CA2094259A1 - Therapeutic fragments of von willebrand factor - Google Patents

Abstract

A polypeptide patterned upon a parent polypeptide and comprising the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 441 (arginine) and ends at approximately residue 733 (valine), or any subset thereof, in which one or more of the cysteine residues normally present in the parent polypeptide, or subset thereof, have been deleted and/or replaced by one or more other amino acids, said polypeptide having therefore less tendency than the parent polypeptide, or subset thereof, to form intra or interchain disulfide bonds in aqueous media at a physiological pH, and including also a DNA sequence encoding an aforementioned polypeptide; and also a biologically functional expression plasmid or viral expression vector containing DNA encoding for an aforementioned polypeptide and capable of being replicated in a host cell; a therapeutic composition comprising one or more of the involved polypeptides; and also a method for inhibiting thrombosis in a patient which comprises administering to such patient an effective amount of the therapeutic composition.

Description

`
WOg2~6~ PCT/US91/07756 ~ ~ 9 ~
. .
.-..
. - ..,":

`.

,.:.-;

.: , . 1 . . :.
. ::
THERAPEUTIC FRAGMENTS OF VON WI~LEBRAND FACTOR
''' " .

Field of the Invention This invention relates to polypeptides which are ~
useful in the treatment of vascular disorders such as ~ .
thrombosis. This invention relates also to :;~
polypeptides which are useful in the treatment of ~ :~
hemorrhagic diseases, such~as von Willebrand disease (vWD). This invention further relates to the ~: production by;recombinant:DNA-directed methods of pharmacologically useful quantities~of the~polypeptides of the present~inventlon. :

The term "hemostasis" refers to those processes which comprise the:defense mechanisms of the body against~loss of circulating blood cause~ by vascular injury. Proce~ses which are normal as a physio1ogic;~
respons~ to vascular injury may lead in~pathologic ~-~' circumstances, such as in a patient afflicted with ~
atherosclerotic vascular disease or chronic congestive : ~:
heart failure, to the formation of undesired thrombi .. ... . . . . ... .. .
(clots) with resultant vascular occlusion. Impairment :~ of blood flow to organs under such circumstances may lead to severe pathologic states, including myocardial :~ .. "' ~V092/0~ PCT/US91/07~

~0~

in~arction, a leading cause of mortality in developed countries. r The restriction or termination of the ~l~w of blood within the circulatory system in response to a wound or as a result of a vascular disease state involves a complex series of reactions which can be divided into two processes, primary and secondary hemostasis. Primary hemostasis refers to the process of platelet plug or soft clot formation. The platelets are non-nucleated discoid structures approximately 2-5 microns in diameter derived from megakaryocytic cellsu Effective primary hemostasis is accomplished by platelet adhesion, the interaction of platelets with the surface of damaged vascular endothelium on which are exposed underlying collagen fibers and/or other adhesive macromolecules such as proteoglycans and glycosaminoglycans to which platelets bind. -Secondary hemostasis involves the reinforcement or -~
; crosslinking of the soft platelet clot. This secondary process is initiated by proteins circulating in the plasma ~coagulation factors) whi~h are activated during primary hemostasis, either in response to a wound or a vascular disease state, The activation o~ these factors results ultimately in the production of a polymeric matrix o~ tha protein fibrinogen (then called ~ibrin) which rein~orces the soft clot.
. '.'.
- . ................ . - . . . .................................................... ...... ~ ~ : .
The present invention relates to antiplatelet drugs. Antiplateiet druys include drugs which suppress primary hemostasis by altering platelets or their interaction with other circulatory system components. --~
.::
~...

. ,:~. ,.. ., . ,.. . ,,. . . ,., .. . . , .. . . . .. .. . . . . . .. . . . . .. . .. . . .. .. . .. I .

'"'.'',' "' " '~' ~'"', '.'''.' ,.' ' ', ,'", ' ' '' '; ".''' "" , 1',' .'' '"' W092/06~ PCTIUS91/~7756 2~9~2~ :
..

Reported Developments ' Specific antiplatelet drugs operate by one or several mechanisms. A first example involves reducing the availability of ionized calcium within the platelet cytoplasm thereby impairing activation of the platelet and resultant aggregation. Pharmaceuticals representative of this strategy include prostacyclin, and also Persatine~ (dipyridamole) which may affect calcium concentrations by affecting the concentration of cyclic AMP. Numerous side effects related to the administration of these compounds have been reported.
An additional class of antiplatelet drugs acts by - inhibiting the synthesis of thromboxane A2 within the platelet, reducing the platelet activation response.
Non-steroidal anti-inflammatory agents, such as ibuprofen, phenolbutazone and napthroxane may produce a -~ similar effect by competitive inhibition of a - particular cyclooxygenase enzyme, which catalyzes the synthesis of a precursor of thromboxane A2. A similar ~herapeutic effect may be derived through the administration of aspirin which has been demonstrated to irreversably acetylate a cyclooxygenase enzyme necessary to generate thromb~xane A2. A third anti-platelet mechanism ha~ involved the pla~elet membrane 50 as to inter~ere with surface receptor function. Or,e such drug is dextran, a large branched polysaccharide, which is beliQved to impair the interaction of ;~
~ibrinogen with platelet receptors that are exposed during aggregation. Dextran-is contraindicated for patients vith a history of renal problems or with cardiac impairment. ~he ther~peutic ticlopidine is stated to inhibit platelet adhesion and aggregation by suppressing the binding of von Willebrand factor and/or .

W~2~0~ PCT/VS91/077~6~
2~9~2ra9 fibrinogen to their respective receptors on the platelet surface. However, lt has been found that ticlopidene possesses insufficient specificity to eliminate the necessity of administering large doses which, in turn, may be associated with clinical side effects.

.
The aforementioned pharmaceuticals are ~oreign to the body and may cause numerous adverse clinical side effects, there being no way to prevent such compounds from participating in other aspects of a patient's physiology or biochemistry, particularly if high doses are required. It would be desirable to provide for pharmaceuticals having such specificity for certain of the reactions o~ hemostasis, that they could be ~:
administered to patients at low doses, such doses being -much less likely to produce adverse effects in ~;
patients.
,:
An example of a pharmaceutical which is representative of a therapeutic that is derived from -~
natural components of the hemostatic process is ;;
described in EP0 Publication No. 317278. This publication discloses a method ~or inhibiting thrombosis in a patient by administering to the patient a therapeutic pol~peptide comprised o~ the amino-terminal region Or the ~ chain of platelet mem~rane glycoprotein Ib, or a subfragment thereo~.
,~ . .
The present invention is directed to the provision of antithrombotic polypeptides derived from von Willebrand factor, one of the proteins of the hemostatic mechanism.

WOg2~06~ PCTlUS91/07756 S~mmary of the_Present Invention In accordance with the presant invention, there is provided a polypeptide patterned upon a parent polypeptide and comprising the amino acid sequence of that fragment of mature von Willebr~nd ~actor subunit which beings approximately at residue 441 (argininP) and ends at approximately residue 733 (valine), or an~
subset thereof, in which one or more of the cysteine ;~
residues normally present in the parent polypeptide~ or subset thereof, have been deleted and/or replaced by one or more other amino acids, said polypeptide having therefore less tendency than the parent polypeptide, or - subset thereof, to form intra or interchain disulfide bonds in aqueous media at a physiological pH. ;
,~
The polypeptides of the invention are expressed in ~ .
~ both recombinant bacterial and recombinant eucaryotic ; ~ host cells.

Modification in accordance with the present inv ntion of a paren~ polypeptide by dPleting or replacing one or more cysteine residues normally presant in the parent polypeptide, or subset thereof, results in a polypeptide having }ess tendancy than the p~rent polypeptide, or~ subset thereof, to ~orm intrachain or interchain disulfide bonds in aqueous media at physiological pH. The practical effect o~ :
this is that the polypeptide o~ the present invention : ;
exhibits a higher degree of therapeutic activity than the parent polypeptide and improved stability and solubility. For convenience, a polypeptide of the present invantion is o~ten referred to herein as being "~utant". . .
- ~ .'.
, .

, . . . - , ~ . . . .

WOg2/~ PCT/US91/~7756 .

In pra~erred ~orm, it is recommended that the invention be practiced by substituting ~or one or more cysteine residues particular amino acid residues which -are expected to not significantly alter the predetermined tertiary structure of the parent cysteine-containing vWF polypeptide or fragment thereof. This contributes to maintaining the :
therapeutic potency of the mutant polypeptide. :;
Preferred amino acid replacements include glycine, serine, alanine, threonine and asparagine, with serine, .:
alanine and glycine being preferred. -Another aspect of the invention is based upon the discovery that cysteine residues 509 and 695 of the ` :~
mature von Willebrand factor subunit nor~ally form an .::
intrachain disulfide bond which confers upon the ` :
subunit, or a fragment thereof, a particular tertiary ::
structure which is involved in ~he binding of von ::
Willebrand factor, or of a therapeutically useful :
polypeptide derived therefrom, to the glycoprotein Ib ;
receptor of platelets. Accordingly, another aspect o~
the invention comprises a polypeptide comprising the -~:
amino acid sequence from approximately residue 441 :.
(arginine~ to approximately residue 733 (valin~) o~ . :
mature von Willebrand ~actor subunit, or any subset of said sequence which contains residues 509 ~cysteine) ;
and 695 (cysteine), wherein one or more of cysteine residuss 459, 46~, 464, 471, and 474 are deleted or , ~ :
replaced by one or ~ore other amino acids A preferred polypeptide is one in which each of cysteine residues 459, 46Z, 464~, 471 and 474 is replaced by a glycine -`
residue and in which cysteine residues SO9 and 695 are linke~ by an intrachain disulfide bond. `

WO9~06~ PC~/US91/0775~

h~ 9 ~

Another aspect o~ the present invention is the provision of a therapeutic composition which comprises a therapeutically effective amount of a polypeptide of the present invention and a pharmaceutically acceptable carrier therefor.
.
Still another aspect of the invention provides a method of inhibi~ing thrombosis in a patient which comprises administering to the patient an effective amount of one or more of the therapeutic compositions of the invention. It is expected that therapeutic compositions comprising one or more of the polypeptides of this invention will be substantially less toxic or cause fewer adverse physiological effects in patients than currently available antiplatelet drugs such as dipyridamole.

A preferred method for ~enerating the polypeptides of the present invention is to subject a DNA nucleotide sequence coding for the von Willebra~d factor subunit, or fragments thereof, to mutagenesis resulting in the deletion of cysteine residues, or their replacement by other amino acid species. The resultant encoding DNA
may be inserted into recombinant bacterial host cells for expression o~ the v~F polypeptide.

The invention provides also ~or eucaryotic host ~
cells containing recombinant vWF DNA-sequences from ~ :
which are expressed therapeutically-active polypeptides related to the 52/48 kDa-tryptic fragment or domain of vWF. The polypeptides are suc_essfully secreted from the host cells.

W092/06~ PCT/US9t~07756 ' ' - 2~9~
8 ;
The polypeptides expressed in this way have certain advantageous features when compared with polypepti~es expressed from racombinant bacterial host -~
cells.
'-' 1) The polypeptides of the present invention assume three dimensional structures which are characteristic o~ the domain which exists in mature circulating von Willebrand factor and they have properly formed disulfide ~onds.
2) The polypeptides of the present invention are closer analogs o~ the natural vWF 52/48 functional domain in that they have the glycosylation characteristic of said domain.

Such polypeptides, when present in monomeric form, may be used as antithrombotic agents. In dimerized form (which dimerization further validates that the polypeptides have natural structural domains), they can be used as antihemorrhagic agents. The therapeutic properties of polypeptides o~ the present invention can be enhanced by altering the glycosylation thereof, as described in detail hereinbelow.

Of importance to the proper three-dimensional folding and secretion of the polypeptides o~ the invention is tha initial attachment thereto o~ a signal peptide ~equence which is also e~fective in causing searetion of other polypeptides ~nrelated to vWF from the same or other-host cells. - -.. . ~
In accordance with the practice of this invention, -~ :
there are provided therapeutically useful polypeptides which are effective in preventing adhesion o~ platelets ` WOg~/O~ PCT/US91/07756 4 ~ ~ ~
.
g .
to surfaces, in inhibiting activation or a~gregation o~
platelets, and in inhibiting thrombosis. More ~.
specifically there are proYided glycosylatèd polypeptides which are effective in inhibiting the binding of von Willebrand factor multimers to platelets :.
. and which are created by expression in mammalian cells ; of mutant human von Willebrand factor subunit DNA
sequences. Such polypeptides show less tendency than homologous non-mutant polypeptides to form interchain .:
disulfide bonds which tend to adversely affect the therapeutic utility thereof~
.
Accordingly, there is provided a polypeptide patterned upon a parent polypeptide and comprising the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 441 (arginine) and ends at approximately .
residue 733 (valine), or any subset thereof, wherein one or more of cysteine residues 459, 462 and 464 are .
deleted and/or replaced by one or more other amino acids, and wherein said polypeptide has less tendency r than said parent polypeptide to form interchain disulfide bonds. . - :
~ .
It is belie~ed that this aspect of the invention will be most commonly practiced by substituting ~or one or more o~ the specified cysteine reæidues particular amino acid residues which do not signi~icantly alter the pre~etermined tertiary structure of the parent cysteine-containing vWF polypeptide, or-of a fragment thereof, thereby maintaining the therapeutic potency of the mutant polypeptide. Suitable amino acid replacements include glycine, serine, alanine, -:

: ~VOg~./Q~ PCT.rUS91/077~6 ~, , . .
' , ';' " 2~ 2~9 10 threonine or asparagine with alanine and glycine being ~ost preferred.

The present invention is concerned also with the preparation by recombinant DNA~directed methods of a-monomeric and properly glycosylated ~ragment of von -Willebrand factor subunit which is useful in inhibiting thrombosis in a patient. The recombinant methods minimize the production of structures which tend to adversely affect the desired therapeutic activity of the desired monomeric form of the fragment, ~or example, dimers, multimers, or aggregates of said ~.
fragment. Accordingly there is provided a process for producing from DNA corresponding to that fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately .
residue 441 (arginine) to approximately residue 730 (asparagine), a biologically active monomer of ~aid subunit fragment having an apparent molecular weight by SDS-polyacrylamide gel electrophoresis of approximately 52 kDa which process comprises the steps of: .-(A) constructing a DNA sequence encoding the subunit fragment which contains upstream from ~
the fragment encoding region ~hereof, and in ~.
proper reading frame there~or, a signal peptide sequence;
(B) mutagenizing the DNA sequence to reduce the number o~ cysteine codons capable of specifying cysteine residues normally involved in interchain disulfide contacts;
(C) inserting the DN~ sequence into a suitable vector to create a construct comprising an :
expression plasmid or viral expression vector, said construct being capable of ~:

~ . .

.; , ,. .. , . , ' ' . ' . .. ' , , . - ', - . ' ~,, , ., , -.. ~... . '. . '.. , ,. , .,, ' : ' :' ' .. : .

W092/~6~ PCT/US~1/077S6 .

' ;:'' directing the expression in and secretion from eucaryotic cells of said monomeric ` subunit fragment;
:~ (D) transforming a eucaryotic host cell with said construct; and (E) culturing said transformed host cell under ~ -conditions which cause expression within and secretion from said host cell of the .:~
monomeric subunit fragment, said conditions .
also permitting glycosylation of said : ~ fragment.

The present invention is also concerned with the .- .
preparation of polypeptides which are useful in the treatment of hemorrhagic disease such as von Willebrand disease (vWD). Speci~ically, the present invention is ~
,~ ~ concerned with preparation by recombinant DNA-directed :
methods of particular ~ragments o~ von Willebrand ~:
factor which fragments are capable of performing a bridging function between the GPIb(a) receptor o~ the platelet me~brane and ~ similar receptor on another platelet cell, or between such a receptor and .
components of the subendothelium including collagen, ~ .
thereby performing the crucial physiological role of native multimeric von Willebrand fac~or in affected indivi~uals. Accordingly there is provided a process rox producin~ from ~NA corresponding to that monomeric fragment of mature von Willebrand factor subuni~ :.
comprising essentially the amino acid sequence from : approximately residue 441 (arginine) to approximately residue -730 (asparagine), or a subfragment thereo~
containing one or ~ore of residue positions 4S9, 462, ~ ~, and 464, a biologically active dimer of said monomeric ~ W092~06~ PCT/US91/~7756 ` 2~25~
`. .
~` 12 .`::
.:3 :`:
fragment or subfragment which process a~mprises the -:
; steps of: ' :
~ (A) constructing a DNA sequence encoding the . -:
., monomeric fragment or subfragment which .further~contains upstream from the fragment .:
encoding region thereof and in proper reading frame therefor, a signal peptide sequence;
(B) inserting the DNA sequence into a suitable .~:~
vector to create a construct comprising an expression plasmid or viral expression vector, said construct being capabls of directing the expression in, and secretion :
from, eucaryotic cells of said monomeric . , .~! fragment or subfragment;
(C) transforming a eucaryotic host cell ~ith said ~: . construct;
(D~ culturing said transformed host cell under conditions that cause expr~ssion within the host cell and secretion therefrom of the dimeric form:of the monomeric fragment or : : subfrag~ént and under which the~monomeric fragmént or subfragment assumes a tertiary structure ~uitable for dimerization and the dimerization thereof, and undar which there is e~fected glycosylation of said monomeric subunit fragment or subfragment or of a dimeric ~o~m thexeof.
.
Another~ spect~of:the invention:is based upon the discovery that the ri~stocetin-induced interaction ::. ` :~
~ 30 between cloned 116 kDa vWF fragment and platelets can : : be enhan~ed by reducing the amount of glycosylation on the 116 kDa fragment.~ This discovery is useful in the ~-design of additional polypeptides effective in the , ~.
' `; ;~ ' ' ` ' '' ' . I ; ; A . ~; ~, I ~0~2/06~ PCT/U~91/077~6 2 ~ 2 'a ~j treatment of thrombosis or o~ von Willebrand disease.
Accordingly, there is provided a mutant polypeptide patterned upon a parent polypeptide which comprises the amino acid sequence of that fragment of mature von S Willebrand factor subunit which begins approximately at .:~
residue 449 (valine) and ends at approximately residue :
- 728 (lysine), or a dimer thereof, from which parent one ;:-or more serine, threonine or asparagine residues which - are sites of O- or N-linked glycosylation have been ~:
deleted or replaced by one or more other amino acids, said mutant polypeptide having less glycosylation when said mutant polypeptide is expressed from recombinant DNA in a host eucaryotic cell than the species of the parent polypeptide having an apparent molecular weight of 52 kDa, as measured by SDS-polyacrylamide gel electrophoresis.

It is believed the invention, and the mutagenesis and protein expression procedures thereof, will be widely practiced in the art to generate mutant mature : 20 von Willebrand factor subunit fragments with improved solubility, stability and therapeutic activity. :~

Although the invention is described initially in connection with the expression and secretio~ ~rom mammàlian cells of certain glycosylated ~ragments of mature von Willebrand factor having therapeutic :
utility, it should be understood that it is applicable also to the expression in mammalian cells of other therapeutic polypeptides in which secretion from said cells of said polypeptides is facilitated by an additional sequence o~ amino acids which are also encoded by a DNA for the therapeutic polypeptide and which comprise human von Willebrand factox signal ~ : r ` W092/06~ PCT/US91/07756~ :

', 20~s2~9 1~
peptide, or a subset thereof, and the amino terminal region o~ the von Willebrand factor propeptide. :-: Accordingly, there is also provided a polypeptide ~hich -, is capable of directing the transport of additional polypeptide sequence across the membrane of the endoplasmic reticulum of a cell and which is comprised of a domain (A) and a domain (B~ as follows: -domain (A) any subset of the signal :
peptide of human von ~o Willebrand factor subunit which signal peptide is capable of being recognized by the endoplasmic reticulum and/or by translocation . 15 receptors which complex with `~
the endoplasmic reticulum and/or the signal peptide; and domain (B) a peptide sequence consisting ::
- essentially of up to the first ~ :
ten residues of the amino :~:
terminal end of von Willebrand factor propeptide;
: said domain (B) being connected by amide linkage to the carboxy terminus of domain (A) a~d capable of being connected by amide linkage to the amino terminus of said additional polypeptide sequence; which polypeptide comprising domain (A) and domain (B) contains a .
sufficient subset Or the sequence of the human ~on ~ ~ .
Willebrand factor signal peptide and propeptide to facilitate cleavage in a manner such that there remains attached to the amino terminal end of the additional polypeptide sequence a subset of the sequence derived from domains (A) and (8), and wherein therapeutic .

,", , . ~
.~,'' '.~.

W09 ~n6~ PCT/US91/077~6 .

`~ activity of ~he additional polypaptide sequence is . retained in whole or part.

Speaking more generally, there is also proYided a process for producing from DNA a therapeutic polypeptide comprising:
(A) constructing a DNA sequence encoding the therapeutic polypeptide which contains - upstream ~rom the polypeptide encoding region thereof, and in proper reading frame therefor, a DNA sequence which itself corresponds to a signal peptide ~nd directly ; -:~
downstream therefrom a semipolar or polar spacer se~uence;
(B) inserting the resultant DNA sequence into a :
suitable vector to create a construct -~:
comprising an expression plasmid or viral expression vector which is capable of directing the exprèssion in and ~ecretion from eucaryotic host cells of said `
therapeutic polypeptide; ~
tC) transforming a eusaryotic host cell with said : :
construct; and (D) culturing said transformed host cell under conditions which cause expression within and secretion from said host cell of the therapeutic polypeptide.

Brie~ Description of the Drawlnq.s Pigure l is a table which shows the previously reported amino acid and DNA sequence for the mature von Willebrand factor subunit (human) between residue 431 and residue 750.

~ . . .. .. . . . . . . .
.. . , .~ . . - .. . . - . ~ .

W092/06~ PCT/US91/07756 .~ , .. .

~, F ~ re 2 ~s a graph whlch shows the inhibition of botrocetin-induced binding of vWF to platelets by a ` cysteine-free mutant polypeptide of the present invention.
. : :
Figure 3 is a graph which shows the inhi~ition of the binding of an anti GPlb monoclonal antibody to platelet by a mutant polypeptide of the present ;~
invention.

.
Figure 4 is a map of pCDM8 plasmid.

Definitions ~-.

Unless indicated otherwise herein, the following terms have the indicated meanings.

Codinq Sequence (Encodin~ DNA~ - DNA sequances which~
in the appropriate reading frame, code for the amino acids of a protein. For the purpose of the present invention, it should be understood that the synthesis or use of a coding sequence may necessarily involve synthesis or use of the corresponding complementary strand, as shown by: 5'-CGG-GGA-GGA-3'/3/-GCC CCT CCT-5' which "encodes" the tripeptide NH2-arg-gly-gly-CO2H.
A discussion of or claim to one strand is deemed to refer to or to claim the other strand and ~he double `
stranded counterpart thereof as is appropriate, useful or necessary in the practice of the art. ~-cDNA - A DNA molecule or sequence which has been enzymatically synthesized from the sequence(s) present in an mRNA template.
.. ~

W0~2/06~ PCTJU~9i/077~
.

; ..
;j 17 Tra~scribed Strand - The DNA strand whose nucleotide sequence is read 3' ~ 5' by RNA polymerase to produce mRNA. This strand is also re~erred to as the noncodinq strand.
.:~
Coding_Strand or Non-Transcribed Strand - This strand ` is the antiparallel compliment of the transcribed strand and has a base sequence identical to that of the ~RNA produced from the transcribed strand except that thymine bases are present (instead of uracil bases of the mRNA). It is referred to as "coding" because like ~' mRNA, and when examined 5' ~ 3', the codons for- translation may be directly discerned.

~, Bioloaical Activity - One or more functions, ef~ects of, activities performed or caused by a molecule in a - 15 biological context (that is, in an organism or in an 'n vitro facsimile). A characteristic biological activity of the 116 kDa homodimeric fragment of the mature von Willebrand factor subunit is the potential ability to ~, bind to more than one platelet GPIb receptor thereby - 20 enabling the molecule to facilitate aggregation of platelets in the presence of ristocetin. Other resultant or related effects o~ the 116 kDa species include ~unction as a thrombotic and the induction of platelet activation, and/or adhesion to surfaaes.
Similarly, a characteristic biological activity of the 52/48 kDa monomeric fragment of the mature von Willebrand factor subunit is the potential ability to bind to only one platelet GPIb receptor thereby enabling the molecule to inhibit botrocetin-induced binding of multimeric vWF to platelets. Other - resultant or related effects of the undimerized 52/48 kDa species include inhibition of platelet activation, W~ g2~ g9 PCr/USgl/07756 -`` ~Q~42~9 .. . .

aggregation, or adhesion to surfaces, and the ~ inhibition of thrombosis.

; Reducinq Conditions - Refers to the presence of a "reducing" agent in a solution containing von Willebrand factor, or polypeptides derived therefrom, which agent causes the disruption of disulfide bonds of j the vWF. However, consistent with u-~age typical in the art, the "reducing" agent such as dithiothreitol (DTT) causes a vWF disulfide bond to be broXen by forminq a disulfide bond between a vWF cysteine and the DTT with no net change in oxidation state of the involv~d sulfur atoms. , - `
~, . J ~ .' Promoter - DNA sequences upstream from a gene which promote its transcription.

Clonin Vehicle (Vector) - A plasmidj phage DNA or other DNA sequence which is able to replicate in a host cell, typically characterized by one or~a small number of endonuclease recognition si~es at which such DNA
sequences may be cut in a determinable fashion for the insertion o~ heterologous DNA without attendant loss of an essential biological function of ~he DN~, e.g., -replication, production of coat prot~ins or loss o~
expression control reglons such as promoters or binding sites, and which may contain a selec~able gene marker suitable for use in the identification of host cells trans~ormed therewith, e.g., tetracycline resistance or ampicillin resistance.
, Plasmid - A nonchromosomal double-stranded DNA sequence comprising an intact "replicon" such that the plas~id is replicated in a host cell. When ~he plasmid is . .

.. . . .. . . . .. . .

WOg2/06~ PCT/US91/07756 .

` .~
."` 19 .
~` placed within a procaryotic or eucaryotic host cell, the characteristics of that cell may be changed (or transformed) as a result of the DNA of the plasmid.
For example, a plasmid carrying the gene for -~ 5 tetracycline resistance ~TetR) transforms a cell previously sensitive to tetracycline into one which is resistant to it. A cell transformed by a plasmid is called a "transformant.l' , .
Expression Plasmid - A plasmid into which has been inserted the DNA being cloned, such as the von Willebrand factor structural gene. The DNA sequence inserted therein may also contain sequences which - con~rol the translation of mRNA resultant therefrom, and contai~ restriction endonuclease sites which - 15 facilitated assembly of, and may facilitate further modification of, said expression plasmid. An ; expression plasmid is capable of directing, in a host cell, the expression therein of the encoded pol~peptide and usually contains a transcription promoter upstream - 20 from the DNA sequence of the encoded structural gene.
.` An expression plasmid may or may not become integrated into the host chromosomal DNA. For the purpose of this invention, an integrated plasmid is nonetheless referred to as an expression plasmid.

Vi~l Expres~ g~Q~ - A viral expression vector is similar to an expression plasmid except that the DNA
may be packaged into a viral particle that ca*
; transfect cells through a natural biological process.

Downstream - A nucleotide of the transcribed strand of a structural gene is said to be downstream from another section of the gene if the nucleotide is normally read `: :

W092/06 ~ PCT/US91/07756 ";
` 2Q94~5~ ~ :

' ;.
~l by RNA polymerase after the earlier section of the ~ gene. The complimentary nucleotide of the - nontranscribed strand, or the corresponding base pair within the double stranded form of the DNA, are also ,-~- 5 denominated downstream.

-l - Additionally, and making reference to the "' ;,~ direction of transcription and of translation within ` - the structural gene, a restriction endonuclease ' ,~ sequence added upstream ~or 5') to the gene means it is ' ' added before the sequence encoding the amino terminal ~, end of the protein, while a modification created downstream (or 3') to the structural gene means that it is beyond the carboxy terminus-encoding region thereof. ''',, von Willebrand ~actor (vWFl - It is understood that all ' '-references herein to von Willebrand factor refer to vWF ;'.
in humans. The term "von Willebrand factor" is intended to include within its scope any and all of the ''~-terms which are defined directly below.

Additionally, von Willebrand factor is found as a '~
component of the subendothelial matrix, as a component "~
of the ~-granules secreted by activated platelets, and as a circulating blood plasma protein. It is possible that the three-dimensional subunit structur~ or multisubunit struc~ure of vWF varies in these different contexts potentially caused, for example, by di~erences in glycosylation. Such differences do not ~ ' -prevent useful therapeutic,vWF-derived,polypeptides ~xom being produced from the vWF DNA sequences of endothelial cells or megakaryocytes according to the practice of this invention.
.

WOg~06~ PCr/US91/07756 ,....... :
`"` - 2~2~9 ,, 21 Furthermore it is possible ~bat there are minor biologically unimportant differences betwee~ the actual DNAs and polypeptides manipulated or otherwise utilized ~ in the practice of the invention and the structural ,~,, 5 , sequences of amino acids or nucleotides thereof as reported herein. It is understood that the invention , encompasses any such biologically unimportant , variations.
, .
;- Pre-pro-vWF,- von Willebrand factor is subject to extensive posttranslational processing. "Pre-pro-vWF"
contains (from the N to the C terminus) a signal peptide comprised o~ approximately 22 amino acid --~ residues, a propeptide of approximately 741 amino , -acids, and then the approximate 2,050 residues of circulating vWF.

;; Pro-vWF - The signal peptide has been removed from pre-pro-vWF.

Mature vWF - Circulating vWF as found in the plasma or ~ as bound to the subendothelium. It consists of a -~ 20 population o~ polypeptide monomers which are typically j ~ associated into numerous species of multimers thereof, ~': each subunit o~ which being 2,050 residues in length.
Additionally, when expressed in mammalian cells, mature vWF is usually glycosylated.

Signal Peptide ~Sequ~nce~ - A signal peptide is the sequence of amino acids in,a,newly transIated polypeptide which signals translocation of the polypeptide across the membrane of the endoplasmic reticulum and into the secretory pathway of the cell. :
A signal peptide typically occurs at the beginning ; :.:

'-~

~j,.,,,,, ,.,, .,,,,,,,,,,.... ,,.,,,,,., ,,,.:, ~; :;

wo ~06~ 2 ~ 9 ~ 2 ~ 9 PCT/US91/077~6 : . ' ' ~ 22 `~ ~amino terminus) of the protein and is 20-40 amino ~ ~
acids long with a stretch of approximately 5-15 -hydrophobic amino acids in its center. Typicaily the signal sequence is proteolytically cleaved from the protein during, or soon after, the process of translocation into the endoplasmic reticulum. That -portion of a gene or cDNA encoding a signal peptide may also be referred to as a signal sequence.
. .
Table 1 shows the standard three letter designations for amino acids as used in the -application.

