CA2095013A1 - Rat thyrotropin receptor gene and uses thereof - Google Patents

Abstract

The rat thyrotropin receptor gene was cloned and expressed. The nucleotide sequence and the substantially pure product expressed therefrom, and parts thereof, are useful in detecting molecules and ligands bindable thereto.

Description

W092/08726 P~T/US90/0~33 , 2~501~

RAT THYROTROPIN RECEPTOR GENE AND USES THEREOF
'' 1 The invention described and claimed herein was supported in 2 part by the Department of Health and Human Services, National 3 Institutes of Health.

The invention relates to a substantially pure nucleotide 6 seguence that encodes the thyrotropin receptor; medicamenta and 7 therapeutic compo~iitioniY comprising ~aid 3equence or the receptor 8 expressed therefrom; me~hods of detecting ligand~i or molecules 9 that bind to said sequence or to said receptor; and therapeutic methods of detecting ligands or molecules that bind to said 11 seguence or to said receptor.
, '' 13 Thyrotropin, or thyroid stimulating hormone (TSH), is a 14 pituitary hormone that regulates the development and activity of the thyroid gland. The thyroid secretes two principle iodine-16 containing hormones, T3 (also known as triiodothyronine) and T4 17 (also known as thyroxine), which, among other roles, regulate 18 basal metabolism. Secretion of T3 and T~ is in turn regulated by 19 TSH.
As with other glycoprotein hormones, TSH is bound at the 21 surface of hormone-responsive cells, for example the epithelial ~
;
:

W092/0~726 PCT/US90/06533 2~9~13 -2- ~
1 follicular cells, by a speciflc integral membrane receptor.
2 Activated receptOrS stimulate and regulate adenylate cyclase 3 through G proteinS, such as GS and Gl, and the cAMP signal 4 regulates the eXpression of a variety of downstream genes and effector functions, such as the breakdown of colloid to mobilize 6 stored ~ and T~ as well as the active synthesis of T3 and T~
7 Clinical correlates of abnormal binding of TSH to its 8 specific receptor may be manifest in a variety of syndromes. For 9 example, hypothyroidism or myxedema can result from a TSH
receptor that is unable to bind TSH, or if binding with TSH
11 occurs, the abnormal recepkor cannot send an appropriate message 12 to influence adenylate cyclase activity. Alternatively, 13 expr~ssion of the receptor may be down-regulated, thereby 14 producing a hypothyroid state, such as during oncogene tran~formation. Another example is hyperthyroidism. A common 16 form of hyperthyroidism is Graves Disease wherein antibodies 17 that react with the TSH receptor mimic TSH and activate the 18 receptor thereby resulting in a tonic up-regulation of thyroid 19 function.
The in situ structure of the thyrotropin receptor remains 21 unclear because of a multiplicity of proteins which appear to 22 interact with TSH. Studies using nondenaturing conditions have 23 identified TSH-binding thyroid proteins or protein complexes with 24 estimated molecular weights of about 500, 300 and lSO kd whereas studies using denaturing conditions, such as with sodium dodecyl 26 sulfate gel electrophoresis, have identified 50-70, 30-45 and 27 15-25 kd components. The latter studies resulted in a postulated 28 TSH receptor structure composed o~ 2 or 3 subunits.

. ::
. .

W092/0~726 3 2~P ~ T/US90/~6533 1 Akami~u et al. identified two proteins that interact with 2 thyrotropin, revealed by virtue of their TSH-dependent binding 3 to TS~-Sepharose. The two proteins, of 43 kd and 70 kd molecular 4 weight. were found to be ~-actin and a member of the hsp70 family, respectively. Biochem Biophys Res Comm 170:351-358 6 (1990).
7 Pure sources of the receptor are unavailable, primarily 8 because of the extraordinarily small number of receptors on 9 thyroid cells. Attempts to use TSH receptor antibodies to purify the receptor have been unsuccessful.
11 Thyrotropin receptor genes have been cloned in two species, 12 dog and human. Parmentiex et al. cloned the dog gene using 13 degenerate oligonucleo~idas, corresponding to conserved regions 14 in the transmembrane segment of known receptors that interact with G proteins, in the polymerase chain reaction. That procedure 16 first yielded a receptor-related clone (probably not TSH
17 receptor) which itself was used to probe a thyroid cDNA library.
18 That screen yielded a putative TSH receptor clone. Science 19 246:1620-1622 (1989).
Nagayama et al. were unsuccessful ln cloni~g a rat gene 21 using oligonucleotide probes corresponding to the rat LH/hCG (LH
22 is luteinizing hormone and hCG is human chorionic gonadotrophin, 23 other glycoprotein hormones) receptor sequence. Those authors 24 then used the same strategy of Parmentier et al. employing transmembrane domain-related oligonucleotides to obtain clones 26 of the human gene. Transfectants showed increased levels of cAMP
27 upon exposure to TSH but not in reponse to hCG, ACTH or insulin 28 exposure. Biochem Biophys Res Comm 165:1184-1190 (1989).

- , ~

W092/08726 ~ PCT/US90/06533 2 ~ 9 ~ 4_ ~
1 Libert et al. used a clone containing the complete coding .:. .
2 sequence of the dog TSH receptor gene to screen a human cDNA
3 bank. They obtained a full length clone and expression thereof 4 in transfected CoS cells. Biochem Biophys Res Comm 165:1250-.
1255 (1989).
6 Misrahi et al. also cloned the human gene. Those authors 7 screened a cDN~ library with a full length porcine LH/hCG
8 receptor cDNA because of a structural similarity between LH and 9 TSH. Biochem Biophys Res Comm 166:394-403 ~1990).
A more favorable starting point for elucidating the 11 structure and function of the thyrotropin receptor would be to 12 study the receptor of a utile animal model. The FRTL-5 rat 13 thyroid cell line has become a widely used in vitro model of a 14 normal, functioning endocrine cell. The growth and function of FRTL-5 cells depend on thyrotropin. The cells can be used to 16 measure and study the action of antibodies in patients with 17 autoimmune thyroid disease. Thus, defining the structure of the 18 rat TSH receptor and its function in the growth and properties 19 of FRTL-5 cells is critically important to a multiplicity of research and clinical programs.

