CA2089495C - Purified thermostable nucleic acid polymerase enzyme from thermotoga maritima - Google Patents

Abstract

A purified thermostable enzyme is derived from the eubacterium Thermotoga maritima, The enzyme has a molecular weight as determined by gel electrophoresis of about 97 kilodaltons and DNA
polymerase I activity. The enzyme can be produced from native or recombinant host cells and can be used with primers and nucleoside triphosphates in a temperature-cycling chain reaction where at least one nucleic acid sequence is amplified in quantity from an existing sequence.

Description

PURIFIED THERMGSTABLE NUCLEIC AC)D POLYMERASE
ENZYME FROM THERMOTOGA MAR)TTMA
Technical Field The present invention relates to a purified, thermostable DNA polymerise ptuified from the hypertherntophilic eubacteria Thermotoea maritime and means for isolating and producing the enzyme. Thermostable DNA polymerises are useful in many recombinant DNA techniques, especially nucleic acid amplification by the polymerise chain reaction (PCR).
Background Art :l0 In Huber et al., 1986, Arch. Microbiol. 144:324-333, the isolation of the bacterium Thermotoaa maritime is described. T. maritime is a eubacterium that is strictly anaerobic, rod-shaped, fermentative, hyperthermophilic, and grows between 55'C and 90'C, with an optimum growth temperature of about 80'C. This eubacterium has been isolated from geothetmally heated sea floors in Italy and the Azores.
~.
'.5 maritime cells have a sheath-like structure and monotrichous flagellation.
T. maritime is classified in the eubacterial kingdom by virtue of having murein and fatty acid-containing lipids, diphtheria-toxin-resistant elongation factor 2, an RNA
polymerise subunit pattern, and sensitivity to antibiotics.
Extensive research his bY.en conducted on the isolation of DNA polymerises a!0 from mesophilic microorganisms such as ~. ~l_i. See, for example, Bessman gl ~., 1957, ,~. i 1. Chem. x:171-177, and Buttin and Kornberg, 1966, ~. Biol. h m.
241:5419-5427. Much less investigation has been made on the isolation and purification of DNA polymerises Trom thermophiles such as Thermotoia maritime.
In Kaledin et al., 1980, Biokhymiv~~ 45:644-651, a six-step isolation and enrichment ~:5 procedure for DNA polymerise activity from cells of a Thermus aquaticus YT-1 strain is disclosed. These steps involve: isolation of crude extract, DEAF-cellulose chromatography, fractionation on hydroxyapatite, fractionation on DEAF-cellulose, and chromatography on single-strand DNA-cellulose. The molecular weight of the purified enzyme is reported by Kaledin e_~, al. as 62,000 daltons per monomeric unit.
30 A second enrichment scheme for a polymerise from Thermus a~uaticus is described in Chien et al., 1976, ~~. Bacteriol. 127:1550-1557. In this process, the crude extract is applied to a DEAF-Sephadex column. The dialyzed pooled fractions are then subjected to treatment on a phosphocellulose column. The pooled fractions are dialyzed, and bovine serum albumin (BSA) is added to prevent loss of polymerise 35 activity. The resulting mixture is loaded on a DNA-cellulose column. The pooled material from the column is dialyzed. The molecular weight of the purified protein is reported to be about 63,000 daltons to 68,000 daltons.
*Trade-mark The use of thermostable enzymes, such as those described in Chien gt al. and Kaledin et a_l., to amplify existing nucleic acid sequences in amounts that are large compared to the amount initially present is described in U.S. Patent Nos.
4,683,195;
4,683,202; and 4,965,188, which describe the PCR process. Primers, template, nucleoside triphosphates, the appropriate buffer and reaction conditions, and polymerise are used in the PCR process, which involves denaturation of target DNA, hybridization of primers, and synthesis of complementary strands. The extension product of each primer becomes a template for the production of the desired nucleic acid sequence.
The patents disclose that, if the polymerise employed is a thermostable enzyme, then polymerise need not be added after every denaturation step, because heat will not destroy the polymerise activity.
U.S. Patent No. 4,889,818, European Patent Publication No. 258,017, and PCT
Publication No. 89/06691 describe the isolation and recombinant expression of an 1~
-94 kDa thermostable DNA polymerise from Thermus aquaticus and the use of that pvlymerase in PCR. Although ~. aauaticus DNA polymerise is especially preferred for use in PCR and other recombinant DNA techniques, there remains a need for other thermostable polymerises.
-- 20 Accordingly, there is a desire in the art to produce a purified, thermostable DNA-polymerase that may be used to improve the PCR process described above and to improve the results obtained when using a thermostable DNA polymerise in other recombinant techniques, such as DNA sequencing, nick-translation, and even reverse transcription. The present invention helps meet that need by providing recombinant 25 expression vectors and purification protocols for ThermotoQa ~ritima DNA
polymerise.
j~isclosure of Invention The present invention provides a purified thermostable DNA polymerise I
enzyme that catalyzes combination of nucleoside triphosphates to form a nucleic acid 30 strand complementary to a nucleic acid template strand. The purified enzyme is the DNA polymerise I from ~Tnotoea, ~j, 'rte Cue) and has a molecular weight of about 97 kilodaltons (kDa) as measured by SDS-PAGE and an inferred molecular weight, from the nucleotide sequence of the ~ DNA polymerise gene, of 102 lcDa.
This purified material may be used in PCR to produce a given nucleic acid sequence in 35 amounts that are large compared to the amount initially present so that the sequences can be manipulated and/or analyzed easily.

2a The invention provides a thermostable DNA polymerise enzyme having a molecular weight between about 97 and 103 kilodaltons that catalyzes the combination of nucleoside triphosphates to form a nucleic acid strand complementary to a nucleic acid template strand, wherein said enzyme is derived from the eubacterium Thermotoga maritima, has 3' to 5' exonuclease activity and has an optimum temperature at which it functions that is higher than about 60°C.
The gene encoding Tma DNA polymerise enzyme from Thermotosa maritima has also been identified, cloned, sequenced, and expressed at high level and provides yet another means w prepare the thermostable enzyme of the present invention.
In addition to the intact gene and the coding sequence for the enzyme, derivatives of the coding sequence for DNA polymerise are also provided.
The invention also encompasses a stable enzyme composition comprising a purified, thermostable ~, enzyme as described above in a buffer containing one or more non-ionic polymeric detergents.
Finally, the invention provides a method of purification for the thermostable polymerise of the invention. This method involves preparing a crude extract from fir. .maritima cells, adjusting the ionic strength of the crude extract so that the DNA polymerise dissociates from nucleic acid in the extract, subjecting the extract to hydrophobic interaction chromatography, subjecting the extract to DNA binding protein affinity chromatography, and subjecting the extract to canon or anion exchange or hydroxyapatite chromatography. In a preferred embodiment, these steps are performed sequentially in the order given above. The nucleotide binding protein affinity chromatography step is preferred for separating the DNA polymerise from endonuclease proteins.
Modes for Carrvine out the Invention The present invention provides DNA sequences and expression vectors that encode Tma DNA polymerise, purification protocols for Tma DNA polymerise, preparations of purified ~n DNA polymerise, and methods for using ~ DNA
polymerise. To facilitate understanding of the invention, a number of terms are defined below.
The terms "cell," "cell line," and "cell culture" are used interchangeably and all such designations include progeny. Thus, the words "transformants" or "transformed cells" include the primary transformed cell and cultures derived from that cell without regard to the number of transfers. All progeny may not be precisely identical in DNA
content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.
The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular bast organism. The control sequences that are suitable for procaryotes, for example, include a promoter, optionally an operator sequence, a ribosome binding site, and possibly other sequences, such as transcription termination sequences. Eucaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
The term "expression system" refers to DNA sequences containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins. To effect transformation, the expression system may be included on a vector; the relevant DNA
can also be integrated into the host chromosome.
The term "gene" refers. to a DNA sequence that codes for the expression of a recoverable bioactive polypeptide or precursor. Thus, the Tma DNA polymerise gene includes the promoter and Tma DNA polymerise coding sequence. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired enzymatic activity is retained.
The term "operably lir~l:ed" refers to the positioning of the coding sequence such that control sequences will function to drive expression of the encoded protein.
Thus, a coding sequence "operably linked" to a control sequence refers to a configuration wherein the coding sequence can be expressed under the direction of the control sequence.
The term "mixture" as it relates to mixtures containing Tma polymerise refers to a collection of materials that includes Tma polymerise but can also include other proteins. If the Tma polymerise is derived from recombinant host cells, the other proteins will ordinarily be those associated with the host. Where the host is bacterial, the contaminating proteins will be bacterial proteins.
The term "non-ionic polymeric detergents" refers to surface-active agents that have no ionic charge and that are characterized, for purposes of this invention, by an ability to stabilize the Tma enzyme at a pH range of from about 3.5 to about 9.5, preferably from 4 to 8.5. Nurnero~us examples of suitable non-ionic polymeric detergents are presented elsewhere.
The term "oligonucleotide" as used herein is defined as a molecule comprised of 2~ two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be derived synthetically or by cloning.
The term "primer" as 'used herein refers to an oligonucleotide that is capable of ~0 acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide "primer" may occur naturally, as in a purified restriction digest, or be produced synthetically. Synthesis of a primer extension product that is complementary to a nucleic acid strand is initiated in the presence of four different nucleoside triphosphates and the Tma thermostable enzyme in 3~ an appropriate buffer at a suitable temperature. A "buffer" includes cofactors (such as divalent metal ions) and salt (to provide tl:e appropriate ionic strength), adjusted to the desired pH. For Tma polyme:ras°, the buffer preferably contains 1 to 3 mM of a magnesium salt, preferably NyCI~, 50 to 200 ~tM of each nucleoside triphosphate, and 0.2 to 1 ~tM of each primer. along with ~0 mM KC1, 10 mM Tris buffer (pH 8.0-8.4j, W~ 92/03556 2 p ~ 9 4 9 ~ PCT/US91/05753 and 100 ~tg/ml gelatin (although gelatin is not required and should be avoided in some applications, such as DNA sequencing).
The primer is single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to 5 separate its strands before being used to prepare extension products. The primer is usually an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerise enzyme. The exact length of a primer will depend on many factors, such as source of primer and result desired, and the reaction temperature must be adjusted depending on primer length to ensure proper annealing of primer to template. Depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15 to 35 nucleotides.
Short primer molecules generally require cooler temperatures to form sufficiently stable complexes with template.
A primer is selected to be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to -ybridize with a template strand for primer elongation to occur. A primer sequence need not wflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-compleme ary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template/primer complex for synthesis of the extension product of the primer.
The terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes that cut double-stranded DNA at or near a specific nucleotide sequence.
The term "therrnostable enzyme" refers to an enzyme which is stable to heat and is heat resistant and catalyzes (facilitates) combination of the nucleotides in the proper manner to form primer extension products that are complementary to a nucleic acid strand. Generally, synthesis of a primer extension product begins at the 3' end of the primer and proceeds towards the 5' end of the template strand until synthesis terminates. A thermostable enzyme must be able to renature and regain activity after brief (i.e., 5 to 30 seconds) exposure to temperatures of 80°C to 105°C and must have a temperature optimum of above 60°C.
The ~ thermostable DNA polymerise enzyme of the present invention satisfies the requirements for effective use in the amplification reaction known as the polymerise chain reaction or PCR. The Tma DNA polymerise enzyme does not become irreversibly denatured (inactivated) when subjected to the elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids, a key step ~ 92/03556 PCT/US91/05753 . ,,.. 2 0 8 9 4 9 5 _ in the PCR process. Irreversible denaturation of an enzyme for purposes herein refers to permanent and complete loss of enzymatic activity.
The hearing conditions necessary to .effect nucleic acid denaturation will depend, e.g., on the buffer salt concentration and the composition, length, and amount of the S nucleic acids being denatured, but typically the denaturation temperature ranges from about 80'C to about 105'C for a few seconds to minutes. Higher temperatures may be required for nucleic acid denaturation as the buffer salt concentration and/or GC
composition of the nucleic acid is increased. The Tma enzyme does not become irreversibly denatured upon relatively short exposures to temperatures of about 80'C-lOS'C.
The ~ thermostable enzyme has an optimum tempezature at which it functions that is higher than about 60'C. Temperatures below 60'C facilitate hybridization of primer to template, but depending on salt composition and concentration and primer composition and length, hybridization of primer to template I5 can occur at higher temperatures (e.g., 60'G-80'C), which may promote specificity of the primer elongation reaction. The higher the temperature optimum for the enzyme, the greater the specificity and/or selectivity of the primer-directed extension process.
The ~ enzyme exhibits activity over a broad temperature range from about 45'C
to 90'C; a preferred optimum temperature is 7S'C-80'C.
-- - 20 The present invention also provides DNA sequences encoding the thermostable DNA polymerise I activity of ~ermotoQa gtaritima. The amino acid sequence encoded by this sequence has homology to portions of the thermostable DNA polymerises of Thermus ~ and Thermus thermoRhilus. The complete coding sequence, from the S'-ATG start codon to the TGA-3' stop codon, of the Tma DNA polymerise gene is 2S depicted below and listed as SEQ ID NO: 1. The sequence is numbered for reference.

