15. transformed microbial host. 17. Cellulase activity produced by expression using the symptomatic organism host of claim 16. A polypeptide having 18. A polypeptide comprising an amino acid sequence derived from the polypeptide of claim 17 Do. 19. Australian Government Analysis 22 June 1993 E. coli X deposited with Cal Laboratories under accession number N93/28000. Plasmid pCNP1 contained in L1-Blue. 20. Isolated cDNA Encoding a Functional Neocallimasteix Cellulase Child. 21. Encoding the sensuality Neocalimastatus patriciarum cellulase An isolated cDNA molecule. 22. Directing the expression of a polypeptide with cellulase activity in a suitable host Contains the celA cDNA operably linked to a regular region that can be DNA structure. 23. Endoglucanase, cellobiohydrolase, and xylanase activities c that can be cleaved into codes for three catalytically active domains, each having clD cDNA. 24. shown in Figure 2 containing the cellulase cDNA that hybridizes to it. ce1A cDNA with restriction map. 25. shown in Figure 2 containing the cellulase cDNA hybridized to it. cclB cDNA with a restriction map of 26. shown in Figure 2 containing the cellulase cDNA hybridized to it. celC cDNA with a restriction map of 27. shown in Figure 1 containing the cellulase cDNA hybridized to it. celD cDNA with a restriction map of 28. shown in Figure 1 containing the cellulase cDNA hybridized to it. celE cDNA with a restriction map of 29. Deletion mutant strain of celD cDNA with the restriction map shown in Figure 12 . 30. (i) Crystalline and amorphous cellulose and Produced from recombinant cellulase clones with activity on cellulose and other cellulose substrates celA oxygen; and (ii) endoglucanase, cellobiohydrolase, and xylanase activities is cleaved into codes for three catalytically active domains, each with celD enzyme An enzyme composition comprising. 31. N. in E.C. Recombinant cellulase derived from Patriciarum and - N. in Cori. Combination with recombinant xylanase derived from Patriciarum Let me. 32. (i) Crystalline and amorphous cellulose and Produced from recombinant cellulase clones with activity on cellulose and other cellulose substrates ce1A oxygen; (ii) endoglucanase, cellobiohydrolase, and xylanase activities is cleaved into codes for three catalytically active domains, each with celD enzyme; and (iii) Coated essentially by pNX Tac as shown in Figures 16 and 17. encoded xylanase enzyme An enzyme composition comprising. 33. (i) Endoglucanases, cellobiohydrolases, and xylanases The code is cleaved into three catalytically active domains, each with its own activity. a celD enzyme that can be used; and (ii) coded essentially by pNX Tac as shown in Figures 16 and 17; xylanase enzyme An enzyme composition comprising. 34. (i) Crystalline and amorphous cellulose contained in E. coli host cells and Manufactured from recombinant cellulase clones with activity on other cellulose substrates. celA enzyme; and (ii) coded essentially by pNX Tac as shown in Figures 16 and 17; xylanase enzyme An enzyme composition comprising. 35. A polypeptide derived from the cellD cDNA of claim 23. 36. A polypeptide derived from the celA cDNA of claim 24. 37. A polypeptide derived from the oelD cDNA of claim 27.