':
22 A first object of the instant invention is to provide 23 substantially pure nucleotide ~equences encoding a ' rat 24 thyrotropin receptor gene, and portions thereof.
A second object of the instant invention is to provide the 26 substantially pure polypeptide product produced therefrom, and '~

W092/08726 PCT/US90/06;33 ~ ~5~ ~9~013 1 portion~ thereof.
2 A third object of the ingtant invention i~ to provide 3 medicamant~ and therapeutic compoYitions comprisins said 4 nucleotide sequences, or portions thereof. or said product, or portion~ thereof, produced therefrom.
6 A fourth object of the instant invention i8 to provide 7 assays employing said sequences, or portions thereof, for 8 detecting nucleic acids hybridizable thereto.
9 A fifth object of the instant invention is to provide assays employing said product, or portions thereof, for detecting 11 ligands bindable thereto.
12 A sixth object of the instant invention is to provide uses 13 of said ~equences or of said products in the treatment and 14 management of disorders that arise from dysfunction of the receptor.
16 A seventh object of the instant invention is to provide a 17 means of making antibodie~ to the thyrotropin receptor nucleotide 18 sequence and product produced therefrom. ' 19 These and other objects have been achieved by the successful cloning and expression of a rat thyrotropin receptor gene.

22 Figure 1 depicts the nucleotide and amino acid sequence of 23 a rat thyrotropin receptor and flanking noncoding sequences.
24 Potential glycosylation sites are underlined and are referred to in consecutive order with the amino terminal-most site denoted 26 as I. A potential phosphorylation site is denoted with the W09~/0~726 PCT/US90/~6533 ~ Vl~ -6- ~
1 underscored dashed line. TMl-TM7 denote hydrophobic regions of 2 the transmembrane domain. Wavy lines indicate approximate 3 endpoints of the probe u~ed for the inltial -~creen of the cDNA
4 bank.
Figure 2 presents at the top, a schematic drawing of the 6 receptor. MET represents the signal peptide region. The 7 highlighted region between amino acid re~idues 300 and 400 8 represents the peptide not found in the LH/hCG recptor. Roman 9 numerals represent putative glycosylation sites.
Below the schematic drawing and to the left are R series of 11 bars drawn to scale with the schematic drawing depicting the 12 extent of the deletion in the extracellular domain of the 13 mutants. The mutants maintained a normal transmembrane domain.
14 Numbers above the bars represent the first and last amino acids deleted. Below the schematic drawing and to the right is a table 16 of data relating to the deletion mutants, that are identified in 17 the first column. TSH binding and cAMP response were determined 18 as described herein.

;""' In order to clone the rat gene, a cDNA library was 21 con~tructed using the FRTL-S rat thyroid cell line as the source .,~,.:.. ~;....
22 of RNA. After clones were obtained, the recombinant receptor was 23 expressed and critical regions thereof were identified.
24 The FRTL-5 cell line (Which is available publicly from the ATCC under accession number CRL 8305 and was deposited in 26 relation to Ambesi-Impiombato, U.S. Pat. No. 4,608,341 and Kohn ., - ~ ~. .

, ~ ~7~ 2~
1 et al., U.S. Pat. No. 4,609,622) was derived from thyroid of 2 normal Fischer rats. The cell~ were maintained in culture a~
3 de~cribed in U.S. Pat. No. 4,609,622. Briefly, the cells were 4 cultured in Coon s modified Ham s F-12 medium supp1emented with calf serum, TSH, insulin and variou~ other optional hormones.
6 The cells were incubated in a C02 environment at physiologic 7 temperatures. The epithelioid cells grew attached to the 8 cultureware surface, had a doubling time of 1-2 days and were 9 passed biweekly with a split ratio of between 5 to 1~. -Templates of cDNA were synthesized using 5 ~g of rat testis 11 poly(A) RNA (Clontech), murine reverse transcriptase (Pharmacia) 12 and Pharmacia s protocol. A 286 base pair (bp) cDNA fragment .. .
13 comprising transmembrane domains was amplified with Thermus 14 aquaticu~ DNA polymerase and 25 pmol of each of two 30-mer oligonucleotide primers complementary to sites flanking the 16 region to be amplified and hybridizable to alternative strands.
17 Mulli~ et al., U.S. Pat. Nos. 4,683,195 and 4,800,159; Mullis, 18 U.S. Pat. No. 4,683,202. Oligomer A has the sequence (5 -19 GGGCTCTACCTGCTGCTCATTGCCTCCGTG~3 ) and oligomer B has the sequence (5 -CCCACAAGGGGCATCGTGGCGATCAGCG-3 ). Each cycle 21 compri~ed 1 minute at 94C for denaturation, 2 minutes at 55C
22 for hybridization and 3 minutes at 72C for extension The 23 amplified fragment was purified from 3% low melting agarose.
24 An FRTL-5 cDNA library waq constructed in ~gtll (Clontech), with mRNA obtained using standard procedures from ceLl~
26 maintained for 7 days in the absence of TSH. Plaques were 27 ~creened u~ing the LH/hCG receptor transmembrane domain-derived 28 cDNA fragment described above, which was labelled by random .

,.,, ,~ .. ...... . . . . . . . .. . . . .

W092/087~6 ~ PCT/US90/06~33 ~ V 1~ -8-1 priming. The initial screen was under low stringency conditions 2 (55C). Positive plaques were isolated, grown and rescreened 3 with the same cDNA fragment probe. The inserts of plaque-4 purified clones were subcloned into the EcoRI site of either pGEM-42 or 7Z (Promega) using gtandard methodologies. DNA
6 sequencing was by the dideoxy chain termination method.
7 The full length rat thyrotropin receptor sequence encodes 8 a protein of 764 amino acids with an estimated molecular weight 9 of about 87,000, as shown in Figure 1. (The sequence was deposited in the GenBank data base on 15 September 1990 and has 11 accession number M34842. It should be noted that in the coding 12 seguence, as noted in Figure 1 wherein the adenine of the ATG
13 codon for the first me~hionine of the extracellular domain is 14 considered nucleotide 1, the codon for the seventh leucine residue at nucleotides 55-57 is CTG. The GenBank sequence lists 16 that codon as CTC, also a leucine codon.) The predicted protein 17 has a 21-23 residue hydrophobic region at its M-terminus which 18 is a signal peptide. Akamizu et al., Biochem Biophys Res Comm 19 169:947-952 (lg90~. There is a long extracellular domain comprising at least five N-linked glycosylation sites and a 21 transmembrane region with seven hydrophobic domains.
22 After transfection into non-thyroid-derived cells, said 23 cells expressed a TSH-sensitive adenylate cyclase response and 24 the ability to bind labelled TSH. The activities were speciflc for TSH, LH did not stimulate an adenylate cyclase response nor . .
26 was LH bound by the transfectants. `~-27 In Northern blots of FRTL-5 mRNA, two species of message 28 were noted. Cells exposed to TSH exhibited decreased levels of ~ `
'~!' .