601 GAAA~.GACTG CTGTTCAGCT TCTAGAGAAG TACAAAGACC TCGAAGACAT
B

W~ O 92/03556 '~ ~ ~ ~ ~ ~ ~ PGT/U891/05753 951 CCCTTCGTTCGCCATAGATCTTGAGACGTCTTCCCTCGATC :TTCGACT

lO 1101 GAAAAAGCTCAAAGAAATTCTGGAGGACCCCGGAGCAAAGATCGTTGGTC

?,S 1851 AAAGACCGGAAGGATTCATGCTTCTTTCAATCAAACGGGGACTGCCACTG

W0~2/03556 2 0 8 9 4 9 5 _ PCT/US91/05753 CATCGGCAAA ACaTGGTCGT
Ga Both the complete ing sequence of the cod Tma DNA polymerise gcnc and the encoded amino acid sequence in three letter abbreviation are provided. For convenience, the amino acid sequence encoded by the Tma DNA
polymerise gene sequence is also depicted below in one letter abbreviation from amino-terminus to carboxy-terminus;
the sequence is numbered for reference.

40i VPPYFDTMIA AYLLEPNEKK FNLDDLALKF LGYKMTSYQE LMSFSFPLFG

501 NVLARMELNG VYVDTEFLKK LSEEYGKKLE ~LAEEIYRIA GEPFNINSPK

v01 QKLKSTYIDA LPKMVNPKTG RIHASFNQTG TATGRLSSSD PNLQNLPTKS

651 EEGKEIRKAI VPQDPNWWIV SADYSQIELR ILAHLSGDEN LyRAFEEGID

The one letter abbreviations for the amino acids are shown below for convenience.

F - Phenylalanine H - Histidine L - Leucine Q - Glutamine I - Isoleucine N - Asparagine M - Methionine K - Lysine V - Valine D - Aspartic Acid S - Serine E - Glutamic Acid P - Proline C - Cysteine T - Threonine W - Tryptophan A - Alanine R _ Arginine Y - Tyrosine G - Glycine The coding sequ ence for Tma DNA polymerise I was identified by a "dcgenerate primer"
method that has broad utility and is an important aspcct of the present invention.degenerate primer method, In the DNA fragments of any B

thermostable polymerise coding sequence corresponding to conserved domains of known thetmostable DNA polymerises can be identified.
In one embodiment of the degenerate primer method, the corresponding conserved domains are from the coding sequences for and amino acid sequences of the thermostable DNA polymerises of ~, ~, and ~. The degenerate primer method was developed by comparing the amino acid sequences of DNA polymerise I
proteins from ~,q,, ~, T7, and ~. ~ in which various conserved regions were identified.
Primers corresponding to these conserved regions were then designed. As a result of the present invention, sequences can be used to design other degenerate primers.
The generic utility of the degenerate primer process is exemplified herein by specific reference to the method as applied to cloning the gene.
To clone the r~ DNA polymerise I gene, the conserved amino acid sequences were converted to all of the possible colons for each of the amino acids. Due to the degenerate nature of the genetic code, a given amino acid may be represented by several different colons. Where more than one base can be present in a colon for a given amino acid, the sequence is said to be degenerate.
The primers were then synthesized as a pool of all of the possible DNA
sequences that could code for a given amino acid sequence. The amount of degeneracy of a given primer pool can be determined by multiplying the number of possible nucleotides at each position.
The more degenerate a primer pool, (i.e., the greater the number of individual unique primer DNA sequences within the pool), the greater the probability that one of the unique primer sequences will bind to regions of the target chromosomal DNA
other than the one desired -- hence, the lesser the specificity of the resulting amplification.
To increase the specificity of the amplification using the degenerate primers, the pools are synthesized is subsets such that the entire group of subsets includes all possible DNA sequences encoding the given amino acid sequence, but each individual subset only includes a portion: for example, one pool may contain either a G or C it a particular position while the other contains either an A or T at the same position. Each of these subpools is designated with a DG number.
Both forward primers (directed from the 5' region toward the 3' region of the gene, complementary to the noncoding strand) and reverse primers (directed from the 3' region toward the 5' region of the gene, complementary to the coding strand) were designed for most of these conserved regions to clone polymerise. The primers were designed with restriction sites at the 5' ends to facilitate cloning. The forward primers contained a III restriction site (AGATCT), while the reverse primers contained an SRI restriction site (GAATTC). In addition, the primers contained nucleotides at the S' end to increase the efficiency of cutting at the restriction site.

WO 92/03556 ~ ~ ~ ~ ~ ~ ~ PCT/US91/05753 Degenerate primers were then used in PCR processes in which the target nucleic acid was chromosomal DNA from Thermotoga maritima. The products of the PCR
processes using a combination of forward and reverse primer pools in conjunction with a series of temperature profiles were compared. When specific products of similar size 5 to the product generated using ~ chromosomal DNA were produced, the PCR
fragments were gel purified, reamplified and cloned into the vector BSM13H3:BgIII (a derivative of the Stratagene vector pBSM+ in which the Hin site of pBSM+ was converted to a Bgl_II site). Sequences were identified as potential thetmostable DNA
polymerise coding sequences if the sequences were found to encode amino acid 10 sequences homologous to other known amino acid sequences in polymerise proteins, particularly those of ~ polymerise and ~1 polymerise.
The portions of the Tma DNA polymerise gene were then identified in the chromosomal DNA of Thermotoea maritima by Southern blot analysis. The Tma chromosomal DNA was digested with a variety of enzymes and transferred to nitrocellulose filters. Probes labeled with 32P or biotin-dUTP were generated for various regions of the gene from the cloned PCR products. The probes were hybridized to the nitrocellulose-bound genomic DNA, allowing identification of the size of the chromosomal DNA fragment hybridizing to the probe. The use of probes covering the 5' and 3' regions of the gene ensures that the DNA fragments) contain most if not all of the structural gene for the polymerise. Restriction enzymes are identified that can be used to produce fragments that contain the structural gene in a single DNA fragment or in several DNA fragments to facilitate cloning.
Once identified, the chromosomal DNA fragments encoding the ~,a DNA
polymerise gene were cloned. Chromosomal DNA was digested with the identified restriction enzyme and size fractionated. Fractions containing the desired size range were concentrated, desalted, and cloned into the BSM13H3:BgIII cloning vector.
Clones were identified by hybridization using labeled probes generated from the previous cloned PCR products. The PCR products were then analyzed on polyacrylamide gels.
The DNA sequence and amino acid sequence shown above and the DNA
compounds that encode those sequences can be used to design and construct recombinant DNA expression vectors to drive expression of Tma DNA polymerise activity in a wide variety of host cells: A DNA compound encoding all or part of the DNA sequence shown above can also be used as a probe to identify thermostable polymerise-encoding DNA from other organisms, and the amino acid sequence shown above can be used to design peptides for use as immunogens to prepare antibodies that can be used to identify and purify a thermostable polymerise.
Whether produced by recombinant vectors that encode the above amino acid sequence or by native Thermotosa maritima cells, however, Tma DNA polymerise will W~2/03556 ~ ~ ~ PCT/US91/05753 typically be purified prior to use in a recombinant DNA technique. The present invention provides such purification methodology.
For recovering the native protein, the cells are grown using any suitable technique. Briefly, the cells are grown in "MMS"-medium containing (per liter): NaCI
(6.93 g); MgS04-7H20 ( 1.75 g); MgCl2-6H20 ( 1.38 g); KCl (0.16 g); NaBr (25 mg);
H3B03 (7.5 mg); SrC12,6H20 (3.8 mg); KI (0.025 mg); CaCl2 (0.38 g); KH2P04 (0.5 g); Na2S (0.5 g); (NH4)2Ni(S04)2 (2 mg); trace minerals (Batch ~ ~1., 1979, Mi i 1. Rev. 4:260-296) (15 ml); resazurin (1 mg); and starch (5 g) at a pH of 6.5 (adjusted with H2S04). For growth on solid medium, 0.8% agar (Oxoid) may be added to the medium. Reasonab:~ growth of the cells also occurs in "SME"-medium (Stetter gl ~., 1983, ~I. ~. Microbj~. 4_:535-S51) supplemented with 0.5%
yeast extract, or in marine broth (Difco 2216).
After cell growth, the isolation and purification of the enzyme takes place in six stages, each of which is carried out at a temperature below room temperature, preferably about 0'C to about 4'C, unless stated otherwise. In the first stage or step, the cells, if frozen, are thawed, lysed in an Aminco french pressure cell (8-20,000 psi), suspended in a buffer at about pH 7.5, and sonicated to reduce viscosity.
In the second stage, ammonium sulfate is added to the lysate to prevent the Tma DNA polymerise from binding to DNA or other cell lysate proteins. Also in the second_ stage, Polymin l~polyethyleneimine, PEI) is added to the lysate to precipitate nucleic acids, and the lysate is centrifuged.
In the third step, ammonium sulfate is added to the su- ~tatant, and the supernatant is loaded onto a phenyl sepharose column equilibrated with a buffer composed of TE (50 mM Tris-Cl, pH 7.5, and 1 mM EDTA) containing 0.3 M
ammonium sulfate and 0.5 mM DTT (dithiothreitol). The column is then washed first with the same buffer, second with TE-DTT (without ammonium sulfate), third with ethylene glycol-TE-DTT, end finally with 2 M urea in TE-DTT containing ethylene glycol. Unless the capacity of the phenylsepharose is exceeded (i.e. by loading more than 20-30 mg of protein per ml of resin) all of the ~ polymerise activity is retained by the column and elutes with the 2 M urea in TE-DTT containing ethylene glycol.
In the fourth stage, the urea eluate is applied to a heparin sepharose colutnrt which is equilibrated with 0.08 M KCI, 50 mM Tris-CI (pH 7.5), 0.1 mM EDTA, 0.2% Tween 20 a d 0.5 mM DTT. The column is then washed in the same buffer and the enzyme eluted with a linear gradient of 0.08 M to 0.5 M KCl buffer. The peak activity .fractions were found at 0.225 M to 0.275 M KCI.
In the fifth stage, the fraction collected in the fourth stage is diluted with affigel-blue buffer without KCl and applied to an affigel-blue column equilibrated in 25 mM
Tris-Cl (pH 7.5), 0.1 mM EDTA, 0.2% Tween 20, 0.5 mM DTT, and 0.15 M KCI.
The column is washed with the same buffer and eluted with a linear gradient of 0.15 M
B

WO 92/03556 PGT/US91/05753~
2~~9495' to 0.7 M KCl in the same buffer. The peak activity fractions were found at the 0.3 M
to 0.55 M KCl section of the gradient. These fractions of peak activity are then tested for contaminating deoxyribonucleases (endonucleases and exonucleases) using any suitable procedure. As an example, endonuclease activity may be determined electrophoretically from the change in molecular weight of phage ~, DNA or supercoiled plasmid DNA after incubation with an excess of DNA polymerise. Similarly, exonuclease activity may be determined electrophoretically from the change in molecular weight of restriction enzyme digested DNA after incubation with an excess of DNA polymerise. The fractions that have no deoxyribonuclease activity are pooled and diafiltered into phosphocellulose buffer containing 50 mM KCI.
Finally, in a sixth stage, the diafiltered pool from stage five is loaded onto a phosphocellulose column equilibrated to the correct pH and ionic strength of 25 mM
Tris-Cl (pH 7.5), 50 mM KCI, 0.1 mM EDTA, 0.2% Tween 20, and 0.5 mM DTT.
The column is then washed with the same buffer and eluted with a linear 0.05 M
to 0.5 M KCl gradient. The peak fractions eluted between 0.215 M and 0.31 M KCI. An undegraded, purified DNA polymerise from these fractions is evidenced by an unchanged migration pattern in an ~ ~ activity gel.
The molecular weight of the DNA polymerise purified from Thermotogg may be determined by any technique, for example, by SDS-PAGE analysis using protein molecular weight markers or by calculation from the coding sequence.
The molecular weight of the DNA polymerise purified from ermotogg maritima is determined by SDS-PAGE to be about 97 kDa. Based on the predicted amino acid sequence, the molecular weight is estimated at about 102 kDa. The purification protocol of native Tma DNA polymerise is described in more detail in Example 1.
Purification of the recombinant Tma polymerise of the invention can be canted out with similar methodology.
Biologically active recombinant Tma polymerises of various molecular weights can be prepared by the methods and vectors of the present invention. Even when the complete coding sequence of the ~ DNA polymerise gene is present in an expression vector in _E. coli, the cells produce a truncated polymerise, formed by translation starting with the methionine codon at position 140. One can also use recombinant means to produce a truncated polymerise corresponding to the protein produced by initiating translation at the methionine codon at position 284 of the coding sequence. The polymerise lacking amino acids 1 though 139 (about 86 kDa), and the polymerise lacking amino acids 1 through 283 (about 70 kDa) of the wild type Tma polymerise retain polymerise activity but have attenuated 5'--~3' exonuclease activity. In addition, the 70 kDa polymerise is significantly more thermostable than native Tma polymerise.