TABLE I
Alanine Ala Cysteine Cys Aspartic Acid Asp Glutamic Acid Glu Phenylalanine Phe Glycine Gly ~ Histidine His - Isoleucine Ile ~ Lysine Lys ;~ Leucine Leu Methionine Met Asparagine Asn Proline Pro Glutamine Gln Arginine Arg Serine Ser Threonine Thr Valine Val ~ryptophan Trp Tyrosine Tyr . ~
Detailed Description of the Invention As set forth above, both the antithrombotic and antihemorrhagic polypeptides of the present invention are based upon fragments of the natural occurring ;

':

wo 9~J0699~ Pcr~ussl/b77s6 2 ~ ~

protein von Willebrand factor (hereina~ter "vWF"). For background purposes, there is set forth hereafter information concerning this protein and its role in hemostasis and thrombosis.
~' . .
Description of the Role of vWF
in Hemostasis and Thrombosis . .
vWF perfoxms an essential role in normal hemostasis during vascular injury and is also of central importance in the pathogenesis of acute thrombotic occlusions in diseased blood vessels. Both of these roles involve the interaction of vWF with ~ platelets which are induced to bind at the affected -- site and are then crosslinked. It is believed:that -~ single platelets first adhere to a thrombogenic surface 3' 15 after which they become activated, a process involving major metabolic changes and significant morphological , changes within the platelet. Activation is evidenced by the discharge of platelet storage granules containing adhesive substances such as von Willebrand factor (an ~ adhesive protein), and the expression on the surface of the platelet of additional functional adhesive sites.
once activa~ed, and as a part o~ normal he~ostasis, platelet cells become aggrega~ed, a process which involves extensive crosslinking of the platelet cells with additional types of adhesive proteins.
:::
As stated above, these processes are normal as a physiologic response to vascular injury. ~owever, they may lead in pathologic circumstances, such as in diseased vessels, to formation of undesired platelet throobi with resultant vascular occlusion.

' ' ' ' ~.

,. :

YO ~/0~ PCT/US91/07756~
`` 2Qg42~9 ;~ 24 Other circumstances in whic~ it is desirable to prevent deposition of platelets in blood vessels include the prevention and treatment of stroke, and to prevent occlusion of arterial gra~ts. Platelet thrombus formation during surgical procedures may also interfere with attempts to relieve preexisting vessel obstructionsO '.
.~, .'' .
~' The adhesion of platelets to damaged or diseased -vessels occurs through mechanisms that involve specific platelet membrane receptors which interact with ; specialized adhesive molecules. One such platelet receptor is the glycoprotein Ib-IX complex which consists of a noncovalent association of two integral ~ membrane proteins, glycoprotein Ib (GPIb) and ! 15 glycoprotein IX (GPIX). The adhesive ligand of the GPIb-IX complex is the protein von Willebrand factor [
which is found as a component of the subendo*helial matrix, as a component of the ~-granules secreted by activated platelets, and also as a circulating blood ' 20 plasma protein. The actual binding site of the vNF to the GPIb-IX receptor has been localized on the amino terminal region of the ~ chain of glycoprotein Ib which ! is represented by GPIb(~).
: .
It is believed tha~ ~he interaction o~ multimeric vWF with glycoprotein Ib-IX complex tat GPIbt~)) ~
results in platelet activation and ~acilitates the ~ , recruitment o~ additional platelets to a now growing : -thrombus. The rapidly accumulating platelets are also crosslinked (aggregated) by ~he binding o~ fibrinogen at platelet glycoprotein IIb-IIIa receptor sites, and possibly also by vWF at these sites, and/or at additional glycoprotein Ib-IX receptor sites. In :

WO~06~ P~T/US9~/07756 .~

addition, the glycoprotein IIb/IIIa receptor may also be involved in the ~ormation of the i~itial monolayer of platelets. Of particular importance in this process is the multimeric and multivalent character of ~ 5 circulatiny vWF, which enables the macromolecule to - effectively carry out its binding and bridging functions.
i, Inactivation of the GPIb~ or GPIIb/IIIa receptors - on the platelets of a patient or inactivation of the binding sites for vWF located in the suben~othelium of a patient's vascular system, thereby inhibiting the bridging ability of vWF, would be of great medical i importance for treating or inhibiting thrombosis.
, Accordingly, the present invention relates to the development of polypeptides which are effective in accomplishing the foregoing.
., .
Although preventing unwanted thrombi is of great importance, thsre ars circumstances where promoting thrombus formation is desirable. von Willebrand disease, the most co~mon of the bleeding disorders, is the term used to describe a heterogeneous ~isease state which results when von Willebrand factor is produced in inadequate quan~ities or when circulating vWF molecules are somehow de~ective. Various subtypes of the disea~e have been described. It is apparent that supplying the bridging function o~ vWF is of central importance in the treatment of patients afflicted with von Willebrand disease.` The present invention is concerned also with preparation of fra~ments of von Willèbrand factor capable of performing a bridging function b tween the GPIb(~) receptor or GPIIb/IIIa receptor of the platelet membrane and a receptor on another platelet, or between ':
....

W0~2~06~ PCT/US91~07756 , ::: 2~9~2~9 ` . :
: 26 ` such a receptor and components of the subendothelium, ;~ thereby performing in affected individuals the crucial : physiological role of native multimeric von Willebrand ~` factor.
.~.`, .
. 5 Information Concerning the Structure of vWF
. and the Desian of Therapeutics Derived Therefrom ~:

.~ The domain of the von Willebrand factor subunit which binds to the platelet membrane glycoprotein Ib-IX ~:~
. receptor-(GPIb~)) has been identified within a ~:. 10 fragment of vWF. The fragment may be generated by ~:
~. trypsin digestion, followed by disulfide reduction, and : extends from approximately residue 449 ~valine) of the circulating subunit to approximately residue 728 (lysine) thereof. Current evidence indicates that this ~rl 15 segment also contains (between residues 509 and 695 1: thereof) binding domains for components of the ;~ subendothelium, such as collagen and proteoglycans, : .
although other regions of the mature vWF subunit may be more important in recognizing these substances~(an additional protaoglycan or heparin binding site is :
.~; located in residues 1-272 of the mature subunit and an addi$iona; collagen binding site within residues 910- .
1110 thereo~).
. .
Figure 1 (SEQ ID N0: 1) shows the previou~ly .
reported amino acid and DNA sequence for the mature von Willebrand factor subunit (human) between residue 431 and residue 750~. The 52/48 kDa fragment produced by ~:
tryptic di~estion has an amino terminus at residue 449 (valine) and extends approximately to residue 728 (lysine). Amino acids are shown by standard three .
letter designations. The DNA se~uence is represented by the coding strand (non-transcribed strand). Very ' ; W092/06~ PCT/US91iO7756 `` 2~9~2~9 .~

little polymorphism has been reported in the 52/48 ; human sequence with one significant exception -`~ histidine/aspartic acid at position 709, see Mancuso, D.J. et al. J. Biol. Chem., 264(33), 19514-19527, Table V, (1989). DNA sequences used for the experiments ; described in the Example section below contain an ;
aspartic acid codon for residue 709 ~codon GAC), although placemen~ of histidine at residue position 709 : (the other known naturally occurring amino acid at this position in ths human sequence, codon CAC) is also `l- useful in the practice of the invention.
`, .
With respect to the therapeutic antithrombotic polypeptides of the present invention, the following information concerning vWF is of particular interest.
.
A fragment of mature ~on Willebrand factor having platelet glycoprotein lb(~) binding activity and of approximately 116,000 (116 kDa) molecular weight is ~--isolated by digesting vWF with trypsin. If the 116 kDa fra~ment is treated with a reducing agent;capable of cleaving disulfide bonds, a pair of identical fragments is generated. Each of the identical fragments ~which ~ `
together comprise the 116 kDa polypeptide) has an apparent molecular we~ght of about 52,000 (52 kDa)c ~Polypeptide moleaular weight are typically measured by ;
migration, relative to standards, in a denaturing gel electrophoresis system. Weight values which result are only approximate.) .= . . - - .:: .
Typically, the S2,000 molecular weight fragment is 30 referred to as a "52/48" fragment reflecting the fact that human enzyme~systems gIycosylate the ~ragment contributing to its molecular weight. The amount of .
~;': ';

,, ., . . .......... . . , . , ~. .. ,. - .. . . .. , . , ~ . .. . . ... .
., . . . . -. . . .. . . . , . .. . . , ,: . ~ - : ,. : ., . -, -WOg2~0~ PCT/US9l/077~6 ~9~2~9 glycosylation varies from molecule to molecule, with two weights, 52,000 and 48,000, being most common.
::
The 52/48 fragment has been demonstrated to have as its amino-terminus residue 449 (valine) of the mature subunit, and as its carboxy-terminus residue 728 (lysine) thereof. Without the additio~al weight contributed by glycosylation, the polypeptide has a molecular weight of approximately 38,000.
. .:
The 52/48 fragment has been demonstrated to competitively inhibit the binding of von Willebrand factor to platelets. However, manipulation of the `
52/48 fragment or its unglycosylated 38 kDa equivalent has proved difficult. Successful manipulation of the fragment has typically required that the cysteine residues thereo~ be reduced and pe~manently alkylated.
Without this treatment, undesired reaction of the cysteine residues thereo~ invariably occurs, leading to the formation of insoluble and biologically inactive polypeptide aggregates unsuited for effective use as therapeutics.
.
It is known that the residue 449-728 ~ra~ment of mature von Willebrand factor subunit, which contains the platelet glycoprot~in Ib(~) binding domain, has cysteine residue~ at positions 459, 462, 46~, 471, 474, 509 and 695. It is known also that all o~ the cysteine residues of the mature vWF subunit are involved in disulfide bonds. tLegaz, et al., J! Biol. Chem., 248, 3946-3955 (1973)). ; - ~ -. .
Marti, T. et al. Biochemistry, 26, 8099-8109 (1987) conclusively identified mature subunit residues ~;

. . .

` W~92~06~ PCT/US91/07756 ' :
471 and 474 as being involved in an intrachain disulfide bond. Residues 509 and 695 were identified as being involved in a disulfide bond, although it was ` not demonstrated whether this pairing was intrachain or interchain (that is, within the same mature vWF
- su~unit).
` ' `:
~ Mohri, H. et al. J. Biol. Chem., 263(34), 17901-'~ 17904 (1988) inhibited the ristocetin-induced binding of I~I-labelled multimeric vWF to formalin-fixed platelets with peptide subfragments of the 449-728 subunit fragment. Peptide sub~ragments fifteen ;~
residues in length were synthesized and tested. Those - peptides which represent subunit sequence contained -within, or overlapping with, two distinct regions, Leu4~ to Asp498 and Glu689 to Val7li were found to be active. ~`
.. .. , ~ ~ . `.
Mohri concluded that the GPIb~) binding domain of `~
vWF was formed by residues contained in two ~ discontinuous sequences Cys47~-Pro488 and ~eu~-Pro7 -` 20 maintained in proper conformation in native vWF by disulfide bonding, although the authors were unable to identify the cysteine residue which formed the stabilizing bond~s) and whether the bonds were intra or interchain.

The present invention provides for polypeptides derived from the residue 449-728 region of the mature von Willebrand factor~subunit which are useful in the treatment of vascular disorders such as thrombosis.

Such ~olecules can be made most efficiently from DNA which encodes that fragment of mature von ':, . ,.,, = .. . . . , ,;. , ;, . , .. . ,, ",, ., ~,, ,, .,, , .,~ , . , ., , .:.

~ . .
W092~06~ PCT/US91/~77~6 ``` 2 ~
: ,:
-~ 30 Nillebrand factor subunit comprising essentially the a~ino acid sequence from approximately residue 441 (arginine) to approximately residue 733 ~valine~, or which encodes any subset of said amino acid sequence, or a mutant polypeptide fragment, or subset thereo~, 1~ which contains fewer cystei~e residues tha~ that of the - comparable wild-type amino acid sequence. A preferred ; method for the preparation of the molecules comprises culturing a host organism transformed with a biologically functional expression plasmid which ;
contains a mutant DNA sequence encoding a portion of said von Willebrand factor subunit under conditions which effect expression of the mutant von Willebrand factor fragment, or a subset thereof, by the host organism and recovering said fragment therefrom.

A preferred means for effecting mutagenesis of cysteine codons in a vWF DNA to codons encoding amino acids incapable of d'sulfide bonding is based upon the site directed mutagenesis procedure of Kunkel, T.A., Proc. Natl. Acad. Sci. U.S.A., 82, 488-492 (1985).
Such ~utant DNA sequences may then be expressed ~rom either racombinant-bacterial or reco~binant eucaryotic -host cell systems.

Fi~st Embodiment of the Invention An important aspect of this embodiment of the invention is the provision of compositions of said vWF-derived polypeptides which are less prone to aggregation and denaturation caused by undesired I -disulfide bonding within the inclusion bodies of host expression cells (or resultant from inclusion body solubilization procedures) than previous preparations. , ;;

:`

~ wo92/n6~ PCT/US91/07756 ``` 2~9~2~9 .
I . . ..
. 31 :
: Tha develcp~ent employs mutagenesis to limit the number ~!~ of cysteine residues present within said polypeptides-;~ Mutagenesis of vWF DNA Encoding The Mature Subunit Residue 449-728 Reqion ' 5 A variety of molecular biological techniques are ~.
available which can be used to change cysteine codons .,` for those of other amino acids.. Suitable techniques include mutagen~sis using a polymerase chain r~action, .. gapped-duplex mutagenesis, and differential - 10 hybridization of an oligonucleotide to DNA molecules :.
differing at a single nucleotide position. For a ~.
; review of suitable codon altering techniques, see : .
Kraik, C. "Use of Oligonucleotides for Site Specific Mutagenesis", Biotechniques, Jan/Feb 1985 at page 12.

. 15 In the practice of this embodiment, it preferred to use the site-directed or site-specific mutagenesis procedure of Kunkel, T.A., Proc. Natl. Acad. Sci. USA, ~ 8~, 488-492 (1985). This proceduxe takes advantage of .
~: a series of steps which first produces, and then selects against, a uracil- ontaining DNA template.
~xample 1 of the present invention explains in detail .;
~` the mutagenesis techniques u~ed to create mutant vWF
cDNA.

.
Other publications which disclose site-directed .
mutagenesis procedures are: Giese, N.A. et al., : Science, 236, 1315 (1987); U.S. Patent No. ~,518,584; ~.
and U.S. Patent No. 4,959,314. ~ :.

It is also preferred in the practice of this embodiment to cause to be substituted for one or more ::
of the cysteine codons of the wild type DNA sequence codons for one or more of the following amino acids~

:
...

W092~06~ P~TIUS91/07756 2~259 alanine, thrRonine, serine, glycine, and asparagine.
Replacement with alanine and glycine codons is ~ost preferred. The selection of a replacement for any particular codon is generally independent of the selection of a suitable replacement at any other position.

The following are representati~e examples o~ the types of codon substitutions which can be made~ using as an example cysteine residue 459:
~) the codon for cysteine 459 could be replaced by a codon for glycine; or -(B) the codon for cysteine 459 could be replaced by two or more codons such as one for serine and one for glycine, such replacement resulting in a new amino acid sequence:
-His45s-ser459(~-Gly459o-Gln~-; or (C) the codon for cysteine 45s could be deleted from the cDNA, such deletion resulting in a shortened amino acid sPquence represented by: ;
_Hi5458-Gln4~-; or (D) one or more codons for residues adjac~nt to cysteine residue 459 could be deleted along with codon 459 as represented by: -Glu457-Gln4~-.

It is conte~plated that codons for amino acids other than alanine, threonine, serine, glycine or asparagine will also be useful in the practice of the invention depending on the particular pri~ary, secondary, tertiary and guaternary environment of the target cysteine residue. - i.

~, . ~ . - - - , ", . .. .-.

W092/06~ PCT/US91/07756 ~

33 :
It is considered desirable in tha practice o~ this embodiment to provide as a replacement for any particular cysteine residue of the 449-728 tryptic vWF -:
. subunit fragment an amino acid which can be ~:
accommodated at the cysteine position with minimal perturbation of the secondary structure (such as ~
~. helical or ~-sheet) of the wild type amino acid .:
; sequence subsegment within which the cysteine position is located. In the practice o~ the present invention, alanine, threonine, serine, glycine and asparagine will generally be satisfactory because they are, like :
cysteine, neutrally charged and have side chains which are small or relatively small in size.
'. '.' . Substantial research has been conducted on the subject of predicting within which types of structuraI
domains of proteins (~-helix, ~-sheet, or random coil3 one is most likely to find particular species of amino acids. Serine is a pre~erred amino acid for use in the practice of this invention because it most closely : .
approximates the size and polarity of cysteine and is ~; believed not to disrupt ~-helical and ~-sheet domains. :.

Reference, for example, to Chou, P.Y. et al., Bioch~ist~, 13(2), 211-222 (1974) and Chou, P.Y. et al., "Prediction of Protein Conformation,"
Biochemist~y, 13(2j, 222-244 (1974) provides further information useful in the selection of replacement amino acids. Chou, P.Y. et al. predicted the secondary ~ -. structure of specified polypeptide seguence segments :;
based on rules for determining which species of amino :
acids therein are.likely to be found in the center of, :
for example,:an alpha helical region, and which . -residues thereof would be likely to terminate ~ ~-- , : ., ......... -, - - , , . . . . .. . . ,. .: . -. ~ , ' ! . - . ,., .: . . , ,.. . . , , " , . " , ... " , " ,, , . ~ , " ,. ... ~. .

W092~06~ PCT/US91/07756 ~
.,`" ` ' . . ''.
~ 2~42~9 `~ 34 ~`~ propagation of a helical zone, thus becoming a boundary ~;' residues or helix breakers. Acoording to Chou, P.~. et al., supra, at 223, cysteine and the group of -threonine, serine, and asparagine are found to be indifferent to ~-helical stru~ture, as opposed to being ; breakers or formers of such regions. Thus, threonine, serine and asparagine are likely to leave unperturbed an ~-helical region in which a potential target cysteine might be located. Similarly, glycine, alanine lQ and serine were found to be more or less indifferent to the formation of ~-regions. It is noted that serine, threonine and asparagine residues represent possible r -new sites of glycosylation making them potentially unsuitable replacement residues at certain positions in secretory proteins subject to glycosylation.

` Generally, the primary consideration which should be taken into account in connection with selecting ~ suitable amino acid replacements is whether the - contemplated substitution will have an adverse effect on the tertiary structure of the fragment. Thus, other amino acids may be suitable as acceptable~substitutes for particular cysteine residues as long as the new ~ residues do not introduce undesired changes in the - tertiary structure of the 449-728 ~ragment. Reactivity with NMC-4 antibody is recommended as a test of whether a mutant polypeptide has the desired therapeutic properties.

Particularly preferred ~utant polypeptides of the pr~sent invention are patterned upon a monomeric form of the residue 449-728 domain of the m~ture subunit fragment, as opposed to a dimer thereof which could provide a bridging function between two platelets.

.~ ~, . .... .... . ....... .. .

, -, ~ WOg2~06~ PCT/US91/07756 ;~ ~
2 ~
`.
` ` 35 Normally, those codons in a vWF DNA fragment for speci~ic cysteines which normally participate in - -~ intsrchain disul~ide bonding should be replaced.
; Cysteine codons encoding residues which form intrachain disulfide bonds should~be left unmutated, i~ the intrachain bond is demonstrated to con~er upon the subunit fragment important structural features, and if conditions can be found which allow the intrachain bond to form properly~

More specifically, preparation of a mutant polypeptide fragment which corresponds to that fragment of mature von Willebrand subunit having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 733 (valine), but which differs ', 15 therefrom in that each of the cysteine residues thereof is replaced by a glycine residue is disclosed. .

The embodiment also teaches that retention of a certain disulfide~bond within polypeptides ~ ;
corresponding to the 449-728 vWF subunit region is particularly important for the design of therapeutic ~-~- molecules derived therefro~. In this regard there is provided a mutant vWF fragment expressed by p5E
plasmids, as described in ~xample 4, and containing an intrachain disulfide bond.
.,, . ~
Important factors in~olve~ in the design of pre~erred mutant polypeptides of the invention are described hereafter. - - -., - , -~ . :
Potential binding sites for collagens and heparin-like glycosaminoglycans exist in the 449-728 tryptic fragment in the loop region between cysteine residues "~ .
~;

W092~06~ PCT/US91/07756~

2 ~ 9 509 and S95. In the event that binding at these sites impairs the antithrombotic therapeutic utility of the -~ molecule by, for example, also providing bridging to collagen, the polypeptide can be redesigned (for example, by chemical synthesis or proteolysis) to delete the loop region.

von Willebrand factor polypeptides derived from bacterial expression systems substantially lack the - glycosylation vWF normally acquires as a re~ult of 1o post-translational processing such as in the Golgi apparatus or Weibel-Palade bodies. The present invention includes within its scope molecules which are made by E.coli BL21~DE3) or other suitable procaryotic host cells and which are enzymatically or chemically ; 15 glycosylated to more resemble the molecules expressed ; by mammalian cells.

Alternatively, the ~NA encoding sequences can be tranferred to expression plasmids or viral expression j vectors capable of causiny expresion in mammalian host ~;
cells to provide normal glycosylation.

It has been established that both platelets and von Willebrand factor molecules contain large numbers of negative charges such as, for example, those contributed ~y sialic acid. Such charges aan facilitate desirable mutual repul~ion o~ the molecules under non-injury conditions. The addition of one or more positively charged residues of lysine and~or of arginine extending from the amino and/or from the carboxy terminus of the 52/48 tryptic frag~ent or recombinant equivalents thereof can overcome electrical repulsions with respect to the ~PIb-IX receptor W092/0~ PCT/US~1/07756 ' ~ 37 2~2~
~acilitating use of the fragment as an antithrombotic therapeutic.

In addition, and with respect to polypeptides patterned upon the 449-728 vWF subunit fragment, it is within the scope of the invention to remove certain cysteine residu~s by site directed mutagenesis and thereaftex inactivating any remaining cysteine residues by chemical inacti~ation thereof, such as, for example, by S-carboxymethylation.
~ , .', A mutant polypeptide that is insoluble can be made ,-~
soluble by covalently linking to i~ a subdomain of a ~-- water soluble polymer, for example, a polyacrylamide. !, Other techniques can also be used to impart solubility : to an otherwise insoluble polypeptide.

In light of the aforementioned, which is generally applicable to all the polypeptides of the invention, ;~
there follows hereafter a discussion of means by which mutant polypeptides of the first em~odiment of the invention can be prepared.
.. ...
To accomplish this, a cDNA clone encoding the von Willebrand factor gene (for the pre-propeptide) was' utilized. ~he cDNA was then subjected to enzymatic ampli~ication in a polymerase chain reaction using oligonucleotides which flanked the indicated r~gion.
The first oligonucleotide representing coding strand DNA contained an EcoRI site 5' to-the codon ~or residue 441 (arginine) and extended to the codon for residue , 446 (glycine). The second oligonucleotide, corresponding to non-coding strand DNA, encoded amino acids 725 to 733 and encoded 3' to codon 733 a HindIII
~ .

;':

~092/06~ PCT/US91/07756 2~2~

restriction sequence. The resultant double stranded : von Willebrand factor cDNA corresponding to the amino - acid sequence ~rom rasidue 44~ to residue 733 ~of the mature subunit) was then inserted, using EcoRI and - 5 HindIII restriction enzymes, into the double stranded replicative ~orm of bacteriophage M13mpl8 which contains a multiple cloning site having compatible EcoRI and HindIII sequences. Following the procedure ~ of Kunkel, T.A., Proc. Nat-l. Acad. Sci. USA, 82, 48 : 10 492 (1985), site directed mutagenesis was performed using hybridizing oligonucleotides suitable for replacing all of the cysteine codons (residue positions ~:
4S9, 462, 464, 471, 474, 509 and 695) with individual glycine codons (see Example 1) or, for example, 5 of the cysteine codons, residue positions 459, 462, 464, 471 and 474, with individual glycine codons (see Example 4). Mutant double stranded vWF cDNA fragments derived from the procedure were removed from M13mpl8 ~; phage by treatment with EcoRI and HindIII restrictionendonucleases, after which the ends of the vWF cDNA
fragments were modified with BamHI linkers.
~, The two types of mutant vWF cDNA, containing either 5 or 7 Cys to Gly mutations, were then : separately cloned into the pET-3A expression vector (see Rosenberg, A.H. et al., Gene, 56, 125-136 (1987)) for expres3ion ~rom E.coli strain BL21(DE3), Novagen Co., ~adison, WI. pET-3A vehicle containing cDNA for the vWF subunit fragment with 7 cysteine-to-glycine mutations is referred to as "p7E", and as "p5E" when the contained vWF cDNA fragment encoded:the 5 above specified cysteine-to-glycine mutations. Mutant von Willebrand factor polypeptides produced by bacterial cultures containing expression plasmid p5E were WO ~/06~ PCT~US91/~775S

, S~ r~ ~ ~

39 `~
.
compared with those expressed from cultures containing p7E plasmids. The p5E molecule is capable of forming a disul~ide bond between cysteine residue 509 and 695 whereas the p7E molecule cannot.
.; ,,~, .
The mutant polypeptides were nok secreted by the ; bacterial host cell~, but rather accumulated in poorly -~
soluble aggregates ("inclusion bodies"~ from which the polypeptides were successfully solubilized following the procedure of Example 1 (p7E) and Example 4 (p5E~.
Polypeptides expressed from p7E and p5E plasmids were characterized by SDS-polyacrylamide gel electrophoresis and immunoblotting (Examples 2 and 5). Under reducing conditions both plasmids express polypeptide species ` having an apparent molecular weight of approximately. ~`
38,000 as measured by SDS-polyacrylamide gel .
electrophoresis, as would be predicted from the unglycosylated molecular weight of the expected amino ~, acid sequences.
: - , The behavior of p5E and p7E extracts was examined using immunologiral methods (see Example 5). vWF-speific murine monoclonal antibodies RG-46 and NMC r4 were used as probes. RG-46 ha~ been ~emonstrated to , `
recogniza as its epitope a linear sequence of amino acids, comprising residues 694 ~o 708 within the mature von Willebrand ~actor subunit. The binding of this antibody to its dete~minant is essentially con~ormation `
independent. Mohri,~ ~. et al., J. Biol. Chem., 263(3~), 17901-17~04 ~1988). ~ `
- . . --. . . . .: ; . ~; :
NMC-4 however, has as its epitope the domain of the von Willebrand factor subunit which contains the glycoprotein Ib binding activity. Mapping of the -WOg2~6~ PCT/US91/07756 - ' 2`~ 9 epitope has demonstrated that it is contained within two discontinuous domains (comprising approximately mature vWF subunit residues 474 to 488 and also approximately residues 694 to 708) brought into disulfide-dependent association, Mohri, H. et al., supra, although it could not be determined whether the disulfide bond conferring this tertiary conformation in the native vWF molecule was intrachain or interchain.
Id. at 17903.

Accordingly, 7.5 ~g samples (of protein) were first run on 10~ SDS-po}yacrylamide gels so that the antigenic behavior of particular bands (under reducing and nonreducing conditions) could be compared with results obtained by Coomassie blue staining.
Immunoblotting ('tWestern Blotting") according to a standard procedure, Burnette, A. Anal. Biochem., 112, - 195-203 ~1981), was then performed to compare pSE and p7E extracts.

It has been determined that, under nonreducing conditions, the single chain p5E pol~peptide fragment (representing the seguence from residue 441 to re~idue 733) displays an approximate 1~0 fold increase in binding a~finity ~or NMC-4 compared to the comparable cysteine-free species isolated from p7E. After electrophoresis under reducing conditions ~utilizing 100 ~M DTT), the single chain p5E specieC shows a remarkably decreased affinity for NMC-4, which was then very similar to that of the cysteine-free p7E species under either reduced or nonreduced conditions. NMC-4 also failed, under reducing or non-reducing conditions, to recognize as an epitope disulfide-linked dimers from the p5E extract.

W092/06~ PCT/US91~07756 .., ' 41 2~942~9 The nitrocellulose filters used to produce :
'. ` autoradiographs based on NMC-4 were rescreened with RG-46 by subtracting the initial NMC-4 exposure response, .. which was kept low through a combination of low :` 5 antibody tit~r and short exposure time. The binding of RG-46 to the 36,000 kDa p7E polypeptide on the filters was the sa~e whether reducing or non-reducing conditions were chosen, consistent with the replarement of all cysteines by glycine in the expressed .
polypeptide. ;
~.............. ................................................................... ... ... ~' .
A large molecular weight vWF antigen (raactive to RG-46) was present in the p5E polypeptide extract under nonreducing conditions. These p5E vWF aggregates (reflecting interchain disulfide bonds) migrated under reducing conditions in the same position as the p7E : .:
polypeptide indicating disruption of their disulfide - .
contacts. However, the large p5E interchain disulfide ~' aggregates which are readily recognized under nonreducing.conditions by RG-46 were not recognized by NMC-4 under either reducing or nonreducing conditions.
It was thus demonstrated that the disulfide bond ..
between residues.509:and 695 in native multimeric vWF
: subunits represents an intrachain contact.

The disul~ide bvnd between residues 471 and 474 of the mature vWF subunit~has previously been shown to be .
an intrachain contact, thus the arorementioned ;`
embodiment i5 able to suggest that interchain disul~ide .
bond(s) in multisubunit mat~re vWF would be for~ed -using one or~ore of cysteine residues 459, 462 or 464.

A wide variety of expression plasmids or viral expression vectors are suitable for the expression of ~:

W092~06~ PCT/US~1/07756 ````-`` 2~9~259 ~`~ ' ` ,.
:`~

~, the 441-733 fragment, or similar vWF ~ragments.
' Representative sxamples inalude pBR322, and derivatives '`~ thereof such as pET-l through pET-7. Suitable host ; `
cells include the bacterial genuses of Escherichia and Bacillus. Of importance in the selection of an expression system is the rerommended presence of a high efficiency transcription promoter directly adjacent to the vWF cloned DNA insert. Mutant vWF cDNA fragments may also be cloned in eucaryotic host cells.
`:`
Thi~ discovery is expected to be particularly useful in the design of therapeutic vWF polypeptides patterned upon the 52/48 tryptic fragment (for use as antithrombotics) or patterned instead upon the 116 kDa homodimer thereof (for use as antihemorrhagics)'.

Second Embodi,ment ,of the Invention Many of the factors dsscribed above with re~pect to the design of and expression of therapeuti~
fragments of vWF from recombinant bacterial cells are i applicable to the design of and expression of vWF
i 20 fragments from eucaryotic host cells. Such applicability is readily apparent to those skilled in ` the art.