.' ;.
~';~'..
~'' ''"'"' W092/08726 2 ~ ~ ~ O 1 3 PCT/US90tO6;33 ~ 9_ 1 both specieq of message and the amount of mes~age was dependent ~ on TSH concentration. A similar down-regulation of the two mRNA
3 species was noted when cells were treated with forskolin, cholera 4 toxin or 8-bromo-cAMP, but no change was noted when the cells were treated with a phorbol ester. Down-re~ulation also occurred 6 when cells were exposed to thyroid-stimulating antibodies, which 7 also increased cAMP levels. Exposure to antibodies that inhibit 8 TSH binding to the receptor increased TSH receptor mRNA levels.
9 Insulin, calf serum and insulin-like growth factor I up-regulated TSH receptor expression. These observations may 11 account for the success of the cloning described herein because 12 RNA was obtained from cells maintained in medium containing 13 in~ulin and calf serum but no TSH.
14 The clone and the receptor protein produced therefrom find utility in a variety of circumstances. For example, the 16 recombinant receptor can be used in assays for detecting ligands 17 capable of binding the receptor. Suitable ligands include 18 thyrotropin and anti-receptor antibodies.
19 Thus, recombinant receptor can be attached to a solid pha~e support, such as the wells of a microtiter plate, plastic beads, 21 dip sticks, membranes and the like. Many such supports have a 22 natural affinity for proteins so attachment of the receptor 23 thereto is accomplished by merely exposing the support to an 24 aqueous solution comprising the receptor. Physiologic saline, tissue culture medium, buffers and the like are suitable fluid 26 vehicles for preparing the aqueous solution. Attachment of the 27 receptor to the support can be enhanced if the 1uid phase is a 28 buffered solution with a pH of about 9. If mere exposure is ::,.

,, :' ' ' , ' ~ .' . ' ~ .

W092t0~726 PCTJUS90/06S33 -10~
1 inadequate f~a~ m~ent, art-recognized attachment agents can be ~3ed- Suitable agents include glutaraldehyde. poly-L-ly~ine 3 and des~ication.
4 After an incubation period to assure attachment, the support is washed liberally. Optionally, non-specific sites on the 6 support are blocked with a non-cross-reactive carrier protein, 7 such as albumin or gelatin, or with a protein laden mixture, such 8 as serum or a non-fat dried milk solution. The blocking 9 solutions are preparable in the fluid vehicles disclosed above, often as 0.1-30% solutions.
11 The receptor attached blocked support is exposed to a te~t 12 sample, often a body fluid sample, such as a blood or serum 13 sample, to determine the presence of ligand, and amounts thereof.
14 The support is incubated with the te~t sample for a period of time to a~sure ligand-receptor binding. Then the support is 16 washed liberally and detection of bound ligand is conducted.
17 The means of detection can take a variety of forms. For 18 example, a readily known labelled second ligand, such as TS~, can 19 be exposed to the solid support following exposure o said support to a test sample suspected of carrying a first ligand 21 bindable ~o the receptor, or part thereof. The amount of label 22 bound thereto is determined, such as by liquid scintillation 23 counting in the case of radiolabelling or by spectrophotometry 24 in the case of enzyme labelling, and measures inhibition of binding of said known second ligand with the receptor, by a first 26 ligand, such as an anti-receptor antibody, in said te~t ~ample.
27 The amount of bound label is related inversely to the amount of 28 first ligand in the test sample.

.'; "' .:

,-''. ':., WO9~/08726 ,~ ~3 ~ 3 PCT/US90/06~33 l Alternatively, a second labelled Ligand bindable to the 2 receptor bound first ligand on the Rupport is exposed to the 3 support and the amount of label bound thereto is determined.
4 Suitable second ligandR include an appropriate antibody, such as an antibody to the receptor or to TSH. The amount of bound label 6 is related directly to the amount of ligand in the test 6ample.
7 Although solid support assays are preferred because of the 8 facility in performing the methods, other assays can be 9 configured without undue experimentation. Thus liquid phase assays are practicable, as well as competition assays and those 11 where the recombinant receptor is labelled. There are many 12 variations in configuring an assay using the recombinant receptor 13 and the skilled artlsan can design an assay of choice within the 14 spirit of the invention. Suitable guidance can be obtained, for example, in U.S. Pat. Nos. 4,486,530 and 4,520,113.
16 Truncated versions of the gene product are also useful.
17 For example, it i9 the extracellular domain that interacts with 18 TSH and with anti-receptor antibodies. Thus that polypeptide l9 domain alone can be used in place of the intact receptor in the uses disclosed herein. Truncated proteins can be obtained for 21 example, by chemical synthesis of the domain or part thereof, 22 chemical treatment of the intact protein to liberate a domain or 23 part thereof from the remainder of the receptor protein and by 24 altering the nucleotide coding sequence, such as by site-directed mutagenesis or by subcloning an approprlate restrlctlon 26 fragment, so that only the extracellular domain or part thereof 27 is expressed.
28 ~ecause of the low density of receptor on thyroid cells, it W092/08726 PCT/US90/06~33~ :
2 ~ 9 ~ O 1 3 -12- ~
1 has not been po~ible to obtain specific high titer anti-2 recPptor antibodies. The substantially pure receptor and parts 3 thereof can be uqed to obtain ~pecific antibody. As descibed 4 below, a rabbit polyclonal anti~erum was raised to a 16 re~idue polypeptide fragment of the extracellular domain of the receptor.
6 Accordingly, monoclonal antibodies to the receptor can be made 7 by obtaining immune cells suitable for hybridization with known 8 myeloma fusion partners and practicing the fusion, cloning and 9 selection that typifies the making of mAbs.
The cloned sequence is useful for ~etecting nucleic acids 11 hybridizable thereto. Accordingly, a nucleic acid hybridization 12 assay, such as filter hybridization ~Southern blot), in situ 13 hybridization, dot/slot blot or a solutlon hybridization assay, 14 with the clone as probe can be used to determine presence of complementary genomic sequences and message, for example. Those 16 procedure~ are useful, for example, in detecting hypothyroidism 17 resulting from a TSH receptor defect. The nucleic acid assays 18 may comprise an amplification step such as taught in Mullis or 19 Mullis et al. (supra) or in Kramer et al. (U.S. ~at. No~
4,786,600).
, 21 The cloned sequence is useful for correcting defects at the ;
22 level of the gene, transcription, translation or processing by, '~
23 for example gene replacement therapy. A~ described below, non- ; ;
24 thyroid cells that normally do not express the thyrotropin ;
receptor were transfected with the full length expressible 26 sequence. The transfectants expre~ed a functional TSH receptor, 27 bound TSH at the cell surface and exhibited a TSH-dependent 28 actlvation of cAMP synthesis. Thus cells from a patlent that ~ -13- 2~9a~3 1 does not expres~ -the TSH receptor or expresses a defective 2 receptor can be rem~ved, tran9fected in vitro. and sta~le 3 transfectant~ that express a functionaL receptor can be 4 introduced back into the patient. If normal tissue transplantation barriers are surmounted, for example using a 6 syngeneic, or at leagt histocompatible thyroid cell line from 7 another individual or a cell line that does not express major, 8 and possibly minor histocompatibility antigens, it is possible 9 that replacement transfected cells need not come from the patient in need of treatment.
11 Certain thyroid dysfunctions are treatable with compositions 12 comprising said nucleotide sequence or preferably said gene 13 product, or portions thereof, encoded thereby. The compositions 14 comprise a therapeutically effective amount of the nucleotide sequence or gene product thereof and a pharmaceutically 16 acceptable carrier. The composition can be administered in any 17 of a variety of art-recognized mode~ including orally and 18 parenterally, preferably intramuscularly or intravenously.
19 Appropriate dosages are determinable by, for example, dose-response experiments in laboratory animals or in clinical trials 21 and taking into account body weight of the patient, absorption 22 rate, half life, disease severity and the like. The number of 23 doses9 daily dosage and course o~ treatment may vary from 24 individual to individual.
Pharmaceutical formulations can be of solid form including 26 tablets, capsules, pills, bulk or unit dose powders and granules 27 but preferably are of liquid form including solutions, fluid 2~ emulsions, fluid ~u~pensions, semisolid~ and the like. In W O 92/~8726 PC~r/US90/06533 ~ ~ 9 ~ 14- ~ ~ ~
1 addition to the active ingredient, the formulation would comprise 2 suitable art-recognized diluents, carrlers, fillers, binders, 3 emulsifiers, surfactants, water-soluble vehicles, buffer~
4 solubilizers and pre~ervatives.
Methods of treatment include those known in the art for 6 administering biologically active agents. Such methods include 7 in v vo and ex vivo modalities. For example, a receptor-8 containing solution can be delivered intraveously, by a pump 9 means attached to a reservoir containing bulk quantities of said solution, by passive diffusion from an implant, such as a 11 Silastic implant and the like. Alternatively, treatment may 12 involve temporary removal of tissue and exposure thereof to the 13 claimed compositions before introduction back into the patient.
14 Thus during hemapheresis, plasmapheresis, transfusion or dialysis, for example, the extracorporeal fluid is passed over 16 solid phase bound receptor to entrap ligands bindable to the 17 receptor. The fluid is then returned to the patient.
18 Delivery of the receptor ~equence is practiced by art-19 recognized means such as electroporation, precipitation, microinjection, liposome fusion, microparticle bombardment and 21 the like. Generally target cells are obtained, such as from the 22 patient in need of treatment or a cell line, the expressible 23 sequence i~ in~erted into said ce~ls and stable transformants are 24 seLected. Said stable transformants expressing said receptor are introduced into the patient in need of treatment by direct 26 infusion into the tissue or by parenteral means.
27 The skilled artisan can determine the most efficacious and 28 therapeutic means for effecting treatment practicing the instant ' W092/08726 P~T/~SgO/06~33 ~ -15- 2~9~(3 ~ ~' 1 invention. Reference can also be made to any of numerous 2 authoritie~ and references including, for example, "Goodman &
3 Gilman ~ The Pharmaceutical Ba~is of Therapeutics" (6th ed., 4 Goodman et al., eds., MacMillan Publ. Co., NY, 1980).

The invention will be described in further detail by way of 6 the following non-limiting Examples.

8 From 8 x 105 plaques screened at low stringency with the rat 9 LH/hCG receptor-related probe described above, 20 FRTL-5 rat thyroid cell clone were obtained. Eighteen, with insert ~izes 11 of 1.4-4.2 kilobases (kb), contained transmembrane domain 12 sequences exhibiting about 70% amino acid sequence identity with 13 the comparable region of the rat LH/hCG receptor. Compared to the 14 LH/hCG receptor, the two largest clones, 4.2 and 2.4 kb in length (4A2 and 16B1, respectively) had an incomplete 5 end.
16 To obtain a full length clone, a 177 bp probe of the 5 end 17 of 16B1 was synthesized using 10 ng of pGEM-7Z (Promega) carrying 18 the 16B1 insert and oligo primer C with the sequence (5 -19 CGCTATACAACAATGGATTTACTTCTT-3') and primer D with the sequence (5 -GAAGAGCAGTAACGCTGGTGGAAGACA-3'). That probe was used to 21 rescreen the bank and revealed a 2.8 kb cDNA clone (T8AFB) with 22 characteristics compatible with its encoding the full-length TSH
23 receptor and only a small portion of the 3 noncoding sequences.

24 The nucleotide sequence of T8AF~, 2834 bp long, contains an open reading frame encoding a protein, Mr 86,528, with 764 amino W092/087~6 S ~ ~ PCT/US90/06533 2~9' -16~ ~
1 acids. The first in-~rame ATG is followe~ by codOns specifying 2 a hydrophobic sequence defined a~ a gignal peptide in the LH/hCG
3 receptor. Akamizu et al., supra. There is a long hydrophilic 4 region with five potential N-linked glycosylation sites followed by a region with seven hydrophobic, membrane-spanning domains and 6 a cytoplasmic region containing a potential protein kinase C
7 phosphorylation site. The TAA stop codon is followed by a 8 polyadenylation signal at ~ucleotide~ 26~6-2691. There is a 9 stretch of amino acidg present in the TSH receptor that i5 not found in the LH/hCG receptor.
ll The homology between the entire coding regions defined by 12 the rat TSH and LH/hCG receptors is relatively low, 64% and 48%
13 for nucleotide~ and amino acids, re~pectively. The homology in 14 the transmembrane region is slightly greater, 60% and 70%, respectively. The overall amino acid homology with the human and 16 dog TSH receptors is 86% and 89%, respectively.