WO 92/03556 ~ ~ ~ ~ ~ ~ ~ PGT/US91/05753 Thus, the entire sequence of the intact DNA polymerise I enzyme is not required for activity. Portions of the DNA polymerise I coding sequence can be used in recombinant DNA techniques to produce a biologically active gene product with DNA polymerise activity. The availability of DNA encoding the DNA polymerise sequence provides the opportunity to modify the coding sequence so as to generate mutein (mutant protein) forms also having DNA polymerise activity. The amino(N)-terminal portion of the Tma polymea~ase is not necessary for polymerise activity but rather encodes the 5'-~3' exonucleasc activity of the protein. Using recombinant DNA
methodology, one can delete approximately up to one-third of the N-terminal coding sequence of the ~ gene, clone, and express a gene product that is quite active in polymerise assays but, depending on the extent of the deletion, has no 5'~3' exonuclease activity. Because certain N-terminal shortened forms of the polymerise are active, the gene constructs used for expression of these polymerises can include the corresponding shortened forms of the coding sequence.
In addition to the N-terminal deletions, individual amino acid residues in the peptide chain of ~ polymerise may be modified by oxidation, reduction, or other derivation, and the protein may be cleaved to obt: s fragments that retain activity. Such alterations that do not destroy activity do not rem::ve the protein from the definition of a protein with Tma polymerise activity and so are specifically included within the scope of the present invention.
Modifications to the primary structure of the ~n DNA polymerise coding sequence by deletion, addition, or alteration so as to change the amino acids incorporated into the ~ DNA polymerise during translation of the mRNA produced from that coding sequence can be made without destroying the high temperature DNA
polymerise activity of the protein. Such substitutions or other alterations result in the production of proteins having an amino acid sequence encoded by DNA falling within the contemplated scope of the present invention. Likewise, the cloned genomic sequence, or homologous synthetic sequences, of the ~ DNA polymerise gene can be used to express a fusion polypeptide with ~ DNA polymerise activity or to express a protein with an amino acid sequence identical to that of native Tma DNA
polymerise. In addition, such expression can be directed by the Tma DNA
polymerise gene control sequences or by a control sequence that functions in whatever host is chosen to express the Tma DNA polymerise.
Thus, the present invention provides a coding sequence for ~ DNA
polymerise from which expression vectors applicable to a variety of host systems can be constructed and the coding sequence expressed. Portions of the polymerase-encoding sequence are also useful as probes to retrieve other thern~ostable polymerase-encoding sequences in a variety of species. Accordingly, oligonucleotide probes that encode at least four to six amino acids can be synthesized and used to retrieve additional 2~~9~9~

DNAs encoding a thetmostable polymerise. Because there may not be an exact match between the nucleotide sequence of the thermostable DNA polymerise gene of ThermotoQa maritima and the corresponding gone of other species, oligomers containing approximately 12-18 nucleotides (encoding the four to six amino sequence) are usually necessary to obtain hybridization under conditions of sufficient stringency to eliminate false positives. Sequences.cncoding six amino acids supply ample information for such probes. Such oligonucleotide probes can be used as primers in the degenerate priming method of the invention to obtain thermostable polymerise encoding sequences.
The present invention, by providing coding sequences and amino acid sequences for Tma DNA polymerise, therefore enables the isolation of other thermostable polymerise enzymes and the coding sequences for those enzymes.
The amino acid sequence of the Tma DNA polymerise I protein is very similar to the amino acid sequences for the thermostable DNA polymerises of T~ and T~h. These similarities facilitated the identification and isolation of the Tma DNA
polymerise coding sequence. The areas of similarity in the coding sequences of these three thermostable DNA polymerises can be readily observed by aligning the sequences.
However, regions of dissimilarity between the coding sequences of the three thermostable DNA polymerises can also be used as probes to identify other thermostable polymerise coding sequences that encode thermostable polymerise enzymes. For example, the coding sequence for a thermostable polymerise having some properties of ~ and other divergent properties of ~ may be identified by using probes directed to sequences that encode the regions of dissimilarity between ~
-wand Tma. Specifically, such regions include a stretch of four or more contiguous ~3~ amino acids from any one or more of the following regions, identified by amino acid sequence coordinates (numbering is inclusive): 5-10, 73-79, 113-119, 134-145, 191-196, 328-340, 348-352, 382-387, 405-414, 467-470, 495-499, 506-512, 555-559, 579-584, 595-599, 650-655, 732-742, 820-825, 850-856. These regions may be considered as "hallmark motifs" and define additional regions of critical amino acid signature sequences for thermostable DNA polymerise functions (e.g. 5'-~3' E exonuclease activity, 3'~5' exonuclease activity, and DNA polymerise activity).
One property found in the Tma DNA polymerise, but lacking in native DNA polymerise and native T~h DNA polymerise, is 3'-~5' exonuclease activity.
This 3'-~5' exonuclease activity is generally considered to be desirable, because misincorporated or unmatched bases of the synthesized nucleic acid sequence are eliminated by this activity. Therefore, the fidelity of PCR utilizing a polymerise with 3'-~5' exonuclease activity (e.g. Tma DNA polymerise) is increased. The 3'~5' exonuclease activity found in rr DNA polymerise also decreases the probability of the formation of primer/dimer complexes in PCR. The 3'~5' exonuclease activity in WO 92/03556 ~ p ~ ~ ~ ~ ~ PGT/US91/05753 effect prevents any extra dNTPs from attaching to the 3' end of the primer in a non-template dependent fashion by removing any nucleotide that is attached in a non-template dependent fashion. The 3'--~5' exonuclease activity can eliminate single-stranded DNAs, such as primers or single-stranded template. In essence, every 3'-5 nucleotide of a single-stranded primer or template is treated by the enryme as unmatched and is therefore degraded. To avoid primer degradation in PCR, one can add phosphorothioate to the 3' ends of the primers. Phosphorothioate modified nucleotides are more resistant to removal by 3'-~5' exonucleases.
A "motif' or characteristic "signature sequence" of amino acids critical for 10 3'-~5' exonuclease activity in thercnostable DNA polymerises can ~~e defincd as comprising three short domains. Below, these domains are identified as A, B, and C, with critical amino acid residues shown in one letter abbreviation and non-critical residues identified as "x."
Representative 15 Domain S~uence Tma Coordinates A DxExxxL 323-329 B NxxxDxxxL 385-393 C YxxxD 464-468 The distance between region A and region B is 55-65 amino acids. The distance between region B and region C is 67-75 amino acids, preferably about 70 amino acids.
In ~ DNA polymerise, the amino acids that do not define the critical motif signature sequence amino acids are L and TSS, respectively, in domain A; LKF and YKV, respectively, in domain B; and SCE in domain C. Domain A is therefore DLETSSL;
domain B is NLKFDYKVL; and domain C is YSCED in Tma DNA polymerise I.
Thus, the present invention provides a thenmostable DNA polymerise possessing 3'~5' exonuclease activity that comprises domains A, B, and C, and, more particularly comprises the sequence D-X-E-X3-L-Xss-bs_N-X3-D_x3-L-X6s-~s-y_X3_ D, where one letter amino acid abbreviation is used, and XN represents the'number (N) of non-critical amino acids between the specified amino acids.
- A thermostable 3'-~5' exonuclease domain is represented by amino acids 291 through 484 of Tma DNA polymerise. Accordingly, "domain shuffling" or construction of "therrnostable chimeric DNA polymerises" may be used to provide thermostable DNA polymerises containing novel properties. For example, substitution of the DNA polymerise coding sequence comprising colons about 291 through about 484 for the Thermos ~,aticus DNA polymerise I colons 289-422 would yield a novel thermostable DNA polymerise containing the 5'-~3' exonuclease domain of ~ DNA polymerise ( 1-289), the 3'-~5' exonuclease domain of ~ DNA
polymerise (291-484), and the DNA polymerise domain of T~ DNA polymerise (423-832). Alternatively, the 5'~3' exonuclease domain and the 3'~5' exonuclease WO 92/03556 2, ~ ~ ~ ~ ~ ~ PCT/US91/05753 domain of ~ DNA polymerise (ca. codons 1-484) may be fused to the DNA
polymerise (dNTP binding and primer/template binding domains) portions of DNA polymerise (ca. codons 423-832). The donors and recipients need not be limited to ~ and ~n DNA polymerises. ~ DNA polymerise provides analogous domains as ~ DNA polymerise. In addition, the enhanced/preferred reverse transcriptase properties of T~h DNA polymerise can be further enhanced by the addition of a 3'~S' exonuclease domain as illustrated above.
While any of a variety of means may be used to generate chimeric DNA
polymerise coding sequences (possessing novel properties), a preferred method employs "overlap" PCR. In this method, the intended junction sequence is designed into the PCR primers (at their 5'-ends). Following the initial amplification of the individual domains, the various products are diluted (ca. 100 to 1000-fold) and combined, denatured, annealed, extended, and then the final forward and reverse primers are added for an otherwise standard PCR.
Thus, the sequence that codes for the 3'~5' exonuclease activity of Tma DNA
polymerise can be removed from Tma DNA polymerise or added to other polymerises that lack this activity by recombinant DNA methodology. One can even replace, in a non-thermostable DNA polymerise, the 3'~5' exonuclease activity domain with the thermostable 3'-~5' exonuclease domain of Tma polymerise. Likewise, the 3'-~5' exonuclease activity domain of a non-thermostable DNA polymerise can be used to replace the 3'-~5' exonuclease domain of Tma polymerise (or any other thermostable polymerise) to create a useful polymerise of the invention. Those of skill in the art recognize that the above chimeric polymerises are most easily constructed by recombinant DNA techniques. Similar chimeric polymerises can be constructed by moving the 5'~3' exonuclease domain of one DNA polymerise to another.
Whether one desires to produce an enzyme identical to native Tma DNA
polymerise or a derivative or homologue of that enzyme, the production of a recombinant forni of Tma polymerise typically involves the construction of an expression vector, the transformation of a host cell with the vector, and culture of the transformed host cell under conditions such that expression will occur.
To construct the expression vector, a DNA is obtained that encodes the mature (used here to include all chimeras or muteins) enzyme or a fusion of the Tma polymerise to an additional sequence that does not destroy activity or to an additional sequence cleavable under controlled conditions (such as treatment with peptidase) to give an active protein. The coding sequence is then placed in operable linkage with suitable control sequences in an expression vector. The vector can be designed to replicate autonomously in the host cell or to integrate into the chromosomal DNA of the host cell. The vector is used to transform a suitable host, and the transformed host is cultured under conditions suitable for expression of recombinant Tma polymerise. The WO 92/03556 2 ~ ~ I~ ~ (~ ~C PGT/US91/05753 r~ polymerase is isolated from the w:. :;,hum or from the cells, although recovery and purification of the protein may not be necessary in some instances.
Each of the foregoing steps can be done in a variety of ways. For example, the desired coding sequence may be obtained from genomic fragments and used directly in appropriate hosts. The construction for pression vectors operable in a variety of hosts is made using appropriate replicons and control sequences, as set forth generally below. Construction of suitable vectors containing the desired coding and control sequences employs standard ligation and restriction techniques that arc well understood in the art. Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, modified, and religated in the form desired. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to facilitate construction of an expression vector, as exemplified below.
Site-specific DNA cleavage is performed by treating with suitable restriction enzyme (or enzymes) under conditions that are generally understood in the art and specified ~y the manufacturers of commercially available restriction enzymes.
See, e.g., New England Biolabs, Product Catalog. In gew. -a1, about 1 ~.g of plasmid or other DNA is cleaved by one unit of enzyme in about .~0 N.1 of buffer solution; in the examples below, an excess of restriction enzyme is generally used to ensure complete digestion of the DNA. Incubation times of about one to two hours at about 3'°C are typical, although variations can be tolerated. After each incubation, protein i~ ~~emoved by extraction with phenol and chloroform; this extraction can be followed by ether extraction and recovery of the DNA from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques.
See, e.g., Methods in Enz~molo_gv, 1980, X5:499-560.
Restriction-cleaved fragments with single-strand "overhanging" termini can be made blunt-ended (double-strand ends) by treating with the large fragment of ~. ~i DNA polymerase I (Klenow) in the presence of the four deoxynucleoside triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20°C to 25°C in 50 mM
Tris pH 7.6, 50 mM NaCI, 10 mM MgCl2, 10 mM DTT, and 5 to 10 ItM dN'TPs. The Klenow fragment fills in at 5' protruding ends, but chews back protruding 3' single strands, even though the four dNTPs are present. If desired, selective repair can be performed by supplying only one of the, or selected, dNTPs within the limitations dictated by the nature of the protruding ends. After treatment with HIenow, the mixture is extracted with phenol/chloroform and ethanol precipitated. Similar results can be achieved using S 1 nuclease, because treatment under appropriate conditions with S 1 nuclease results in hydrolysis of any single-stranded portion of a nucleic acid.
Synthetic oligonucleotides can be prepared using the triester method of Matteucci ~t ~1., 1981, J. Am. hem. o~. 103:3185-3191, or automated synthesis 2089~9~ is methods. Kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately 10 units, of polynucleotide kinase to 0.5 N.M
substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl2, 5 mM dithiothreitol (DTT), and 1 to 2 ~tM ATP. If kinasing is for labeling of probe, the ATP will contain high specific activity ~3zP.
Ligations are performed in 15-30 ~t.l volumes under the following standard conditions and temperatures: 20 mM Tris-Cl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 33 ~,g/ml BSA, 10 mM-50 mM NaCI, and either 40 ~.M ATP and 0.01-0.02 (Weiss) units T4 DNA ligase at 0'C (for ligation of fragments with complementary single-stranded ends) or 1 mM ATP and 0.3-0.6 units T4 DNA ligase at 14'C (for "blunt end"
ligation). Intermolecular ligations of fragments with complementary ends are usually performed at 33-100 ~g/ml total DNA concentrations (5 to 100 nM total ends concentration). Intermolecular blunt end ligations (usually employing a 20 to 30 fold molar excess of linkers, optionally) are performed at 1 ~tM total ends concentration.
In vector construction, the vector fragment is commonly treated with bacterial or calf intestinal alkaline phosphatase (BAP or CIAP) to remove the 5' phosphate and prevent religation and reconstruction of the vector. BAP and CIAP digestion conditions are well known in the art, and published protocols usually accompany the commercially available BAP and CIAP enzymes. To recover the nucleic acid fragments, the preparation is extracted with phenol-chloroform and ethanol precipitated to remove AP and purify the DNA. Alternatively, religation can be prevented by restriction enzyme digestion of unwanted vector fragments before or after ligation with the desired vector.
For portions of vectors or coding sequences that require sequence modifications, a variety of site-specific primer-directed mutagenesis methods are available. The polymerase chain reaction (PCR) can be used to perform site-specific mutagenesis. In another technique now standard in the art, a synthetic oligonucleotide encoding the desired mutation is used as a primer to direct synthesis of a complementary nucleic acid sequence of a single-stranded vector, such as pBS
13+, that serves as a template for construction of the extension product of the mutagenizing primer. The mutagenized DNA is transformed into a host bacterium, and cultures of the transformed bacteria are plated and identified. The identification of modified vectors may involve transfer of the DNA of selected transformants to a nitrocellulose filter or other membrane and the "lifts" hybridized with kinased synthetic primer at a temperature that permits hybridization of an exact match to the modified sequence but prevents hybridization with the original strand. Transformants that contain DNA that hybridizes with the probe are then cultured and serve as a reservoir of the modified DNA.