This ~econd embodiment includes withln itæ scope the recognition of,,certain o~ the roles performed by , cysteine residues present in the residue 449-728 primary se~uence fragment of the mature vWF subunit.
In this connection, this embodiment confirms that the cysteine 509-695 disulfide bond is an intrachain bond and provides for effective therapeutics incorporating the 509-695,bond for the purpose of treating ..

W092/06~ PCT/US~l/077~6 2 ~ 9 '~

thrombosis, or ~or the purpose of treating von ``
Willebrand's diseas~. ;

Both the antithrombotic polypeptides and antihemorrhagic polypeptides of this the second embodiment of the inYention are based upon that amino acid sequence domain which comprises approximately residues 449 to 728 of the mature von Willebrand factor ~:
subunit and which, if ~ully glycosylated, would be : :
equivalent in weigh~ to the 52/48 kDa vWF subunit : 10 fragment. In practice it is difficult to derive therapeutically useful quantities o~ such polypeptides ~rom blood plasma. Di~ficulties include effective ~
separation of 116 kDa and 52/48 kDa fragments from .
; other components of tryptic digests and effective :.`
sterilization of blood-derived components from human ~ :
viruses such as hepatitis and AIDS. In addition, methods reported in the literature to generate the 52/48 kDa monomer from the 116 kDa dimer have utilized complete disulfide reduction with resultant loss of tertiary structure. Certain important manipulations of the 52/48 frag~ent, such as replacement of selective cysteine residues to i~prove product utility and stability, can only be accomplished in a practical sense by recombinant DNA technology.
. .
However, the production by recombinant DNA- :
directed means of.therapeutic vWF polypeptides analogous to the 52/48--tryptic fragment has ~et with certain li~itations. It is desirable that the --polypeptide not only be made by the host cells but that it be correctly folded for maximum therapeutic utility.
It is believed that the principal factor which has to date prevented the expression of the most W092/06 ffl PCT~US91~07756 2a~2rj9 therapeutically active forms o~ the 52/48 ~ragment is the incorrect ~olding o~ the molecule caused by the linking up of cysteine residues to for~ incorrect disulf ide contacts. In addition, such polypeptides appear to exhibit hydrophobic properties or solubility problems which would not be encountered if they were to be contained within the entirety of the natural vWF
subunit, or were properly glycosylated.

Of critical importance, therefore, to the synthesis of vWF-deriv2d therapeutic polypeptides is the selection of conditions which minimize the formation of improper disulfide contacts. Prior expression of such polypeptides from recombinant DNA in host bacterial cells has certain disadvantages. With reference to the first embodiment, newly produced vWF
polypeptides are unable to escape from the host cells, causing them to be accumulated within insoluble ` aggregates therein (inclusion bodies) where the efféctive concentration of cysteine residues was extremely high. Under these circumstances, disulfide bonds not characteristic of the vWF molecule as it naturally exists in the plasma are encouraged to, and do, form either within the inclusion bodies or during attempts to solubilize the polypeptide therefrom~

This embodiment provides a solution to these difficulties by causing the vWF-derived polypeptides to be expressed in mammalian cells using a DNA sequence which encodes the polypeptide and which also encodes for a signal peptide, the presence of which causes the vWF polypeptide to be secreted from the host cells.
Incorrect disulfide bond formatlon is minimized by :

- W0~2/06~
P~T/~S91/07756 . .
.: . .
2~9~2~

limiting the accumu}ation of high local concentra~ions of the polypeptide as in inclusion bodies.

In addition, enzymes present in the host eucaryotic cells, unlike bacteria, are able to glycosylate (add carbohydrate chains to) the vWF-1 derived polypeptides resulting in therapeutic molecules -; which ~ore closely resemble domains of vWF molecules derived from human plasma.

The recombinant 116 kDa polypeptide generated according to this embodiment, without mutation of any of the cysteine codons therefor, is demonstrated to represent a dimer of the subunit fragment consisting of - residues 441-730 and possesses an amount of glycosylation equivalent to that found in the comparable reg}on of plasma-derived vWF.

There follows hereafter a description of the types of therapeutic vWF-derived p~lypeptides which have or may be generated according to the ef~ective recombinant procedures of the second embodiment.
' .:
Recombinant vWF Polypeptides o~ the Se~Qond ~m~odiment Stated broadly, this second embodiment includes any fragment of mature von Willebrand subunit ~ comprising that sequence of amino acids between approximately residue 449 and approximately residue 728, or a subfragment thereof, from which at least one of cysteine residues 459, 462 and 464 thereof is , ;
removed. Such removal reduces the tendency of the -fragment to form undesired interchain disulfide bonds ;'' :
,;

W092/06~ PCT/US91/077~6 . 2~'12~
:

(and resultant dimers) with the result that therapeutic utility as an antithrombotic is improved.

, A further aspect o~ the embodiment encompasses a glycosylated form of the above defined polypeptides.

In the design of antithrombotic polypeptides derived from the aforementioned region of vWF, it is preferred that cysteine residues be retained at positions 509 and 695 so that the tertiary structure of the GPIb(~) binding domain o~ the mature vWF subunit fragment is preserved. `
~, Also preferred in the practice of the embodiment is a glycosylated polypeptide derived from the aforementioned region of vWF in which cysteine residues are retained at positions 509 and 695 and in which each of cysteine residues 459, 462 and 464 i~ deleted or replaced by residues of other amino acids.
.. , Additionally preferred in the praotice of the ,~ embodiment is a glycosylated polypeptide derived from the aforementioned region of vWF in which cysteine residues are retained at positions 509 and 695 and in which any one of cysteine residues 459, 462 a~d 464 is ~ `
deleted or replaced by a single residue of another amino acid.

Important factors involved in the de~ign of, or further modification to, the preferred mutant ;~
polypeptides (antithrombotics) of the invention are;`
described hereafter. ;~

,`,.:
',.' :' . :,, . . :, .

W092/06~ PCT/U~9l/077~6 ''' ```` - 2 ~
;:

Potential binding sites ~or collagens and glycosaminoglycans ~or protaoglycans) exist in the 449-` 728 tryptic fragment in the loop region between cysteine residues 509 and 695. In the event that binding at these sites by such macromolecule~ impairs ; the antithrombotic therapeutic utility of any of the - recombinant polypeptides of the invention by, for example, also providing bridging to collagen, the polypeptide can be redesigned (for example, by proteolysis, covalent labelling or mutagenesis) to deleta or alter the loop region, or a subdomain thereof.
. . ' .
The second embodi~ent is also concerned with the ` preparation of polypeptides which are useful in the treatment of hemorrhagic disease. Stated broadly, there is provided a process for the production by - recombinant DNA-directed methods of a dimeric , polypeptide substantially equivalent to the 116 kDa , tryptic fragment derived from circulating vWF. In accordance with the process, the monomeric fragment initially formed assumes a tertiary structure suitable for dimerization, and dimerization thereo~ is ef~ected - (see Example 7). In addition, the process conditions are such that it is posaible to form a propexly glycosylated dimeric polypeptide.

There follows hereafter a discussion of means by which polypeptides of ~he second;embodiment can be prepared and, in particular, by which such polypeptides can be ef~ecti~ely secreted from host cells in proper folded form and possessing preferably only those disulfide bonds whose presence is consistent with therapeutic utility.

:

W092/06~ PCT/USgl/077~

`` 2~25-9 Preparation of Mutant Polypeptides of the Second Embodi~ent - Construction of Suit~a~b~l~e~J~ y~ Expression Plasmids , , Essential elements necessary for the practice of the embodiment are: (A) a DNA sequence which encodes the residue 449-728 domain of the mature vWF subunit, or encodes a subdomain thereof; (B) an expression plasmid or viral expression vector capable of directing in a eucaryotic cell the expression therein of the aforementioned residue 449-728 domain, or subdomain thereof; and (C) a eucaryotic host cell in which said expression may be effected.
;
The expression of the DNA sequence of the von Willebrand factor subunit fragment is facilitated by -placing a eucaryotic consensus translation initiation sequence and a methionine initiation codon upstream (5') to the residue 449-728 encoding DNA. The vWF DNA
sequence may be a cDNA sequence, or a genomic sequence ZO such as, for example, may be produced by enzymatic amplification from a genomic clone in a polymerase chain reation. Expression of the residue 449-728 `-`
encoding sequence is further facilitated by placing downstream there~rom a translatio~ termination codon `
such as ~GA. The vWF-polypeptide so expressed typically remains within the host cells because of the lack o~ attachment to the nascent vWF polypeptide of a signal peptide. In such a situation, purification of proteins expressed therein and the extraction of pharmacologically useful ~uantities thereof are more difficult to accomplish than if the polypeptide`were secreted into the culture medium of the host cells.
Such Pxpression syste~s are nonetheless useful for diagnostic assay purposes such as, for example, testing W092/0~ PCT/US91/07756 ' ~4~

4~
the proper ~unc~ion o~ platelet GPIb-IX receptor complaxes in a patient.

- In the preferred practice of the invention in ; which the polypeptide is secreted from the host cell, there is provided a vWF-encoding DNA sequence for insertion into a suitable host cell in which there is also inserted upstream from the residue 449-728 encoding sequence thereof a DNA sequence encoding the : vWF signal peptide (see Example 7). Other vWF-encoding DNA sequences correspo~ding to different regions of the mature vNF subunit, or corresponding to the propeptide, ~;
or to combinations of any of such regions, may be similarly expressed by similarly placing them downstream from a vWF signal peptide sequence in a suitable encoding DNA. When attached to the amino terminal end of the residue 449-728 fragment of the vWF
- subunit, the signal peptide causes the fragment to be - recognized by cellular structures as a polypeptide of the kind to be processed for ulti~ate secretion from the cell, with concomitant cleavage of the signal polypeptide from the 449-728 fragment.

With respect to the construction of a eucaryotic ' expression system and the expression therein of the tryptic 52/48 kDa domain of mature subunit vWF (the residue 449-728 fragment~, it has been fou~d (see Example 7) to be conveneint to manipulate a slightly larger fragment represented by residues 441 (arginine) to 730 (asparagine). Other similar fragments- :-containing s~all regions of additional amino acids (besides the 449-728 residue sequence), which additional amino acids do not significantly affect the function of said fragment, may also be expressed.
. .

~ W092/06~ PCT/US9l/07756 ``` 2~9~2~9 Similarly, functional fragments may be expressed from which, when compared to the 449-728 fragment, several residues adjacent to the a~ino and carboxy terminals ha~e been removed as long as the GPIb(~) binding sequences are not compromised.
~, ~
It has also been found to be e~fective, with respect to the construction of a suitable DNA séquence for encoding and axpressing the residue 441-730 fra~ment, to cause to be inserted between the DNA
; 10 encoding the carboxy terminus of the signal peptide and the codon for residue 441, codons for the first three amino acids of the vWF propeptide (alanine-glutamic acid-glycine) said codons being naturally found directly downstream (3') to the signal sequence in the . . .
human vWF gene. As is further elaborated below (see Example 17), the presence of such a propeptide sequence ~a spacer) facilitates recognition hy signal peptidase ~;
of a proper cleavage site which process generates a therapeutic vWF polypeptide of a proper size and facilitates secretion from the host cell of the therapeutic product. As elaborated below, this spacer sequence should be of semipolar or polar character. ;
.:
In accordance with this invention, there is provided a spacer sequance comprising between one and up to the ~irst ten residues of the amino terminal region of the vWF propeptide. It is within the scope of the invention to utilize longer propeptide encoding sequences with the understanding that the desired tertiary structure of the 441-730 residue sequence is not adversely affected.

':

~ W092/0S~ PCT/USgl/07756 . .
2 ~ a ~ ;
.` 51 :~ A wide variety of expression plasmids or viral expression vectors are suitable for the expression of the residue 441-730 mature vWF subunit fragment or - - similar vWF fragments. One factor of importance in selecting an expression system is the provision in the :
plasmid or vector of a high efficiency transcription promoter which is directly adjacent to the cloned vWF
insert.
.~ .
Another factor of importance in the æelection of e.
` 10 an expression plasmid or viral expression vector is the provision in the plasmid or vector o~ an antibiotic .~-. resistance gene marker so that, for example, continuous selection for stable transformant eucaryotic host cells ;
.- can be applied. :.-Examples of plasmids suitable for use in the practice of the invention include pCDM8, pCDM8~, pcDNAl, pcDNA1~, pM~r~ and Rc/CMV. Preferred plasmids include pCDM8~, pcDN~ , pMU~ and Rc/CMV.

Examples of viral expression vector systems suitable for the practice of the invention include those based upon retroviruses and those based upon baculovirus Auto~3~ha californ~ca nuclear polyhedrosis .
vlrus.

Representative host cells comprising permanent cell lines suitable for use in the practice of the invention include CHO-K1 Chinese hamster ovary cells, ::
ATCC-CCL-61, COS-l cells, SV-40 transformed African ;:- .
Green monkey kidney, ATCC-CRL 1650; ATT 20 murine pituitary cells; RIN-5F rat pancreatic ~ cells;

~ W092/06~ PCT/US91/077~6 9~259 cultuxed insect cells, Spod~etera ~uqi~erd~; or yeast ~Sarcomyces).
. .:
Example 7 contains a detailed explanation of ;
preferred procedures used to express and secrete the 441-730 sequence. In that Example, the fragment is -secreted as a homodimer held together by one or more ~` disulfide bonds involving cysteine residues 459, 462 and 464. Expression of monomeric fragments useful as ;
antithrombotics necessitates control be made of the disulfide bonding abilities of the monomers which is -. achieved most preferably by mutagenesis procedures as -described in the aforementioned ~irst Embodiment of the Invention.
.. ..
,';
The specific proto~ol used to generate the mutant , 15 vWF residue 441-730 fragment containing cysteine to - glycine substitutions at each of residue positions 459, 462 and 464 is des~ribed in Example 9. ~he expression plasmid used therein was designated pAD4/ 3C.

The specific protocol, adapted from that of - 20 Example 9, and which was used to generate the three mutant residue 441-730 fragments, each of which contains a different single Cys ~ Gly mutation ~at positions 459, 462 or 464) i9 described in Example 11.
The respective expression plasmids used therein were designated pAD4/G459, pAD4/GU2 and pADlG~ (collectively "the pAD4/~lC plasmids"). Similar procedures may be used to produce mutant residue 441-730 fragments with ~ ~
Cys ~ Gly mutations at two of the three a~orementioned :
positions.

:,',:.

. "''' ' ~ '' ' . .; . . ,;, ... , ., ., . . ~, , ~:

W092/06~ PCT/US91/07756 Properties of the P~ly~eptides o~ the Seco~d Embodiment :
Homodimeric 116 kDa vWF Frraqments Example 7 below discloses the use of stably transformed CHO-Kl cells to express the unmutagenized residue 441-730 vWF subunit fragment~ As set forth in Example 10 below,-the unmutagenized fragment was also expressed in unstable COS-l trans~ormants.

SDS-polyacrylamide gel electrophoresis of secreted - and immunoprecipitated proteins derived ~rom CHO-Kl cells demonstrates that, under nonreducing conditions, the dominant vWF-derived polypeptide, detected by staining with coomassie blue, has an apparent molecular weight of about 116,000 (Example 7). This result W2S . .
confirmed by characterizing the polypeptides secreted by pAD4/WT transformed COS-l cells (Example 12) using - autoradiographs of 35S-labelled proteins. Under disulfide-reducing conditions (such as in the presence of 100 mM dithiothreitol~ the 116 kDa fragment was no longer detected and the vWF-derived material appears as the expected 52/48 kDa mono~er. ~ ~
: - " ".
Th~ apparent molecular weight of the recombinant 115 kDa polyp~ptide wa~ cons~stent with the presence of said polypeptide as a homodimer o~ the 441-730 ~ragment. This homodimer carries al~o an amount of glycosylation equivalent to that observed in the 116 kDa polypeptide~isolated by tryptic digestion of mature plasma (circulating) vWF. It is thus demonstrated that exprsssion cf the 441-730 fragment in the mammalian cell cultures of this invention favors the formation of the disulfide-dependent 116 kDa dimer thereof, ,. .. .. .

` WO9~06~ PCT/US91/07756 - ~ , 2a342~9 mimicking the structure seen in plasma. ~hat the 116 kDa fragment so formed represents a correctly ~olded polypeptide was evidenced by its reaction (under nonreducing conditions) with conformation-dependent ~ -NMC-4 antibody. This antibody recognizes a properly assembled GPIb(~) binding site (Example 7). Reactivity - with NMC-4 disappears under reducin~ conditions.

The dimeric 116 kDa fragment which is within the scope of the present embodiment and which contains two GPIb(~) binding sites supports ristoc~tin-induced platelet aggregation by virtue of its bivalent character. This was evidenced in Example 8 below.

Since it was demonstrated in the first embodiment (using bacterially-expressed vWF fragments) that cysteine residues 471 and 474 and also residues 509 and 695 are involved in intrachain bonds, the interchain bonds which stabilize the 116 kDa homodimer must be formed from one or more of residues 459, 462 and 464.
It is further noted that since residues 459, 462 and 464 are in such close proximity in any monomer, there may be variation as to which particular residue or residues contribute the interchain disulfide bond or bonds which ~orm the interpoly~eptide contact in any particular mature vWF dimer or multimer, or recombinant 116 kDa ~ragment. ~herapeutically-ac~ive populations of dimerio ~olecules can be generated according to the practice o~the invention utilizing any of the possible combinations of interchain disulfide bonds.

It is noted that Lt is also possible that some structural folding or disulfide bond formation associated with thie generation of therapeutically - .

` WOg2/06~ PCT/US91/07756 : ,.
2 0 ~ 9 . .
. ~ :
active con~ormations of the recombinant 116 kDa dimers of the invention, or disulfide exchange therein, occurs after the polypeptides are secreted from a host cell.

Since there are also contained within the 441-730 vWF fragment potential binding sites for collagens, ; proteoglycans and glycosaminoglycans, the 116 kDa polypeptide is capable of performing a bridging function between a platelet and the subendothelium.
This enables it to bP used in a method for inducing platelet adhesion to surfaces such as, for example, vascular subendothelium. There is also provided a ; method of inducing platelet activation and/or aggregation which comprises contacting platelets with an effective amount of the recombinant 116 kDa polypeptide. Such a method is useful in the treatment ' of von Willebrand disease.

It is noted that as long as at least one of the ~
one or more potential interchain disulfide bonds ~ ;
stabilizing the~homodimer is left intact, and the amino acid sequences comprising the two GPIb(~) binding sites - are preserved, that other regions of one or more o~ the two monomeric fragments thereo~ ~ould be deleted, if necessary, to modi~y the therapeutic propertie~ of the dimer. "

52/4B kDa monomeric vWF fraoments An important aspect of the second embodiment of the invention is the provision of glycosylated 52/48 kDa monomeric frag~ents of the vWF subunit having substantial elements of normal tertiary structure.
Such fragments have a reduced tendency to form dimers . - -: . .

~' ~

`~ WO9~/06 ~ PCT/US91~077~6 2 ~i 9 ` .
.

which tend to be unsuitable for use as antithrombotici therapeutics. ~
'. ' ~ : .
Following the above described procedures for site directed mutagenesiis, residue 441-730 vWF ~ragments -~
were produced in which one or more of cysteine residues ~ -459, 462 and 464 were replaced with glycine residues.
~xa~ples 9, 10 and 11 below explain the mutagenesis and cell culture conditions necessary to create COS-1 cell transformants expressing these mutant vWF polypeptides. -Examples 12 to 14 of the in~ention describe the : properties of the molecules so derived in comparison with the recombinant 116 kDa polypeptide produced from pAD4/WT transformed COS-1 cells.

The vWF-derived polypeptides expressed by pAD4/~3C
transformed COS-1 cells (containing the vWF 441-730 DNA
sequence, but with each of cysteine ciodons 459, 462 and 464 thereof replaced by single glycine codons) were - compared with the polypeptides secreted by pAD4/WT
transformed COS-l cells. To performi the comparisons, 35S-methionine-supplemented culture medium from each culture was subjected to immunopreicipitation using equal amounts of NMC-4 and RG-46 anti-vWF antibodies ~Example 12) to collect the vWF-derived secreted proteins. The immunoprecipitated vWF polypeptides were then resolved by autoradiography of 35S-label on SDS
polyacrylamide gels. No 116 kDa polypeptide could be detected in culture extracts of pAD4/~3C transformed cells under-nonreducing conditions. Instead, under either reducing or nonreducing conditions, a band having an apparent molecular weight of 52 kDa was seen.
In contrast, the pAD4/WT trans~ormed COS-1 cells WO g2/O~ P~/US91/07756 ., .

203~2~i9 ` 57 . .
; produce under nonraducing conditions, as expected, a polypeptide o~ apparent molecular weight o~ 116 kDa.
.
The immunoprecipitation procedure was also ;
repeated using only conformation-dependent NMC-4 antibody (Example 13). The major vWF-derived component isolated from the culture medium of pAD4/WT trans~ormed cells again had an apparent molecular weight of 116 kDa under nonreducing conditions and 52 kDa under reducing conditions. A band of apparent 52 kDa molecular weight was detected under nonreducing conditions on gels o~
pAD4/A3C derived polypeptide material. As described in Example 13, reactivity with NMC-4 antibody is important evidence that the 52 kDa fragment detected in pAD4/A3c transformed cells possesses the tertiary structure of the natural residue 441-730 domain.

The immunoprecipitation procedure was also used to detect NMC-4 reactive vWF polypeptide produced by pAD4/AlC transformed COS-l cells cultured under i~
; conditions similar to those for pAD4/WT and ~3C
~ransfor~ants in the presence of 35S methionine.
Immunoprecipitated proteins were run under reducing and nonreducing conditions in SDS-polyacrylamide gels and compared with vWF polypeptides produced by pAD4/WT and pAD4/~3C transformants tExample 14).

~5 It was r~vealed that substitut1on of any one o~
cysteine residues 459, 462 or 464 by glyeine results predominantly in a polypeptide having an apparent molecular weight-of 52 kDa under nonredu~ing or reducing conditions, the formation of the 116 kDa species having been prevented.

. - ., - . - . . . ~ . .
- , -, : . .. :.

. - - . . ~ :, .
.. . ~. .. .

.. . - . , . ... ~ . ~ .

WO ~/06~ PC~/US91~07756 2~)9~2~9 ~,~,., The apparent molecular weight o~ 52 kDa ~r recombinant polypeptides derived ~rom COS-l cells transformed with either p~D4/A3C or pAD4/AlC plasmids is consistent with said palypeptides being ~onomers of the 441-730 fragment, while carrying also an a~ount of :~:
glycosylation equivalent to that seen in the 52 kDa .
polypeptide as isolated ~rom tryptic digestion and reduction of mature plasma (circulating3 vnF.
:' , Unlike the dimeric polypeptides o~ apparent 116 ;:
kDa molecular weight, the monomeric 52 kDa polypeptides produced by pAD4/~lC and pAD4/~3C plasmids are unlikely - :.:
to be capable of the bridging ~unction associated with the dimer. Accordingly, there is provided a method of preventing platelet activation and/or aggregation which comprises contacting platelets with an effective amount of a mutant recombinant 52/48 kDa polypeptide which polypeptide shows at least a substantially reduced tendency to~dimerize when compared with nonmutant (wild type) recombinant 52/48 kDa polypeptides.

There is further provided a method of preventing : -the adhesion of plate}ets to sur~aces which comprises contacting platelets with an effective amount of a mutant recombinant S2/48 kDa polypeptide which shows at least a substantially reduced tendency to dimerize when compared with nonmutant recombinant 52/48 kDa .1:
polypeptides.

Contained within the 441-730 vWF fragment are potential binding sites for collagen (approximately residues 542-622) and glycosaminoglycans and :-proteoglycans (also within the residue 509-695 .
disulfide loop1, in addition to the GPIb~ binding , :

.
.~ -.

., , : .. , , , .: . : - . . . , . .,, - ., .. , ........ :,: .. ~ ..

W~92/06~ PCT/US91/077S6 .
2~2~

59 ;
sites. It is probable becauæe o~ steric ¢onsiderations -`
that a single fra~ment comprising residues 441-730 - could not perform effectively as a bridging, potentially thrombotic, molecule. It is noted, however, that as long as the GPIb(~) binding domain of the 52/48 kDa monomer (consisting of approximately the primary sequence regions 474-488 and 694-708, and a tertiary domain thereof contributed in part by the 509-695 disulfide bond) iB preserved, other regions (such as part of the heparin and collagen binding loop) of the said 52/48 kDa monomeric fragment could be deleted or altered, such as by proteolysis or by mutagenesis, if necessary, to modify or preserve the antithrombotic therapeutic properties thereof.

` 15 It is also possible that some structural folding or disulfide bond formation associated with the generation of therapeutically active confor~ations of the recombinant~52/48 kDa monomers of the invention, or disulfide exchange therein, occurs after the polypeptides are secreted from a host cell. ~- ;
.~ .
Limitation of the Glycosylation of vWF-Derived Polypeptidas to nhan~e ~herapeutic Activity von Wil~ebrand factor and platelet glycoprotein Ibt~) are glycoproteins, that is, proteins to which carbohydrate molecules ~such as sugars) are attached.
In the case of von Willebrand factor, this natural process of adding carbohydrate (referred to as glycosylation) substantially increases the molecular weight of the protein. For example, with respect to the tryptic fragment of the mature vWF subunit which consists of residues 449-728, the apparent molecular .~_ ~ .. .. .. .. . .. . . ....... .. .. .

. .. . .. . . . .
- - . : . :. - - , . . . . - -WO ~2/06999 PCr/USgl/07756 ;~' , 3 4 2 ~ 9 weight rises ~rom about 38 kDa to 52 kDa in humans as a result of said glycosylation.

.. Glycosylation of newly synthesized polypeptides is :
much more complex in eucaryotic cells (such as ma~malian cells) than in bacterial cells.
Glycosylation has been found to be particularly co~mon in protein species which sPrve as membrane recaptors, .: .
` such as GPIb~, and in proteins which interact therewith (such as vWF).

By way of background, glycosylation iB typically accomplished in mammalian cells in several stages beginning soon after the nascent polypeptide appears on ~.
the ribosome and continuing as the protein is further ~-processed for ultimate insertion into the cell : 15 membrane, or for secretion from the cell. Since glycosylation is so important to the function of many ::
glycoproteins (see Wagner, D.D. et al., J. Ce.11 Biol., ~ .
102, 1320-1324 (1986) concerning certain possible ~unctions with respect to vWF), the role of -:
glycosylation in the GPIb(~)- binding activity of the residue 449-728 region of the mature von Willebrand fac~or subunit was investigated. As demonstrated herein the therapeutic activity of the vWF 116 kDa dimer can be enhanced by restricting the glycosylation thereof. This indicates that the activity of 52~48 kDa monomers should also be similarly enhanced.

Any suitable means can be used to restrict the glycosylation of the vWF 116 kDa dimers or of the 52/48 kDa monomers.
,.,~

W092/06~ PCT/US91/07756 2 ~ 5 9 By way o~ background, it is noted that qlycosylation o~ the 52/48 tryptic ~ragment of circulating mature von Willebrand factor subunit has been determined to occur predominantly at residue `i 5 positions 468 (asparagine); 500 and 723 ~serine); and - 485, 492, 493, 705, 714 and 724 (threonine). Titani, ; K. et al., Biochemistry, 25, 3171-3184 (1986).
Glycosylation of asparagine is N-linked (from the side ~` chain amide group). Serine and threonine hydroxyl groups present 0-linked glycosylation sites. The ~-present invention encompasses modi~ication o~
glycosylation at both N- and 0-linked sites.

Tunicamycin, an antibiotic which may be isolated from cultures of Streptomyces has been demonstrated to inhibit the glycosylation of proteins in eucaryotic cells. Duskin, D. et al., J. Biol. Chem., 257(6), 3105-3109 (1982). Speci~ically, tunicamycin inhibits the synthesis of N-type glycosidic linkages ~at asparagine N-linked sites). See Mahoney, N.C. et al., J. Chromatoq., 198, 506-510 tl980). Accordinglyt the - treatment of eucaryotic cells with tunicamycin provides for an effective system in which to modify glycoproteins that are produced therein.
.
Following the procedure of Example 15, stable CH0-Xl transformants containing pAD5/WT plasmids and capable o~ secreting the recombinant 116 kDa vWF
~ragment (see Example 1) were cultured in the presence of tunicaymcin. A~ter:about-36 hoursji the culture medium was harvested and concentrated. The concentrated culture~medium, in vhich the dominant vWF-derived polypeptide species has an apparent molecular weight of 116 kDa, was tested in ristocetin-induced ... . .. , . . " , , .............. . . , ...... ... . . ~ .

,~ ~ , .: .;. - .
- ..

W092/06~ PCT/US91/07756~
` : " `
` 209~2~
:` ' , platelet aggregation assays (see Example 9j and ,~
compared with culture,medium ~rom untreated cell cultures (generating polypeptides with normal N-linked ~ glycosylation). It was demonstrated that the ' -,~ 5 tunicamycin induced limitation on N-linked ' , glycosylation of the secreted 116 kDa vWF ~ragment ~ ' substantially increased its ability to support ristocetin-induced platelet aggregation.
.
For the purpose of inhibiting N-linked ,, glycosylation, it is preferred in the practice of this invention to add to the culture medium of cells expressing vWF-derived polypeptide a concentration of tunicamycin between about 0.3 and about 1.5 ~g/ml.
Below about 0.3 ~g/ml, the action of the antibiotic tends to result in a heterogeneous population of ' ' differentially cleaved polypeptides. This effect is', ~' not expected to be significantly lessened by longer exposure of the host cells to antibiotic-containing`: ~:
, medium since the nascent vWF polypeptides are likely', ,- 20 only to be processed by glycosylating enzymes for a '~
limited period of time after translation. Above approximately 1.5 ~g/ml, there were signs of toxicity,~
with respect to CHO-Kl cells. It is beiieved that this',' was caused by inhibition of glycosylation of CHQ-K1 '' proteins, such glycosylation being necessary for cell', function and growth. Although the range of suitable','~
tunicamycin concentrations may be;different under dif~erent cell culture conditions,:or with different~, '-host cell lines, the ~bove guidelinea can be readily used ~o ascertain with,respectito other cell lines appropriate tunicamycin incubation conditions.
-WO~/06g~9 PCT/US91/07756 2~2~

~he Role of Sialic Acid-containing Carbohydrate Side Chains in the Binding o~ the 52/48 vWF
Fraqment to Platelets one of the most important types of carbohydrate S which is found on both N- and 0-linked carbohydrate side chains of the 52/48 tryptic fragment is sialic acid. Sialic acid is negatively charged and -contributes to regions of net negative change on the surface of vWF multimers and also of platelet GPIb~) receptors. Sialic acid facilitates mutual repulsion of vWF and GPIb(~) under non-injury conditions. In fact, platelets and circulating vWF normally coexist in the blood without any interaction occuring, although vWF
bound to the subendothelium, presumably as a result of chemical or physical changes induced by injury, binds to platelets.