18 Transfection experiments with C05-7 cells (which is a 19 publicly available non-patented cell line with ATCC accession number CRL 1651), or other non-thyroid cell, used a commercially 21 available electroporation device and the technique recommended 22 by the manufacturer (Bio-Rad). The expression vector was 23 constructed by subcloning the EcoRI T8AFB cDNA insert into the 24 EcoRI site of SV40 promoter-driven pSG5 (Stratagene).
The cells (about 1~7 per ml), which were washed and 26 resuspended in 0.8 ml of sucrose/phosphate buffer, were incubated W092/08726 PCT/US90/06;33 ~ 17- 2 ~ 1 3 1 with the pla~mid DNA ~80 ~g in 10 ~1 of water) for 10 minute9 in 2 an ice-water bath before being pulBed wi~h 330 V and 25 ~F. The 3 cells then were plated in dishe~ at 1.5-4 x 1o6 cells per di~h.
4 Cell viability wa~ ~50% after electroporation. After a 40-48 hour stabilization culture period, TSH-8timulated cAMP production 6 and TSH binding were mea~ured.
7 Highly purified bovine TSH (NIDDK-bTSH-I-l, 30 units/mg) and 8 LH (USDA-bLH-B5, 2.1 units/mg) were obtained from the hormone 9 distribution program of the National Institute of Diabetes and Digestive and Kidney Disease~. TSH was radioiodinated and 11 binding thereof was measured using standard techniques, for 12 example as described in Tramontano & Ingbar (Endo 118:1945-1951 13 (1986~) with the exception that the incubation and wash buffer 14 was modified Hanks' balanced salt solution (wherein NaCl is replaced by 222 mM sucrose) containing 0.5% bovine serum albumin 16 and 20 mM Hepes at pH 7.4. The incubation mixtures contained 17 about 4 x 106 cpm of l25I-labeled TSH (120 ~Ci/~g) and unlabeled 18 TSH or LH. Specific binding was caLculated by subtracting values 19 obtained in the presence of 0.1 ~M unlabeled TSH.
Level~ of cAMP were a~sayed using a standard technique, for 21 example as described in Kohn et al. ( supra) . Briefly, the test 22 sub~tance, for example TSH or thyroid stimulating antibody, was 23 added to the culture medium or to cells washed and maintained in 24 Hank'~ balanced salt golution or the modified Hank'~ balanced salt solution described above, along with a cAMP
26 phosphodiesteraseinhibitor, such as3-isobutyl-1-methylXanthine.
27 After a brief incubation of 0.5-3 hours the cells were separated 28 and the amount of cAMP in the medium wa~ determined, and in cell ,::

W092/08726 ~ 3 PCT/U~90/06533 -18- ~
1 ly~ates if de9ired- Presen~e of cAMP was determined by 2 commercially available radioimmunoai~isay kit~i(for example DuPont 3 or New England Nuclear). Cell pellets were in each case 4 solubilized with 1 M NaOH for protein determinations. Protein was measured using a commercially available kit with bovine serum 6 albumin as standard (Bio-Rad).
7 When T8AFB in the correct orientation was transfected into 8 COS-7 cells, the expressed protein caused the cells to become 9 sensitive to TSH in c~M~ assays. The relative increase in total c~MP induced by 0.1 nM TSH in the transfected cells was 5-fold 11 above basal (>20 pmol/mg of protein). By comparison, LH did not 12 increase significantly levels of cAMP above basal level when 13 tested at a lO-fold higher (1 nM) concentration. COS-7 cells 14 transfected identically with constructs containing the cDNA
insert in the opposite orientation did not have a TSH-induced 16 increase of adenylate cyclase activity.
17 The development of a TSH-sensitive adenylate cycla~e 18 re~ponse in the transfected COS-7 cells was accompanied by the 19 appearance of specific binding of TSH. Binding of 125I-labeled TSH to C05-7 cellqi transfected with the in~iert in the correct 21 orientation, but not in the opposite orientation, exhibited a 22 curvilinear i otherm similar to that of FRTL-5 thyroid cells 23 (Tramontano & Ingbar, supra) and wa9 inhibited 50%, 75% and >90%
24 by 0.3, 3 and 30 nM unlabeled TSH, respectively, but was not inhibited by 10 nM LH. The Kd values for the high-ainity and 26 low-affinity binding sites were estimated at about 1.3 x 10l M
27 and 5.1 x 10-8 M, respectively. Those values compare favorably 28 with the values that were obtained for FRTL-5, 5.9 x 10l M and : ' ' ...

W092/08726 -19- 2 ~ 9 ~ ~ ~ 3 PCT/US9~/06533 1 1.7 x 10-8 M, respectively, by Tramontan & Ingbar (supra).

3 Poly(A) RNA's from FRTL-5 cells were prepared u5ing 4 standard procedures. The RNA's were separated by size and transferred to Nytran membranes (Schleicher & Schuell) using 6 standard Northern blot methods, see for example Zarrilli et al.
7 (Mol Endo 3:1498-1508 (1989)) and Isozaki et al. (Mol Endo 8 3:1681-1692 (1989)). The probes used were the purified inserts 9 from clone T8AFB, 16B1 or 4A2 and as a controll a ~-actin cDNA
(kindly provided by B. Paterson, National Cancer Institute). The 11 final wash of the filters was in 1 x SSPE (0.15-0.18 M NaCl/10 12 mM phoi~phate, pH 7.4/0.5-1.0 mM EDTA) containing 0.1% SDS at 13 65C. Quantitation of RNA amounts was inferred from 14 densitometric scanning (LKB laser densitometer) of the hybridized bands with the value obtained in the lane containing RNA of cells 16 not exposed to TSH at time zero serving as an arbltrary reference 17 value.
18 Northern analyses of poly(A)+ RNA from F~TL-5 cells 19 identified two mRNA species, 5.6 and 3.3 kb in size. The same two mRNA's were detected barely in poly(A)~ RNA of rat ovary and 21 were not detected in rat testis, brain, liver, lung or spleen 22 (RNA samples obtained from Clontech). A probe derived from the :
23 midportion of the extracellular domaln of the T~FB clone 24 hybridized with both species of transcripts. A 0.7 kb cDNA probe derived from the 3 nontranslated portion of clone 4A2 hybridized 26 with only the 5.6 kb transcript. That suggests that the 5.6 kb ' ":' :.~

. ~
W092/0872~ 2 ~ 20- PCT/USsO/0~;33 1 mRNA transcript is larger primarily because it contains a longer 2 3 noncoding reyton.

.....
4 Poly(A) RNA from FRTL-5 cells maintained in the absence of TSH for 7 days had significantly higher levels of the 5.6 kb and 6 3.3 kb transcripts than did cells maintained in the presence of 7 TSH, suggesting that TSH down-regulated expression of the gene.
.~ , .
8 Down-regulation was rapid, 3-4-fold within 8 hours of TSH

9 challenge, and was dependent on TSH concentra~ion. A comparable ' down-regulation was found when cells were exposed to cholera 11 toxin, forskolin or 8-bromo-cAMP, compounds known to affect the 12 adenylate cyclase complex. Down-regulation was not found when 13 cells were exposed to phorbol 12-myristate 13-acetate. Mea~ured 14 at the same time and under the same conditions, TSH binding to cells decreased about 60% whether TSH, cholera toxin, forskolin, 16 or 8-bromo-cAMP was the agent. The addition of insulin, insulin-17 like growth factor-I or calf ~erum to FRTL-5 cells that had been j~

18 maintained for 7 days with no TS~ or insulin and little (about 19 0.2%) or no calf serum, up-regulated the TSH receptor gene and wa~ required for down-regulation by TSH or compounds known to 21 affect the expression of the adenylate cyclase complex.