WO 92/03556 2 0 8 ~ ~ 9 ~ PGT/US91/05753 In the constructions set forth below, correct ligations for plasmid construction are confirmed by first transforming ~. ~ strain DG101 or another suitable host with the ligation mixture. Successful transformants are selected by ampicillin, tetracycline or other antibiotic resistance or sensitivity or by using other markers, depending on the mode of plasmid construction, as is understood in the art. Plasmids from the transformants are then prepared according to the method of Clewell gl g_l., 1969, Pr~c.
N~1. Acid. ~. T~SA x:1159, optionally following chloramphenicol amplification (Clewell, 1972, ~. Bacte~. ~Q:667). Another method for obtaining plasmid DNA
is described as the "Base-Acid" extraction method at page 11 of the Bethesda Research Laboratories publication Focus, volume 5, number 2, and very pure plasmid DNA
can be obtained by replacing steps 12 through 17 of the protocol with CsCI/ethidium bromide ultracentrifugation of the DNA. The isolated DNA is analyzed by restriction enzyme digestion and/or sequenced by the dideoxy method of Singer gl ~., 1977, Pr~c . 1~1. cad. ~. USA 2:5463, as further described by Messing gl ~., 1981, T~. Acids ~. Q:309, or by the method of Maxim gl ~., 1980, Methods in En~,vmologv øx:499.
The control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene. Generally, procaryotic, yeast, insect, or mammalian cells are used as hosts. Procaryotic hosts are in general the most efficient and convenient for the production o~ recombinant proteins and are therefore preferred for the expression of Tma polymerasc.
The procaryote most frequently used to express recombinant proteins is ~. ~.
For cloning and sequencing, and for expression of constructions under control of most bacterial promoters, E_. Eli K12 strain MM294, obtained from the ~. ~i Generic Stock Center under GCSC #6135, can be used as the host. For expression vectors with the PI,N~S control sequence, _E. ~ K12 strain MC1000 lambda lysogen, N~N53cIg5~ SusPgo, ATCC 3y531, may be used. ~. ~ DG116, which was deposited with the ATCC (ATCC 53606) on April 7, 1987, and ~. ~ KB2, which was deposited with the ATCC (ATCC 53075) on March 29, 1985, are also useful host cells. For M13 phage recombinants, E_. Eli strains susceptible to phage infection, such as _E. Eli K12 strain DG98, are employed. The DG98 strain was deposited with the ATCC (ATCC 39768) on July 13, 1984.
However, microbial strains other than ~. ~ can also be used, such as bacilli, for example Bacilli ~g~,j,~, various species of Pseudomonas, and other bacterial strains, for recombinant expression of ~ DNA polymerise. In such procaryotic systems, plasmid vectors that contain replication sites and control sequences derived from the host or a species compatible with the host are typically used For example, ~. Eli is typically transformed using derivatives of pBR322, described by Bolivar gJ gl., 1977, Gene 2:95. Plasmid pBR322 contains genes for 2~894~~
ampicillin and tetracycline resistance. These drug resistance markers can be either retained or destroyed in constructing the desired vector and so help to detect the presence of a desired recombinant. Commonly used procaryotic control sequences, i.e., a promoter for transcription initiation, optionally with an operator, along with a 5 ribosome binding site sequence, include the ~i-lactamase (penicillinase) and lactose (lac) promoter systems (Chang et al., 1977, Nature 198:1056), the tryptophan (trp) promoter system (Goeddel gl ~1., 1980, Nuc. ci Rg,F. $:4057), and the lambda-derived PL promoter (Shimatake ~ g~., 1981, Nature ?2:128) and N-gene ribosome binding site (NHS). A portable control system cassette is set forth in United States 10 Patent No. 4,711,845, issued December 8, 1987. This cassette comprises a PL
promoter operably linked to the NHS in turn positioned upstream of a third DNA
sequence having at least one restriction site that permits cleavage within six by 3' of the NHS sequence. Also useful is the phosphatase A (phoA) system described by Chang gl ~1. in European Patent Publication No. 196,864, published October 8, 1986.
15 However, any available promoter system compatible with procaryotes can be used to construct a Tma expression vector of the invention.
The nucleotide sequence of the ~ insert may negatively affect the efficiency of the upstream ribosomal binding site, resulting in low levels of translated polymerase.
The translation of the Tma gene can be enhanced by the construction of "translationally 20 coupled" derivatives of the expression vectors. An expression vector can be constructed with a secondary translation initiation signal and short coding sequence just upstream of the ~,a gene coding sequence such that the stop codon for the short coding sequence is "coupled" with the ATG start codon for the T-ma gene coding sequence. A secondary translation initiation signal that efficiently initiates translation can be inserted upstream of the Tma gene start codon. Translation of the short coding sequence brings the ribosome into close proximity with the Tma gene translation initiation site, thereby enhancing translation of the Tma gene. For example, one expression system can utilize the translation initiation signal and first ten colons of the T7 bacteriophage major capsid protein (gene 10) fused in-frame to the last six colons of TrpE. The TGA (stop) colon for TrpE is "coupled" with the ATG (start) colon for the Tma gene coding sequence, forniing the sequence TGATG. A one base frame-shift is required between translation of the short coding sequence and translation of the Tma coding sequence. These derivative expression vectors can be constructed by recombinant DNA methods.
The redundancy of the genetic code can also be related to a low translation efficiency. Typically, when multiple colons coding the same amino acid occur, one of the possible colons is preferentially used in an organism. Frequently, an organism accumulates the tRNA species corresponding to the preferred colons at a higher level than those corresponding to rarely used colons. If the pattern of colon usage differs WO 92/03556 ~ ~ ~ ~ ~ ~ ~ PGT/U891/05753 between Thermotoga maritinna and the host cell, the iRNA species necessary for translation of the polymerase gene may be in low abundance. In the ~ coding sequence, arginine is most frequently coded for by the "AG~'~ c~don, whereas this codon is used at low frequency in ~. ~ genes, and the corr~.~onding tRNA is present in low concentration in ~. ~ host cells. Consequently, the low concentration in the ~. Eli host cell of "Arg U" tRNA for the "AGA" condon may limit the translation efficiency of the polymerase gene RNA in ~. ~i host cells. The efficiency of translation of the coding sequence within an ~. ~ host cell may be improved by increasing the concentration of this Arg tRNA species by expressing multiple copies of this tRNA gene in the host cell.
In addition to bacteria, eucaryotic microbes, such as yeast, can also be used as recombinant host cells. Laboratory strains of Saccharomyces cerevisiae, Baker's yeast, arc most often used, although a number of other strains are commonly available. While vectors employing the two micron origin of replication are common (Broach, 1983, Meth. ~,, x:307), other plasmid vectors suitable for yeast expression are known (see, for example, Stinchcomb gl ~., 1979, Nature ~$,~:39; Tschempe ~ ~., 1980, Gene 1Q:15; . :,nd Clarke ~ ~., 1983, ~. ~. IQ,~:300). Control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess gl g~., 1968, ,~. ~y. Enz3rme $gg. 1:149; Holland ~ ~., 1978, ~iotechnolosv x:4900;
and Holland gl ~., 1981, ~. 4iol. Chem. ~5 :1385). Additional promoters known in the art include the promoter for 3-phosphoglycerate kinase (Hitzeman ~ ~., 1980, ~. 'R~1.
~. x:2073) and those for other glycolytic enzymes, such as glyceraldehyde 3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phc~Phoglucose isomerase, and glucokinase. Other promoters that have the additional advantage of transcription controlled by growth wditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and enzymes responsible for maltose and galactose utilization (Holland, ~).
Terminator sequences may also be used to enhance expression when placed at the 3' end of the coding sequence. Such terminators are found in the 3' untranslated region following the coding sequences in yeast-derived genes. Any vector containing a yeast-compatible promoter, origin of replication, and other control sequences is suitable for use in constructing yeast r~ expression vectors.
The ~ gene can also be expressed in eucaryotic host cell cultures derived from multicellular organisms. See, for example, Tissue 1 r , Academic Press, Cruz and Patterson, editors (1973). Useful host cell lines include COS-7, COS-A2, CV-1, marine cells such as rnurine myelomas NS1 and VERO, HeLa cells, and Chinese hamster ovary (CHO) cells. Expression vectors for such cells ordinarily include ~~~~4~5 promoters and control sequences compatible with mammalian cells such as, for example, the commonly used early and late promoters from Simian Virus 40 (S V
40) (Fiers ~ ~1., 1978, Nature 2:113), or other viral promoters such as those derived from polyoma, adenovirus 2, bovine papilloma virus (BPV), or avian sarcoma viruses, or immunoglobulin promoters and heat shock promoters. A system for expressing DNA in mammalian systems using a BPV vector system is disclosed in U.S. Patent No. 4,419,446. A modification of this system is described in U.S. Patent No.
4,601,978. General aspects of mammalian cell host system transformations have been described by Axel, U.S. Patent No. 4,399,216. "Enhancer" regions are also important in optimizing expression; these are, generally, sequences found upstream of the promoter region. Origins of replication may be obtained, if needed, from viral sources.
However, integration into the chromosome is a common mechanism for DNA
replication in eucaryotes.
Plant cells can also be used as hosts, and control sequences compatible with plant cells, such as the nopaline synthase promoter and polyadenylation signal sequences (Depicker gl g~,., 1982, ~. IVY. $p,~. ~. x:561) are available.
Expression systems employing insect cells utilizing the control systems provided by baculovirus vectors have also been described (Miller el ~1., 1986, Genetic En 'n~ Bering (Setlow et ~1_., eds., Plenum Publishing) $:277-297). Insect cell-based expression can be accomplished in $podont~r f ' ei . These systems can also be used to produce recombinant Tma polymerise.
Depending on the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described by Cohen, 1972, ~. Natl. Acid. ,5~. ~ x:2110 is used for procaryotes or other cells that contain substantial cell wall barriers.
Infection with Aerobacterium tumefaciens (Shaw gl g_l., 1983, ~en~ 2:315) is used for certain plant cells. For mammalian cells, the calcium phosphate precipitation method of Graham and van der Eb, 1978, Virology ,5:546 is preferred. Transformations into yeast are carried out according to the method of Van Solingen ~ ~., 1977, ~. ,~~. ~Q:946 and Hsiao g~ g_l., 1979, Proc. Natl. Acid. Sci. ~ 76:3829.
Once the Tma DNA polymerise has been expressed in a recombinant host cell, purification of the protein may be desired. Although a variety of purification procedures can be used to purify the recombinant thermostable polymerise of the invention, fewer steps may be necessary to yield an enzyme preparation of equal purity.
Because ~. ~ host proteins are heat-sensitive, the recombinant thermostable DNA polymerise can be substantially enriched by heat inactivating the crude lysate.
This step is done in the presence of a sufficient amount of salt (typically 0.3 M
ammonium sulfate) to ensure dissociation of the Tma DNA polymerise from the host DNA and to reduce ionic interactions of Tma DNA polymerise with other cell lysate 20 89495 _ W~I'a/03556 PGT/US91 /05753 proteins. In addition, the presence of 0.3 M ammonium sulfate promotes hydrophobic interaction with a phenyl sepharose column. Hydrophobic interaction chromatography is a separation technique in which substances are separated on the basis of differing strengths of hydrophobic interaction with an uncharged bed material containing hydrophobic groups. Typically, the column is first equilibrated under conditions favorable to hydrophobic binding, such as high ionic strength. A descending salt gradient may then be used to elute the sample.
According to the invention, an aqueous mixture (containing either native or necornbinant ~ DNA polymerise) is loaded onto a coluam containing a relatively strong hydrophobic gel such as phenyl sepharose (manufactured by Pharmacia) or Phenyl TSK ((manufactured by Toyo Soda). To promote hydrophobic interaction with a phenyl sepharose column, a solvent is used that contains, for example, greater than or equal to 0.3 M ammonium sulfate, with 0.3 M being preferred, or greater than or equal to 0.5 M NaCI. The column and the sample-are adjusted to 0.3 M ammonium sulfate in 50 mM Tris (pH 7.5) and 1.0 mM EDTA ("TE") buffer that also contains 0.5 mM
DTT, and the sample is applied to the column. The column is washed with the 0.3 M
ammonium sulfate buffer. The enzyme may then be eluted with solvents that attenuate hydrophobic interactions, such as decreasing salt gradients, ethylene or propylene glycol, or urea. For native ~ DNA polymerise, a preferred embodiment involves washing the column with 2 M urea and 20% ethylene glycol in TE-DTT.
For long-term stability, r~ DNA polymerise enzyme can be stored in a buffer that contains one or more non-ionic polymeric detergents. Such detergents are generally those that have a molecular weight in the range of approximately 100 to 250,000 daltons, preferably about 4,000 to 200,000 daltons, and stabilize the enzyme at a pH of from about 3.5 to about 9.5, preferably from about 4 to 8.5.
Examples of such detergents include those specified on pages 295-298 of McCutcheon's & Deterrents, North American edition (1983), published by the McCutch~ott Division --- -of MC Publishing Co., 175 Rock Road, Glen Rock, NJ (USA) and U.S. Patents 5,352,600 and 5,079,352. -Preferably, the detergents are selected from the group comprising ethoxylated fatty alcohol ethers and lauryl ethers, ethoxylated alkyl phenols, octylphenoxy polyethoxy ethanol compounds, modified oxyethylated and/or oxypropylated straight-chain alcohols, polyethylene glycol monooleate compounds, polysorbate compounds, and phenolic fatty alcohol ethers. More particularly preferred are Tween 20, a polyoxyethylatcd (20) sorbitan monolaurate from ICI Americas Inc., Wilmington, DE, and Iconol NP-40, an ethoxylated alkyl phenol (nonyl) from BASF Wyandotte Corp.
Parsippany, N1.
The thermostable enzyme of ~~is invention may be used for any purpose in which such enzyme activity is necessary or desired. In a pardcuZarly preferred B