The vWF-platelet GPIb(~) interaction can be demonstrated in vitro in the presence of certain mediators such as the positively charged glycopeptide ristocetin, or following chemical manipulation of the vWF molecule itself, as by removal of terminal negatively charged sialic acid residues ~rom carbohydrate side chains. ~eMarco, L. et al., J. Clin.
Invest., 68, 321-328 (1981). Slalic acid residues are ~ound in carbohydrate side chains which are attached ~o serine and threonine sites ~0-linked) and also asparagine (N-linked) sites in the resldue 449-728 vWF
~ragment. ~ , - ~

The ef~ect of tunic~mycin in enhancing the therapeutic capability of the 116 kDa fragment results in part from limiting the sialic acid content of the - 116 kDa dimer. This effect should be equally applicable to 52/48 kDa monomers. Accordingly, the . W092/06~ PCT/USgl/b7756 , ~
....
'; 2~n~2~9 . 64 .,, : treatment with tunicamycin of host cells containing Qxpression plasmids which produce monomeric 52/4B kDa vWF fragments (such as pAD4/~3C or pAD4/~lC, Examples 9 and 11) will cause to be expressed therefrom ~;
antithrombotic therapeutics with increased GPIb(~) :
binding activity. .

Accordingly this invention encompasses the process of treating a eucaryotic host cell which contains a DNA :-sequence encoding the 449-728 tryptic vWF fragment with . -tunicamy~in for the purpose of limiting ~he glycosylation of said fragment, or of dimers thereof.

This invention also encompasses additional ways to - .
restrict the glycosylation of vWF-derived polypeptides - for the purpose of improving the therapeutic utility :
thereof.
(A) It is noted that there are numerous enzymes which can be used to cleave carbohydrate side chains ~including N-or 0-linked) from glycoproteins.
Representative examples include (1) 0-glycanase~, an endo-~-N-acetyl-galactosaminidase, which cleaves O-linked sugars whare there is a gal-~-(1,3)gal NAc core disaccharide linked to a serine or threonine residue; (2) N-glycanase~, an N-glycosidase F, peptide-~N-acetyl-~-glucosaminyl~asparagine amidase, which hydrolizes asparagine-linked oligosaccharides; and (3) gal~
1,4-GlcNAc-~-2,6-sialyl transferase, - which can be used to modify sialic acid sites, all from Genzyme Co., Boston, MA, WOQ2/06~ PCT/US91/07756 ~ :.
`; 2~9~2~9 or endo-H and endo-F from Sigma Chemica].
Co., St. Louic, M0.
(B) Example 16 describes the production by site directed mutagenesis of mutant : 5 polypeptides patterned upon a parent : polypeptide which comprises the amino acid sequence of that fragment of mature von Willebrand faot~r which begins approximately at residue ~49 (valine) and ends approximately at residue 728 ; (lysine). It is taught in ~xample lÇ
. that particular codons encoding serine, threonine, and also asparagine residue which are or are potentially sites of 0-or N-linked glycosylation respectively (for the parent polypeptide encoded by a vWF cDNA) can be deleted or replaced with codons for other amino acids thereby enabling the expression in host : 20 cells and secretion therefrom of a polypeptide having less glycosylation (including sialated carbohydrate~ than the parent vW~ polypeptide.

As taught in ~xamples 7, 9 and 11, control over whether the e~pressed polypeptide is dimeric or monomeric is e~fected by mutation of one or more of cy~teine codons 459, 462 and 464. ~onomeric polypeptides so derived are useful antithrombotics whereas the dimeric forms are useful in treating hemorrhage in patients with von Willebrand disease... It is noted that the same secondary and tertiary . `
structural factors previously described for selecting .
: suitable replacement amino acids for cysteine residues . ..

: .
'~

W092/06~ PCT/US91tO7756 20'J ~'~ 59 `~ 66 may be applied to replace the serine, threonine and ~ asparagine xesidues which are glycosylation sites. In ; addition, and ~or the purpose of designing mutant vWF-derived polypeptides, although serine, threonine, and asparagine are considered suitable replacements for most cysteine residues, the possibility must be considered that cys - thr, cys - ser or cys ~ asn substitutions will introduce into the vWF-deri~ed polypeptide naw glycosylation sites resulting in ;
polypeptides with increased carbohydrate content.

It is also noted that mutant polypeptides derived -, from the 449-728 region of the mature vWF subunit can be designed to possess substantially increased carbohydrate content by using site directed mu~agenesis procedures to introduce additional serine, threonine ans asparagine codons into a DNA within a host cell capable of glycosylating the polypeptide and then secreting it.

Use of the von Willebrand Factor Signal Peptide to E~fect Secretion from ~ost ;
; Cells of~Non-vWF Derived PolypePtides The present invention provides als~ a process for producing from an encoding DNA se~uence biologically active monomers and dimers corresponding approximately to the residue 449-728 sequence of the mature von Willebrand ~actor subunit, which polypeptides are secreted from host cells. Of central importance to the success of this process is the assembly of a VWF DNA
sequence to which is also attached a DNA sequence encoding the vWF signal peptide. Recognition of the signal sequence by cellular components enables the vWF
polypeptide to be secreted from the cell in-~tead of accumulating therein as a substantially insoluble ; I ' ' '' ' ' . ' ' . ' ' '. ' '.' ' . ' . '' .. . '.' ' ' ' .. '. ~ ' '' ' ~ . .

; , .,' ' ' '. ' ' ' ' ' ' ' . ~ ~ '~ ' ' ' . ' " '. ' . ' ' "' ' . '. ' . ," " ,' ' ' ' ' . . ' W0~2/06~ PCT/US91iO77~6 `:

aggregation of polypeptides. Proteins trapped in inclusion bodies are generally believed to demonstrate improper folding and disulfide bonding. See Williams, ; D.C. et al., science, 215, 687 (19~2).

In order for the reoombinant polypeptide representing vWF subunit residues 441 to 730 to be secreted from a host cell, it is necessary that the nascent polypeptide which combines the signal peptide and matura vWF subunit sequence be recognised by the endoplasmic reticulum and cellular components such as translocation receptors and signal peptidase which are necessary to the process of secretion. Proper recognition of the carboxy terminal end of the signal peptide by signal peptidase is generally required. ~or ' 15 the purpose of enhancing the secretion from host cells ij of the recombinant 441-730 vWF fragment or other i unrelated therapeutic polypeptides, there may also be -; inserted between the DNA encoding the vWF signal peptide and the DNA encoding the structural sequence of 2Q the therapeutic polypeptide a small spacer DNA
sequence.
. '' ~.
Preferred examples o~ spacer DNA include sequences encoding from about one to about ten of the amino acid residues which comprise the amino terminal sequence reg~on of the vWF propeptide. Particularly preferred as spacer cDNA sequences are those wh1 ch encode ,. NH2-Ala-Glu-Gly-CO2H, ~ '"
- NH2-Ala-Glu-Gly-Thr-CO2H, or - NH2-Ala-Glu-Gly-~hr-Arg-CO2H, -which represent the first 3, 4 and 5 amino acid residues of the amino terminal region of the vWF
propeptide.

:' ..

, W092/06~ ~ PCT/US91/07756 , ',' .
` ~a~2~9 , ~ 68 Example 17 teaches conditions under which such combined constructs may be expressed in host cells. As depicted in Example 17 of the invention, the vWF signal peptide contains a substantially hydrophobic region (as - , is true of most signal peptides) whereas the amino terminal region of the vWF propeptide is substantially hydrophilic. - '-', Proper recognition by signal peptidases of target cleavage sites generally requires semipolar or polar ','`
regions adjacent to or in conjunction with the carboxy terminal region of the signal peptide. von Heijne, G., , J. Mol. Biol., 184, 99-105 (1985).
:
The DNA sequence used in the practice of this ; invention to cause secretion of t~e 52/48 kDa domain of the vWF subunit provides such a polar domain by ~ , connecting to the signal peptide a spacer derived from , ~ ' the vWF propeptide (Ala Glu-Gly) followed by the highly polar Arg~ Arg~2 residues of the mature subunit sequence.

This aspect of the invention is particularly important with respect to the expression and secretion of therapautic fragmants of polypeptides. Such ' '' fragments do not include the amino terminal region of the e~tire polypeptide. The amino terminus would normally present a hydrophilic,domain which is positioned directly adjacent,to the, carboxy terminus of the signal peptide. In such cases, a semipolar or polar spacer (such as ala-glu-gly of vWF) may be caused ,''~
to be inserted between the signal sequence and the sequence for the therapeutic polypeptide fragment to facilitate recognition as a proper signal peptidase W092/06~ PCT/US91~07756 ~ 4'~

cleavage site. Alternatively, and i~ the polypeptide fragment's activity i9 unaf~ected, the exact residue position which comprises the amino terminus of said cloned therapeutic polypeptide ~ragment may be selected so as to commence a region of hydrophilic residues which will form a recognition sequence. The substantially hydrophilic character of residue 441-450 region of the 52/48 kDa fragment indicates that the fragment may be successfully expressed within and secrated from eucaryotic cells without use of a spacer between the signal peptide and the mature subunit sequence.
; ' ~ ,, The use of preferred species of spacer polypeptides (such as the first 3, 4 or 5 residues of the vWF propeptide) is advantageous in that it causes to remain attached to the therapeutic polypeptide upon secretion from the cell only a biologically insignificant sequence of foreign amino acids unlikely to afPect the function of the therapeutic polypeptide.
~ . : :. .:
i 20 The following information is provided to : facilitate selection of semipolar and polar spacer se~uences useful in the practice of the invention.

; - It is possible to predict the extent o~ relative hydrophobic or hydrophilic character which a particular peptide ~e~uence wilI exhibit when present within larger polypeptides. One such model is the relative hydrophobicity/hydrophilicity index as described by Kyte, J. et al., J. Mol. Biol., 156, 105-132 (1982)~.
An overall index value is assigned based on individual residue contributions and the position of the particular amino acid residues within the peptide. The ';.-.:
' ': ' :.

_ . ~ i, ... ...... . .. . .. .. ... . .

wo ~2Jo~ Pcr/usgl/b7756.
2~9~2~9 .

maximum value of hydrophobicity described therein is ~4.5 (equivalent to isoleucine). The maximum value of hydrophilicity described therein is -4.5 (equivalent to arginine). In the practice of the present invention, a ` 5 spacer peptide is considered semipolar or polar if according to the method of Kyte, J. et al., supra, it possesses an overall index value of between approximately 0 and approximately -4.5. It is noted however that a very short, slightly hydrophobic spacer may nonetheless prove functional i~ the adjacent ~ -therapeutic polypeptide sequence is highly polar.

Representative index values for spacer peptides useful in the practice of the invention are as follows.
Subscript numbers refer to residue positions within the mature vWF subunit sequence which can be seen to alter significantly the relative hydrophilicity of the combined sequence region.
(A) Ala-Glu-Gly -0.7 (B) Ala-Glu-Gly-Thr -0.7 ~ -(C~ Ala-Glu-Gly-Thr-Arg -1.46 `
(D) Ala-Glu-Gly-Arg~l-Arg~2 -2.22 tE) Ala-Glu-Gly-Arg~l to Lys~7 -1.16 ~F) the first ten ~amino terminal) residues -1.45 o~ the vWF propeptide - ,, With respect to the exprassion of therapeutic polypeptidas derived from von Willebrand factor or other proteins in which recombinant DNA-directed methods are used to create a host cell transformed with an expression plasmid or viral expression vector containing an appropriate DNA, it is generally accepted that a variety of eucaryotic signal peptides are suitable. In addition, amino acid sequence subsets of , : . . - - . .

W092/06~ Pcr/us9l/b7756 ' 2~9~9 signal peptides which supply ~he necessary hydrophobic do~ain thereo~ ara usaful in the practice o~ the invention.

Preferred as additional polypeptides which may be successfully secreted from host cells ~y constructing a DNA sequence encoding the target polypeptide and a vWF
signal peptide sequence are polypeptides comprising "A"
type sequence domains. Preferred as additional polypeptides which may be successfully secreted from host cells by constructing a DNA sequence encoding the target polypeptide and a vWF signal peptide/propeptide sequence are also polypeptides comprising "A" type sequence domains.
.. ' "A" type domains have originated from gene duplication of a common structural genetic element with .
tha result that they share substantial amino acid sequence homology (greater than approximately 15 to 20~) with the regio~ of the mature vWF subunit between approximately residues 500 and 700. Mancuso, D.J. et ~:;
alO, J. Biol. Chem., 264(33) 19514-19527 (1989).
Representative of such proteins are complement factor 3, co~plement component C2, cartilage matrix protein, ~I-collagen type VI, ~ subunits o~ leucocyte adhesion receptors Mac-l, and LFA-l, VLA-1 and VLA-2. The 2,050 residue mature von Willebrand subunit itself contains -two other "A" domains, A2 (approximately residues 710-910) and A3 ~approximately residues 910-1110).
':'' Antibodies with ~erapeutic Activity .
Antibodies, and particularly conformation dependent antibodies, are powerful tools for analyzing ':

' WO9~J06~ PCT/VS91/077~6 '' ~.

~9~

the structure and function of macromolecules. By blocking macromolecular interactions, antibodies can also have important therapeutic utility.

Accordingly, this invention includes within its S scope an antibody which is specific for the vW~
subunit, or any polypeptide containing a subset thereof which antibody is made by a process which involves immunizing animals with a polypeptide patterned upon th~ mature vWF subunit sequence between approximately residue 441 and residue 730 thereof, and having less -~ tendency than the polypeptide upon which it is patterned to form interchain disulfide bonds owing to - deletion or replacement, of one or more of cysteine residues 4S9, 46Z or 464 of the pattern sequences.
Further diagnostic or therapeutically useful antibodies can be generated against polypeptides so patternad upon -, the above stated sequence region and in whic~ cysteine residues 509 and~695 form a disulfide bond, thereby - recreating important domains of tertiary structure. ;

Therapeutic comDositions one or more of the polypeptides of the present invention can be formulated into pharmaceutical preparations ~or therapeutic, diagnostic, or other uses. To prQpare them ~or intravenous administration, the compositions are dissolved in water containing physiologically compatible substances such as sodium chloride (e.g. at 0.35-2.0 M), glycine, and the like - and having a buffered pH compatible with phy~iologica conditions, which water and physiologically compatible substances comprise a pharmaceutically acceptable carrier. ~, ~ WQg2/06~ PCT/US91/077~
' 2 j ~

.

With respect to the monomeric 52 kDa polypeptides o~ the invention having at least a substantially reduced tendency to dimerize, the a~ount to administer for the prevention or inhibition of thro~bosis will depend on the severity with which the patient is subject to thrombosis, but can be determined readily for any particular patient.

With respect to the recombinant 116 kDa polypeptide of the invention, or other dimeric ~
polypeptide subfragments thereof, the amount to ~ -administer for the treatment of von Willebrand disease will depend on the severity with which the patient is subject to hemorrhage, but can be determined readily for any particular patient.
~.
Examples ," ~
The following Examples are representative of the :
practice of the invention.
.
I. Construction of vW~ Polypeptides Suitable to Carry IIb-Type Mutat~ons ;
, Example 1 - Expression of a ~utant cysteine-free mature von Willebrand factor subunit fragment having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 733_(valine) _ _ ;
Preparation of a cDNA Clone fxom pre-ero-von Willebrand Factor mRNA
..~
- A cDNA clone encoding the entire von Willebrand factor gene (for the pre-propeptide) was provided by - Dr. Dennis Lynch, Dana-Farber Cancer Institute, Boston, wos2~06sss Pcr/usslib77s~, 2~425!~
.
.

MA and was prepared as describe,d in Lynch, D.C. et al., Ce~l, 41, 49-56 ~1985). It had been deemed probable that the size of vWF mRNA would likely exceed - that of human 28S type rRNA. Accordingly, total RNA
from endothelial cells (the major source of plasma vWF) was sedimented in sucrose gradients, with ~NA larger than 28S being selected for construction of a cDNA
library.
:, ..
This enriched fraction was further purified using - 10 two separate cycles of poly(u)-Saphadex~ chromatography to select for RNA species (mRNA) having 3' : polyadenylated ends. Lynch at al., supra, estimated ~! the prevalence of vWF mRNA in this fraction at about 1 in 500, which fraction was used to generate a cDNA
library of approximately 60,000 independent , recombinants.

To generate the cDNA library, stand,ard techniques were used. The mRNA population was primed using an oligo (dT) primer, and then transcribed with a reverse transcriptase. ThP RNA strands were then removed by alkaline hydrolysis, leaving cDNA anticoding stran,ds (equivalent to transcribed strandsj which were primed by hairpin looping for second stran,d synthesis using DNA polymerase I, The hairpin loop was removed wi~h S~
nuclease and rough ends were repaired with DNA
polymerase I.

GC tailing, Maniatis, T. et al., Molecular lonin~, 2nd ed., v.l, p.5.56 ~1987), was then used to anneal the cDNA into plasmid vector pBR322. Oligo(dC) tails were added to the cDNA fragments with terminal transferase and were annealed to oligo(dG) ~ailed WO ~2~ 9 PCr/USgl/b775f;

r~

pB~322. The plasmids were transformed into ampicillin sensitive ~.coli, strain ~101 for propagation.
Suitable clones were identified after screening with 32P-labelled cDNA prepared as reverse transcriptase product of immunopuri~ied vWF polysomes. Positive clones were subcloned into pSP64 (Promega Co., Madison, . .
Primer Directed AmPlification of cDNA

- cDNA representing the full length pre-pro-vWF gene from p5P64 was subjected to enzymatic amplification in a polymerase chain reaction. Based upon the established nucleotide sequence of the pre pro-vWF -gene, Bonthron, D. et al. Nucl Acids Res., 14(17), -7125-7127 (1986); Mancuso, D. et al., ~. of Biolo~ical Chemistry, v.264(33~, 19514-19527 (1989) oligonucleotides flanking the region of interest (designated (1), SEQ ID N0: 2, and (2), SEQ ID N0: 3) were prepared. All oligonucleotides used herein were synthesized by the phosphoramidite method , Sinha, et al., Tetrahedron Letters, 24, 5843 (1983), using a model 380B automated system, Applied Biosystems, Foster City, ~A.
Oligonucleotide (1) (SEQ ID N0: 2) 5'ACGA~C CGG CGT TT~ GCC ~CA GGA3' ;
EcoRI Arg~l A Gly4~

Oligonucleo~ide (2) (SEQ ID N0: 3~ ~ -3'GG GAC CCC GGG TTC TCC TTG AGG TAC CAT TCGAAG5' 5'cc ctq ggg ccc aag agg aac tcc atg qta aqcttc3' Leu~ - Me~32Val733HindIII
.

!
; ""' W092r06~ PCT/US91/077~ _ :
~ ~ 9 ~

The oligonucleotide~ overlap the ends of the coding region ~or that fragment of the mature vWF subunit which can be produced by digestion with trypsin and which begins with residue 449 (valine) and ends with residue 728 (lysine). Oligonucleotide (1) corresponds to coding strand DNA (analogous with mRNA) for amino acid positions 441 to 446 and adds an EcoRI restriction site 5' to the codon for amino acid 441.
Oligonucleotide (2~ corresponds to the non-coding strand (transcribed strand) of mature vWF D~A for amino acids positions 725-733 and adds a ~indIII restriction site 3' to the codon for amino acid 733. The coding strand complementary to (2) is shown in lower case letters.

Using the above oligonucleotides with the full length cDNA as template, a cDNA fragment corresponding to mature vWF residues Nos. 441-733, and containing EcoRI and Hind III linkers, was then synthesized in a ~
polymerase chain reaction following the method of ~ :
Saiki, R.K. et al. Science,-239, 487-491 (1988).
' The procedure utilizes a segment of double-stranded vWF cDNA, a subsegment of which is to be amplified, and two single-stranded oligonucleotide primers (in this case oligonucleotides ~1), (2)) which flank the ends o~ the subsegment. The primer oligonucleotides (in the presence of a DN~ polymerase and deoxyribonucleotide triphosphates) were added in ~uch higher concentrations than the DNA to be~
amplified.

Specifically, PCR reactions were performed with a DNA thermal cycler (Perkin Elmer Co., NorwalX, CT/Cetus WOg2~06~ PCT~US91/07756 .~ . .

.
` 77 Corporation, ~erkeley, CA) using Taq polymerase tThermus ag~aticus~. The reactions wera run in 100 ~e volumes containing 1.0 ~g of pre-pro-vWF cDNA, 1.0 ~g - of each synthetic oligonucleotide primer, and buffer consisting of 50 mM KCl, 10 mM Tris HCl (pH 8.3), 1.5 mM MgCl2, 0.1% gelatin (BioRad Co., Richmond, CA) and -~
200 mM of each dNTP. PCR conditions were 35 cycles of 30 seconds at 94C, 30 seconds at 52C and 1 minute at 72OC. Amplified fragments were then purified and isolated by electrophoresis through a 2~ agarose gel, -- Maniatis et al., Molecular Cloning~ A Laboratory Manual, 164-170, Cold Spring ~arbor Lab., Cold Spring Harbor, NY (1982).

The vast majority of polynucleotides which accumulate after numerous rounds of denaturation, ; oligonucleotide annealing, and synthesis, represent the desired double-stranded cDNA subsegment suitable for further amplification by cloning.

For some experiments, cDNA corresponding to the ! 20 mature vWF fragment beginning at amino acid sequence position 441 and ending at poæition 733 was prepared and amplified directly from platelet mRNA following the procedure of Newman, P.J. et al. J. Clin. Invest., 82, 739-743 ~1988). Primer nucleotides No. 440 and 733 were utilized as be~ore with the resulting cDNA "~ ~;
containing EcoRI and HindIII linkers.

Insertion of cDNA into M13mpl8 Cloninq Vehicle ~

The resultant double stranded von Willebrand -factor cDN~ corresponding to the amino acid sequence from residue 441 to 733 was then inserted, using EcoRI

., W~2/~ P~T/US9l/~775~
2~9~59 :

and HindIII restriction enzyme~, into the double stranded replicative form of bacteriophage M13mpl8 ; which contains a multiple cloning site having compatible EcoRI and HindIII sequences. ~ -, M13 series filamentous phages infect male (F
factor containing) E.coli strains. The infecting form of the virus is represented by single stranded DNA, the (~) strand, which is converted by host enzymes into a double stranded circular form, con~aining also the minus (~) strand, which double stranded structure is referred to as the replicative form ~RF). The ability to isolate a stable single stranded (*j form of the virus is particularly useful to verify ths integrity of any cloned sequences therein. See Messing, J., Meth.
Enzymolooy, 101, 20-78 (1983); Yanish-Perron, C. et al., Gene, 33, 103-lO9 (1985).

Accordingly, the vWF cDNA insert was completely sequenced using single-stranded dideoxy methodology (Sanger, F. et al. Proc. Natl. Acad. Sci USA, 74, 5463-5467 (19771~, utilizing the single-stranded (+~ form of M13mpl8, to confirm that the vWF cDNA fragment contained the correct coding seguence for mature vWF '~
subunit residues 44~-733. - ~;

Si~e-Di~ctedJM~t~g~ s to Replace Cysteine Residues Cysteine residues 459, 462, 464, 471, 474, 509, and 695, within the mature vWF fragment corresponding r ~'' to amino acids 441 to 733, were replaced with glycine residues by substitution of glycine codons for cysteine ;~
codons in the corresponding cDNA. In order to accomplish this, oligonucleotides (see Sequence Listing WO9~/06~ PCr/US91/0775S .
: .:
2 ~ 3 4 ~6 r~.S ~3 ,~
79 :
ID NOS: 5-8~ encompassing the region of each cysteine codon of the vWF cDNA were prepared as non-coding strand (transcribed strand) with the corresponding base :-substitutions needed to substitute glycine for ; 5 cysteine. The oligonucleotides used were as follows~
Oligonucleotide (3) (SEQ ID NO: 4~
3 'GGA CTC GTG CCG GTC TAA CCG GTG CAA CTA CAA CAGS' 5'cct gag gac aqc cag att agc cac qqt gat gtt gtc3' Pro Glu ~is Gly Gln Ile Gly His Gly Asp Val Val 459 462 4~4 .:
(simul~aneously replacing cy~eines 459, 462, 464).
"~.' .

: Oligonucleotide (4~ (SEQ ID NO: S) ~
3 ' TTG GAG TGG CCA CTT CGG CCG GTC CTC GGC5' - :
j 5~aac ctc acc aat gaa gcc qac cag gay ccg3' .~
., 15 Asn Leu Thr Gly Glu Ala Gly Gln Glu Pro .:.
471 474 .:
(simultaneously replacing cysteines 471, 474) .. ..
Oligonucleotide (5) (SEQ ID NO: 6) 3'CTA AAG ATG CCG TCG TCC G5' 205'gat ttc tac qc agc agg c3' :~
Asp Phe Tyr Gly Ser Arg - 509 ; :
~ (replacing cysteine 509) `:~.
.:~ : . ': '' Oligonucleotide (6) (SEQ ID NO: 7) 3'TCG ATG GAG CCA CTG GAA CGG5' 5'agc tac ctc qat gac ctt gcc3' Ser ~yr Leu Gly Asp Leu Ala (replacing cysteine 695) --- , Hybridizing oligonucleotides are shown in capital .
letters and are equivalent to the transcribed strand ~`' (non-coding DNA). .The equivalent coding strand is ' '~.,.
. ::

:
W~g2~0~ PCT/US91/0775~

`: 209~2~
: ` ~o shown in lower case letters with the oorresponding amino acids shown by standard three letter designation. ;~
(for designations see Table 1) As elaborated below, cysteines 459, 462 and 464 were replaced simultaneously using oligonucleotide ~3).
Cysteine residues 471 and 474 were then replaced ` simultaneously using oligonucleotide t4). Cysteine residues 509 and 695 were then replaced individually using oligonucleotides (5) and ~6) respectively.
'~:
The cysteine to glycine cDNA substitutions were accomplished following the procedure of Kunkel, T.A., Proc. Natl. Acad. Sci. USA, 82,488-492 (1985) which ' procedure repeats a series of steps for each oligonucleotide and takes advantage o~ conditions which select against a uracil containing DNA template:
~A) M13mpl8 phage, containing wild type vWF cDNA corresponding to amino acid positions 441 to 733, is grown in an E.coli CJ236 mutant dut~ung~strain in a uracil rich medium. Since this E.coli strain is deficient in deoxyuridine triphosphatase (dut-), an intracellular pool of dUTP
accumulates which competes with dTTP for incorporation into DNA.
(see Shlomai, J. et al. J. ~iol.
Chem:., 253(9), 330S-3312 ~1978).
Viral DNA synthesized under these conditions includes several uracil insertions per viral genome and is stable only in an E.coli strain c WO 9~/D69g9 PCr/US91/07756 2 ~ ~ :
. .

which i5 incapable of removing . ;
uracil, such as (ung~) strains . .
whi~h lack uracil glycosylase.
Uracil-containing nucleotides are : - 5 lethal in singIe stranded (+) ~ .
M13mpl8 DNA in ung~ strains due to ~ ~-, the creation of abasic sites by : ~
. ~: uracil glycosylase. ; :.
(B) ~Single-stranded ~+) viral DNA is .: ;~
isolated from culture media in : which phage were grown in E.col1 :
strain CJ236 dut~ung~. The single r stranded ( ~ form of the virus contains the specif ied vWF cDNA at `, ~ ~
its multiple cloning site which .,~ ~;
cDNA is equivalent to the ~ : : nontranscribed vWF DNA strand ~ : ~ :
:~ ~C)~ Oligonucleotide (3), which:contains ~ codon alterations necessary to ~ substitute gly~ines for cysteines ::
at positions 459, 4~62 and 464, is then~ annealed in vitro~ to single stranded :(~ phage: DNA. Gerlerally, : .~.
a wide range o~ oligonuclaotide concentra~ion8 i8 suitable in this procedure. 5ypically 40 ng o~
: oligonucleotide was annealed to 0.5-1.0 ~g N13mpl8 phage (+~ DNA.
- (D) AlI missing sequence o~ the ~ :
30 . ~ M13~pl8(-) strand is then completed ~ in vitro using T7 DNA polymerase ;.
; ~: ànd T4 ~A ligase in a dTTP rich .i :
environment thereby generating a .:
transcribable vWF cDNA sequence -.', : .:
''~

` W0~2/06~ PCT/US91/~7756 ~

`" 209~-2~
. .

corresponding to amino acid ;~
positions 441 to 733 of the mature vWF subunit.
(E) The double stranded M13mpl8 phage, S now containing a thymine normal (~) strand and a (+) strand with ~; several uracil substitutions, is trans~ormed into a wild type E.~oli XL-1 Blue (Stratagene, La Jolla, - CA) strain which contains normal levels of uracil glycosylase and deoxyuridine triphosphatase.
(F) Uracil glycosylase and other ;
enzymes present in the new host initiate destruction of the uracil- ''~r containing (') strand of the double-strand phages, leading after ~".
replication in the host of ~ ;
remaining pha~e (~) strand DNA to 20 ~ the presence of stable~thymine-~ normal double~strand d (RF) DNA
; ~ which reflects the glyoi~e mutations inducéd by`the oligonucleotide.
~- 25 (G~ Steps (A) to (F) of the above process are then repeated for each o~ oligonucleotides (4), ~5) and ~6) until each successive cysteine codon of the vWF sequence within the M13~pl8 phage has been replaced by a glycine codon.
- . : , .
~ (H) Upon completion of mu~agenesis , procedures the sequence of the vWF
; ~ cDNA insert was reconfirmed using .
' ' ' j . -`: :
W~92~06~ PCT/US91/07756 209~259 ::?` the eingle stranded DN~ dideoxy ~ethod. (Sanger, F. et al., supra) construction of_Expression Plasmids The double stranded vWF cDNA fragment containing 7 site-specific cystei~e to glycine mutations is then removed from M13mpl8 phage by treat~ent with EcoRI and HindIII restriction endonucleases, after which the ends of the fragment are modified with BamHI linkers !~ (Roberts, R.J. et al. Nature, 265, 82-84 (1977)) for .3 10 cloning into a high efficiency E.coli expression `3 vector. The particular expression vector chosen is plas~id pET-3A, developed by Rosenberg, A.H. et al.
Gene, v.56, 125-135, (1987) and which is a pBR322 derivative containing a high efficiency (~10) T7 - 15 transcription promoter directIy adjacent to the BamHI
- linker site. When containing the above-specified fragment of-mutant vWF cDNA, the pET-3A vehicle is refered to as "p7E" or p7E expression plasmid. ~ -A second pET-3A-derlved expression plasmid ~designated p7D3 was constructed containing the ;~
identical vWF coding sequence cloned into the plasmid in the opposite orientation. p7D should be unable to express the vWF polypeptide fragment.