22 Patients with autoimmune thyroid disease have circulating 23 antibodies that increase cAMP level~ or that inhibit TSH binding.

24 Representative antibodies were obtained from diaqnosed patients using Protein G (Genex) and the manufacturer 8 recommended -26 procedure or a standard procedure for immunoglobulin purification 27 by affinity chromatography. Stimulating antibodies were ':

. ~ .. .... , . .. .. ~ .. .. ...... ........ ... . ..... . ... . .. . . . . .

W~92/0~726 PCT/US90/06~33 ( -21 2~3013 1 identified by their ability to induce cAMP using the assay 2 described above with FRTL-5 cells and with the immunoglobulin at 3 a concentratiOn of 1 mg/ml.
4 Antibodies that inhibit TSH binding were identified using a solid pha~e a~say. BriefLy, microtiter plates optionally were 6 precoated with O.l ml of a 20 ~g/ml poly-L-lysine (Mr 70,000 from 7 Sigma) solution prepared in water for one hour at room 8 temperature. The solution was replaced with O.1 ml of thyroid 9 membranes, obtained by standard procedures, diluted appropriately in 20 mM Tris-acetate, pH 7.O. Controls consisted of wells 11 containing 0.5% bovine serum albumin (BSA) in place of membranes.
12 After 4 hours or more of incubation at 4C, the wells were wa~hed 13 with buffer comprising 0.5% BSA in 20 mM Tris-acetate, pH 6.7 for 14 30 minutes at room temperature. The buffer wa~ replaced with a te~t sample diluted appropriately in the same buffer and the 16 plate~ were allowed to incubate. The wells then were exposed to 17 labelled TSH, incubated, washed and bound label determined. The 18 inhibition activity is related directly to the decrease in 19 labelled TSH bound when compared to the decrea~e obRerved with IgG from a normal individual.
21 When IgG preparations from patients with Graves di~ease 22 were tested, those antibodies, which increased cAMP levels as 23 does TSH, also down-regulated TSH receptor mRNA levels to that 24 comparable to what is found in cells expo~ed to TSH. IgG
preparations from patients with primary hypothyroidism, which 26 have inhibitory activity, increased TSH receptor mRNA levels 27 about 2-fold over ba~eline. Reactivity of both types of 28 antibodies with FRTL-5 cells was a~sociated with the presence of W092/08726 ~ PCT/US90/06~33 -~2-1 the TS~ receptor on the cell a~ both typeq of antibody reacted 2 with FRTL-5 cells but not with FRT rat thyroid cells. ~ERT is a 3 continuously growing line that, like ERTL-5, i9 derived from 4 Fischer rats and ha9 an apparentlY normal adenylate cyclase complex gensitive to cholera toxin and for~kolin (Ambesi-6 Impiombato ~ Coon, Int Rev Cytol Supp 10:163-171 (1979), Ambesi-7 Impiombato, supra and Kohn et al., supra). FRT c~lls did not 8 expresq the two species of TSH receptor mRNA s in Northern 9 blots.) 11 The technique of site-directed mutagenesis enabled the 12 identification of critical sites on the extracellular domain 13 including sites that are important for TSH binding, that impart 14 TSH binding specificity on the receptor, ~pecies specificity and antibody binding sites. For example, two sites on the 16 extracellular domain are important for TSH receptor function and 17 stimulating antibody action, but not for high affinity TSH
18 binding; a third site is important immunologically but is not 19 important functionally and is not important for either inhibiting or Ytimulating antibody interaction; and a fourth site adjacent 21 to the third contributes more to receptor function than to TSH
22 binding.
23 Oligonucleotide mediated site-directed mutagenesis was 24 performed using t~e T7-GEN In Vitro Mutagenesi~ kit of U.S.
Biochemical Corp. Two phosphorylated oligos which imparted new 26 restriction sites unique to the full length clone or vector were W092/08726 PCT/~S90/06333 ~ -23- h~flJ13 1 annealed with a single strand preparation of the EcoRI T8AFB
2 construct ingerted into M13mpl8.
3 To derive mutant~ of potential glycosylation site~, the 4 asparagine residue (AAT) was converted to glutamine (CAG) using a 27-mer complementary to the target sequence and having the CAG
6 codon located centrally. A second ~trand comprising methylated 7 cytosine was generated with T7 polymerase and T4 ligase. After 8 removal of the parental strand with MspI (or Sau3AI), HhaI and 9 exonuclease III, competent cells were transfected with the ln vitro synthesized, mutated single stranaed DNA. Restriction 11 mapping and dideoxy sequencing validated mutations in the 12 re~ulting clones.
13 The EcoRI inserts in correct orientation of positive clones 14 were used to produce 9 deletion mutants after reconstruction and subcloning. Mutant Ml lacked amino acids 37-121 (where the first 16 residue is the initiating methionine~; M2 lacked amino acids 110-17 307; M2A lacked amino acids 173-231 M2B lacked amino acids 233-18 265; M2C lacked amino acids 268-303; M3 lacked 308-410; M3A
19 lacked 338-399; M3B lacked 339-367 and M3C lacked 374-400 (~ee Eigure 2).
21 The M3B transfectant was able to bind TSH and showed induced 22 cAMP ~ynthesis upon reaction with TSH or thyroid ~timulating 23 antibody. M3A and M3C transfectants showed no TSH binding or 24 TSH-induced increase in cAMP response. The M3 mutant showed a low level of TSH binding capability. An interpretation of the 26 data is the deletion which preserves TSH binding and function, 27 amino acids 339-367, defines a region that is not critical for 28 receptor function, nor for stimulating or inhibiting antibody W092/08726 ~13 (~ r ~1~ PCT/US90/06;33 ~ 24- ~

1 binding. Adjacent regions, amino acids 308-339 and 367-399 2 define regions that contribute ~o TSH binding and receptor 3 f~nction since the M3 mutant did show some binding capability 4 and lacked that peptide. The region defined by amino acids 308-339 appears to be more important to receptor function than to TSH

6 binding.