WO X03556 ~ ~ 8 9 4 9 5 PCT/US91/05753 embodiment, the enzyme catalyzes the nucleic acid amplification reaction lrnown as PCR. This process for amplifying nucleic acid sequences is disclosed and claimed in U.S. Patent Nos. 4,683,202 and 4,865,188. The PCR nucleic acid amplification method involves amplifying at least one specific nucleic acid sequence contained in a nucleic acid or a mixture of nucleic acids and in the most common embodiment, produces double-stranded DNA.
For ease of discussion, the protocol set forth below assumes that the specific sequence to be amplified is contained in a double-stranded nuclcic-acid.
However, the process is equally useful in amplifying single-stranded nucleic acid, such as mRNA, although in the preferred embodiment the ultimate product is still double-stranded DNA. In the amplification of a single-stranded nucleic acid, the first step involves the synthesis of a complementary strand (one of the two amplification primers can be used for this purpose), and the succeeding steps proceed as in the double-stranded amplification process described below.
This amplification process comprises the steps of:
(a) contacting each nucleic acid strand with four different nucleoside triphosphates and two oligonucleotide primers for each specific sequence being amplified, wherein each primer is selected to be subs:antially complementary to the different strands of the specific sequence, such that the extension product synthesized from one primer, when separated from its complement, can serve as a template for synthesis of the extension product of the other primer, said contacting being at a temperature that allows hybridization of each primer to a complementary nucleic acid strand;
(b) contacting each nucleic acid strand, at the same time as or after step (a), with 2S a DNA polymerase from Thermoto~a maritima that enables combination of the nucleoside triphosphates to form primer extension products complementary to each strand of the specific nucleic acid sequence;
(c) maintaining the mixture from step (b) at an effective temperature for an effective time to promote the activity of the enzyme and to synthesize, for each different sequence being amplified, an extension product of each primer that is complementary to each nucleic acid strand template, but not so high as to separate each extension product from the complementary strand template;
(d) heating the mixture from step (c) for an effective time and at an effective temperature to separate the primer extension products from the templates on which they 3~ were synthesized to produce single-stranded molecules but not so high as to denature irreversibly the enzyme;
(e) coolin ~ the mixture from step (d) for an effective time and to an effective temperature to promote hybridization of a primer to each of the single-stranded molecules produced in step (d); and B

WO 92/03556 ~ ~ ~ ~ ~ 9 ~ PCT/US91/05753 (f) maintaining the mixture from step (e) at an effective temperature for an effectivc time to promote the activity of the enzyme and to synthesize, for each different sequence being amplified, an extension product of each primer that is complementary to each nucleic acid template produced in step (d) but not so high as to separate each 5 extension product from the complementary strand template. The effective times and temperatures in steps (e) and (fj may coincide, so that steps (e) and (f) can be canned out simultaneously. Steps (d)-(fj are repeated until the desired level of amplification is obtained.
The amplification method is useful not only for producing large amounts of a 10 specific nucleic acid sequence of known sequence but also for producing nucleic acid sequences that are known to exist but are not completely specified. One need know only a sufficient number of bases at both ends of the sequence in sufficient detail so that two oligonucleotide primers can be prepared that will hybridize to different strands of the desired sequence at relative positions along the sequence such that an extension 15 product synthesized from one primer, when separated from the template (complement), can serve as a template for extension of the other primer into a nucleic acid sequence of defined length. The greater the knowledge about the bases at both ends of the sequence, the greater can be the specificity of the primers for the target nucleic acid sequence and the efficiency of the process.
20 In any case, an initial copy of the sequence to be amplified must be available, although the sequence need not be pure or a discrete molecule. In gencral, the amplification process involves a chain reaction for producing, in exponential quantities relative to the number of reaction steps involved, at least one specific nucleic acid sequence given that (a) the ends of the required sequence are known in sufficient detail 25 that oligonucleotides can be synthesized that will hybridize to them and (b) that a small amount of the sequence is available to initiate the chain reaction. The product of the chain reaction will be a discrete nucleic acid duplex with termini corresponding to the 5' ends of the specific primers employed.
Any nucleic acid sequence, in purified or nonpurifted form, can be utilized as the starting nucleic acid(s), provided it contains or is suspected to contain the specific nucleic acid sequence one desires to amplify. The nucleic acid to be amplified can be obtained from any source, for example, from plasmids such as pBR322, from cloned DNA or RNA, or from natural DNA or RNA from any source, including bacteria, yeast, viruses, organelles, and higher organisms such as plants and animals.
DNA or RNA may be extracted from blood, tissue material such as chorionic villi, or amniotic cells by a variety of techniques. See, e.g., Maniatis ~ ~., supra, pp. 280-281. Thus, the process may employ, for example, DNA or R~IA, including messenger RNA, which DNA or RNA may be single-stranded or double-stranded. In addition, a DNA-RNA hybrid that contains one strand of each may be utilized. A mixture of any of these nucleic acids can also be employed as can nucleic acids produced from a previous amplification reaction (using the same or different primers). The specific nucleic acid sequence to be amplified can be only a fraction of a large molecule or can be present initially as a discrete molecule, so that the spec sequence constitutes the entire nucleic acid The sequence to be amplified need not be present initially in a pure form; the sequence can be a minor fraction of a complex mixture, such as a portion of the ~i-globin gene contained in whole human DNA (as exemplified in Saild gl g~., 1985, i n ~Q:1530-1534) or a portion of a nucleic acid sequence due to a particular microorganism, which organism might constitute only a very minor fraction of a particular biological sample. The cells can be directly used in the amplification process after suspension in hypotonic buffer and heat treatment at about 90 C-100 C
until cell lysis and dispersion of intracellular components occur (generally 1 to 15 minutes).
After the heating step, the amplification reagents may be added directly to the lysed cells. The starting nucleic acid sequence can contain more than one desired specific nucleic acid sequence. The amplification process is useful not only for producing large amounts of one specific nucleic acid sequence but also for amplifying simultaneously more than one different specific nucleic acid sequence located on the same or different nucleic acid molecules.
Primers play a key role in the PCR process. The word "primer" as used in describing the amplification process can refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding the terminal sequences) of the fragment to be amplified or where one employs the degenerate primer process of the invention. For instance, in the case where a nucleic acid sequence is inferred from protein sequence information, a collection of primers containing sequences representing all possible codon variations based on degeneracy of the genetic code will be used for each strand. One primer from this collection will be sufficiently homologous with the end of the desired sequence to be amplified to be useful for amplification.
In addition, more than one specific nucleic acid sequence can be amplified from the first nucleic acid or mixture of nucleic acids, so long as the appropriate number of different oligonucleotide primers are utilized. For example, if two different specific nucleic acid sequences are to be produced, four primers are utilized. Two of the primers are specific for one of the specific nucleic acid sequences, and the other two primers are specific for the second specific nucleic acid sequence. In this manner, each of the two different specific sequences can be produced exponentially by the present process.
A sequence within a given sequence can be amplified after a given number of amplification cycles to obtain greater specificity in the reaction by adding, after at least WO 92/03556 ~ ~ ~ 4~ j~ (.~ ~ PCT/US91/05753 one cycle of amplification, a set of primers that are complementary to internal sequences (i.e., sequences that are not on the ends) of the sequence to be amplified.
Such primers can be added at any stage and will provide a shorter amplified fragment.
Alternatively, a longer fragment can be prepared by using primers with non-complementary ends but having some overlap with the primers previously utilized in the amplification.
Primers also play a key role when the amplification process is used for ~ vi mutagenesis. The product of an amplification reaction where the primers employed are not exactly complementary to the original template will contain the sequence of the primer rather than the template, so introducing an '~~n vitro mutation. In further cycles, this mutation will be amplified with an undiminished efficiency because no further mispaired priming is required. The process of making an altered DNA sequence as described above could be repeated on the altered DNA using different primers to induce further sequence changes. In this way, a series of mutated sequences can gradually be produced wherein each new addition to the series differs from the last in a minor way, but from the original DNA source sequence in an increasingly major way.
Because the primer can contain as part of its sequence a non-complementary sequence, provided that a sufficient amount of the primer contains a sequence that is complementary to the strand to be amplifieti, many other advantages can be realized.
For example, a nucleotide sequence that is not complementary to the template sequence (such as, e.g., a promoter, linker, coding sequence, etc.) may be attached at the 5' end of one or both of the primers and so appended to the product of the amplification process. After the extension primer is added, sufficient cycles are run to achieve the desired amount of new template containing the non-complementary nucleotide insert.
This allows production of large quantities of the combined fragments in a relatively short period of time (e.g., two hours or less) using a simple technique.
Oligonucleotide primers can be prepared using any suitable method, such as, for example, the phosphotriester and phosphodiester methods described above, or automated embodiments thereof. In one such automated embodiment, diethylphosphoramidites are used as starting materials and can be synthesized as described by Beaucage gt ~1-., 1981, Tetrahedron Letters 22:1859-1862. One method for synthesizing oligonucleotides on a modified solid support is described in U.S.
Patent No. 4,458,066. One can also use :: primer that has been isolated from a biological source (such as a restriction endonuclease digest).