A third expression plas~id (pJD18) contains wild type 52/48 tryptic vWF fragment cDNA encoding the vWF
amino acid sequence between residues~441 and 733, (with 7 cysteines) in the same pET-3A vector. ~

The p7E (or p7D and pJD18) expression plasmids -~`
were then cloned into an ampicillin sensitive E.coli ~

WOg2/OS~ PCT/US91/07756~
20~12~9 :` :
``~ 84 ~ strain, B~21(DE3), Novagen Co., Madison WI, ac~ording - to a well established protocol Hanahan, D., Mol.
Biol., 166, 557-580 (1983). Strain BL21(DE3) is engineered to contain a gene for T7 RNA polymerase so that the vWF insert can be transcri~ed with high efficiency.
, Expression of Mutant vWF PolypeEtides ~ -:`
Three separate samples of E.coli strain BL21(DE3) containing respectively p?E, p7D or pJD18 expression plasmids were innoculated into 5-6 ml of 2X-YT growth ~ medium containing 200 ~g/ml of ampicillin, and grown - overnight at 37C to create fully grown cultures. 2X-YT growth medium contains, per liter of water, ~0 gm Bacto-tryptone, lQ gm yeast extract and 5 gm NaCl.
` 15 Five ml of each overnight culture was then innoculated into 500 ml of 2X-YT medium, again containing 200 ~g/ml of ampicillin and grown for 2 hours at 37C with shaking.
.
After the 2 hour incubation period, the cultures were induced for protein expression by addition of isopropyl-beta-d-thiogalactopyranoside to a concentration of 5 mM. The incubation was then continued for 3 hours at 37C.

A high level of expression of vWF polypeptide was obtained with p7E and p~D18 resulting in the generation of cytoplasmic granules or "inclusion bodies" which contain high concentrations of vWF polypeptide in essentially insoluble form. Solubilization of vWF
polypeptide was accomplished according to the following procedure. As explained in Example 2, p7E and pJD18 - .. - ~.... .. .

~`~ W092/06~ ` PCTi/US91/077S6 ~`` ~
!', !
` 85 2~9~259 extracts responded very differently to solubilization procedures. See Maniatis, T. et al., Molecular Clonin~, 2nd ed., vol. 3, Sec. 17.37, (1989) Cold -, Spring Harbor Laboratory Press, Cold Spring Harbor, NY, ~j; 5 for a general discussion of the properties of, and -i successful manipulation ~trategies for, inclusion bodies.
: - :
.-, . . .
. The cells were harvested by centrifugation at 4000 g for 15 minutes in a JA-14 rotor at 4C. The pelleted cells were washed in 50 ml of ice cold bu~fer (0.1 N ..
NaCl, 10 mM Tris pH 9.0, 1 mM EDTA) and repelleted by `~ centrifugation at 4000 g at 4C. `
:
The cell pellets from p7E, p7D and pJD18 cultures were each redissolved in 5 ml of lysing buffer and kept ice-cold for 30 minutes. The lysing buffer comprises a solution of sucrose 25%(w/v), 1 mM
'! phenylmethylsulfonylfluoride (PMSF), 1 mM ethylene diaminetetraacetic acid ~EDTA), 2 mg~ml lysozyme and 50 mM Tris hydrochloride, adjusted to pH 8Ø --J ., ' ':
After the 30 minute incubation, aliquots of 1.0 Molar MgCl2 and MnCl2 were added to make the lysing solution 10 mM in each cation. Sixty ~g o~ DNAseI
~Boehringer-Mannheim) was then added and the incubation wa~ contlnued at room temperature rOr 30 minutes.

Twenty-ml of buffer No. 1 (0.2 M NaCl, 2 mM EDTA, and 1% (w/v) 3-~(3-cholamidopropyl)-dimethylammonio~
propanesulfona~e (CHAPS), 1~ (wiV) Non-idet 40, and 20 mM Tris hydrochloride, pH 7.5) was then added to the incubation mixture. The insoluble material was ` WOg2/06~ PCT~US9l/07756 ~09~;i9 :-8~
pelleted ~y centrif`ugation at 14,00Q g ~12,000 rpm in aJA-20 rotor) for 30 minutes at 4C.

- The relatively insoluble pelleted material derived from each culture (which contains the desired polypeptides except in the case of p7D~ was washed at 25C in 10 ml of buffer No. 2 (0.5~ (w/v) Triton X-lO0 surfactant, 2 mM EDTA, 0. 02 M Tris hydrochloride, pH
7.5) and vortexed extensively. The suspension was centrifuged at 14,000 g for 30 minutes at 4C and the supernatant was then discarded. The process o~
- resuspension of th:e pelleted material in buffer No. 2, vortexing and centrifugation was repeated twice.

Each pellet was then washed in 5 ml of buffer No.
3 (O.02 M Tris hydrochloride, pH 7.5, and 2 mM EDTA) at ` 15 25C and vortexed extensively. The suspension was then centrifuged at 4C for 30 minutes at 14,000 g after which the supernatant was discarded leaving a pellet of inclusion body derived material (the ~Iwet pellet") with a clay-like consistency (With respect to the following final steps, and in replacement therefor, see also Example 20 which presents an additional improved procedure).

The insoluble pellet was slowly redissolved in an 8 Molar urea solut~on held at room temperature ~or 2 hours, after which solubilization was con~inued overnight at 4C. The urea-soluble material was extensively dialyzed against a solution of 0.15-N NaCl containing 20 mM Hepes (N-t2-hydroxyethyl]piperazine-N-r2-ethanesulfonic acid]) ~pH 7.4) (!'Hepes-buffered saline") at 4C.

- - . - .. . - . . . . . , , , , , . :

.': ' ' - , - .. ' . ' . . , , ',. ! ,, . ,. ". , ,, . .,, . ~... . , ,, ~ ,. . .. . .

` W~92/06~ PCT/U~91/07756 ;
`: 2 ~ ~ 4 ~
.~ .
~;` 87 The æolublized peptide extracts were assayed for purity (Example 2), used in vWF binding inhibition assays (Example 3) or subject to further purification.
Further purification steps should not be delayed and the samples should remain cold.
,~ ., .
The cysteine-free vWF polypeptide (comprising subunit positions 441 ~o 733) cons~itutes more than 75 of the material solubilized from the inclusion bodies according to the above procedure. Further purification of the cysteine-free mutant ~WF polypeptide was accomplished by redialyzing the partially purified - peptide extract against 6 M guanidine ~Cl, 50 mN
Tris HCl, pH 8.8 followed by dialysis against 6 M urea, .
25 mM Tris-HCl, 20 mM KCl, 0.1 mM EDTA, pH 8Ø The ; 15 extract was then subjected to high performance liquid chromatography using Q-Sepharose0 Fast Flow (Phar~acia, Uppsala, Sweden) for anion exchange. The column was c preequilibrated with 6 M urea, 25 mM Tris HCl, 20 mM
~Cl, 0.1 mM EDTA p~ 8Ø Elution of the vWF ~:;
polypeptide utilized the same buffer except that the concentration~of~Cl was raised to 250 mM. ~ol~peptide samples used *or ~urther assays were redialyzed against 0.15 ~ NaCl, 20 mM Hepès, p~ 7.4. However, long term storage was best achieved in ureà bu~fer (6 ~ urea, 25 mM Tris HCl, 20 mN RCl, 0.1 mM EDTA pH 8Ø Final p7E-vW~ polypeptide percent amino acid compositions (by acid hydrolysis) compared closely with values predicted from published sequence information (Bonthron, D. et al. and also Mancuso, D. et al. in Example 1, supra; -see also Figure 1).

:'' ~ ~' ~, .. ., . . . . .. ... , .. ; .. .. .. . . ....... ~ . .. .......... . .. .

~ W09~/~6~ PCT/~S91/07756 "2 ~ 9 .

Example 2 - Characteri2ation o~ the cysteine-free mutant von Willebrand factor fragment roduced by expression plasmid p7E _ . .
Urea-solubilized and dialyzed polypeptides ~` 5 extracted from inclusion bodies of cultures containing , expression plasmids p7E, p7D and pJD18 were analyzed usiny polyacrylamide gel electrophoresis tPAGE) and immunoblotting.

~ Characterization by SDS-- 10 Polyacrylamide Gel Electrophoresis ' The purity and nature of the expression plasmid extracts, which had been urea-solubilized and then extensively dialyzed, were first analyzed using the denaturing sodium dodecylsulfate-polyacrylamide gel - 15 electrophoresis procedure of Weber, K. et al. ~ _~iQ
- Chem., 244, 4406-4412 (1969), as modified by Laemli, U.K. Nature, 227, 680-685 (1970) using an acrylamide concentration of 10%. The resultant gels were stained with Coomassie blue and compared.
;i' ' ~' 20 The extract from expression plasmid p7E contains as the major component, the mutant von Willebrand factor polypeptide which migrates with an apparent molecular weight of approximately 36,000 Daltons. The polypeptide appears as a single band under both reducing conditions (addition of between 10 and lO0 ~M
dithiothreitol "DTT" to the sample for 5 min at 100C
prior to running the gel in a buff~r also containing the same DTT concentration) and nonreducing conditions, -which result is consistent with the substitution of ;
glycine residues for all of the cysteine residues therein. No vWF polypeptide could be extracted from host cells containing p7D expression plasmids as ~.:
~ ~ .

.. ,,,,,.. ..... ; 1:

W092~ P~T/US91/0~756 .
5 ~
` 8 expected ~rom the opposite orientation of the vWF cDNA
~ insert.
., ,-,., ~ .:
The cysteine-containing vWF polypeptide expressed by host cells containing pJD18 plasmids, and which - 5 contains the wild type amino acid sequence of the 52J48 fragment, (herein represented by a residue 441 to 733 cloned fragment) behaved differently under redu~ing and nonreducing conditions of electrophoresis. The wild- :
type sequence expressed ~rom pJD18 forms intermolecular disulfide bridges resulting in large molecular weight aggregates which are unable to enter the 10~ acrylamide gels. After reduction (incubation with 100 mM DTT for 5 min at 100C), the vWF peptide migrates as a single -, band with a molecular weight of approximately 38,000.

Characterization ~y Immunoblottin~
!
Polypeptides expressed from p7E, p7D and pJD18 were further characterized by immunoblotting ("Western ~! blotting"~ according to a standard procedure Burnett et al., A. Anal. Biochem., 112, 195-203, ~1981) and as recommended by reagent suppliers. Samples containing approximately 10 ~ o~ protein fro~ the urea-solubilized and dialyzed inclusion body extracts of host cells (containing p7E, p7D and pJD18 plasmids) were subjected to electrophoresis on 10~ polya~rylamide gels, Laemli, U~K. Nature, 227, 680 ~85 (1~70), in the preaence o~ 2% concentration of sodium dodecyl sulfate.

Thè proteins were blotted and im~obilized onto a nitrocellulose sheét (Schleicher and Schuell, Keene, NH) and the pattern was then visualized using immunoreactivity.
:: ' W092~ PCT/US91/b7756 2~25~

~ The von Willebrand ~actor-specific monoclonal ;~ antibodie~ Ifrom mice) used to identi~y the polypeptides were RG-46 (see Fugimura, Y. et al. J.
Biol._Chem., 261(1), 381-385 (1986), Fulcher, C.A. et al. Proc. Natl. Acad. sci. USA, 79, 1648-1652 (1982) ), and NMC-4 (Shima, M. et al. J. Nara Med. Assoc., 36, 662-669 (1985) ), both of which have epitopes within the-expressed vWF polypeptide of this invention.
.
The secondary antibody t~ rabbit anti-mouse - 10 IgG), labelled by the method of Fraker, P.J. et al.
Biochem._Biophys. Res. commun., 80, 849-857 tl978) ), ~, was incubated for 60 minutes at 25C on the nitrocellulose sheet. After rinsing, the sheet was developed by autoradiography.
..;
Peptide extracts from host cells containing p7E
and pJD18 sxpression plasmids display strong immunoreactivity for RG-46 antibody and a weaker but definite affinity for NMC-4 antibody. As expected, ~ peptide extracts from p7D plasmids show no ,`1 20 immunoreactivity with either RG-45 or NMC-4.

.
Example 3 - Inhibition of botrocetin-induced binding o~ vWF to platelets by the cysteine-~ree nutant ~olypep,tide ex~ressed by ~7E

It has been demonstrated that botrocetin, extracted from the venom of Bothrops iararaca modulates the in vitro binding of multimeric von Willebrand ~'`
factor to platelets (Read, et al~ Proc. Natl. Acad. - ~
Sci., 75,-4514-4518 ~1978)) and that botrocetin binds .' to vWF within the region thereof containing amino acid 30 , sequence positions 441-733 (of the mature subunit), and ',, - ~'`' ':
:~.
' .
': '. ' . ,. . , , ~ , ~, , , , , . ~ , ; .

W092/0~
PCT/US9l/D7756 `~- 2~425~
.. - :.':.
`:`` 91 ' ' `~ thus the GPIb binding domain. (Andrews, R~K. et al., Bioche~istry, 28, 8317-8326 (1989)~.

- The urea-solubilized and dialyzed polypeptide extracts, obtained (according to the method of Example ~`
1) from cultures containing expression p~asmids p7E, p7D and pJD18, were tested without further purification for their ability to inhibit botrocetin-inducPd vWF `
binding to formalin-fixed platelets on a dose dependent basis.
`' Formalin-fixed platelets, prepared according to the method of MacFarlane, D. et al., Thromb. Diath.
Haemorrh. 34, 306-308 (1975), were pre-incubated at room temperature for 15 minutes with specified dilutions of peptide extracts obtained from cultures :`
containing pJD18, p7D, and p7E plasmids. Botrocetin, (Sigma, St. Louis, M0) to a final concentration of 0.4 ~g/ml, and ~I-labelled multimeric vWF (isolated ~rom human plasma cryoprécipitate according to the method of Fulcher, C~A. et al. Proc. Natl. Acad. Sci. USA, 79, 1648-1652 (1~82), and labelled according to the method o~ Fraker, P.J. et al. Bioche _ Biop~s. Res. Commun., 80, g49-857 ~1978)) were then added to the incubation mixture, and the a~ount of ~ vWF bound to the platelets was deter~ined.

fflI-vWF binding to the platelets was re~eren~ed against 100~ binding which was de~ined as the a~ount of vWF bound in the absence of added peptide `~`
extracts.
. . ' ' Figure 2 demonstrates that peptide extracts from expression plasmids p~D, and pJD18 (unr duced and ~2/f~ PCr~US~1/0i756 2 ~9 ~hS9 `~ 92 unalkylated) cannot competa with plasma-derived vWF ~or platelet GPIb receptor binding sites. The peptide ~ extract ~rom plasmid p7E was e~fective in a dose - dependent manner (using a range of 0 to 100 ~g extract/ml) in inhibiting vWF binding. The concentration o~ urea-solubilized polypeptide extract (~g/ml) in the incubation mixture reflects the total ; protein concentration from the extract. Addition of peptide extracts to the reaction mixture causes certain ` 10 nonspecific effects which raise apparent initial binding to 110% of the value found in the absence of the added peptide extracts. The l~-IvWF concentration used was 2~g/ml.
.
Example_4 - Expression of a mutant vWF fragment of reduced cysteine content containing a disulfide-dependant conformation Utilizing the procedures of Example 1, except as --modified below, a mutant vWF polypeptide fragment (corresponding to the mature vWF subunit sequenGe from residue 441 to residue 733) was prepared in which the cysteines at positions 459, 462, 464, 471 and 474 were each replaced by a glycine residue. Cysteine residues were retained at positions 509 and 695, and allowed to form an intrachain disulfide bond.

Site directed mutagenesis was perform~d only with oligonucleotides No. 459 and 471, thereby substituting glycine codons only at positions 459, 462, 464, 471 and 474. Upon completion of mutagenesis procedures, the ~ "~
sequence o~ the mut~nt vWF c~NA was confirmQd using the single-stranded dideoxy method. ~;~

,,,'~ ~, , , W092~06~ PCT/US9~/07756 .

;`
;` 93 Th~ double-stranded ~orm of the vWF cDNA insert .
` (containing 5 cysteine to glycine mut~tions) was then removed from M13mpl8 phage by treatment with EcoRI and . HindIII restriction endonucleases, modified as in i 5 Example 1 with BamHI linkers, and cloned into pET-3A. The pET-3A
: vehicle so formed is referred to as "p5E" or p5E
'?' expression plasmid.

.
: The p5E expression plasmids ~ere then cloned into . 10 ampicillin sensitive E.coli strain BL21(DE3), Novagen ~ Co., Madison, WI, according to the procedure of .~. Hanahan, D., J. Mol. Biol., 166, 557-580 (1983). The ; p5E mutant polypeptide was e~pressed from cultures of : `
E.coli BL21(DE3) following the procedure of Example 1 except that solubilization of inclusion body pellet material in the presence of 8 Moiar urea need not be ~ continued beyond the initial 2 hour period at room ~ temperature, at which point redissolved material had ..
reached a concentration of 200 ~g/ml. Oxidation of .::
cysteine residues 509 and 695 to form a disulfide bond ~-was accomplished by dialysis overnight against Hepes-. bu~fered saline. ~Formation of intrachain rath2r than interchain disulfide bonds is favored by allowing thiol :.
i oxidation to proceed at a low protein concentration such as 50-100 ~g./ml.

As in Example l ~ertaining to the p7E extracts, ;:
final purification of urea-solubilized inclusion body preparations was accomplished by dialysis against the 6 M guanidine and 6 M urea buffers followed by anion exchange chromatography.
:
. ~ .

.. . , ~., . ,.. . ~ .. . . , , , , , , : : , .

- :,. . - ,,i , . ': ;., , ~ ;. ' . ,; , . . -, ,, .. . .

W~92/~6~ PCT/US91/07756 2~259 . .

Example 5 - Characterization of the mutant vWF ~ragment produced by exprassion ~lasmid p5E
.
The mutant von Willebrand factor polypeptides produced by cultures containing expression plasmid p5E
were characterized utilizing the procedures of Example - 2, and in particular compared with the vWF fragment expressed by plasmid p7E.

Urea-solubilized and dialyzed polypeptides extracted from inclusion bodies (according to the procedure of Example 4) were compared with similar `
extracts from p7E plasmid cultures produced as in `
~xample 1.
., ` .
,~1 Characterization by SDS-' 15 PolyacFylamide Gel Electrophoresis J The denaturing sodium dodecylsulfate gel procedure s of Example 2 was used to compare the p5E vWF fragments, which can form disulfide bonds using cysteine residues 509 and 695, with the p7E ~ragment which has no . -, `
~ 20 cysteine residues. ~Electrophoresis was conducted using ~i`
'~ ~ 7.5 ~g of protein extract per lane on 10% acrylamide gels under reducing (100 mM dithiothreitol) and non-reducing conditions.
~' .
Under reducing condition6, and a~ter staining with Coomassie blue, extracts ~rom p7E and p5E have ~identical el~ctrophoretic mobilities.

Electrophoresis under nonreducing conditlons, however, demonstrates the effects of disulfide bonds involving residues 509 and 695. A substantial amount .
:

,, ; ~
W092/06~ PCT/US91/07756 `~ 95 `~ o~ the p5E extract appears as a high molecular weight complex (resulting from interchain disulfide bonds) ~ which enters the gel only slightly. Densitometric .r` scanning of the gels of initial preparations indicates - 5 that approximately 25% of the p5E polypeptide material `f found on nonreducing gels is represented by monomers of '`,r' the 441-733 fragment having an apparent molecular weight of approximately 38,000. The percent of monomer present in p5E extracts can be improved significantly -by conducting urea solubilization, dialysis, and thiol oxidation at a more dilute protein concentration, such as 50-lO0 ~g/ml, to favor intrachain rather than ,i interchain disulfide bond formation.
,. . . ...
, This p5E monomeric species has a slightly higher mobility during electrophoresis under nonreducing conditions than the comparable p7E product species which has no cysteine residues. The mobilities of these p5E and p7E monomeric 38 kDa species appear identi~al under reducing conditions. The slightly accelerated mobility of a polypeptide which retains ~i tertiary structure in the presence of SDS under nonreducinq conditions, when compared to the mobility `' o~ the homologous polypeptide which the anionic detergent converts completely into a negatively charged fully rigid rod under said conditions, is generally considered suggestive of the presence of an intrachain d~sulfide bond.

Characterization_by_~mm.un~ob~lottinq .~
The behavior of p5E ~nd p7E extracts were also examined using immunological methods.

., - . : . . : - . -` W~92/06~ PCT/US91/077~6 ; :
: 2~9~2~9 As in Example 2, vWF-specific murine monoclonal antibodies RG-46 and NMC-4 were used as probes. RG-46 has been demonstrated to recogni7e as its epitope a linear sequence of amino acids, comprising residues 694 to 708, within the mature von Willebrand factor subunit. The binding of this antibody to its -~ determinant is essentially conformation independent.
Mohri, H. et al., J. Biol._Chem., 263(34), 17901-17904 -(19~

NMC-4 however, has as its epitope the domain of ~`
the von Willebrand factor subunit which contains the glycoprotein Ib binding site. Mapping of the epitope has demonstrated that it is contained within two 3~ discontinuous domains ~comprising approximately mature vWF subunit residues 474 to 488 and also approximately residues 694 to 708) brought into disulfide-dependent `
, ~ association, Mohri, H. et al., supra, although it was Y unknown whether the disulfide bond conferring this tertiary conformation in the native vWF molecule was intrachain or interchain. Id. at 17903.

-~ 7.5 ~g sample~ (of protein) were fir-~t run on 10% SDS polyacrylamide gels so that the antigenic behavior of particular bands ~under reducing and nonreducing conditions) could be compared with results obtained above by Coomassie blue staining. Immunoblottin~ was performed as in Example 2 to co~pare pSE and p7E
extracts.

Application of antibody to the nitrocellulose sheets was usually accomplished with antibody solutions prepared as follovs. Mioe were injected with B- . -lymphocyte hybridomas producing NMC-4 or RG-46. ;~

'":: .' '-'. `
' ~

-- , . . .

, .. .. '" , !, . , . ~,., ~ ., ' ` ' .; ~, i `.' ' ', . . ' ,.

`; W0~2J0~ PCT/US91~7756 ~ 2~259 : 97 - Ascites ~luid from peritoneal tumors was collected and ;~ ` typically contained approximately 5 mg/ml of monoclonal antibody. The ascites fluid was mixed (1 part per i 1000) into blocking fluid (PBS containing 5% (w/v) non- ..
. 5 fat dry milk, carnation) to minimize non-specific - background binding. The antibody-containing blocking fluid was then applied to the nitrocellulose.
. .
Under nonreducing conditions, the single chain p5E
:. polypeptide fragment (representing the sequence from . 10 residue 441 to residue 733) displayed an approximate 120 ~old increase in binding affinity for M~C-4 compared to the comparable cystein-free species :~ isolated from p7E also representing the primary i~ sequence from residue 441 to 733. After electro-.~ 15 phoresis under reducing conditions (utilizing 100 mM
DTT), the single chain p5E species showed a remarkably de~reased affinity for NMC-4, which was then very ~:
-~ similar to that of the cysteine-free p7E specie~ under either reduced or nonreduced conditions. NMC-4 also fails, under reducing or non-reducing conditions, to :-recognize as an epitope disulfide-linked dimers from the p5E extract. ;::
': ' " . .
The nitrocellulose filters used to produce autoradiographs based on NMC-4 were rescreened with RG-46 by subtracting the initial NNC-4 exposure response, which was kept low through a combination of low.
antibody titer and short exposure ~i~e. The binding of RG-46 to the p7E 36,000 kDa polypeptide on the ~ilters is t~e sa~e whether reducing or non-reducing conditions were chosen, consis~ent with the replacement of all cysteines by glycine in the expressed polypeptide.

. ' ~ .
. _, . . , . , . ~ , . . . . .

, . : .- ,~ - . -: :
- - . -- , ~ - , :

W092/~ PCT/US91/077~6 ```` 2~9~2~
.... .
, 98 ~: .
A large molecular weight vWF antigen (reactive to RG-46) is present in the p5E pol~peptide extract under nonreducing conditions. ~hese p5E vWF aggregates ;
(reflecting interchain disulfide bonds) migrate under -~
reducing conditions in the same position as the p7E
-` polypeptide indicating disruption of their disulfide contacts. However, the large p5E interchain disulfide aggregates which are readily recognized under ~` nonreducing conditions by RG-46 ~re not recognized by NMC-4 under either reducing or nonreducing conditions. -It is thus demonstrated that the disulfide bond between residu~s 509 and 695 in native multimeric vWF subunits ; represents an intrachain contact.

` Example 6 - Inhibition of the binding of an anti-GPIb monoclonal antibody by p5E polypeptide t Monoclonal antibody LJ-Ibl is known to compl tely inhibit von Willebrand ~actor-platelet glycoprotein Ib interaction. ~anda, M. et al., J. Biol Chem., 261(27), 12579-12585 (19863. It reacts specifically with the amino terminal 45 kDa domain of GPIb~ which contair.s the vWF binding site. Vicente, V. et al., J~
` Bio~ _ em., 265, 274-280 (1990).

To assess the inhibitory actiYity of p5E extracts on antibody binding, a concentration o~ LJ-Ibl was ~irst selected which would, in the absence of p5E
extracts, provide half-maximal binding.
. . .
.. . .. . .
LJ-Ibl was iodinated by the procedure of Fraker, D.J. et al., Biochem. Biophys. Res. Commun., 80, 849-857 (1978~ using Il~ from ~mersham, ~ lington Heights, IL and Iodogen (Pierce Chemical Co., Rockford, IL).

WOg2/06~ PCT/US91/07756 2~259 . 99 .~, .
... .
~ Wash~d platelets were prepared by the albumin density ,~ gradient technique of Walsh, et al., Br. J. Eaematol., -~! 36, 281-2~8 (1977), and used at a count of 1 x ~08/ml.
~ Half-maximal binding of antibody to pla~elets was - 5 observed at 10 ~g/ml LJ-Ibl concentration, which concentration was selected for p5E polypeptide inhibition studies.

' ?, The p5E polypeptide extract was purified according to the procedure of Example 4 including final lo puri~ication of the urea-solubilized inclusion body preparation by dialysis against 6.0 M guanidine and urea solutions followed by Q-Sepharose0 chromatography.

To evaluate binding, platelets were incubated for 30 minutes at 22-25C with LJ-Ibl (10 ~g/ml) and concentrations of purified p5E protein (.002-10.0 ~Molar~ as indicated in Figure 3. Inhibition was plotted in the presence of 2 ~g/ml botrocetin, Sigma Chemical Co., St. Louis, MO, (Figure 3, dark circles) and in the absence of botrocetin (open circles).

~ess than 5 percent of the I~I label bound to the platelets was contributed by labelled substances other than LJ-Ibl as determined by binding competiti~n experiments in the presence o~ a 100 ~old excess of unlabelled LJ-Ibl. BacXground labelling was subtracted rrom data points. ~inding of I~I LJ-Ibl was expressed as a percentage of a control assay lacking recombinant polypeptides. Fifty percent inhibition of I~I LJ-Ibl ~-binding to plàtelets was àchieved at 10 ~M of p5E
polypeptide without botrocetin whereas in the presence of botrocetin (2 ~g/ml), 50% inhibition may be achieved at less than 0.1 ~M. It is known that botrocetin - . : : - . . .; : ~ -, , -- - - . .:

~: :

~ W092/V6~ PCT/US91/07756 `- 2 ~ g :`` ` ,, ~ ..
.~. 100 induces in circulating multisubunit von Willebrand . ~actor and single subunits thereof a con~ormational , change which enhances or permits binding to the GPIb~ -receptorO This example demonstrates that the p5E ::
polypeptide ~containing an intrachain cysteine 509-695 bond) behaves very much like native circulating von ; Willebrand factor with respect to how its activity is `. modulated by botrocetin. Structural similarity is therefore indicated. .