7 Deletion mutants spanning portions of the extracellular 8 domain that included potential glycosylation sites (Ml, M2, M2A, 9 M2B and M2C) and lacking the hydrophobic signal peptide region (amino acids 5-23) did not exhibit TSH binding nor did TSH

11 elevate cAMP levels in transfected COS-7 cells. To further 12 define the actual sites responsible for the loss of function in 13 Ml, M2, M2A, M2B and M2C, mutant~ with individual carbohydrate 14 deletions (I through V) were created. Carbohydrate units II, III and V did not influence TSH binding or rece~tor function.

16 In contrast, carbohydrate units I and IV limited TSH binding but 17 did not influence the TSH-induced or ~timulating antibody-18 induced increase in cAMP.

.
20 Amino acids 339-367 are part of a region found on the TSH ;
21 receptor and not on the LH/hCG receptor. The TSH receptor-22 specific region contains a stretch of hydrophilic amino acid 23 residues. It is known that certain amino acids and combinations 24 thereo are like~y to be immunonogenic and the probability of immunogenicity of the stretch of hydrophilic amino acids in the 26 TSH receptor is high. A si~teen residue peptide (Tyr-Tyr-Val-'' ' ~ 25- 2 ~9a ~ 13 1 Phe-phe-Glu-Gl~-Gln-Glu-Asp-Glu-Ile-Ile-Gly-phe-cysi commercially 2 synthesized under contract) from this region was tested on FTRL-3 5 cells and COS-7 cells transfected with the full length TSH
4 receptor cDNA. It wa~ found that the 16-mer had no effect on TSH
binding, Ts~-induced c~MP synthesis, stimulating antibody-6 induced cAMP synthesis or the binding of inhibiting antibodies.
7 The 16-mer readily produced antibodies within three weeks 8 of injection into rabbits using an immunization schedule 9 recommended by Hazelton Laboratory. The resulting antisera were reactive in an ELISA, as described below, using the 16-mer a~
11 antigen as described below. Furthermore, the antibodie~ bound 12 to FRTL-5 cells, which express TSH receptor, but not to FRT
13 cell~, which do not expre~s TSH receptor. - ;
14 Eor the ELISA, protein antigen was bound to the wells of a microtiter plate by dilution of antigen in bicarbonate buffer, 16 pH 9.6, containing about 0.1% BSA ~Calbiochem) at a concentration 17 of about 5-20 ~g/ml, and adding 100 ~l of the solution to the 18 wells. The plate was incubated at 37C for about 2 hour~. The 19 plates were washed with PBS-T (phosphate-buffered saline containing 0.05% Tween-20). The test sample, for example 21 antipeptide antibody, patient serum or patient IgG preparation, :, 22 wa~ diluted appropriately in 1% BSA in PBS-T and next added to 23 the wells. The plate was incubated for about 90 minutes at room 24 temperature and then washed as described above. An appropriate amount of a detection moIecule diluted with 1% BSA in PBS-T was 26 added to the wells, the plate was incubated for about 90 minutes, 27 washed and the amount of peptide-reactive material in the test 28 sample was determined. Suitable detection molecules include an W092/08726 ~ PCT/US90/06533 -26- ~
1 avidin-biot1n system or an appropriate antibody radioactively 2 labelled or enzyme conjugated (avai~able, for example, from Zymed 3 or Amersham). In the ca~e of radiolabelling, a gamma or liquid 4 scintillation counter is used to determine the amount of well bound label. In the case of enzyme labelling, a suitable 6 substrate is added to the well and appropriate detection is 7 effected, for example by luminometry or spectrophotometry.
8 The peptide was used in the ELISA to determine the presence 9 of reactive antibodies in IgG preparations from a variety of patients including those with Graves Disease. Preparations from 11 29/34 patients with Graves' Disea~e reacted positive in the assay 12 whereas samples obtained from 22 patients with non-thyroid 13 diseases ~including rheumatoid arthritis, systemlc lupus 14 erythematosus and non-autoimmune thyroid disease, such as adenoma) and from 15 normal individuals were non-reactive with 16 the peptide.
~ .':
17 Publications and references referred to and recited herein 18 are expre3sly incorporated by reference.

19 While preferred embodiments of the instant invention have been de~cribed, it will be apparent to those skilled in the art 21 that many changes and modification~ can be made to the products 22 and processes without departing from the ~pirit of the invention.
23 For example, it is clear that changes can be made to the 24 nucleotide or amino acid sequence without affecting the capability thereof to hybridize to homologous sequences or to 26 serve as a functional receptor. Thus a functional equivalent W092/08726 PCT/US90/06i33 ~ 27- 2 ~9a O~3 1 of a nucleic acid fragment can be defined in terms of capability 2 of hybridization or in term~ of capability of expressing a 3 polypeptide product therefrom that comprises residues of a rat 4 thyrotropin receptor A functional equivalent of a polypeptide can be defined in term9 of carrying a function normally 6 associated with the intact protein, such a~ a peptide that 7 defines an antibody binding site, a peptide that comprises the 8 extracellular domain or a peptide that comprises a carbohydrate 9 binding site on said extracellular domain.
The described embodiments are thus to be considered 11 illu~trative and not restrictive. The scope of the invention is, ;
12 ther~fore, indicated by the appended claims rather than the 13 foregoing description. All changes that come within the meaning 14 and range of equivalency are to be embraced within the scope of the invention.

.,,: ::,--..
.

W O 92/0872~ PCT/US90/06~33 PCT Apsl1~ant~s Guid~ - vol~ nnex ~4~ f,~
-28~ ~NEX M3 _ _ . _ _ .
I~ el~OOR6ANlSl4~S
6 ~ 24 d ~ ~ ~ ~ . .

d~
_ _ American Type Culture Collection (ATCC) , _ .
A~ ~ C~) ' : :
12301 Parklawn Drive Rockville, Maryland 20852 :~
~nited States of America _ O_d_~ ~
17 ~ay 1983 (17.05.83) CRL 8305 . .
. AllO T~OlllaL l-lC~1011--' (~ ~ tl ~ ~_1~. 'rllh 1~_~ b c~ U_l U
. -- . - -- - I '.
., . .