~(~~9~9~

No matter what primers are used, however, the reaction mixture must contain a template for PCR to occur, because the specific nucleic acid sequence is produced by using a nucleic acid containing that sequence as a template. The first step involves contacting each nucleic acid strand with four different nucleoside triphosphates and two oligonucleotide primers for each specific nucleic acid sequence being amplified or detected. If the nucleic acids to be amplified or detected are DNA, then the nucleoside triphosphates are usually dATP, dCTP, dGTP, and dTTP, although various nucleotide derivatives can also be used in the process. The concentration of nucleoside triphosphates can vary widely. Typically, the concentration is 50 to 200 EtM
in each dNTP in the buffer for amplification, and MgCl2 is present in the buffer in an amount of 1 to 3 mM to activate the polymerise and increase the specificity of the reaction.
However, dNTP concentrations of 1 to 20 p.M may be preferred for some applications, such as DNA sequencing or generating radiolabeled probes at high specific activity.
The nucleic acid strands of the target nucleic acid serve as templates for the synthesis of additional nucleic acid strands, which are extension products of the primers. This synthesis can be performed using any suitable method, but generally occurs in a buffered aqueous solution, preferably at a pH of 7 to 9, most preferably about 8. To facilitate synthesis, a molar excess of the two oligonucleotide primers is added to the buffer containing the template strands. As a practical matter, the amount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process. Accordingly, primeraemplate ratios of at least 1000:1 or higher are generally employed for cloned DNA templates, and primer:
template ratios of about 108:1 or higher are generally employed for amplification from complex genomic samples.
The mixture of template, primers, and nucleoside triphosphates is then treated according to whether the nucleic acids being amplified or detected are double-or single-stranded. If the nucleic acids are single-stranded, then no denaturation step need be employed prior to the first extension cycle, and the reaction mixture is held at a temperature that promotes hybridization of the primer to its complementary target (template) sequence. Such temperature is generally from about 35°C to 65°C or more, preferably about 37°C to 60°C for an effective time, generally from a few seconds to five minutes, preferably from 30 seconds to one minute. A hybridization temperature of 35°C to 70°C may be used for ~ DNA polymerise. Primers that are 15 nucleotides or longer in length are used to increase the specificity of primer hybridization. Shorter primers require lower hybridization temperatures.
The complement to the original single-stranded nucleic acids can be synthesized by adding Tma DNA polymerise in the presence of the appropriate buffer, dNTPs, and wo nio35s6 2 0 $ ~ ,~ ~ Pcrius9vos~s3 .r.

one or more oligonucleotide primers. If an appropriate single primer is added, the primer extension product will be complementary to the single-stranded nucleic acid and will be hybridized with the nucleic acid strand in a duplex of strands of equal or unequal length (depending on where the primer hybridizes to the template), which may then be separated into single strands as described above to produce two single, separated, complementary strands. A second primer would then be added so that subsequent cycles of primer extension would occur using both the original single-stranded nucleic acid and the extension product of the first primer as templates.
Alternatively, two or more appropriate primers (one of which will prime synthesis using the extension product of the other primer as a template) can be added to the single-stranded nucleic acid and the reaction carried out.
If the nucleic acid contains two strands, as in the case of amplification of a double-stranded target or second-cycle amplification of a single-stranded target, the strands of nucleic acid must be separated before the primers are hybridized.
This strand separation can be accomplished by any suitable denaturing method, including physical, chemical or enzymatic means. One preferred physical method of separating the strands of the nucleic acid involves heating the nucleic acid until complete (>99%) denaturation occurs. Typical heat denaturation involves temperatures ranging from about 80°C to 105°C for times generally ranging from about a few seconds to minutes, depending on the composition and size of the nucleic acid. Preferably, the effective denaturing temperature is 90°C-100°C for a few seconds to 1 minute. Strand separation may also be induced by an enzyme from the class of enzymes known as helicases or the enzyme RecA, which has helicase activity and in the presence of riboATP is known to denature DNA. The reaction conditions suitable for separating the strands of nucleic acids with helicases are described by Kuhn Hoffmann-Berling, 1978, CSH-Quantitative Biology x:63, and techniques for using RecA are reviewed in Radding, 1982, ~. $~.
Genetics x:405-437. The denaturation produces two separated complementary strands of equal or unequal length.
If the double-stranded nucleic acid is denatured by heat, the reaction mixture is allowed to cool to a temperature that promotes hybridization of each primer to the complementary target (template) sequence. This temperature is usually from about 35°C to 65°C or more, depending on reagents, preferably 37°C to 60°C. The hybridization temperature is maintained for an effective time, generally a few seconds to minutes, and preferably 10 seconds to 1 minute. In practical terms, the temperature is simply lowered from about 95°C to as low as 37°C, and hybridization occurs at a temperature within this range.
Whether the nucleic acid is single- or double-stranded, the DNA polymerase from ermotog~, maritima can be added prior to or during the denaturation step or when the temperature is being reduced to or is in the range for promoting hybridization.

~U~'~~~~ 30 Although the thermostability of Tma polymerase allows one to add Tim polymerase to the reaction mixture at any time, one can substantially inhibit non-specific amplification by adding the polymerise to the reaction mixture at a point in time when the mixture will not be cooled below the stringent hybridization temperature. After hybridization, the reaction mixture is then heated to or maintained at a temperature at which the activity of the enzyme is promoted or optimized, i.e., a temperature sufficient to increase the activity of the enzyme in facilitating synthesis of the primer extension products from the hybridized primer and template. The temperature must actually be sufficient to synthesize an extension product of each primer that is complementary to each nucleic acid template, but must not be so high as to denature each extension product from its complementary template (i.e., the temperature is generally less than about 80'C to 90' C).
Depending on the nucleic acids) employed, the typical temperature effective for this synthesis reaction generally ranges from about 40°C to 80°C, preferably 50°C to 75'C. The temperature more preferably ranges from about 65'C to 75'C for 'f'hermotog~ maritima DNA polymerise. The period of time required for this synthesis may range from about 10 seconds to several minutes or more, depending mainly on the temperature, the length of the nucleic acid, the enzyme, and the complexity of the nucleic acid mixture. The extension time is usually about 30 seconds to a few minutes.
If the nucleic acid is longer, a longer time period is generally required for complementary strand synthesis.
The newly synthesized strand and the complement nucleic acid strand form a double-stranded molecule that is used in the succeeding steps of the amplification process. In the next step, the strands of the double-stranded molecule are separated by heat denaturation at a temperature and for a time effective to denature the molecule, but not at a temperature and for a period so long that the thermostable enzyme is completely and irreversibly denatured or inactivated. After this denaturation of template, the temperature is decreased to a level that promotes hybridization of the primer to the complementary single-stranded molecule (template) produced from the previous step, as described above.
After this hybridization step, or concurrently with the hybridization step, the temperature is adjusted to a temperature that is effective to promote the activity of the thermostable enzyme to enable synthesis of a primer extension product using as a template both the newly synthesized and the original strands. The temperature again must not be so high as to separate (denature) the extension product from its template, as described above. Hybridization may occur during this step, so that the previous step of cooling after denaturation is not required. In such a case, using simultaneous steps, the preferred temperature range is 50°C to 70°C.

The heating and cooling steps involved in one cycle of strand separation, hybridization, and extension product synthesis can be repeated as many times as needed to produce the desired quantity of the specific nucleic acid sequence. The only limitation is the amount of the primers, thermostable enzyme, and nucleoside triphosphates present. Usually, from 15 to 30 cycles are completed. For diagnostic detection of amplified DNA, the number of cycles will depend on the nature of the sample and the initial target concentration in the sample. For example, fewer cycles will be required if the sample being amplified is pure. If the sample is a complex mixture of nucleic acids, more cycles will be required to amplify the signal sufficiently for detection. For general amplification. and detection, the process is repeated about I S
times. When amplification is used to generate sequences to be detected with labeled sequence-specific probes and when human genomic DNA is the target of amplification, the process is repeated 15 to 30 times to amplify the sequence sufficiently so that a clearly detectable signal is produced, i.e., so that background noise does not interfere with detection.
No additional nucleosides, primers, or thermostable enzyme need be added after the initial addition, provided that no key reagent has been exhausted and that the enzyme has not become denatured or irreversibly inactivated, in which case additional polymerise or other reagent would have to be added for the reaction to continue.
Addition of such materials at each step, however, will not adversely affect the reaction.
After the appropriate number of cycles has been completed to produce the desired amount of the specific nucleic acid sequence, the reaction can be halted in the usual manner, e.g., by inactivating the enzyme by adding EDTA, phenol, SDS, or CHC13 or by separating the components of the reaction.
The amplification process can be conducted continuously. In one embodiment of an automated process, the reaction mixture can be temperature cycled such that the temperature is programmed to be controlled at a certain Ievel for a certain time. One such instrument for this purpose is the automated machine for handling the amplification reaction developed and marketed by Perkin-Elmer Cetus Instruments.
Detailed instructions for carrying out PCR with the instrument are available upon purchase of the instrument.
Tma DNA polymerise is very useful in the diverse processes in which amplification of a nucleic acid sequence by the polymerise chain reaction is useful. The amplification method may be utilized to clone a particular nucleic acid sequence for insertion into a suitable expression vector, as described in U.S. Patent No.
4,800,159.
The vector may be used to transform an appropriate host organism to produce the gene product of the sequence by standard methods of recombinant DNA technology.
Such cloning may involve direct Iigation into a vector using blunt-end ligation, or use of restriction enzymes to cleave at sites contained within the primers. Other processes W0~92,/03556 2 0 8 9 4 9 5 PCT/US91/05753 suitable for Tma polymerise include those described in U.S. Patent Nos.
4,683,195 and 4,683,202 and European Patent Publication Nos. 229,701; 237,362; and 258,017.
In addition, the present enzyme is useful in asymmetric PCR (see Gyllensten and Erlich, 1988, Proc. Natl. Acid. Sci. USA 85:7652-7656); inverse PCR (Ochman et al., 1988, Genetics 120:621); and for DNA sequencing (see Innis et al., 1988, Proc. Natl.
Acid.
Sci. USA 85:9436-9440, and McConlogue et al., 1988, Nuc. Acids Res.
16(20):9869).
Tma polymerise is also believed to have reverse transcriptase activity; see PCT Patent Publication No. 91/09944, published July 11, 1991.
The reverse transcriptase activity of ~ DNA polymerise permits this enzyme to be used in methods for transcribing and amplifying RNA. The improvement of such methods resides in the use of a single enzyme, whereas previous methods have required more than one enzyme. - -The improved methods comprise the steps of: (a) combining an RNA template with a suitable primer under conditions whereby the primer will anneal to the corresponding RNA template; and (b) reverse transcribing the RNA template by incubating the annealed primer-RNA template mixture with Tma DNA polymerise under conditions sufficient for the DNA polymerise to catalyze the polymerization of _ deoxyribonucleoside triphosphates to form a DNA sequence complementary to the sequence of the RNA template.
In another aspect of the above method, the primer that anneals to the RNA
template may also be suitable for amplification by PCR. In PCR, a second primer that is complementary to the reverse transcribed cDNA strand provides a site for initiation of synthesis of an extension product. As already discussed above, the Tma DNA
polymerise is able to catalyze this extension reaction on a cDNA template.
In the amplification of an RNA molecule by Tma DNA polymerise, the first extension reaction is reverse transcription, in which a DNA strand is produced in the form of an RNA/cDNA hybrid molecule. The second extension reaction, using the DNA strand as a template, produces a double-stranded DNA molecule. Thus, synthesis of a complementary DNA strand from an RNA template with ma DNA
polymerise provides the starting material for amplification by PCR.
When Tma DNA polymerise is used for nucleic acid transcription from an RNA
template, the use of buffers that contain Mn2* provide improved stimulation of ~
3~ reverse transcript3se activity compared to previously used, Mg2* containing reverse transcription buffers. Consequently, increased cDNA yields also result from these methods.
AS SLatP.d above, the product of Rh'A transcription by Tma DNA polymerise is an RNA/cDNA hybrid molecule. The RNA is then removed by heat denaturation or B
...

any number of other known methods including alkali, heat, or enzyme treatment.
The remaining cDNA strand then serves as a template for polymerization of a self complementary strand, thereby providing a double-stranded cDNA molecule suitable for ampl~cation or other manipulation. The second strand synthesis requires a sequence specific primer and ~ DNA polymerise.
Following the synthesis of the second cDNA strand, the resultant double-stranded cDNA molecule can serve a number of purposes, including DNA
sequencing, amplification by PCR, or detection of a specific nucleic acid sequence.
Specific primers useful for amplification of a scgment of the cDNA can be added subsequent to the reverse transcription. Also, one can use a first set of primers to synthesize a specific cDNA molecule and a second nested s. . of primers to amplify a desired cDNA
segment. All of these reactions are catalyzed by ~m DNA polymerise.
~ DNA polymerise can also be used to simplify and improve methods for detection of RNA target molecules in a sample. In these methods, ~m DNA
polymerise catalyzes: (a) reverse transcription; (b) second strand cDNA
synthesis; and, if desired (c) amplification by PCR In addition to the improvement of only requiring a single enzyme, the use of ~ DIVA polymerise in the described methods eliminates the previous requirement of two sets of incubation conditions that were necessary due to the use of different enzymes for each procedural step. The use of ~ DNA
polymerise provides RNA transcription and amplification of the resulting complementary DNA with enhanced specificity and with fewer steps than previous RNA cloning and diagnostic methods. These methods are adaptable for use in kits for laboratory or clinical analysis.
The RNA that is transcribed and amplified in the above methods can be derived from a number of sources. The RNA template can be contained within a nucleic acid preparation from any organism, such as a viral or bacterial nucleic acid preparation.
The preparation can contain cell debris and other components, purified total RNA, or purified mRNA. The RNA template can also be a population of heterogeneous RNA
molecules in a sample. Furthermore, the target RNA can be contained in a biological sample, and the sample can be a heterogeneous sample in which RNA is but a small portion. Examples of such biological samples include blood samples and biopsied tissue sin les.
Aluiough the primers used in the reverse transcription step of the above methods are generally completely complementary to the RNA template, the primers need not be completely complementary. As in PCR, not every nucleotide of the primer must anneal to the tcmplate for reverse transcription to occur. For example, a non-complementary nucleotide sequence can be present at the 5' end of the primer with the remainder of the primer sequence being complementary to the RNA.
Alternatively, non-complementary bases can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the RNA template for hybridization to occur and allow synthesis of a complementary DNA strand.
The following examples are offered by way of illustration only and are by no means intended to limit the scope of the claimed invention. In these examples, all ~~ percentages are by weight if for solids and by volume if for liquids, unless otherwise noted, and all temperatures are given in degrees Celsius.