Example 7 - Expression o~ homodimeric 116 kDa von Willebrand factor fragment in stable mammalian trans~ormants . :
, ~ .
This example is illustrative of conditions under .
-? which a DNA sequence encoding the mature vWF subunit !`. 15 fragment having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 730 (asparagine) may be expressed, and of the secretion .. from cultured ma~malian host cells of a glycosylated homodimeric form of the 441-730 vWF fragment having native tertiary structure.
~ . . .;
~xpression of the 116 XDa homodi~er is achisved using a DNA construct in which the ~ollowing structural ~lements are assembled in a 5' to 3' dir~ction ~referring to tha codiny or ~ontran~cribed strand): ' ;
(A) a eucaryotic consensus translation initiation sequ~nce, CCACC; and (B) the initiating vWF methionine codon followed by--the remaining 21 amino acids of the vW~
signal peptide; and .
~C) the coding sequence corresponding to the first three amino acids from the amino terminus region of the vWF propeptide; a~d - ', : `
W~9~/0~ PCT~U~91/07~6 9425~
.. . .
; `~ 1 o 1 , tD) the coding sequence ~or vWF amino a~id ~.
residues 441-730; and -'~ (E) the "TGA" translation termination codon. :

. . ~ . . .
:: Preparation o~ a cDNA Clone from .~ 5 Pre-pro-von Willebrand Factor mRNA ~-.. . .
The cDNA clone, pvWF, encoding the entire pre-pro-vWF gene was obtained from Dr. Dennis Lynch, Dana- .
Farber Cancer Institute, Boston, MA and was prepared as described in Lynch, D.C. et al., Cell, 41, 49-56 (1985). Preparation of pvWF was described in Example ~, 1. ':
. 1 .
Primer Directed Am~lificatlon of cDNA - Phase I