. -- - .
e. O~A~D TATSS 1~0 ~1 I~IIC~ ~111~ ~ In 11~- _ ~ ~ ~ ~ ) ., ~ . ;' -) ': , .: . , L ~ ~hl~ h~ ac~ h~ cb~ ~ ~ ~ O~
, (~
(~ ff~ _ ' O Th- ~ i ~< (b~ Ih- _~ ~ ~o i ~W
- ~_ ., j, ~Ad~l ~ - _ _ _ . _ _ _ . . . -- .
f~ f~O11 , W O 92/08726 PCT/VS90/06533 ~:
PCT ADpl tcant ~ 5 G li~e - Volun~ nn~x ~13 -29- ~ M3 _ . _ . . . .
~l~gOO~C~ 5 ~, '.
~o~ d~_ r~ 16 ~_ 18~ _ ~n~-. n~no~l o- ~or t~ .
.
American Type Culture Collection (ATCC) '': ' 12301 Parklawn Drive Rockville, Marvland 20852 _ United States or America _ ::
A~ . ~ . .
Unknown CRL 1651 _ . t~ ~

. .
_ _ . : :

_ '~`
.....
,,' _ _ _ _ ~.
1. ~t~-rd~rJ~rcr~ r.~ r~r~ Ur~ e~ ~r~~
J~ - ~ ~'4--~o~ ~ . ~ '. ' O Tb~ ~ Id rr~ ~Ir~ t~ rl ~n~ tt~ Ird~ 11~ ~ ~ r r~
_ ._~ :_ ':.. ,'.

I~d 0~1 r . ~ .
on~ o ~ r ~
.,:

Claims (41)

WHAT IS CLAIMED IS:

1. A substantially pure nucleic acid fragment hybridizable to a rat thyrotropin receptor gene or functional equivalent thereof.

2. The fragment of claim 1 that is hybridizable to said gene.

3. The fragment of claim 1 that comprises a polynucleotide hybridizable with sequences of said gene that encode the extracellular domain of the receptor expressed therefrom.

4. A substantially pure nucleic acid fragment comprising sequences encoding a rat thyrotropin receptor or functional equivalent thereof.

5. The fragment of claim 4 that encodes said receptor.

6. The fragment of claim 4 that comprises sequences encoding the extracellular domain of said receptor.

7. The substantially pure nucleic acid sequence, or functional equivalent thereof, of Figure 1.

8. The substantially pure nucleic acid sequence of Figure 1.

9. The substantially pure amino acid sequence, or functional equivalent thereof, of Figure 1.

10. The substantially pure amino acid sequence of Figure 1.

11. The substantially pure amino acid sequence of Figure 1 comprising the extracellular domain.

12. A substantially pure rat thyrotropin receptor or functional equivalent thereof.

13. A substantially pure rat thyrotropin receptor.

14. The extracellular domain of a rat thyrotropin receptor or functional equivalent thereof.

15. The extracellular domain of a rat thyrotropin receptor.

16. A medicament comprising:
(a) a therapeutically effective amount of at least one member selected fro the group consisting of a rat thyrotropin receptor, the extracellular domain of said receptor and functional equivalents of either or both of said receptor and said domain; and (b) a pharmaceutically acceptable carrier.

17. A method of detecting nucleic acids hybridizable to a rat thyrotropin receptor gene comprising the steps of:
(a) exposing at least one member selected from the group consisting of a substantially pure polynucleotide comprising a rat thyrotropin receptor gene and a functional equivalent thereof to a test sample comprising molecules bindable to said receptor gene; and (b) determining the presence of bound molecules.

18. A method of detecting ligands bindable to a rat thyrotropin receptor comprising the steps of:
(a) exposing at least one member selected from the group consisting of substantially pure rat thyrotropin receptor and a functional equivalent thereof to a test sample comprising a ligand bindable to said receptor; and (b) determining the presence of bound ligand.

19. The method of claim 18 which further comprises the step of binding either said substantially pure thyrotropin receptor or functional equivalent thereof, or both, to a solid support prior to exposing step (a).

20. The method of claim 18 wherein said ligand is thyrotropin.

21. The method of claim 18 wherein said ligand is an anti-glycoprotein hormone receptor antibody.

22. The method of claim 21 wherein said glycoprotein hormone is thyrotropin.

23. The method of claim 18 wherein said functional equivalent of substantially pure rat thyrotropin receptor comprises the extracellular domain.

24. The method of claim 23 wherein said extracellular domain comprises peptides, wherein said peptides are epitapes for antibodies.

25. The method of claim 24 wherein said peptide comprises Tyr-Tyr-Val-Phe-Phe-Glu-Glu-Gln-Glu-Asp-Glu-Ile-Ile-Gly-Phe-Cyg.

26. A therapeutic method comprising administering to a patient in need of treatment a therapeutically effective amount of a composition comprising at least one member selected from the group consisting of substantially pure rat thyrotropin receptor, extracellular domain thereof and functional equivalents of either or both said receptor and said domain.

27. A therapeutic method comprising treating a patient in need of therapy with a therapeutically effective amount of at least one member selected from the group consisting of substantially pure rat thyrotropin receptor, extracellular domain thereof and functional equivalents of either or both said receptor and said domain.

28. The method of claim 27 wherein said treating step occurs ex vivo.

29. A method of detecting thyrotropin receptor or functional equivalents thereof comprising the steps of:
(a) exposing an antibody, or binding site thereof, that binds specifically to the rat thyrotropin receptor or functional equivalents thereof to a test sample comprising said receptor or functional equivalents thereof; and (b) determining the presence of bound receptor or functional equivalents thereof.

30. The method of claim 30 wherein said antibody is a monoclonal antibody.

31. A method of making an antibody that binds specifically to thyrotropin receptor comprising immunizing a mammal with substantially pure rat thyrotropin receptor or functional equivalents thereof.

32. The method of claim 31 which further comprises fusing antibody secreting cells of said immunized mammal with a myeloma cell.

33. An antibody that binds specifically to thyrotropin receptor.

34. The antibody of claim 33 wherein said receptor is rat thyrotropin receptor.

35. The antibody of claims 33 or 34 wherein said antibody is a polyclonal antibody.

36. The antibody of claims 33 or 34 wherein said antibody is a monoclonal antibody.

37. A medicament comprising:
(a) a therapeutically effective amount of an anti-thyrotropin receptor antibody or binding site thereof; and (b) a pharmaceutically acceptable carrier.

38. A therapeutic method comprising treating a patient in need of therapy with a therapuetically effective amount of a composition comprising an anti-thyrotropin receptor antibody or binding site thereof.

39. The method of claim 38 wherein said treating step occurs ex vivo.

40. A medicament comprising:
(a) a therapeutically effective amount of at least one member selected from the group consisting of a rat thyrotropin receptor gene and functional equivalents thereof; and (b) a pharmaceutically acceptable carrier.

41. A therapeutic method of treating a patient in need of therapy comprising the steps of:
(a) obtaining cells compatible with said patient;
(b) introducing into said cells an expressible rat thyrotropin receptor gene, or functional equivalents thereof, to produce transfected cells;
(c) obtaining stable transfected cells expressing said gene or functional equivalents thereof; and (d) introducing said stable transfected cells into said patient.