Purification of Thermotoga maritima DNA Pol,~vr This example describes the isolation of Tma DNA polymerise from Thermoto~a maritima. The DNA polymerise was assayed at various points during ptu~ificadon according to the method described for T~ca polymerise with one modification ( 1 mM
MgCl2) in Lawyer~t al., 1989,1. Biol. hem. ~(11):C427-6437.
Typically, this assay is performed in a total volume of 50 ltl of a reaction mixture composed of 2~ mM TAPS-HCI, pH 9.5 (20'C); 50 mM KCI; 1 mM MgCl2; 1 mM ~i-mercaptoethanol; 200 ~M in each of dATP, dGTP, and TTP; 100 ~M a-32P-dCTP (0.03 to 0.07 ~Ci/nMol); 12.5 ~tg of activated salmon sperm DNA; and polymerise. The reaction is initiated by addition of polymerise in diluent (diluent is composed of 10 mM Tris-HCI, pH $.0, 50 mM KC1, 0.1 mM EDTA, 1 mg/ml autoclaved gelatin, 0.5% NP40, 0.5% Tween 20, and 1 mM ~i-mercaptoethanol), and the reaction is carried out at 75°C. For the calculations shown below, one assumes that the volume of the polymerise (and diluent) added is ~ ~t.l, and the total reaction volume is SO ~tl. After a 10 minute incubation, the reaction is stopped by adding 10 E.tl of 60 mM EDTA. The reaction mixture is centrifuged, and 50 ~tl of reaction mixture is transferred to 1.0 ml of 50 ~tg/ml carrier DIVA in 2 m.M EDTA (at 0°C).
An equal volume (1 ml) of 20% TCA, 2% sodium pyrophosphate is added and mined. The mixture is incubated at 0°C for 15 to 20 minutes and then filtered through Whitman GF/C filters and extensively was;~ed (6 x ~ ml) with a cold mixture containing 5% TCA
and 1 % pyrophosphate, followed by a cold 9~% ethanol wash. The filters are then dried and the radioactivity counted. Background (minus enzyme) is usually 0.001% to 0.01% of input cpm. About ~0 to 250 pmoles 3~P-dCTP standard is spotted for unit calculation. One unit is equal to 10 nmoles dIVTP in;orporated in 30 minutes at 7~°C.
Units are calculated as follows.
sample cnm - enzyme dil. cpm - pmole dCTP incorporated 'specific activiry of dCTP
(cpm/pmole j ,..\ ZQ 89495 nmole incorporated x 3 x dilution factor x 4 = units/ml 4.167 x 10 The 4.167 factor results from counting only 5/6 (50 ~tl) of the reaction volume after the stop solution is added (60 ul).
5 All operations were carried out at 0'C to 4'C unless otherwise stated. All glassware was baked prior to use, and solutions used in the purification were autoclaved, if possible, prior to use.
About 50 g of frozen Thermotoaa maritima strain MSBS cells (provided by Prof. Dr. K. O. Stetter, Regcnsburg, Germany) were thawed in 25 ml of 3 x TE-DTT
.,10 buffer (150 mM Tris-Cl, pH 7.5, 3 mM EDTA, and 3 mM dithiothreitol) containing 2.4 mM PMSF (from 144 mM stock in DMF) and homogenized at low speed with a magnetic stirrer. The thawed cells were lysed in an Aminco french pressure cell (8 -20,000 psi). The lysate was diluted with additional 1 x TE-DTT buffer containing fresh 2.4 mM PMSF to final 5.5x cell wet weight and sonicatcd to reduce viscosity (40 15 to 100% output, 9 min., 50% duty cycle).
The resulting fraction, fraction I (275 ml) contained 5.31 g of protein and 15.5 x 104 units of activity. Ammonium sulfate was added to 0.2 M (7.25 g) and the lysate stirred for 15 mic:.rtes on ice. Ammonium sulfate prevents the Tma DNA
polymerise from binding to DNA in the crude lysate and reduces ionic interactions of 20 the DNA polymerise with other cell lysate proteins.
Empirical testing showed that 0.2% Polymin P (polyethylcneimine, PEI) precipitates __>9290 of the total nucleic acid. Polymin P (pH 7.5) was added slowly to 0.2% (5.49 mI of 10% PEI) and the slurry stirred 30 minutes on ice, then centrifuged at 30,000 x g at 4'C for 30 minutes. The supernatant was designated fraction II
(246 ml) 25 and contained 3.05 g of protein and 12.5 x 104 units of activity.
Fraction II was adjusted to 0.3 M.ammonium sulfate by addition of 3.24 g solid ammonium sulfate to ensure complete binding of the DNA polymerise to phenyl sepharos~ Fraction II was then loaded onto a 2.2 x 6.6 cm (25 ml) phenyl sepharose CL-4B (lot OM 08012, purchased from Pharmacia - LKB) column (equilibrated in TE
30 containing 0.3 M ammonium sulfate and 0.5 mM DTT) at 38 ml/hr (10 ml/em2/hr). All resins were equilibrated and recycled according to the manufacturer's recommendations.
The column was washed with 150 ml of the same buffer (A~a to baseline), then with 90 ml TE containing 0.5 mM DTT (no ammonium sulfate), followed by a 35 wash with 95 ml of 20% ethylene glycol in TE containing 0.5 mM DTT and finally, eluted with 2 M urea in TE containing 20% ethylene glycol and 0.5 mM DTT. When the column fractions were assayed, a large proportion of the activity was found in the flow-through and wash fractions, indicating that the capacity of the column had lien exceeded. Approximately 70% of the DNA polymerise which had bound to this first B

WO 03556 2 p g g 4 9 5 PCT/US91/05753 phenyl sepharose column eluted at low salt (with the TE-DTT wash), and the balance of the bound material eluted with 2 M urea in 20% ethylene glycol in TE-DTT wash.
The flow-through activity from the first phenyl sepharose column was designated PSII load (226 ml) and contained 1.76 g protein. Fraction PSII load was S applied to a second phenyl sepharose column (of the same lot and dimensions), and the run was repeated the same way. Again, the capacity of the column was exceeded, and activity was found to elute with both the low salt and 2 M urea washes. Only 10% of the bound DNA polymerise eluted with the TE-DTT wash; the major portion (--90%) eluted with the 2 M urea in 20% ethylene glycol in TE-DTT wash.
The flow-through activity from the second phcnyl sepharose column was combined with the TE-DTT eluates from the first and second phenyl scpharose columns and adjusted to 0.3 M ammonium sulfate. This fraction (PSIII load, 259.4 ml) contained 831 mg protein and was reapplied to a third phenyl sepharose column of 50 ml bed volume at 10 mUcm2/hr. This time; all of the applied activity was retained by the column and only eluted with the 2 M urea in 20% ethylene glycol in TE-DTT
wash.
All three urea eluates werc separately concentrated -3 to 4 fold on Amicon YM30 membranes and dialyzed into heparin sepharose loading buffer shortly after elution to avoid prolonged exposure to urea (to avoid carbamylation). The dialyzed and concentrated urea eluates were assayed for protein concentration and wcre found to vary greatly in their specific activity. Because the urea eluate from the second phenyl sepharose column contained the majority of the activity at significantly higher specific activity (--8 x 104 units of activity at -1000 units/mg protein) than the other two eluates, it was processed separately from thcm.
The dialyzed and concentrated phenyl sepharose II urea eluate was applied to a S ml bed volume heparin sepharose CL 6B (purchased from Pharmacia - LKB) column that had been equilibrated with 0.08 M KCI, 50 mM Tris-Cl, pH 7.5, 0.1 mM
EDTA, 0.2% Tween 20, and 0.5 mM DTT. This column and all subsequent columns were run at 1 bed volume per hr. All of the applied DNA polymerise activity was retained by the column. The column was washed with 17 ml of the same buffer (AZ8o to baseline) and eluted with 60 ml of a linear 80 to 500 mM KCl gradient in the same buffer.
Fractions (0.53 ml) eluting between 0.21 and 0.315 M KCl were analyzed by SDS-PAGE. The peak fractions eluting between 0.225 and 0.275 M KCl were pooled separately. The flanking fractions~w~re kept to be combined later with other fractions.
The pool of peak fractions (affigel'I load) was diluted with affigel-blue buffer without KCl to reduce its ionic strength to 0.15 M KC1.
The affigel I load fraction contained 3.4 mg of protein and was applied to a 4.3 ml affigel-blue (purchased from BioRad) column, which had becn equilibrated in mM Tris-Cl, pH 7.5, 0.1 mM EDTA, 0.2% Tween 20, 0,5 mM DTT, and 0.15 M
KCI. All of the applied Tma DNA polymerise was retained. The column was washed B

W~2/03556 ~ ~ 8 ~ ~ ~ PCT/US9l/Of753 with 15 ml of the same buffer and eluted with a 66 ml linear 0.1 S to 0.7 M

gradient in the same buffer.
Fractions (0.58 ml) eluting between 0.34 and 0.55 M KCl were analyzed by SDS-PAGE and appeared to be >90% pure. The polymerise peak fractions were no 5 longer contaminated with site-specific endonuclease (indicated by absence of lower-molecular-weight specific DNA fragments after one or twenty-two hours incubation at 65'C with 2 units of Tma polymerise using 600 ng of plasmid pLSG 1 (ccc-DNA)).
The polymerise peak fractions eluting between 0.3 and 0.55 M were pooled and _ concentrated ~20-fold on an Amicon YM 30 membrane. This fraction was then diafiltered into 2.5 x storage buffer (50 mM Tris-Cl, pH ?.5, 250 mM KCI, 0.25 mM
EDTA, 2.5 mM DTT, and 0.5% Tween 20 [Pierce, Surfact-Amps]) and stored at 4'C.
The urea eluates from the first and third phenyl sepharose columns were combined with the flanking fractions from the first heparin sepharose column.
This pool (HSII load) contained --200 mg protein and wis diluted with heparin sepharosc buffer without KCl to adjust its ionic strength to 80 mM KCl. HSII load was applied .
to a 16 ml bed volume heparin sepharose column (equilibrated in 80 mM KC1, 50 mM'-Tris-Cl, pH 7.5, 0.1 mM EDTA, 0.2% Tween 20, and 0.5 mM DTT). No detectable polymerise acrivity appeared in the flow-through fractions.
The column was washed with 80 ml of the same buffer and eluted with a 200 ml linear 80 to 750 mM KCl gradient in the same buffer. Fractions (2 ml) eluting between 0.225 and 0.335 M KCl were combined, concentrated --5-fold on an Amicon YM 30 membrane, and dialyzed into hydroxyapatice-buffer. This fraction (HA
load) contained 9.3 mg protein and was loaded onto a 4 ml bed volume hydroxyapatite (high resolution HPT, purchased from Calbiochem) column that had been equilibrated in 10 mM potassium phosphate buffer, pH 7.5, 0.5 mM DTT, 0.1 mM EDTA, and 0.2%
Tween 20. All of the applied DNA polymerise activity was retained by the column.
The column was washed with 12 ml of the same o;.iffer and eluted with a 60 ml linear 10 to 500 mM potassium phosphate (pH 7.5) gradient. Fr. ~ ~tions (0.8 ml) eluting between 0.105 and 0.230 M potassium phosphate were ~ .alyzed by SDS
PAGE. Compared to the affig~l column I load fraction (which by SDS-PAGE
appeared to be ~10 to 20% pure), these fractions were ~5-fold less pure. The DNA
polymerise peak fractions eluting between 0.105 and 0.255 M potassium phosphate were combined, concentr4~ed -3-fold on an Amicon YM 30 membrane, and diafiltered into affigel-blue buffer.
The affigel II load fraction was applied to a 3 ml bed volume affigel-blue column that had been equilibrated in affigel-blue buffer. No detectable DNA
polymerise activity appeared in the flow-through fractions. The column was washed with 9 ml of the same buffer and eluted with a 50 ml linear 0.2 to 0.7 M KCl gradient in :he same buffer. Fractions (0.58 ml) eluting between 0.33 and 0.505 M KCl were B