i The cDNA representing the full length pre-pre-vWF :~.
- gene from pSP64 was subjected to enzymatic amplification in a polymerase chain reaction according J to the method:of Saiki, R.K~ et al. Science, 239, 487-~ 491 (1988~, as described in Example 1.
, :i --~ : For PCR amplification, the followin~
} oligonu~leotides were synthesizsd by the phosphoramidite method, Sinha, e~ al., Tetrahedron , 24, 5843 (1983), using a model 380B automated system, Applied Biosystems,. Foster City, CA.
Oligonucleotide (7) - see SEQ ID N0: 3 ; .
5' - GTCGACGCCACCATGATTCCTGCCAGA - 3' :SalI Met . .:
.: - ., Oligonucleotide ~8) - see SEQ ID NO:. 9 5' - TCAGTTTCTAGATACAGCCC - 3' XbaI
;~ -`W092~V~gg~ PCT/US91/07756 :

``` 2~25~ :

:In designing the oligonucleotides used herein, reference was made to the estab~ished nuclsotide sequence of the pre pro-vWF gene, Bonthron, D. et al., ~
Nucl. Acids.Res., 14(17), 7125-7127 (1986); Mancuso, D. -et al., J. Biol. Chem., 264(33), 19514-19527 (1989).
'~ ,:', Oligonucleotide (7) was used to create a SalI
restriction site fused 5' to a eucaryotic con~ensus -:
-~ translation initiation sequence [CCACC) preceding the initiating methionine codon of the vWF cDNA. See Kozak, M. Cell, 44, 183-292 (1986).
, :
Oligonucleotide (8) hybridizes with the non-transcribed strand (coding strand) of the vWF cDNA and ~.
overlaps with nucleotides which are approximately 360 ; .
base pairs from the initiating methionine in the pre-pro-vWF cDNA, thus spanning (at residues 120 and 121 within the pre-pro-vWF cDNA sequence) an XbaI
restriction site.

The polymerase chain reaction therefore synthesi~ed a cDNA fragment, containing (reading from 5' to 3' on the coding strand) a SalI site, a consensus initiation sequence, an initiating methionine codon, the codon sequence for the signal peptide, and approximately, the first 100 codons of the propeptide, followed by an XbaI site.

Ins~s~ _oDNA into Ml3mPl8 Cloninq Vehicle ..
The ampli~ied cDNA fragment was then inserted, using SalI and XbaI restriction enzymes, into the :
double stranded replicative form of bacteriophage ~: .
M13mpl8 which contains a multipla cloning site having :

_ . .. . . . .

WOg2/06~ PCT/US91/07756 2 ~

.

compatible SalI and XbaI sequences. The resulting clone is known as pADl. see ~rrand, J.R. et al. J.
Mol. Biol., 118, 127-135 (1978) and Zain, S.S. et al.
J. ~ol. Biol., 115, 249-255 (1977) for the properties of SalI and XbaI restriction enzymes respectively. The ~-~ vWF cDNA insert was completely sequenced using single-stranded dideoxy methodology (Sanger, F. et al. Proc.
Natl. Acad. Sci. USA, 74, 5463-5467 (1977)) to confirm that the vWF cDNA fragment contained the correct vWF
coding sequence.
., .
~ Primer Directed Amplification of cDNA - Phase II

-~ cDNA corresponding to mature vWF amino acid residues 441 to 732 was then amplified in a poiymerase chain reaction. For amplification, the pvWF clone encoding the entire pre-pro-vWF gene was used. ~`
Alternatively, a cDNA corresponding to mature subunit j residues 441 to 732 may be prepared and then amplified directly from platelet mRNA following the procedure of Newman, P.J. et al. J. Clin. Invest! ~ 82, 739-743 tl988).

Suitable ~lanking oligonucleotides were synthesized as follows:
Oligonuclaotide ~9) - see SEQ ID N0: 10 5! - AC GAA~TC CGG CGT TTT- GCC TCA GGA - 3' EcoRI Arg~lArg~2 Oligonucleotide (10) - see SEQ ID N0: 11 5' - G AAGCTT AC CAT GGA ~ CCT C?T GGG - 3' HindIII Met Ser Asn Arg Lys Pro . - . ~ - . -., ... . - - .: . :

W092/~ ~ PCT/US91/07756 '~
~` , 2~25~ .
"` 104 s 3' - ~QQ TTC cC TTG~AGG TAC CA ~~ÇGA~ G - 5 ' Pro Lys Arg Asn Ser Met HlndIII
727 728 729 73~ 731 732 (equivalent to anticoding strand) The ends of the double stranded vWF cDNA fragment product were then modified with BamHI linkers ~Roberts, -~ R.J. et al. Nature, 265, 82-84 (1977)), digested with BamHI, and inserted into the BamHI site of pADl, which ~ site is directly downstream(3'3 from the XbaI site.
'.`~'4.'10 The resultant plasmid was designated pAD2.

~ LOODOUt Mutagenesis of pAD2.
" .
Site-directed (loopout) mutagenesis was then performed to synchronize the reading frames of the first insert with the second insert simultaneously deleting all propeptide codon sequence (except that encoding the first 3 amino terminal residues of the - propeptide), and the remaining bases between the XbaI
and BamHI sites.

As a loopout primer, the following oligonucleotide was utilized which encodes the four carboxy-terminal ~ ~
amino acid residues of the signal peptide, the three ~`
amino-terminal residues of the propeptide, and amino acid residues 441 to 446 o~ the mature vWF subunit sequence. . , :~
Oligonucleotide (11) - see SEQ ID NO: 12 5' - GGGACCCTTTGTGCAGAAGGACGGCGTTTTGCCTCA~ 3' ..
Arg~l Gly46 ~;
The loopout of~undesired nucleotide sequence was accomplished following the procedure of Kunkel, T.A., ;: :
Proc._Natl. Acad. Sci. USA, 82, 488-492 (1985). This procedure involves the per~ormance of a series of steps ,~
-','.,' ;' ' , ..

W~92/0~ PCT/U~9~/07756 ` 2~9~2~9 ~ ~

to take advantage of conditions which select against a ` uracil containing DNA template: -(A~ M13mpl8 phaga (containing cDNA corresponding to the consensus translation initiation , 5 seguence, the signal peptide, approximately the first 121 amino acids of the propeptide, residual intervening M13mpl8 polylinker ~ . se~uence, and codons corresponding to mature ;1 subunit sequence residues 441 to 732) is grown in an E.coli CJ236 mutant dut~ung~
strain in a uridine rich ~edium. Since this ; E.coli strain is deficient in deoxyuridine triphosphatase (dut-), an intracellular pool of dUTP accumulates which competes with dTTP
for incorporation into DNA. (see Shlomai, J.
et al. J. Biol Chem., 253(9), 3305-3312 (1978~.~ Viral DNA synthesized under these conditions includes several uracil insertions ~-- per viral genome and is stable only in an ~ .
~ ggli strain which is incapable of removing uracil:,: such as ~ung~) strains which lack uracil glycosylase. Uracil-containing ~ ;~
nucleotides are lethal in single stranded (+j M13mpl8~DNA in ung+ strains due to the creation o~ abasic sites by uracil glycosylase.

~B) Single-stranded (~) viral DN~ is:isolated ~rom culture media in which phage were grown in: E.ooli strain. CJ236 dut~ung~. The single .. stranded (~) form of the virus contains the specified vWF cDNA at its multipla cloning site. This cDNA is equivalent to the ~ -transcribed vWF cDNA strand.

: WOD2/06~

;``:`` 2~2~9 .

~; (C) Oligonucleotide (11) is then annealed ln ....
. vitro to single stranded t~) phage DNA, r , .
thereby looping out the undesired sequence. :.
. Generally, a wide range o~ oligonucleotide concentrations is suitable in this procedure.
, Typically 40 ng of oligonurleotide was annealed to 0.5-1.0 ~g ~13mpl8 phage (+) DNA.:
i . .,:
i (D) All missing sequence o~ the M13mpl8(~) strand is then completed in vitro using ~7 DNA
polymerase and T4 DNA ligase in an .
- environment containing dTTP, dGTP, dATP and rC~
dCTP, thereby generating a chimeric vWF cDN~
sequence without the undesired intermediate sequence.
. . . .
tE) The double stranded M13mpl8 phage, now .. containing a thymine normal (~) strand and a t+) strand with several uracil substitutions, is transformed into a wild type E.coli XL-l -~ Blue (Stratagene, La Jolla,~CA) strain which -. -contains normal ievels of uracil glycosylase ~ -and deoxyuridine triphosphatase.

.
F~ Uracll glycosylase and other enzymes present : -in the new host initlate dastruction o~ the ::
uracil-containing (~) strand of the double strand~d phages, leading after replication in ~:
the host of~remaining phage (~) strand DNA to ~ .
the presence of stable thymine-normal dou.ble stranded (RF) D~A-~hich reflects the desired deletion. Upon completion of mutagenesis procedures, the sequence of the vWF cDNA
insert was confirmed using the single ; ~ ;

.
', w~ s~/~sg . 107 s~randad ~A dideoxy method. (Sanger, F. e~
al., supra).
. . .
`~ A second mutagenesis procedure, ~ollowing steps (A) to (F) above, was performed to add to the cDNA
insert a translation termination codon (T~A), and an Xbal restriction site (TCTAGA). The oligonucleotide, ~--~ again synthesized by the phosphoramadite method and , containing also sequence homology at its 3' end with the ~13mpl8 vehicle sequence, was as follows. The stop .~ 10 codon was added after residue 730.
Oligonucleotide (12) - see SEQ ID N0: 13 5'- GGGCCCAA~`AGG`AAC-TGA-TCTAGA-AAGCTTGGCACTGGC -3' Argn~sn~0 XbaI
~ : .
. The f inal M13mpl8 recombinant containing the ~ :
' 15 desirad construct as a SalI - XbaI ins~rt was designated pAD3-1. In addition to the XbaI site created 3' to the termination codon, an XbaI site exists in the polylinker region of M13mpl8 directly 5 ' to the SalI site. The vWF insert was again sequenced by the dideoxy method to verify organization and integrity of the components.

Cloning of the SalI XbaI Fragm~nt of ~AD3-J~to ~he 1~ Ve tor ,e ~he SalI-XbaI fragment was th~n removed from pAD3-1 (as contained within the XbaI~XbaI fragment) and ins`erted into p~iuescript II KS(-j vector (Stratagene, La Jolla, CA) which had been previousiy digested with.
XbaI. pBluescript II KS(-) contains an XhoI
restriction site which is 5 ' to the XbaI insert and a NotI site which is directly 3' to the XbaI insert. A

.. . . ..... .

WO~ 6~ PCT/US~l/07756 2 ~ 9`~

?~ 108 resultant plas~id selected aæ having the proper insert orientation was designated pA~3-2.

Alternatively, the SalI-XbaI ~ragment itself may -i be removed from pAD3-1 and inserted into pBluescript II
5 RS(-~ vector which would have been digested previously with SalI and XbaI restriction enzymes. The resultant plasmid, a form of pAD3-2, would also contain an XhoI ~ -restriction site which is directly 5~ to the SalI site, and a NotI site which is directly 3' to the XbaI site.
Such a construct (see below) is also suitable for !,, insartion into pCDM8~ vectors. ~
-- . .
Construction of Plasmids for ; Intearation into Mammalian Cells "
A selection procedure, based on aminoglycosidic ~ 15 antibiotic resistance, was then employed to select - continuously for transformants which retained the vWF
expression plasmid.
: .
pCDM8 vector~(developed by B. Seed et al. Nature~
329, 840-842 ~1987) and available from Invitrogen, San Diego, CA) was~modified by Dr. Timothy O'Toole, Scripps Clinic and Research Foundation, La Jolla, CA to include a neomycin resistance gene (phosphotransferase II3 that was cloned into the BamHI restriction site of pCDM8 as a part oP a 2000 base pair BamHI fragment. The site of t~e BamHI insert is indicated by an arrow in Figure 4.
The protein produced by the neoy cin(neo) gen~ also confers resistance against ot~er~aminoglycoside antibiotics such as~Geneticin0 G418 sulfate ~Gibco/Life Technologies, Inc., Gaithersburg, MD). The neo gene is provided by the Tn5 transposable element and is wideIy distributed in procaryots. Lewin, J., Genes, 3rd ed., ~ W092/06~ P~T/US91/~7756 , ```; ` ~9~2~ `
'` 109 - p.596, Wiley ~ Sons (1987). The final construct places the neo gene under the control o~ an SV40 early promoter. -~' Several other ~uitable expression vectors containing neomycin resistance markers are commercially available: pcDNA 1~ (Invitrogen, San Diego, CA~
Rc/CNV (Invitrogen, San Diego, CA) and p~r~
~; (Clontech, Palo Alto, CA). If necessary, ~he vWF
fragment may be differently restricted or modified for expression capability in these other expression plasmids.

.
The XhoI-NotI fragment o~ pAD3-2 was therefore inserted into pCDM8~ which had been r~stricted with XhoI and NotI. Ampicillin sensitive E.coli strain XS-127 cells ~Invitrogen, San Diego, CA) were trans~ormed with the resultant ligated DNA mixture following the method of Hanahan, D., J. Mol. Biol., 166, 557-580 (1983).

Plas~ids from resultant colonies were characterized by restriction mapping and DNA ~equencing to identify colonies which contained the intended insert. One such appropriate plas~id ~d~signated pAD5/W~) was maintained in E,~o~1 strain XS-127, and was selectQd ~or mammalian cell transformation proceduras.
; ., Prior to use in trans~orming mammalian cells, : supercoile~ plasmids-(pAD5/~T) were recovered ~rom host E.coli by an alkaline cell lysis procedure, Birnboim, H.C. and Doly, J., Nucleic Acids Research, 7,1513 ~1979), followed by purification by CsCljethidium WO92~h~ PCT/US91/07756 20~ 9 ~ ~
` lI0 bromide equilibrium centri~ugation according to Maniatis, T. et al., Molecular_Clo~ing, 2nd ed~, p.
1.42, Cold Spring Harbor Laboratory Press (1987). -:
Transformation o~ Chinese Hamster Ovary Cells pAD5/WT was introduced into C~O-K1 Chinese hamster ovary cells (ATCC-CCL-61) by a standard calcium phosphate-mediated trans~ection procedure. Chen, C. et al. Mol._Cell. Biol., 7(8), 2745-2752 (1987).

CHO-K1 cells were grown at 37C in Dulbecco~s modified Eagle's medium (DMEM) (Gibco/Li~e Technologies, Inc., Gaithersburg, MD) supplemented with - 10% heat-inactivated fetal calf serum (FCS), 0.5 mM o~ -each nonessential amino acid (from NEAA supplement, Whittaker, Walkersville, MD) and 2 mM L-glutamine under -a 5% C2 atmosphere, and then subcultured 24 hours prior to transformation at a density of 1.5 x 105 cells per 60 mm tLssue culture dish (approximately 25% of confluence). C~O-Kl cells have a doubling time in DMEM/10%FCS of approximately 16 hours undsr these conditions.
' ~
To accomplish transformation, pAD5/WT plas~ids were recovered ~rom cultures of E.Coli strain XS-127, according to tha method of Birnboim, H.C. and Doly, J., Nup~eic Aclds Research, 7, 1513 (1979). Ten ~g o~
plasmids were applied to the cells of each 60 mm dish in a calcium-phosphate solution according to the method of Chen et al., supra. After inoculation with plasmid, the cells were maintained in DMEN/~0% FCS for 8 hours at 37C in a 5% C02 atmosphere.
' .

~` ~
~ W092/06~ PCT/U~91/07756 ~` .2~.2~.9 ., .

.
, 111 The growth medium was then replaced with a solution o~ phosphate-bu~fered salina, 137 mM NaCl, 2.7 mM KCl, 4.3 ~M Na2HP04 7H2O/l.4 mM KH2P04, pH 7.4, hereinafter "P~S", containing also 10% (v/v) glycerol.
The cultures were then maintained in glycerol-PBS for 2 minutes to increase the efficiency of transfor~ation - (see Ausukel, et al., eds. current Protocols in Molecular Biology, p.9.1.3, Wiley & Sons tl987). After 2 minutes the glycerol-PBS solution was replaced with DMEM/10~ FCS.
.
After approximately 24 hours of growth at 37C in a 5% C02 atmosphere, the cells were trypsinized as follows. Growth medium for each dish was replaced by 3 ml of 0.25% trypsin in PBS. Trypsinization was conducted for 3 minutes. The trypsin-containing medium was removed and the dishes were then placed in the incubator for a further 15 minutes after which the cells~were resuspended in DMEM containing 10% fetal calf serum. The cells from each dish were then split 20 fold, and pl ed at a density of 3 x 104 cells/60 mm dish (approximately 5~ of confluence).

Production of stable transforman~s, which have integrated the plasmid DNA, was then accomplished by adding Geneticinæ G418 sul~ate to the 60 mm dishes to a concantration o~ 0.8 ~g/ml. Growth was continued for 10-14 days at 37C in a 5% CO2 atmosphere. Surviving independent colonies were trans~erred to }2- well plates using cloning rings and then grown for another ~-seven days in DME~ FCS supplemented with 0.8 mg/m}
of Geneticin~. Under these conditions, 3 to 7 -surviving colonies per plate were apparent after 10-14 days. Approximately lOQ stable transformants can be ~:

~ W~92/06 2a~ P~T/US91/0775~

'`` :
1~2 isolated from each original 60 mM dish originally containing approximately ' - :
5 x 105 cells at a plate density of 50-70~ of confluence.
. :. .
Fifty to seventy percent of G418-resistant cell ;;
lines produce the 441-730 mature vWF subunit fragment.
The specific geometry of integration o~ each clone presumably prevents expression in all cases. Stable transformants were then cultured and maintained at all ; 10 times in medium containing Geneticin~ G418 sulfate (.8 ~ -mg/ml) to apply continuous selection.
't ' ~
Colonies expressing the recombinant 441-730 vWF
polypeptide were detected by dot-blot analysis on nitrocellulose after lysis in disruption buffer (see Cullen, Methods i __~1zy~oloqy, 152, 684-704 (1987)) 7 comprising 10 m~ Tris HCl, pH 7.8, 150 mM NaCl, 5 mM
EDTA, 10 mM benzamidine, 1 mM PMSF, 1~ (w/v) Non-idet 40 (an octylphenol-ethylene oxide condensate containing an average of 9 moles of ethylene oxide/mole phenol), Sigma, St. Louis, M0.

.
RG-46 (see Fugimura, Y. at al. J. Biol. Chem~, 261(1), 381-385 ~1986) and Fulcher, C.A. et al. Proc.
NatL~cad. Sci. USA, 79, 1648-1652 (~982)) was used as the primary antibody. ~he secondary antibody (~
rabbit anti-mouse IgG) which had been labelled by the method of Fraker, P.J. et al. Biochem. Biophys. Res.
Comm~n., 80, 849-857 (1978) was incubated for 60 minutes at 25C on the nitrocellulose sheet. After rinsing, the nitrocellulose was developed by autoradiography to identify those colonies expressing the vWF fragment.

. ~' ' . .

- . - . : . - ': . - . ', , . : . ': :. I . - - . :~ .

W092/06~ PCT~US91/~77S6 9~2~9 :``

Secretion Qf the von Wi~lebrand Factor Fraqment .' Secretion o~ the 441-730 mature vWF subunit fragment into the culture medium by CH0-R1 cells was confirmed by immunoprecipitation and immunoaffinity chromatography of culture medium.

Confluent transformed CH0-K1 cells were rinsed - three times with PBS to remove bo~ine vWF and then incubated in DMEM without FCS for 16 hours at 37OC in a 5% C02 atmosphere. To a 5 ml volume of the cultur~
medium was added a 1/10 volume (0.5 ml) of lOx immunoprecipitation buffer (lOxIPB) which comprises 100 ` ~M Tris HCl, pH 7.5, 1.5 M NaCl, 10 mM EDTA, and 10%(w/v) Non-idet 40. It has been established that bovine vWF-derived polypeptides present in fetal cal~ serum do not react with NMC-4.
J~ ~ ~
The mixture was then incubated for 16 hours at 4~C
with approximately 0.05 mg of NMC-4 or 0.0 mg of RG-46 murine monoclonal anti-vWF anti~ody (or 0.1 mg of both) allowing formation o~ IgG-vWF complexes. Immune complexes were precipitated by taking advantage o~ th~
affinity of protein A (isolated from the cell wall of St~phyl~occu~ reus) ~or consta~t regions of heavy-ahain antibady polypeptides following generally the method o~ Cullen, B. et al., Meth. E~ olQ~y~, 152, 684-704 (1987). See also Harlow, E. et al. eds, Antibodies. A Laboratory Manual, Chapters 14-15, Cold Spring Harbor Laboratory Press (1988). ;
.: :
Protein A-Sepharose~ beads were purchased from Sigma, St. Louis, M0. Immune complexes were then preoipitated with the beads in the presence o~ 3 M

' WOg2/~ PCT/US91/077~6_ .
209~g ~ ~ .
: ::
114 ;
NaCl/1.5 M glycine (pH 8.9), and washed twice with lx IPB and then once with lx IPB without Non-idet 40.

Immunoprecipitated proteins were then ~--- electrophoresed in polyacrylamide gels containing ;
sodium docecyl sulfate (SDS-PAGE~ following the method of Weber, K. et al., J. Biol. Chem., 244, 4406-4412 (1969), or as modified by Laemli, U.K., Nature, 227, 680-685 (1970), using an acrylamide concentration of 10~. Samples of immune-complexed vWF protein were dissociated prior ~o electrophoresis by heating at 100C for 5 minutes in non-reducing and 2% SDS-containing acrylamide gel sample buffer to disrupt non-covalent bonds. The protein A-Sepharose~4B beads were spun down and discarded. Visualization was accomplished with Coomassie blue staining which revealed the dominant vWF-derived polypeptide species ::
to have an apparent molecular weight, based on molecular weight markers, of:about 116,000 daltons.
~, Protein bands: in duplicate gels were blotted and immobilized onto nitrocellulose sheeks (Schleicher Schuell Co., Xeene, NH) and the pattern wa~ then visualized using immunoreactivity according to the :
highly sensitive "Western blot" technique. Burnette, et al., A. An~ ioche~, 112, 195-2C3 (1981).

The von Willebrand factor-specific monoclonal antibodies (from-mice; used to identi~y the polypeptides were RG-46 ~see Fugimura, Y. et al. J. . ;
Biol. Chem., 261(1), 381-385 (1986), Fulcher, C~A. et al., Proc. Natl. Acad. Scl. USA, 79, 1648-1652 (1982)), and NNC-4 (Shima, ~. et al., J. Nara Med. Assoc., 36, - .-. ,. -.. - , .. . . ~. -.. . , .. , ... . ; .. ... . . ~.. . : . - , .. . .. , .. . ... . ~ . . . . . ... . . , - .. ~ .. . .. . :

- W0~2/06~ P~T/US91/0775~
. . .
`` 2~942~
.

662-669 ~19~)), both o~ which ~ave epitopes within the expressed vWF polypeptide of this invention.
~ . .
The secondary antibody (~ rabbit anti-mouse IgG), labelled by the method of Fraker, P.J. et al., - 5 Biochem. Bio~hys. Res. Commun., 80, 849-857 (1978)), ~ was incubated for 60 minutes at 25C on the .~? nitrocellulose sheet. After rinsing, the sheet wa~
developed by autoradiography.
' .
, Growth medium from non-transformed CH0-Kl cells shows no immunoreactivity with RG-46 and NMC-4 anti-vWF
,~ monoclonal antibodies under identical conditions.
., ~
The 116 kDa fragment may also be isolated from the ~ culture medium of CH0-Kl cells using immunoaffinity ?, : chromatography. Approximately 300~g of the 116 kDa fragment can be recoyered from 500 ml of culture medium derived from transformed CH0-Rl culture plates using NMC-4 antibodies coupled to partic~es of Sepharose~4B.
.
Example 8 - Induction of platelet aggregation by the homodi~eric 116 kDa von Willebrand factor fragment derived from the culture medium o~
stable CH0-K1 t ansformant~

The tryptic 116~XDa fragment has been previously ` `
characterized as a dimer consisting of two identical disulfide-linked subunits each corresponding to the `
tryptic 52/48 kDa fragment of vWF and containing the mature subunit sequence from residue 449 to residue `
728. owing to its bivalent character,~the dimeric 116 kDa fragment can support ristocetin-induced platelet `
aggregation wheroas the cons~ituent 52/48 kDa subunit - '",'~

.

: ` :
W~2/06~ PCT/US91/07756 `
:~`' ,:

~,~9 ~2;i9 116 . .
cannot (see Mohri, H. et al., J. ~iol. Che~., 264(29~, 17361--17367 (1989) ~, r Stable pAD5/WT CH0-Kl transformants, and untransformed CH0-K1 cells as controls, were aach grown to 90% of confluence in DMEM/10~ FCS, at 37OC in a 5%
C2 atmosphere. The 60 mm plates were then rinsed twice with PBS and the incubation was continued in DMEN
(without FCS) for 24 hours. The resultant ~erum-free culture medium was collected and concentrated (at 18C) 300 fold in a centrifugation-filtration apparatus, Centricon 30, Amicon Co., Lexington, MA.
, .
A dose-dependent platelet aggregation curve results from the addition of concentrated culture : medium from pAD5/WT transformed cells to pIatelets. No aggregation was seen in the presence of control culture medium derived from untransformed CH0-K1 cells. -:
Platelets for the assay were prepared using albumin density gradients according to the procedure of Walsh, ~ ~ et ~l. British ~. of Hematolo~y, 36, 281-298 ~1977).
; 20 Aggregation was monitored in siliconized glass cuvettes maintained at 37C with constant stirring (1200 rpm) in.~
a Lumi-aggregometer ~Chrono-Log Corp., Havertown, PA). ..
Aggregation experiments followed generally the procedure o~ ~ohri, ~. et al., ~ L~LLJ ~h~a ~ 264(29), 17361-17367 (1989). rwO to ten ~l quantities o~ 300 ~old con~e~trated FCS-free DMEN from cultures of pAD5!WT-transformed and control untransformed CH0-X1 cells (~M? were brought up to 100 ~l by dilution with "Hepes" buf~ered saline, comprising 20 mM Hepes, N-~2- .
hydroxyethyl]piperazine-N'-E2-ethanesulfonic acid], (pH
7.4), and 0.15 M.NaCl. The 100 ~l samples were then : mixed with 200 ~l of platelet suspension (4 x 108/ml) - -. . ;... : ~ . . . ~ . ... . . .

~ WO92~0Sggg PCT/US91/07756 2~259 ~ 117 : .
and then incubated with stirring in the aggregomet~r ~or 5 ~inutes. Riætocetin was then added to a final ~' concentration o~ lmg/ml at the injection timepoints , ` (time zero). Aggregation was monitored by recording ~i 5 changes in light transmittance. Platelet aggregation can be observed with as little as 100 ~1 of : unconcentrated serum-free medium from pAD5jWT~
transformed cell lines. Serum-free medium from control untransformed cultures concentr~ted up to 300 fold, and assayed at up to }0 ~1 concentrated medium/100 ~1 sample did not induce platelet aggregation.

Preincubation w MonoclonaI Antibodies ,~ As a further control to confirm the speci~icity of ~ the ristocetin-induced 116 kDa vWF fragment-platelet i, 15 interaction, platelets were preincubated with anti- '~
platelet glycoprotein Ib monoclonal antibody L3-Ibl which has been specifically demonstrated to block vWF-platelet GPIb-IX receptor interaction ~Handa, et al., -~
J. Biol. Chem., 261, 12579-12585 (1986)).
.1 - `
The effect of preincubating the platelets with platelet surface receptor-speci~ic LJ-Ib~ monoclonal antibodies prior to conducting the aggregation assay was examined~ Platelets subjected to this ~-preincubation did not exhibit an aggregation response whereas platelets similarly preincubated with monoclonal antibody LJ-C~ (Trapani-Lombardo et al., J.
Clin. I~vest., 76, 1950-1958 ~1~85) gave an effective aggregation response. LJ-CP3 has been demonstrated to block platelet GPIIb~IIIa receptor sites and not vWF- -specific GPIb-IX receptors. To perform the as~ays antibody W -Ibl or antibody LJ-CP3 was added, at a `

~V092/06~ PCT/US91/07756 ~a9~2s9 ' .

;~ concentration of 100 ~g/ml, to the platelet/serum mixture while the mixture was being stirred in the aggregometer/ and at a timepoint one minute prior to the point when ristocetin (to 1 mg/ml) was added. The assays were otherwise identical to those described abo~e. Changes in light transmittance were monitored for an approximate 5 minute (LJ-Ibl~ or 4 minute tLJ-CP3) interval.
.
Example_9 - Construction of a mammalian transformant for the expression of the monomeric 441-730 mature von Willebrand factor subunit fragment with cysteine-to-glycine mutations at residues 459~ 462`and 464 .. . .
. This example is illustrative of conditions under : 15 which a DNA sequence encoding a mature vWF subunit fragment, which has an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 730 ~ -(asparagine) and which further contains glycine residues substituted for cysteine residues at positions 459, 462 and 464 thereof, can be constructed and transfected into mammalian cells.
; ., ` : .
The SalI-XbaI insert of pAD3-2 (see Example 7) was removed by restriction and then cIoned into pcDNAl `
vector ~Invitrogen, San Diego, CA) which had been previously diges~ed with XhoI and XbaI restriction enzymes. Since XhoI and SalI restriction sites contain identical internal sequences -TCGA- / -AGCT- , a S~lI
restricted fragment may be annealed into an XhoI site.
The ~ragments were ligated with T4 DNA ligase; however A ;~
the integrity of the XhoI site was not restored. This plasmid construct was designated pAD4/WT.

` W092/06~ PCT~US9l/07756 ~09~2~9 : .
`` 119 Site-directed mutaqenesis usinq M~ 3mpl8 pAD4/WT was restricted with EcoRI and SmaI
enzymes. pcDNAl vector contains an EcoRI site withi~
its polylinker region which is upstream from the XhoI
('~SalII') site but contains no SmaI site. As shown in Figure 1 (SEQ ID NO: 1), a unique SmaI site (CCCGGG~ is ~-~q ~ contained within the vWF cDNA insert, spanning mature - sllbunit residues 716 (glycine) to residue 718 (glycine~.
. ., ~:.
Accordingly, an approximate 950 base pair EcoRI-SmaI fragment of pAD4/WT was subcloned into the EcoRI-SmaI site within the polylinker region of M13mpl8 phage. The vWF sequence in M13mpl8 was then mutagenized and reinserted into the previously restricted pAD4/WT construct leading to reassembly of the intact residue 441-730 vWF sequence.

The mutagenesis followed the procedure of Example 1 and Kunkel, T.A., supra, and utilized the following oligonucleotide.
Oligonucleotide t13) - see SEQ ID N0: 14 3' - GGACTCGTGCCGGTCTAACCGGTGCCACTACAACAG - 5' 5' - cc~gagcaca~ccagattggccacggtgatgttgtc - 3' GlY4ss Gly462 S;ly~4 Tbe hybridizing oligonucleotide i5 shown ~3' ~ 5') in capital letters and is equivalent to transcribed strand (non-coding strand DNA). Underlined letters indicate the single base mutations ~or the mutant codons. The equivalent coding strand is shown in lower case letters with the corresponding glycine substitutions identified by three letter designation.
':
:- .

WO9~/06~ PCT~US91/077~6 `~09~12~9 , ;~` 120 The mutant 950 base pair EcoRI-SmaT fragment was then re-inserted into the EcoRI SmaI site of the previously restricted pAD4/WT plasmid. The mutant construct was designated pAD4/~3C. To facilitate long-term storage and propagation, pAD4/~3C was transformed -into ampicillin sensitive E.coli strain XS-127 according to the method of Hanahan, D., J. Mol. Biol., 166, 557-580 (1983).
. .
Consistent with the proc2dures of Example 1, the sequence of the mutant cDNA was confirmed by the dideoxy method and the plasmid was purified by CsCl/ethidium bromide equilibrium centrifugation.

! Transformation of COS-1 cells ~
,. :
pAD4/~3C was introduced into COS-l cells (SV 40 - 15 transformed African Green monkey kidney cells, ATCC -CRL 1650) by a standard calcium phosphate-media~ed transfection procedure. Chen, C. et al., Mol. ~ell.
; Biol., 7(8), 2745-2752 (1987).
:~ ' , , " COS-l cells were grown at 37C in Dulbecco's modified Eagle's medium (DME~) (Gibco/Li~e Technologies, Inc., Gaithersburg, MD) ~upplemented with 10% fetal calf serum (FCS) under a 5% C2 atmosphere, and then su~cultured 24 hour~ prior to transformation at a denæity of 1.5 x 105 ~ells/60 mm tissue culture dish (approximately 25% of confluence). COS-l cells have a doubling time in DMEM/10% FCS of approximately 20 hours under these conditions.
:
To accomplish transformation, pAD4/~3C plasmids were recovered from cultures ~f E.coli strain XS-127 - WOg2/06~ PCT/U~91/0~7~6 ~9.~2~9 .................... .
. . . . .

according to the method of Birnboim, H.C. and Doly, J., Nucleic A~ids Research, 7, 1513 (1979). Ten ~g of ;
plasmids were applied to the cells of each 60 mm dish -in a calcium phosphate solution according to the method of Chen et al., supra. After inoculation with plasmid, -~
the cells were maintained in DMEM/10% FCS for 8 hours at 37OC in a 5% CO2 atmosphere.
., ,,-.,", .
The growth medium was then replaced with a solution of phosphate-buffered saline/10% (vjv) glycerol. The cultures were then maintained in glycerol-PBS for 2 minutes to facilitate the production of transformants (Ausukel, et al. eds, Current Protocols in Molecular Biology, p.9.1.3, Wiley & Sons - (1987)). After 2 minutes, the glycerol-PBS solution -;
was replaced with DMEX/10% FCS. Antibiotic resistance -was not used to select for stable transformants. The cells were then maintained at 37C in DMEM/10~ FCS in a 5~ C2 atmosphere. ;

ExamDle_10 - Transformation of COS 1 cells by pAD4 !WT ~lasmids COS-1 cells were also transformed successfully with pAD4/WT plasmids. Although antibiotic resistance was not used to select for stable trans~ormants, transient expression of the 116 k~a fragment therefrom Was part~cularly use~ul for the purpose of comparing the properties of the 116 kDa mutagenizad polypeptide -produced by pAD4/ 3C plasmids to those of the pAD4/WT
116 kDa homodimer.
.... . . .. . .
Following the procedures of Example 9, pAD4/WT
plasmids were recovered from storage cultures of E.coli~!~
strain XS-127. Transformation of COS-1 cells with !
pAD4/WT was then accomplished using the procedures of ,';"':' . . - .
.; - , W092/OS~ PC~/US91/07756 .: . . .
~,~ ` "' .

Example 9. The cells were then maintained a~ 37C in DMEM/10% FCS in a 5~ CO2 atmosphere.

~' Example 11 - Construction of ~ammalian transformants ~-~ which express mutant 441-730 mature von - 5 Willebrand factor subunit fragments wherein each mutant contains a single cvs~eine-to-alvcine substitution Following the procedures of Example 9, and using suitable oligonucleotides for site-directed mutagenesis, three plasmids (pAD4/G459, pAD4/G4Q and pAD4/G~, coIlectively referred to as "pAD4/~lC
plasmids") were constructed. Such plasmids are identical to pAD4/WT except that each contains a single base pair mutation which corresponds to a single cy~teine to glycine substitution at mature vWF subunit ~'è residue positions 459, 46Z and 464 respectively. The ~-oligonucleotides used are identical to oligonualeotide (13) used to prepare pAD4/~3C except that each contains only one of the three mutant codons of that oligonucleotide, the other two codons being represented by the wild type coding sequence. To facilitate long-term storage and propagation, samples of pAD4/G4s9, pAD4/G462, and pAD4/G~ were each cloned into ampi~illin sensitive E.coli strain XS-127 following the method of ~xample 9.

Consistent with the procedures o~ Example 9, the sequences of the mutant cDNAs were confirmed by the dideoxy method and the plasmids were purified by CsCl/ethidium bromide equilibrium centrifugation.

Transformation of COS-1 cells with either pAD4/G459, pAD4/~4Q or pAD4/G464 plasmids was accomplished ~ ...... .. . , . . , ~.. ~ , . .. .... ...... . . . .

., . . . ,. : ..

;:
-~ W0~2/06~ PCT/US91/07756 . ~, . . .
- 2~39'4~5~
~, .

according to the protocol of Example 9. Antibiotic , resistance was not used to select for ~table ~ transformants. The cells were then maintained at 37C -M in D~EM/10% FCS in a 5~ CO2 atmosphere.
':
Examle 12 - Expression and characterization of von Willebrand factor subunit fragments by COS-l cells transformed with pAD4/WT and pAD4/A3C plasmids-_ , COS-l cells which had been transformed~with pAD4/~3C or pAD4/WT plasmids according to the -procedures of Examples 9 and 10 respectively were cultured to express the encoded vWF DNA as explained below. COS-1 cells similarly transformed with pc~NA1 plasmid vector (not containing a vWF cDNA inse~t) were used as controls.
.~ ; .
COS-l cells at a density of 4-5 x 105/60 ~m dish , were transformed by adding, at time zero, 10 ~g of ? pAD4~WT, pAD4/a3C or p~DNAl plasmid. Following the procedure of Examples 9 and 10, the cells weré
glycerol-shocked a~ter a period o~ 8 hours. The cells ` ~ were then covered with DNEMjlO% F~S at 3~C in a 5~ CO2 atmosphere for 32 hours.
, .
The cells for each culture were then rinsed three ! ' ti~es with PBS and the incubation was continued with DMEM (without FCS) which was supplemented wîth 35S~
methionine (A~ersham Co., Arlington Heights, IL) having a specific activity`of 1300 Ci/~mol to a final concentration of 100 ~Ci/ml. The cells were returned to the incubator for 16 hours, after which time the -respective culture media were harvest~d for '' :' .~ .

~ W092/06~ PCT/US9ltO77~
2a9~ 9 .
;`......................................................................... .

purification by immunoprecipitation of secreted vWF
polypeptides.

Immunoprecipitation followed generally the procedure of Example 7. Five ml volumes of culture . -media were incubated with 0.5 ml of lOX
immunoprecipitation buffer, 0.05 mg of NMC-4 antibody ~: and 0.05 mg of RG-46 antibody for 16 hours.

Treatment with protein A-Sepharose~8 was performed according to Example 7. Samples of IgG- :
. 10 complexed vWF protein were dissociated prior to SDS-PAGE in SDS-containing sample buffer.

For analysis of the vWF polypeptides under reducing conditions, the sample buffer was modified.to contain 100 mM dithiothreitol (DTT).
.:
Results The gels were run under reducing and non-reducing:
conditions and were dried and subject to autoradiography to develop the 35S label. No 35S-labelled protein was detected as an immunopreaipitate :
: 20 derived from control cultures of COS-l cells (transformed by unmodi~ied pcDN~1 vehicle) undex either reducing or non-reducing conditions (see gel lanes d~signated MOCK).
, COS-1 cells transformed with pAD4/WT plasmids produce, under non-reducing conditions, a prominent 35S-labelled band of an approximate apparent molecular weight of 116,000. This value is consistent with proper mammalian glycosylation of the 441-730 fragment.

~

: ~ :
W092/~6~ PCT/US91/07756 .
, "` 2~2~9 "` 125 When run under reducing conditions, no 116 kDa material is apparent, consistent with the reduction of the -'9 , disul~ide bonds which stabilize the 116 kDa homodimer. -.` Under reducing conditions, a pro~inent 35S-labelled band - 5 is visualized of approximately 52,000 apparent molecular weight. The apparent 52 kDa value is again -:
consistent with proper glycosylation of the redu~ed monomeric 441-730 fragment.
.
.~ The gel lanes corresponding to transformation with .
pAD4/~3C show no apparent 116 kDa material. Instead a band is apparent, under reducing and non-redùcing ~
~ conditions, at an apparent molecular weight of `;
:~i approximately 52,000. .

Thus, mutagenesis to replace cysteine residues 459, 462 and 464 within the 441-730 vWF fragment with glycine residues results in the successful expression . -~
of a non-dimerizing polypeptide presumably having only .`~
intrachain (471 to 474 and 509 to 695) disulfide bonds. ~.
Interaction with NMC-g (see also Example 7) is known to 20 : require an~intact~509 to 695 intrachain disul~ide bond, :
.~ thereby demonstrating the presence of native wild type tertiary structure in the polypeptide produced by pAD4/~3C.
' The gels also demonstrated the presence of low 2S molecular we~ght 35S-labelled material (under reducing and non-reducing conditions) probably indicati~g tha~
- not all vNF polypeptides produced by pAD4/WT constructs -, successfully dimerize and that proteolysis andlor .
incomplete glycosylation of the polypeptide may prevent higher yields. Proteolysis andjor incomplete :`:
glycosylation also presumably affect the yield of the .~

: .

W0~2/06~ PCT/US91/077~6 '1 2 ~ ~
126 ..
~onomeric vWF polypeptide produced by the pAD4/~3C :.
trans~or~ants. Some high molecular weight aggregate ~ ~-material (essentially not entering the gels) is present ~ -in non-reduced samples from pAD4/WT and pA~4/~3C.

Example 13 - Use o~ NMC-4 monoclonal antibody to , immunoprecipitate vWF polypeptides :~ secreted by pAD4/WT and pAD4/Q3C
transformed COS-1 cells _ .,. :
The NMC-4 monoclonal anti~ody has as its epitope the domain o~ the von Willebrand factor subunit which contains the glycoprotein Ib binding site. ~apping o~ -the epitope has demonstrated that it is contained within two discontinuous domains (comprising approximately mature vWF subunit residues 474 to 488 : 15 and also approximately residues 694 to 708) brought into disulfide-dependent association by an intrachain (residues 509 to 695) disulfide bond.
-Thus, reactivity with NMC-4 is important evidence of whether a particular recombinant 441-730 mature vWF
subunit fragment has assumed the tertiary structure of the analogous wild type residue 441-730 domain.

Accordingly, the procedure o~ Example 12 was followed to characteri2e v~F polypeptides secreted by pA~4/WT and pAD4/~3C transformed COS-1 cells, with the modi~ication that immunopxecipitation of the culture media was ef~ected solely with NMC-4 antibody (0.05 mg NNC-4 per 5 ml of cultur~ media to which 0.5 ml of 10X
immunoprecipitation bu~fer had been added).

Samples were run under reducing and non-reducing conditions. Consistent with the results of Example 12, .=,,, , . ~ , .. ... .

: . - - . . :

W0~2/06~ PCT~US91/077~6 the major component isolated from pAD4/W~ cul ure medium has an apparent molecular weight of 116 kDa under non-reducing conditions and 52 kDa under reducing conditions.
.
Although only a small fraction of the total - :.
~ pAD4/ 3C derived vWF polypeptide material binds to NMC-:.~ 4 (compared to conformation independent RG-46), a band :~ o~ apparent molecular weight o~ S2 kDa is visible under -reducing and non-reducing conditions in gels of NMC-4 i~
~ 10 immunoprecipitates.

Exam~le 14 - Expression and ~haracterization of von Willebrand factor subunit fragments produced by COS-l cells transformed with AD4/G459, pAD4/G~2 or pAD4/G4~ plasmids - ::.

.
Transformation of COS-1 cells by either pAD4/G459, `.
.',: pAD4/i~2 or pAD4/G~ plasmid (collec~ively the ~p~D4/QlC ~ -~ plasmids") was accomplished according to the procedure i of Example 11. Culture media were analyzed for . .;
secreted vWF polypeptide according to the procedure of --~
Example 7, using only NMC-4 for immunoprecipitation. :

35S-labelléd proteins, prepared according to .
Example 12, were immunoprecipitated by NMC-4 and run in SDS-polyacrylamide gels u~der reducing and non-reducing . ~-conditions and compared with vWF antigen produced by ..
pAD4/WT and pAD4/Q3C transformants. : .~ ~

~he gels demonstrated that substitution of any one , : -o~ the 3 cysteines;~459, 462, 464) believed responsible I- .
~or interchain disulfide contacts in native mature subunits prevents the formation of the homodimeric 116 kDA polypeptide characteristic of pAD4/WT transformed -.

- , ~ `'.

.; . !.,''. ?. .. ' ' ' ,. , .. , - ' . W092/06~ PCT/US91/077S6 `i ~` 2 0 9 ~ 9 ,`
:~. 128 " CQS-l cells. ~hese three vWF antigens with a single glycine su~stitution appear predominantly as monomeric polypeptides of an apparent molecular weight of 52,000 under reducing or non-reducing conditions. That the predominant material has an apparent molecular weight of 52 kDa is strongly suggestive of correct .; glycosylation by the COS-1 cell transformants duplicating glycosylation 6een in the human 52/48 kDa - tryptic vWF fragment. Some inadequately glycosylated and/or proteolyzed vWF antigen (molecular weight less than 52 kDa) is also apparent in the gels. The - relatively small fraction of pAD4/~3C vWF polypeptidP
which is successfully folded and secreted, thereby presenting an NMC-4 epitope, was shown by the low intensity of the pAD4/~3C transformant autoradiograph ~- band of apparent 52,000 molecular weight.
:
Example 15:- Enhancement of the Af~inity of the Recombinant 116 kDa vWF Fragment for Platelet GPIb(~) Receptor Sites in the Presence of Ristocetin This example demonstrates that the affinity of the ~ :
recombinant 116 kDa vW~ fragment for platelets can be enhanced by reducing the amount of N-linked glycosylation present in the 116 kDa polypeptide.
. ~ .
Stable CHO-X1 transformants containing DNA ~rom pAD5/WT plasmids were incubated overnight (following generally the cell culture procedures of Example 1 and with an initial cell density of about 5 x:105 cells/60 mm tissue culture dish~ in DMEM containing 10% FCS wi~h 0.5 mM of each nonessential amino acid, 2 mM L-glutamine, and also tunicamycin (from StreptomYces, - , :. ~ , ", .

:-: ~, .

: i ` W092~06~ P~T/US91/0775 :
"` 2~X~
.
;~ 129 product T7765 containing A, B, C and D isomers thereo~, i Sigma Chemical Co., Sk. Louis, M0) at 0.8 ~g/ml.

.~ ` The cells were then washed twice with PBS and incubated in DMEN with 0.5 mN of each nonessential .~ 5 amino acid, 2 mM L-glutamine and 0.4 ~g~ml tunicamycin . ::
~- - for 24 additional hours. The culture medium was harvested and concentrated 300 fold in a centrifugation-~iltration apparatus, model Centricon . 30, Amicon Co., Lexington, MA.

lo As a control, medium ~rom stable transformants :
incubated without tunicamycin (under otherwise identical conditions) was also harvested. The . respective abilities of the vWF-derived recombinant 116 kDa dimeric polypeptides (fro~ treated and untreated cultures) to support ristocetin-induced platelet ., .
aggregation were cQmpared. ~ :
-.
The amount of vWF derived antigen varied from ~.
preparation to preparation depending on the precise extent of growth in each tissue culture dish. Based on ~he ratio of NMC-4 reactivity of particular samples of -FC9-free medium derived from treated:and untreated ..
cells, respective ~l amounts of 300 fold concentrated mediu~ were chosen to reflect equal amoun~s of vWF
antigen ~or comparison in the ristocetin assay. Equal NMC-4 a~inity constants were presumed. ~
: .
In order to determine the normalizing ratio, ~.
between 10 and 100 ~l quantities of FCS-free cultura : :
medium samples ~from treated and untreated cultures) -were electrophoresed in SDS-polyacrylamide gels as described in ~xample 1, after which the bands were ' WO9~/06~ PCT/US91/077~6 ::`` 2~9~'~5'~

." transferred to nitrocellulose sheets for immunoblotting :~
according to a standard procedure. Burnette, et al., . A.~nal. Biochem., 112, 195-203 (1981). Detection on the nitrocellulose sheets was accomplished using NMC-4 as primary antibody followed by ~ rabbit anti-mouse IgG as secondary antibody and visualization by autoradiography (see Example 1). For normalization, total vWF antigen reactive with NNCo4 fro~ each culture was determined from densitometric scans of the autoradiographs.
~ .
- Ristocetin-induced platelet aggregation assays - were performed according to the procedure of Example 2 and demonstrated that tunicamycin treated cells produced a NMC-4 reactive antigen having a greater platelet aggregation inducing capability than that , produced by untreated cells which generated polypeptides with normal N-linked glycosylation. The comparative aggregation profiles used ristocetin concentrations of 0.5, 0.75 and 1.0 mg/ml.
:
In addition, the NMC-4 reactive 116 kDa - polypaptide material from untreatPd cells was resolved by ~estern blotting into multiple species with slightly di~ferent electrophoretic mobilities. Aftar treatment with tunicamycin, only a single species was observed.
It is thus demonstrated that N-linked glycosylation of the recombinant 116 kDa Pragment i~ heterogeneou~ and that the level o~ such glycosylation affects the biological activity of the fragment.

` ` wo 9~ 9g9 . ~ j .
.
~``` ` 2~9~2~9 ! ' ~ 131 ., ~xamPle 16 - Construction of Mammalian Transformants ror the Expression of Monomeric or .~ Dimeric Fo~ms of the Residue 441-730 ~i 5 von Willebrand Factor Subunit Frag~ent !~
with Reduced Levels o~ Glycosvlation , This example demonstrates the preparation o~ vWF-derived polypeptides patterned upon the mature subunit 449-72~ sequence (the 52/48 kDa frag~en~), or dimers ~:`
; thereof, but containing less glycosylation than that ,,.
;, 10 present in the 52/48 fragment, or dimers thereof, as ~, isolated from circulating plasma ~WF.
. ~., ~ Mutaaenesis of_vWF cDNA
, . ~' One or more particular codons of a cDNA encoding . the mature subunit residue 441-730 fragment which encode serine, threonine or asparagine residues thereo~
may be replaced with codons for other amino acids, such ~ -as, for example, alanine or glycine, following the procedures of Examples I and 3.
,..~, Brie~ly, the M13mpl8 recombinant DNA sequence .;
encoding vWF subunit residues 441-730 and designated :~
pAD3-1 (Example 7) can be cloned into pcDNAl vector (according to the proceduxe o~ Example 9) to generate the pAD4/WT pla~mid.

pAi4/WT pla~mid aan be restricted with EcoRI and SmaI enzymes. A~ explained in Example 9, pcD~A1 contains an EcoRI sits within its polylinker region but no S~aI ~ite. A unique SmaI site (CCCGGG) is contained :~
within the vWF cDNA insert, epanning mature subunit residues 716 (glycine) to residue 718 (glycine).
- :

W092/06~ PCT/U~g~/07756 2~ 5 ~
; 132 This approximata 950 base pair EcoRI-SmaI fragment : o~ pAD4/WT can be subcloned into the EcoRI-SmaI site within the polylinker region of Ml3mpl8 phage. The vWF
sequence can then be mutagenized to delete or replace one or more serine, threonine, or asparagine codons (encoding potential sites of glycosylation) prior to being reinserted into the previously r~stricted pAD4/WT
construct, leading to reassembly of the intact residue 441-730 vWF sequence.

A pr~ferred form of mutagenesis follows the procedure of Kunkel, T.A., supra (Exa~ple 7) and utilizes a hybridizing oligonucleotide suitable for deleting one or more serine, threonine, or asparagine codons, or alternatively suitable for substituting one or more codons ~or other amino acids, such as for glycine or alanine. ~he pcDNA1-derived plasmid containing vWF cDNA which encodes a polypeptide with reduced potential for glycosylation can be designated pAD4/-G.

Following the procedures of Examples g and 10, COS-l cells can be transformed with pAD4/-G plasmids.
The polypeptides expressed in this way will form 116 kDa homodimers which compared to the pA~4/WT
polypeptides have fewer potential sites ~or glycosylation. Many other expreæsion plasmid/host cell systems can be used to express the mutant vWF cDNA
including notably the pCDN8~/CHO-Xl system of Example 7.

ExDression of Monomeric Fraqments WOg~/06~ PCr/US9~07756 ;
2 ~ ~ ~ c~

.

Following the procedure o~ Example 9, deletion of . .
- or substitution for one or more codons encoding one or ~ more of the above mentioned potential glycosylation .
sites within the 441-730 sequence can be per~ormed with an oligonucleotide which also encodes cys - gly codon changes at, for example, cysteine residue posi~ions ; ;~
: 459, 462, and 464. Alternatively, a second round of - ~
mutagenesis could be performed in ~13mpl8 phaye to ; ~:
effect the cysteine to glycine mutations.

When reassembled, the pcDNA1 plasmid construct containing cys - gly mutations at vWF subunit positions 459, 462, and 464, and one or more further codon .::
mutations to restrict glycosylation of the encoded vWF
polypeptide, can be designated pAD4/~3C,-G. This polypeptide, lacking the cysteine residues which stabilize the 116 kDa homodimer (s~e Examples 12 and .~:
14) will be expressed and secreted from host cells as a monomeric fragment.

: ExamPle 17 - Expression and Secretion by Eucaryotic Cells of Other ~herapeutic PolyPeptides . ~
:: Example 7 and Examples 12-14 demonstrate that the polypeptide consis~ing o~ the 22 residue human vWF
signal peptide and the first three amino acids of the human vWF propeptide directs the successful secretion ~rom CHO-Kl and COS-1 cells of the mature vWF subunit ~ragment, ~onsisting of residues ~41-730, which fragment could otherwise only be recovered from host cells by cell lysis.

` WOg2/~6~ PCT/US91/077~
2 ~
5~ r`~ `.

134 .
~he amino acid sequenc~ ~see SEQ ID NO: 15) NH2- Met-Ile-Pro-Ala-Arg-Phe-Ala-Gly-Val-Leu-Leu-Al~-Leu-Ala-1~u-Ile-Le~-Pro-Gly-Thr-Leu-Cya-Ala-Glu-Gly-Thr-Arg-Gly-Arg-Ser-Ser-Thr-CC2H t Xnown ~ignal peptidase cleavage site : and fragments and combinations of fragments thereof will prove useful in the process of directing the secretion into the lumen of the endoplasmic reticulum and, therefore, into the culture medium of eucaryotic host cells of therapeutic polypaptides comprising other regions of the vWF molecule or consisting of other protein species or fragments thereof.

It is believed also that the amino acid sequence comprising NH2-ala-gluogly-CO2H will facilitate the identification by signal peptidases of a proper :
clea~age site, when said amino acid seguence is `.
positioned on the C-terminal side of the human vWF
signal peptide.
.
Following the procedures of Example 7, a DNA
sequence useful in the expression of a therapeutic polypeptide can be constructed in which the following structural elements would be assembled in a 5' to 3' direction (re~erring to the coding or nontransc~ibed strand):
(A) a sequence of nucleotides suitable for re~triction;
(B) a eucaryotic consensus translation initiation sequence;
(C) a methionine codon followed by 21 other codons which together would encode the human : :
vWF signal peptide; . ;
~' ,,.,: ' ~: .

.,--.. ., .. , . , .: . .

: `

. .
:
W092/06~ PCT/US91/07756 -2 ~ ~
.
i.
: 135 ::
~D) a coding sequence corresponding to approximately the ~irst three amino acids of the amino terminal regivn of the human vW~
propeptide; :~
(E) the coding sequence for the therapeutic ~:
polypeptide; ~:-. (F) a translation termination codon; a~d - ~G) a sequence of nucleotides suitable for ~ - restriction.
;
This construct may then be inserted into a plasmid or viral expression vector which cloning vehicle may in turn be used to transform suitabIe eucaryotic hoRt n cells from which the therapeutic polypeptide would be :~.
expressed.

Exam~le 18 - Preparation of Subsets of the 52/48 kDa Polype~tide This example is illustrative of the preparation of ~: polypeptides representing embodiments of the invention which are cysteine-deficient subset~ derived from the residue 441-733 fragment of vWF subunit. The example is also illustrative of conditions under which such subsets may be expressed from recombinant bacterial host cells. The subsets ~ay be expressed also from recombinant eucaryatic cells, for example, by following the general procedùres of Examples 7 and 9. The subsets are capable of interfering ~ith the interaction of multimeric vWF and platelet ~PIb~, ~hat is, they : .
have utility às antithrombotics.
- - . . ~ , ;, : There follows hereafter a description of the :~ ;
preparation of three groups of polypeptides co~prising the afore~entioned type subsets, with the first group ~ .
: .:.
.

WOg?/06~ ~ PCT/US91/07756~
`2 ~ X 5`~
' o~ subsets being cysteine-free and those of tha second : and third groups of subsets having but two cysteine residues (five of the cysteine residues having been removed). The subsets of the second and third goups -~
differ in that there is retained either the N-terminal - region ~second group) or the C-terminal region (third group) of the polypeptide.

Polypeptide Subsets ~cysteine-free) of the_Residue 441-733 Domain of vWF Subunit Mutant (fusion) polypeptides consisting of the residue 441-733 seguence, but lacking either the internal G10 ~residues 474-488) or D5 (residues 694-708) region, were created using loopout mutagenesis in M13mpl8 phage of restriction fragments of p7E
constructs and then tested for antithrombotic activity.

Specifically, p7E plasmids were recovered from cultures of E.coli BL21(DE3) using an alkaline cell lysis procedure, Birnboim, H.C. and Doly, J~, Nucleic Acids Rese~ch, 7, 1513 (1979) followed by purification by CsCl/ethidium bromide equilibrium centrifugationO
An XbaI restriction site exists in p7E plasmid ~contributed by the parent pET-3A vector) upstream from the T7 transcription promoter. Accordingly, the vWF
insert ~for residues 441-733) was removed as an XbaI-HindIII restriction fragment for loopout mutagenes~s ~see Example 1) in M13mpl8 phage. Loopout of the G10 region or D5 region, respectively, was accomplished using the following oligonucleotides which represent non-coding strand ~transcribed strand) DNA.
Shown below the two 3' ~ 5' oligonucleotides are the corresponding coding strands and resultant amino acid sequences.

'`" ' :
~ . . . . . . ... .... .... .. . . . .. ..

W092/Q6~ PCTI~S91/07756 : .
2~9~259 ` Oligonuclaotide (1~) - see SEQ ID N0: 16 :

3' - GAG TGG CCA CTT CGG CAC TCG GGG TGG TGA - 5' 5' - ctc acc ggt gaa gcc gtg agc ccc acc act - 3' Leu Thr Gly Glu Ala Val Ser Pro Thr Thr 469 470 471 47~ 473 489 490 491 492 493 deletion of G10 binding peptide Oligonucleotide (15) - see SEQ ID N0: 17 3' - CTC TAG CAA TCG ATG CTG TAC:GGT GTT CAG - 5' 5' - gag atc gtt agc tac gac atg gca caa gtc -3' Glu Ile Val Ser Tyr Asp Met Ala Gln Val deletion of D5 binding pept1de DNA sequence analysis was used to confirm that the intended vWF coding~sequences were produced.~ The ~wo ~ .
mutagenized XbaI-Hin~III restriction ~ragments were then inserted into eepArate pET-3A plasmids that had -~
been cut wi~h XbaI and HindIII restriction endonuclease : 20 and which w~re thereafter designated p7E/~GlO and ...
~ p7E/~D5.
.
The resultant mutant (~usion) vWF polypeptides were then te~ted ~or their ability to bind to GPIb~.
U~ing the as~ay procedure of Example 6 (inhibi~ion of the binding o~ LJ-Ibl antibody to GPIb~ in the absence : of botrocetin modulator), it was determined that the residue 441-733 ~ragment, which was expressèd from p7E
and from which the l'G10" peptide sequence was deleted, ~ .
: binds 5PIb~. The p7E-derived fusion fra~ment lacking : :
., ,' ~ "~';'" .

W~92/06~ PCT/US91/07756 :`` " 2~9~259 :

the 'ID5'' peptide sequence did not. However, when the experiments were repeated using botrocetin as a modulator of binding (sae the method of ~xample 6), both of the fused subfragments were effective in inhibiting binding by LJ-Ibl, and hence have ` antithrombotic utility.

Other in vitro assays which can be used to - identify vWF-derived polypeptides having antithrombotic activity include inhibition of botrocetin-induced binding of vWF to platelets by the mutant polypeptide (6ee Example 3), and the inhibition of human platelet agglutination in a system using bovine vWF, but without -a modulator such as botrocetin or ristocetin.

Cysteine-deficient Polypeptide Subsets Having N-terminal Deletions - Therapeutic polypeptide subsets effective as antithrombotics have also been prepared which are patterned upon the residue 441-733 vWF subunit fragment, but which contain N-terminal deletions.
- ' . .-Preparation of such polypeptides was accomplished ~;
using loopout mutagenesis in M13~pl8 phage of the XbaI-HindIII restriction fra~ment from p5E expres ion plasmid. Thus, the vWF encoding sequence ~p5E) encoded ~;
cysteine ~or residue positions 509 and 695 and glycine at residue positions 459, 462, 4~4, 471 and 474. p7E
sequence is also useful for expression of such antithrombotic polypeptides. Antithrombotic polypeptides equivalent to those expxessed from p7E
constructs can be made by reduction and alkylation of cystaine residues otherwise contained therein.
.:~ .
.' ' ' . WOg2~06~ ~CT/US91/07756 2~'12~
.,` , .
, The dssign o~ oligonucleotides used to create N-terminal deletions in the vWF subunit fragment made reference to DNA sequence of the pET-3A vector that is upstream (5') from the codon encoding vWF residue 441.
Expression of the residue 441-733 fragment as an EcoRI-HindIII insert (with both 5' and 3' ends thereof .
modified by Bam~I linkers, Example 1) in pET-3A
involves expression also of a twenty residue amino aoid ~-~ sequence (SEQ ID N0:18) that remains attached to the amino terminal of the vWF fragment. ~This sequence, as shown below, is encoded by vector DNA downstream from :
the T7 promoter site but does not affect adversely the :~.
therapeutïc activity of the vWF polypeptide.
initiation codon ~ .
- Met Ala Ser Met Thr Gly Gly Gln Gln Met .
Gly Arg Gly Ser Pro Gly Leu Gln Glu Phe Arg~
~ from EcoRI
~ .
:~ 20 It is noted that the EcoRI encoding sequence (Glu-Phe) survived~modification with a ~amHf linker in the ~; T4-DNA ligase procedure (Example 1) ln this particul~r .
case. The corresponding pET-3A vector coding sequence located upstream from the initiating methionine and residue 441 (arginine) is as follows.

Oligonucleotide (16) - see SEQ ID N0: l9 S' - GAA GGA GAT ATA CAT ATG GCT AGC . . . ;.~
- ~ Met Ala Ser -:
. .
Accordingly, generation of N-terminal dele~ions was accomplished using loopout mutagenesis with a hybridizing oligonucleotide which encodes sequence .-:
from the veotor (ending at the initiating methionine) .. :,, - -, ... . . . . . . .. ..

W0~2/06~ PCT~USgl/~77S6 ` 299'~2~ ~

` 140 and then the intended N~terminal region of the new vWF ~, polypeptide.
. ~ .
Representative of the oligonucleotides necessary ~, for the preparation of the therapeutic polypeptides is oligonucleotide 17 (SEQ ID N0: 20) which corresponds to non-coding strand (t~anscribed strand) DNA. Shown ~,~
- below this oligonucleotide are the corresponding coding strand and resultant amino acids. ' '.-~ .''..
3' - CCT CTA TAT GTA TAC GTC CTC GGC CCT CCG - 5 ' `
gga gat ata cat atg cag gag ccg gga ggc ' Met Gln Glu Pro Gly Gly 474' 475 476 477 478 479 ,~,', Representative of cysteine-deficient polypeptides ',' reflecting such N-terminal deletions are Met Gln47s to Valn3, Met-Thr4~ to Val~3, and Met Ty~ to Val~3. Such ' ~ ~' polypeptides (and other species having terminal '-~ deletion of any subsets of the vWF residue 441-508 -`~ sequence that contain one or more cysteine residues) have antithrombo~ic therapeutic activity. These ~-~
polypeptides can present also the cysteine 509-695 loop when expres6ed from p5E constructs.

Cysteine-defici~nt Polypeptide Subsets Havina C-Terminal ,Deletions ''' The procedure used to express recombinant bacterial polypep~ides using pET-3A vectors results in polypeptide~ that comprise also a series of amino acids on the C-termina} side of Val~3, the additional residues arising from transl~tion of vector sequence (see SEQ ID N0: 21).
~. .
Specifically, residue 441-733 fragments expressed ' from p5E (or p7E) constructs contain also 22 residues ~

W0~2/06~ PCT/US91/077~6 .2.~ ~ ~.2 .~.~

.

~used to the C-terminal side of residue 733 (valine~
- resulting ~rom the expression of vector sequence prior to the ~irst vector stop codon.
:.
This pET-3A vector sequence, which reflects also modification (Example 1) of the HindIII site of the EcoRI-HindIII fragment by a BamHI linker, is 5SEQ ID :
No: 21):
Val Ser Ser Asp Pro Ala Ala Asn Lys Ala Arg Lys Glu Ala Glu Leu Ala Ala Ala Thr Ala Glu Gln *
stop codon .
In order to prepare an appropriate encoding DNA
sequence for vWF polypeptides having C-terminal deletions, loopout mutaganesis was performed in p5E
using hybridizing oligonucleotides patterned on non-coding strand DNA. To prepare a polypeptide (using the . polypeptide ~nding at residue Asp7~ as an example~, a Aybridizing oli~onucleotide was created encoding vWF
subunit sequence (for ~xample, from residue 706 to 713) that included also between certain codons thereof (for example, c~don 709 and codon ilO~ the stop ~odon/reading frame shi~t se~uence 3' - ACT-ACT-T - 5'.

Accordingly, vWF-derived polypeptides were generated that have C-terminal deletions and which terminate at residues 709, 704, 700 and 696 - respectively. ,~

~V092/0~ PC~/~S91/077~
2 ~

Deposit o~ Str~ins Useful in Practic-in~ the Invention Deposits of biologically pure cultures of the . -following strains were made under the Budapest Treaty with the American Type Culture.Collection, 12301 .
Parklawn Drive, Rockville, Maryland... The accession numbers indicated were assigned after ~uccessful .:
viability testing, and the requisite fees were paid..;.

Access to said cultures will be available during .~::
pendency of the patent application to one determined by ..
the Commissioner of the United States Patent and .~::
Trademark Office to be entitled thereto under 37 C.F.R.
~ 1.14 and 35 U.S.C. ~122, or if and when such access is required by the Budapest Treaty. All restriction on .
availability of said cultures to the public will be .. :~
-lS irrevocably removed upon the granting of a patent based upon the application and said cultures will re~ain. . :.
permanently available for a term of at least five.years :.
- after the most recent request for the furnishing of samples and in any case for a period of at least 30 :~
years after the date.of the deposits. Should the cultures become nonviable or be inadvertantly destroyed, they will be replaced with viable culture(s) .
of the ~ame taxonomic description.

Stra~/Plasmi~ ATCC No. Deposit Date EL~Qli p5E BL21 (DE3) 96.3 ATCC.68406 9/19/go E.cQli XS127 96.4 . ATCC 68407 9/19/90 ,, :.
' ': ' - . : . ~ . .. . . . . . . ..

Claims (86)

What is claimed is:

1. A polypeptide patterned upon a parent polypeptide and comprising the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 441 (arginine) and ends at approximately residue 733 (valine), or any subset thereof, in which one or more of the cysteine residues normally present in the parent polypeptide, or subset thereof, have been deleted and/or replaced by one or more other amino acids, said polypeptide having therefore less tendency than the parent polypeptide, or subset thereof, to form intra or interchain disulfide bonds in aqueous media at a physiological pH.

2. A polypeptide according to Claim 1 which contains residues 509 (cysteine) and 695 (cysteine), wherein one or more of cysteine residues 459, 462, 464, 471, and 474 are deleted or replaced by one or more o her amino acids.

3. A polypeptide according to Claim 2 in which each of cysteine residues 459, 462, 464, 471, and 474 is deleted or replaced.

4. A polypeptide according to Claim 2 in which cysteine residues 509 and 695 are covalently linked by a disulfide bond.

5. A polypeptide according to Claim 2 in which each of cysteine residues 459, 462, 464, 471, and 474 is replaced by a single residue of one or more of alanine, threonine, serine, glycine or asparagine.

6. A polypeptide according to Claim 1 in which each cysteine residue is replaced by glycine.

7. A polypeptide according to Claim 2 in which each cysteine residue is replaced by glycine.

8. A polypeptide according to Claim 1 in which each of cysteine residues 459, 462, 464, 471, 474, 509 and 695 is replaced by a single residue of one or more of alanine, threonine, glycine, serine or asparagine.

9. A polypeptide which consists essentially of any subset or combination of subsets of a polypeptide of Claim 1.

10. A polypeptide according to Claim 1 wherein one or more of the cysteine residues normally present in the parent polypeptide, or subset thereof, have been deleted.

11. A polypeptide according to Claim 10 in which one or more amino acid-residues adjacent to a deleted or substituted cysteine residue position have also been deleted or substituted.

12. A polypeptide according to Claim 1 wherein at least one additional residue of lysine and/or of arginine extends from the amino and/or from the carboxy terminus of said polypeptide.

13. A polypeptide according to Claim 1 in which one or more of the free thiol groups thereof are chemically inactivated so as to prevent the disulfide bonding thereof.

14. A polypeptide according to Claim 9 comprising one or more fragments of a mature von Willebrand factor subunit, said polypeptide containing a cysteine residue 509 and a cysteine residue 695 linked by a disulfide bond, and further comprising a domain of said von Willebrand factor subunit which binds to platelet membrane glycoprotein Ib.

15. A polypeptide according to Claim 1 which is glycosylated.

16. A polypeptide according to Claim 1 wherein one or more of cysteine residues 459, 462 and 464 are deleted and/or replaced by one or more other amino acids, and wherein said polypeptide has less tendency than said parent polypeptide to form interchain disulfide bonds.

17. A polypeptide according to Claim 16, containing cysteine residue corresponding to positions 509 and 695 of said fragment or subfragment, in which cysteine residues 509 and 695 are linked by an intrachain disulfide bond.

18. A polypeptide according to Claim 16 in which one or more of the amino acid residues adjacent to a deleted or substituted cysteine position have also been deleted or substituted.

19. A polypeptide according to Claim 16 which is glycosylated.

20. A polypeptide according to Claim 16 in which each of cysteine residues 459, 462 and 464 is replaced by one or more residues of an amino acid chosen from among alanine, threonine, serine, glycine or asparagine, the selection for a replacement at one position being independent of the selection of a replacement at another position.

21. A polypeptide according to Claim 16 in which any two of cysteine residues 459, 462 and 464 are replaced, respectively, by one or more residues of amino acids chosen from among alanine, threonine, serine, glycine, or asparagine, the selection for a replacement at one position being independent of the selection of the replacement at the other position.

22. A polypeptide according to Claim 16 in which any one of cysteine residues 459, 462 and 464 is replaced by one or more residues of amino acids chosen from among alanine, threonine, serine, glycine or asparagine.

23. A polypeptide according to Claim 20 in which cysteine residues 459, 462 or 464 are replaced by single residues of glycine.

24. A polypeptide according to Claim 22 in which a single residue of glycine replaces the substituted cysteine residue.

25. A polymeric structure which inhibits the binding of von Willebrand factor to platelet membrane glycoprotein Ib comprising two covalently linked domains, one of the domains comprising:
a polymer chosen from (A) or (B) below (domain 1):
(A) a polymer having a linear sequence of amino acids which includes the sequence from approximately residue 469 (leucine) to approximately residue 520 (aspartic acid) of mature von Willebrand factor subunit, or any subset thereof; or (B) a polymer having a linear sequence of amino acids which includes the sequence from approximately residue 469 (leucine) to approximately residue 520 (aspartic acid) of mature von Willebrand factor subunit, or any subset thereof, in which one or more of cysteine residues 471, 474, and 509 are deleted or replaced by one or more other amino acids; and the other domain comprising:
a polymer chosen from (C) or (D) below (domain 2):
(C) a polymer having a linear sequence of amino acids which includes the sequence from approximately residue 689 (glutamic acid) to approximately residue 713 (valine) of mature von Willebrand factor subunit, or any subset thereof; or (D) a polymer having a linear sequence of amino acids which includes the sequence from approximately residue 689 (glutamic acid) to approximately residue 713 (valine) of mature von Willebrand factor subunit, or any subset thereof, in which cysteine residue 695 is deleted or replaced by another amino acid.

26. A polypeptide structure which inhibits the binding of von Willebrand factor to platelet membrane glycoprotein Ib, comprising two domains linked by a disulfide bond, one of the domains comprising:
a peptide chosen from (A) or (B) below (domain 1):
(A) a peptide which includes the sequence of amino acids of mature von Willebrand factor subunit from approximately residue 469 (leucine) to approximately residue 520 (aspartic acid) or any subset thereof; or (B) a peptide which includes the sequence of amino acids of mature von Willebrand factor subunit from approximately residue 469 (leucine) to approximately residue 520 (aspartic acid) or any subset thereof, in which one or both of cysteine residues 471 and 474 are deleted or replaced by one or more other amino acids; and the other domain (domain 2) comprising:
a peptide which includes the sequence of amino acids of mature von Willebrand factor subunit from approximately residue 689 (glutamic acid) to approximately residue 713 (valine) or any subset thereof which contains residue 695; and wherein said disulfide bond connects cysteine residue 509 of domain 1 and cysteine residue 695 of domain 2.

27. A DNA sequence encoding the fragment of mature von Willebrand factor subunit having an amino terminus at approximately residue 441 (arginine) and a carboxy terminus at approximately residue 733 (valine) or encoding a subfragment thereof, in which one or more of the cysteine codons normally found in said DNA sequence are deleted or replaced by missense codons.

28. A DNA sequence according to Claim 27 in which the codons encoding amino acid residues 459, 462, 464, 471, 474, 509, and 695 of the mature von Willebrand factor subunit are deleted or replaced by missense codons.

29. A DNA sequence according to Claim 27 in which the wild-type codons encoding cysteine residues 459, 462, 464, 471 and 474 of the mature von Willebrand factor subunit are deleted or replaced by missense codons.

30. A DNA sequence according to Claim 27 in which one or more of the wild-type cysteine codons encoding residues 459, 462 and 464 are deleted or replaced by missense codons.

31. A DNA sequence according to Claim 27 in which each of the missense codons codes for glycine.

32. A DNA sequence according to Claim 27 in which the missense codons code for one or more of alanine, threonine, serine, glycine, or asparagine.

33. A DNA sequence according to Claim 27 which comprises also a restriction endonuclease site at each end of the sequence.

34. A DNA sequence according to Claim 33 in which the restriction endonuclease site preceding the codon of residue 441 is EcoRI and the restriction endonuclease site following the codon of residue 733 is HindIII.

35. A DNA sequence encoding any subset or combination of subsets of the fragment of mature von Willebrand factor subunit having an amino terminus at approximately residue 441 (arginine) and a carboxy terminus at approximately residue 733 (valine), in which one or more of the up to 7 cysteine codons normally found therein are deleted or replaced by missense codons.

36. A DNA sequence according to Claim 30 in which the codons encoding cysteine residues 459, 462 and 464 are each replaced by missense codons.

37. A DNA sequence according to Claim 30 in which a codon encoding one of cysteine residues 459, 462 and 464 is replaced by a missense codon.

38. A DNA sequence according to Claim 30 in which the codons encoding any two of cysteine residues 459, 462 and 464 are replaced by missense codons.

39. A DNA sequence according to Claim 30 in which each cysteine codon for which a substitution is made is replaced by one or more codons chosen from among those which encode alanine, threonine, serine, glycine, or asparagine, the selection for a replacement at any one position being independent of the selection of the replacement at any other position for which a substitution is also made.

40. A DNA sequence according to Claim 39 in which a glycine codon is substituted for any cysteine codon replaced therein.

41. A DNA sequence comprising domains (A), (B) and (C) as follows:
domain (A) a DNA sequence encoding the von Willebrand factor signal peptide; and downstream therefrom, domain (B) a DNA sequence consisting essentially of nine nucleotides and encoding the first three amino acids of the amino terminus region of the von Willebrand factor propeptide; and downstream therefrom, domain (C) a DNA sequence encoding all or part-of the 2,050 amino acid sequence of the mature von Willebrand factor subunit.

42. A DNA sequence according to Claim 41 in which the DNA subsequence, domain (C) thereof, corresponding to mature von Willebrand factor subunit DNA
encodes an amino acid sequence from approximately residue 441 (arginine) to approximately residue 730 (asparagine).

43. A DNA sequence according to Claim 41 in which the DNA subsequence, domain (C) thereof, corresponding to mature von Willebrand factor subunit DNA
encodes discontinuous subsequences of mature von Willebrand factor subunit amino acid primary structure.

44. A polypeptide which is capable of directing the transport of additional polypeptide sequence across the membrane of the endoplasmic reticulum of a cell and which is comprised of a domain (A) and a domain (B) as follows:
domain (A) any subset of the signal peptide of human von Willebrand factor subunit which signal peptide is capable of being recognized by the endoplasmic reticulum and/or by translocation receptors which complex with the endoplasmic reticulum and/or the signal peptide; and domain (B) a peptide sequence consisting essentially of up to the first ten residues of the amino terminal end of von Willebrand factor propeptide;
said domain (B) being connected by amide linkage to the carboxy terminus of domain (A) and capable of being connected by amide linkage to the amino terminus of said additional polypeptide sequence; which polypeptide comprising domain (A) and domain (B) contains a sufficient subset of the sequence of the human von Willebrand factor signal peptide and propeptide to permit intracellular cleavage of said polypeptide containing additional polypeptide sequence in a manner such that the therapeutic activity of the additional polypeptide sequence is retained in whole or part.

45. A cloning vehicle which contains a DNA sequence according to Claim 27.

46. A cloning vehicle comprising essentially M13mp18 bacteriophage which contains a DNA sequence according to Claim 27.

47. A cloning vehicle which contains a DNA sequence according to Claim 30.

48. A biologically functional expression plasmid or viral expression vector, containing DNA encoding for a fragment of mature von Willebrand factor subunit having an amino terminus at approximately residue 441 (arginine) and a carboxy terminus at approximately residue 733 (valine), or a subfragment thereof, in which one or more of the cysteine codons normally present in the encoding DNA are deleted or replaced by missense codons, which plasmid or vector is capable of being replicated in a host cell and directing expression therein of said vWF subunit fragment or subfragment.

49. An expression plasmid or viral expression vector according to Claim 48 in which the codons thereof encoding cysteine residues 459, 462, 464, 471 and 474 of the mature von Willebrand factor subunit within said plasmid or vector are deleted or replaced by missense codons.

50. An expression plasmid or viral expression vector according to Claim 48 in which the codons thereof encoding cysteine residues 459, 452, 464, 471, 474, 509 and 695 of the mature von Willebrand factor subunit within said plasmid or vector are deleted or replaced by missense codons.

51. An expression plasmid according to Claim 48 which is selected from a group consisting of pBR 322, pET-1 through pET-7, and any constructs derived therefrom.

52. An expression plasmid or viral expression vector capable of directing, in eucaryotic cells, the expression therein and secretion therefrom of a fragment of mature von Willebrand factor subunit having an amino terminus at approximately residue 441 (arginine) and a carboxy terminus at approximately residue 730 (asparagine), or a subfragment thereof, said plasmid or vector therefore containing a transcriptional promoter, followed downstream by a DNA sequence encoding said fragment or subfragment, and a signal sequence positioned upstream from and in proper reading frame with said encoding DNA sequence, said signal sequence directing and/or facilitating the secretion of the fragment or subfragment from the eucaryotic cell.

53. An expression plasmid or viral expression vector according to Claim 48 capable of directing, in eucaryotic cells, the expression therein and secretion therefrom of a fragment of the mature von Willebrand factor subunit having an amino terminus at approximately residue 441 (arginine) and a carboxy terminus at approximately residue 730 (asparagine), or a subfragment thereof, in which one or more of cysteine residues 459, 462 and 464 are replaced by single residues of glycine, said plasmid or vector therefore containing a transcriptional promoter, followed downstream by a DNA sequence encoding said fragment or subfragment, and a signal sequence positioned upstream from and in proper reading frame with said encoding DNA sequence, said signal sequence directing and/or facilitating the secretion of the fragment or subfragment from the eucaryotic cell.

54. A recombinant host transformed with an expression plasmid or viral expression vector of Claim 48.

55. A recombinant host according to Claim 54 wherein said host is a prokaryot selected from Escherichia, or Bacillus, or a eucaryot selected from a group consisting of yeast (Sarcomyces), cultured insect cells, and cultured mammalian cells.

56. A recombinant host according to Claim 54 wherein the host is E.coli, strain BL21(DE3), and the expression plasmid therein is pET-3A.

57. A viral expression vector according to Claim 48 which is selected from the group consisting of the baculovirus Autographa californica nuclear polyhedrosis virus, and retroviruses.

58. A recombinant eucaryotic host cell transformed with an expression plasmid or viral expression vector according to Claim 52.

59. A process for producing from DNA which encodes that fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately residue 441 (arginine) to approximately residue 733 (valine), or which encodes any subfragment thereof, a mutant von Willebrand factor fragment, or subfragment thereof, which contains fewer cysteine residues than that of the comparable non-mutant amino acid sequence, and which process comprises culturing a host organism transformed with a biologically functional expression plasmid which contains a mutant DNA sequence encoding a portion of said von Willebrand factor subunit under conditions which effect expression of the mutant von Willebrand factor fragment, or subfragment, by the host organism and recovering said fragment or subfragment therefrom.

60. A polypeptide produced by the process of Claim 59.

61. A mutant polypeptide patterned upon a parent polypeptide containing a predetermined number of cysteine residues which parent polypeptide further comprises the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 441 (arginine) and ends at approximately residue 733 (valine), or any subset thereof, which mutant polypeptide contains fewer cysteine residues than said predetermined number and which is produced by mutagenesis of a nucleotide sequence coding for the parent polypeptide.

62. A mutant polypeptide according to Claim 61, in which one or more amino acid residues adjacent to a deleted or substituted cysteine position have also been deleted and/or substituted.

63. A process for producing a mutant polypeptide patterned upon a parent polypeptide which parent comprises the sequence of amino acids from approximately residue 441 (arginine) to approximately residue 733 (valine) of mature von Willebrand factor subunit or a subset of said sequence, which mutant polypeptide differs from the parent polypeptide in that one or more of the cysteine residues of said parent are deleted or replaced by one or more amino acid residues chosen from alanine, threonine, serine, glycine or asparagine and which process comprises providing a nucleotide sequence which codes for the parent DNA
sequence, preparing a mutant nucleotide sequence derived therefrom in which one or more of the codons corresponding to the cysteine residues of the parent polypeptide are deleted or mutated, and then culturing a host organism transformed with a biologically functional expression plasmid or viral expression vector which contains said mutant-DNA sequence under conditions which effect expression of the mutant polypeptide by the host organism, and recovering said polypeptide therefrom.

64. A process for producing from DNA corresponding to that fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately residue 441 (arginine) to approximately residue 730 (asparagine), or a subfragment thereof containing one or more of residue positions 459, 462, and 464, a biologically active dimer of said subunit fragment or subfragment which process comprises the steps of:
(A) providing a DNA sequence encoding the subunit fragment or subfragment which contains upstream from the fragment encoding region thereof and in proper reading frame therefor, a signal peptide sequence; and (B) inserting the DNA sequence into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, which construct is capable of directing the expression in, and secretion from, eucaryotic cells of said subunit fragment or subfragment; and (C) transforming a eucaryotic host cell with said expression plasmid or viral expression vector; and (D) culturing said transformed host cell under conditions that cause expression within the host cell and secretion therefrom of the dimeric form of the subunit fragment or subfragment, and under which the monomeric subunit fragment or subfragment assumes a tertiary structure suitable for dimerization and the dimerization thereof, and under which there is effected glycosylation of said monomeric subunit fragment or subfragment or of a dimeric form thereof.

65. A dimeric polypeptide prepared by the process of Claim 64 which is glycosylated and has an apparent molecular weight as measured by SDS-polyacrylamide gel electrophoresis of about 116 kDa.

66. A process for producing from DNA corresponding to that fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately residue 441 (arginine) to approximately residue 730 (asparagine), a biologically active monomer of said subunit fragment having an apparent molecular weight by SDS-polyacrylamide gel electrophoresis of approximately 52 kDa which process comprises the steps of:

(A) providing a DNA sequence encoding the subunit fragment which contains upstream from the fragment encoding region thereof, and in proper reading frame therefor, a signal peptide sequence;
(B) mutagenizing the DNA sequence to reduce the number of cysteine codons capable of specifying cysteine residues normally involved in interchain disulfide contacts;
(C) inserting the DNA sequence into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, said construct being capable of directing the expression in and secretion from eucaryotic cells of said monomeric subunit fragment;
(D) transforming a eucaryotic host cell with said construct; and (E) culturing said transformed host cell under conditions which cause expression within and secretion from said host cell of the monomeric subunit fragment, said conditions also permitting glycosylation of said fragment.

67. A process for producing from DNA corresponding to a fragment or combination of fragments of von Willebrand factor a biologically active polypeptide structure which process comprises the steps of:
(A) providing a DNA sequence encoding the von Willebrand factor fragment or fragments which further contains upstream from the fragment encoding region thereof, and in proper reading frame therefor, a DNA subsequence encoding a polypeptide according to Claim 44;
and (B) inserting the DNA sequence into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, which construct is capable of directing the expression in and secretion from eucaryotic cells of said subunit fragment or fragments; and (C) transforming a eucaryotic host cell with said expression plasmid or viral expression vector; and (D) culturing said transformed host cell under conditions which cause expression within and secretion from the host cell of said polypeptide structure which conditions further permit the glycosylation thereof.

68. A process for producing from DNA a therapeutic polypeptide which process comprises the steps of:
(A) providing a DNA sequence encoding the therapeutic polypeptide and which further contains upstream from the polypeptide encoding region thereof, and in proper reading frame therefor, a DNA sequence corresponding to a polypeptide according to Claim 44; and (B) inserting the resultant DNA sequence into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, which construct is capable of directing the expression in and secretion from eucaryotic cells of said therapeutic polypeptide; and (C) transforming a eucaryotic host cell with said expression plasmid or viral expression vector; and (D) culturing said transformed host cell under conditions which cause expression within and secretion from said host cell of the therapeutic polypeptide.

69. An antibody which is specific for von Willebrand factor subunit, or any polypeptide comprising one or more subsets thereof, which antibody is made by a process of immunizing animals with a polypeptide according to Claim 1 and then isolating the specified antibodies generated thereby.

70. An antibody which is specific for von Willebrand factor subunit, or any polypeptide containing a subset thereof, in which the epitope for said antibody is dependent upon the existence of a disulfide bond between two cysteine residues in said subunit, or in a polypeptide containing a subset of said subunit, which cysteine residues are or are equivalent to subunit residues 509 and 695, and which antibody is made by a process of immunizing animals with a polypeptide according to Claim 4 and then isolating the specified antibodies generated thereby.

71. A therapeutic composition comprising one or more polypeptides according to Claim 1 effective to inhibit binding of von Willebrand Factor to platelets, and a pharmaceutically acceptable carrier.

72. A method of inhibiting platelet activation and/or aggregation which comprises contacting platelets with an effective amount of a composition according to Claim 71.

73. A method of inhibiting adhesion of platelets to surfaces which comprises contacting platelets with an effective amount of a composition according to Claim 71.

74. A method of inhibiting thrombosis in a patient which comprises administering to such patient an effective amount of a composition according to Claim 71.

75. A method of treating von Willebrand disease in a patient comprising administering to such patient an effective amount of a composition according to Claim 65.

76. A polypeptide according to Claim 1 capable of binding to collagen, heparin-like glycosamino-glycans or proteoglycan

77. A mutant polypeptide formed by mutagenesis of a nucleotide sequence encoding all or part of a parent polypeptide, the parent polypeptide comprising a sequence of amino acids having substantial sequence homology with the "A1" domain of von Willebrand factor and further containing a predetermined number of cysteine residues, wherein said mutant polypeptide contains cysteine residues forming an intrachain disulfide bond of the parent polypeptide but fewer cysteines than said predetermined number.

78. A mutant polypeptide formed by mutagenesis of a nucleotide sequence encoding all or part of a parent polypeptide, the parent polypeptide comprising a sequence of amino acids having substantial sequence homology with the "A1" domain of von Willebrand factor, wherein said mutant polypeptide contains one or more additional cysteine residues not found in the parent polypeptide.

79. A process for producing from DNA corresponding to that monomeric fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately residue 441 (arginine) to approximately residue 730 (asparagine), or a subfragment thereof, containing one or more of residue positions 459, 462, and 464, a biologically active dimer of said monomeric fragment or subfragment which process comprises the steps of:
(A) constructing a DNA sequence encoding the monomeric fragment or subfragment which further contains upstream from the fragment encoding region thereof and in proper reading frame therefor, a signal peptide sequence;
(B) inserting the DNA sequence into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, said construct being capable of directing the expression in, and secretion from, eucaryotic cells of said monomeric fragment or subfragment;
(C) transforming a eucaryotic host cell with said construct;
(D) culturing said transformed host cell under conditions that cause expression within the host cell and secretion therefrom of the dimeric form of the monomeric fragment or subfragment and under which the monomeric fragment or subfragment assumes a tertiary structure suitable for the dimerization thereof, and under which there is effected glycosylation of said monomeric subunit fragment or subfragment or of a dimeric form thereof.

80. A mutant polypeptide patterned upon a parent polypeptide which comprises the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 449 (valine) and ends at approximately residue 728 (lysine), or a dimer thereof, from which parent one or more serine, threonine or asparagine residues which are sites of O- or N-linked glycosylation have been deleted or replaced by one or more other amino acids, said mutant polypeptide having less glycosylation when said mutant polypeptide is expressed from recombinant DNA in a host eucaryotic cell than the species of the parent polypeptide having-an apparent molecular weight of 52 kDa, as measured by SDS-polyacrylamide gel electrophoresis.

81. A DNA sequence which encodes a mutant polypeptide according to Claim 80.

82. A method of preventing or treating thrombosis in a patient which comprises administering to such patient an effective amount of a therapeutic composition comprising (A) a pharmaceutically acceptable carrier;
and (B) a polypeptide patterned upon the amino acid sequence from approximately residue 449 (valine) to approximately residue 728 (lysine) of mature von Willebrand factor subunit, which polypeptide contains less glycosylation than that found attached to the 449-728 fragment as isolated from circulating mature vWF, having an apparent molecular weight by SDS-polyacrylamide electrophoresis of 52 kDa.

83. A method of treating hemorrhage in a von Willebrand disease patient which comprises administering to such patient an effective amount of a therapeutic composition comprising (A) a pharmaceutically acceptable carrier;
and (B) a dimeric 116 kDa polypeptide patterned upon the amino acid sequence from approximately residue 449 (valine) to approximately residue 728 (lysine) of mature von Willebrand factor subunit, which dimeric polypeptide contains less glycosylation than that found in the comparable disulfide-bonded sequence region of fully glycosylated circulating mature vWF and/or contains less than the maximum glycosylation of said 116 kDa disulfide-bonded region as determined by Titani, K. et al., Biochemistry, 25, 3171 (1986).

84. A process for treating a eucaryotic host cell, which contains a DNA sequence encoding with respect to mature von Willebrand factor subunit only that fragment thereof comprising approximately residues 449-728, to limit the glycosylation of the vWF fragments, including dimers thereof, expressed therein comprising adding to the culture medium of said host cells tunicamycin in an amount sufficient to limit said glycosylation.

85. A process for treating a polypeptide according to Claim 1 with an enzyme capable of removing from said polypeptide one or more carbohydrate moieties for the purpose of improving the therapeutic potency of the polypeptide which process comprises adding said enzyme to a sample of said polypeptide under conditions which permit sufficient activity of said enzyme.

86. A process for producing from DNA a therapeutic polypeptide comprising:
(A) providing a DNA sequence encoding the therapeutic polypeptide which contains upstream from the therapeutic polypeptide-encoding region thereof, and in proper reading frame therefor, a DNA sequence which itself corresponds to a signal peptide and directly downstream therefrom a semipolar or polar spacer sequence;
(B) inserting the resultant DNA sequence into a suitable vector to create a constant comprising an expression plasmid or viral expression vector which is capable of directing the expression in and secretion from eucaryotic host cells of said therapeutic polypeptide;
(C) transforming a eucaryotic host cell with said constant; and (D) culturing said transformed host cell under conditions which cause expression within and secretion from said host cell of the therapeutic polypeptide.