-.., 20~949~ 38 analyzed by SDS-PAGE. Because the earlier eluting fractions looked slightly cleaner by their silver staining pattern, two pools were made. Fractions eluting between 0.31 and 0.4 M KCl were combined into pool I; fractions eluting between 0.4 and 0.515 M
KCl were combined into pool II. The two pools were each separately concentrated ~7-fold on an Amicon YM 30 membrane.
All three affigel-blue pools still contained high levels of contaminating, non-specific nucleases. Upon incubation at 70°C with 1.5 units of DNA
polymerise, both a single-strand M13 DNA template and a multifragment restriction digest of a plasmid were degraded within a few hours. ~n_ i~-activity gels were run and showed that the DNA polymerise fractions had not suffered proteolytic degradation.
The two pools from the second affigel-blue column were combined and dialyzed into a phosphocellulose column buffer. The dialyzed fraction (Pll I
load) was loaded onto a 3 ml phosphocellulose column, which had been washed overnight with 25 mM Tris-Cl, pH 7.5, 50 mM KCI, 0.1 mM EDTA, 0.2°Io Tween 20, and 0.5 mM
DTT. This wash later proved to have been insufficient to equilibrate the pH of the phosphocellulose resin. Unfortunately, this was discovered after the sample had been loaded onto the column. All of the applied activity bound to the column.
The column was washed with 9 ml of loading buffer and eluted with a 45 ml linear 50 to 700 mM KCl gradient. DNA polymerise peak fractions (0.58 ml) eluting between 0.46 and 0.575 M KCl were analyzed by SDS-PAGE.
Separation of contaminating proteins was observed throughout the peak: a ~-45 kDa contaminating band elutes at 0.53 M KCI; an ~85 kDa contaminating band has an elution peak at 0.54 M KCI. Therefore, this column was repeated (loading at somewhat higher ionic strength considering the elution profile of the polymerise). The peak fractions, eluting between 0.475 and 0.56 M KCl from the first phosphocellulose column were combined with the pool from the first affigel column. The combined fraction (Pll II load) now contained all of the purified polymerise (~7.5 x 104 units).
Fraction Pll II load was diluted with phosphocellulose buffer to adjust its ionic strength to 0.2 M KCI. Pll Il load was loaded onto a 9 ml bed volume phosphocellulose column, which, this time, had been equilibrated to the correct pH and ionic strength of 25 mM Tris-Cl, pH 7.5, 200 mM KCI, 0.1 mM EDTA, 0.2% Tween 20, and 0.5 mM DTT. The column was washed with 27 ml of the same buffer and was intended to be eluted with a 140 ml linear 0.2 to 0.8 M KCl gradient. However, instead of an upper limit buffer of 0.8 M KCI, the buffer had a concentration of 52 mM
KCl which resulted in a gradient decreasing in salt. The column was then reequilibrated with 32 ml of 0.2 M KCl-phosphocellulose buffer, and the 140 ml linear 0.2 to 0.8 M KCl gradient was reapplied.
The routine assays of flow-through, wash, and gradient fractions showed that, at this higher pH (pH 7.5), the DNA polymerise does not bind to the phosphocellulose WO 92/03556 ~ ~ ~ PGT/US91/05753 resin at 0.2 M KCI. The DNA polymerise activity containing fractions from the flow-through, wish, and decreasing salt-gradient-fractions were combined. The resulting pool was concentrated on an Amicon YM30 membrane. However, a mishap with the concentrator led to further losses of DNA polymerise activity. The recovered activity was dialyzed into phosphocellulose buffer with 50 mM KCl and designated Pll III load.
This fraction was loaded onto a 5 ml bed volume phosphocellulose column that had been equilibrated with phosphocellulose buffer with 50 mM KCI. All of the applied activity was retained by the column. The column was washed with 15 ml of the same buffer and eluted with a 45 ml linear 50 to 500 mM KCl gradient in the same buffer. Fractions (0.87 ml) eluting between 0.16 and 0.33 M KCl were analyzed by SDS-PAGE and ~ ~ activity gels.
Based on the silver staining pattern, two pools were made. The peak fractions, eluting between 0.215 and 0.31 M KCI, were kept separate from the leading and trailing fractions, which were combined into a side-fractions pool. Both pools were concentrated on centricon 30 membranes and diafiltered into 2.5x storage buffer (50 mM Tris-HCI, pH 7.5, 250 mM KCI, 0.25 mM EDTA, 2.5 mM DTT, and 0.5%
Tween 20 [Pierce, Surfact-Amps]) and subsequently mixed with 1.5 volumes of 80%
glycerol.
About 3.1 x 104 units were recovered in the peak fraction; the side pool yields an additional 1 x 103 units of activity. The purified DNA polymerise was undegraded as evidenced by an unchanged migration pattern in an '~ ~ activity gel. The molecular weight as determined by gel electrophoresis of the purified DNA
polymerise is approximately 97 kDa. ~ DNA polymerise is recognized by epitope-specific antibodies that correspond to ,T~a DNA polymerise amino acid residues number through 587 (DGTP1) and 718 through 732 (DGTP3).
Synthetic oligodeoxyribonucleotides DG 164 through DG 167 are four different 16-fold degenerate (each) 22mer pools designed as "forward" primers to one of the motifs in the template binding domains (3'-most 14 nucleotides) of thermostable DNA
polymerises. This motif is the amino acid sequence_Gly-Tyr-Val-Glu-Thr and corresponds identically to the T. a~uaticus (~) DNA polymerise amino acids 718 through 722 and to the ~. lhermophilus (~ DNA polymerise amino acids 720 through 724. This motif is found in a DNA polymerise gene in all Thermus species.
The combined primer pool is 64-fold degenerate, and the primers encode a ,B~III
recognition sequence at their 5'-ends.
Forward primers DG 164 through DG 167 are shown below:

p~T/US91/05753 DG164 SEQ B7 NO: 2 5'CGAGATCTGGNTAYGTWGAAAC
DG165 SEQ ID NO: 3 5'CGAGATCTGGNTAYGTWGAGAC
DG 166 SEQ ID NO: 4 5'CGAGATCTGGNTAYGTSGAAAC
DG167 SEQ ID NO: 5 5'CGAGATCTGGNTAYGTSGAGAC
5 In these forward primers: A is Adenine; C is Cytidine; G is Guanidine; T is Thymine;
Y is C+T (pYrimidine); S is G+C (Strong interaction; 3 H-bonds); W is A+T
(Weak interaction; 2 H-bonds); and N is A+C+G+T (aNy).
Synthetic oligodeoxyribonucleotides DG 160 through DG 163 are four different 8-fold degenerate (each) 20mer pools designed as "reverse" primers to one of the 10 motifs in the template binding domains (3'-most 14 nucleotides) of thermostable DNA
polymerises. These primers are designed to complement the (+)-strand DNA
sequence that encodes the motif Gln-Val-His-Asp-Glu and that corresponds identically to the Tea DNA polymerise amino acids 782 through 786 and to the T t DNA polymerise amino acids 784 through 788. This motif is found in a DNA polymerise gene in all ~'hermus 15 species. The combined primer pool is 32-fold degenerate, and the primers encode an SRI recognition sequence at their 5'-ends.
Reverse primers DG 160 through 163 are shown below:

DG160 SEQ m NO: 6 5'CGGAATTCRTCRTGWACCTG

DG161 SEQ ID NO: 7 5'CGGAATTCRTCRTGWACTTG

20 DG 162 SEQ m NO: 5'CGGAATTCRTCRTGSACCTG

DG163 SEQ ID NO: 9 5'CGGAATTCRTCRTGSACTTG

In these reverse primers A, C, G, T, S, and W are as defined above, and R is G+A
(puRine).
To amplify an ~230bp fragment of the Tma DNA polymerise gene, a PCR
25 amplification tube was prepared without MgCl2 that contained in 80 N.l: (1) 5 ng denatured Tma genomic DNA; (2) 50 pmoles (total) of the combined forward primer set DG164-DG167; (3) 50 pmoles (total) of the combined reverse primer set DG160-DG163; (4) 2 units ~ DNA polymerise; (5) 50 p.M each (final) dNTP; (6) 0.05%
Laureth-12; and (7) standard PCR buffer except no magnesium chloride.
30 The sample was flash-frozen at -70'C and then stored at -20'C. The frozen sample was carefully layered with 20 ~t.l of IOmM MgCl2 (final concentration 2 mM), immediately overlayed with 50 ~tl of mineral oil, and cycled in a Perkin Elmer Cetus Thermal Cycler according to the following file: ( 1 ) step to 98°C -hold 50 seconds; (2) step to 50'C - hold 10 seconds; (3) ramp to 75'C over 4 minutes; and (4) step to 98'C.
35 The file was repeated for a total of 30 cycles. One-fifth (20 ~.1) of the amplification product was purified on a 3% Nusieve/1% Seakem agarose composite gel, and the approximately 230 by fragment was eluted, concentrated, and digested with Bgl_II and EcoRI.

2~~~~~5~

Synthetic oligodeoxyribonucleoddes DG 154 and DG 155 are two different 32-fold degenerate (each) l9mer pools designed as "forward" primers to one of the motifs in the primeraemplate binding domains (3'-most 11 nucleotides) of thermostable DNA
polymerises. This motif is the tetrapeptide sequence Thr-Ala-Thr-Gly and corresponds identically to the ~ DNA polymerise amino acids 569 through 572 and to ~ DNA
polymerise amino acids 571 through 574. This motif is found in a DNA
polymerise gene in all Thermos species. The combined primer pool is 64-fold degenerate and the primers encode a ,~g~II recognition sequence at their 5'-ends.
Forward primers DG 154 and DG 155 are presented below:
DG154 SEQ m NO: 10 CGAGATCT~ CNGCNACWGG
DG155 SEQ ID NO: 11 CGAGATCTACNGCNACSGG
In these forward primers, A, C, G, T, S, W, and N are as defined above.
To amplify an approximately -667bp fragment of the ~ DNA polymerise gene, a PCR amplification tube was prepared without MgCl2 that contained, in 80 E,tl:
(1) 5 ng denatured ~ genomic DNA; (2) 50 pmoles (total) o~ she combined forward primer set DG154-DG155; (3) 50 pmoles (total) of the combined reverse primer set DG160-DG163; (4) 2 Units of ~q DNA polymerise; (5) 50 ~,M each (final) dNTP;
(6) 0.05% Laureth 12; and (7) standard PCR buffer except no magnesium chloride.
The sample was flash-frozen at -70°C and then stored at -20°C. The frozen sample was carefully layered with 20 ~tl of 10 mM MgCl2 (final concentration 2 mM), immediately overlayed with 50 ~tl of mineral oil, and cycled in a Perldn Elmer Cetus Thermal Cycler according to the following file: (1) step to 98°C - hold 50 seconds; (2) step to 55°C - hold 10 seconds; (3) ramp to 75°C over 4 minutes;
(4) step to 98°C. The file was repeated for a total of 30 cycles.
One-fifth 20 ~tl) of the amplification product was purified on a 1.5% agarose gel, and the approximately 670 by fragment was eluted, concentrated, and digested with $g~II and SRI as above.
These amplification reactions yielded a 667 by fragment and a 230 by fragment, which was a subfragment of the 667 by fragment. These fragments proved useful in obtaining the complete coding sequence for the Tma DNA polymerise I gene, as described in the following example.

Cloning the Thermotoga maritima fTma) DNA Polvmerase I Gene This Example describes the strategy and methodology for cloning the Tma DNA
polymerise I (Tma Pol I) gene of Thermoto~_a maritima.
The DNA sequences of the PCR products generated with primers DG164-167 and DG 160-163 (230 bp) and DG 154, 155 and DG 160-163 (667 bp) contain an XmaI

WO~/03556 ~ PCT/US91/05753 restriction site recognition sequence, 5'CCCGGG. Oligonucleotides were designed to hybridize to sequences upstream and downstream of the Xmal site. DG224 is a 2lmer, homologous to the PCR products 59-79 by 3'-distal to the Xmal site. DG225 is a 22mer, homologous to the PCR products from the r~I site to 2lbp upstream (5') of the Xmal site. The sequence of DG224 and of DG225 is shown below (K is G or T).
DG224 SEQ ID NO: 12 5'ACAGCAGCKGATATAATAAAG
DG225 SEQ ID NO: 13 5'GCCATGAGCTGTGGTATGTCTC
DG224 and DG225 were labelled by tailing with biotin-dUTP and terminal transferase in reactions designed. to add approximately 8 biotin-dUMP residues to the 3'-end of oligonucleotides. These labelled oligonucleotides were used as probes in Southern blot analysts of restriction digests of genomic ~ DNA. A preliminary restriction map was generated based on the Southern analysis results, and the DNA sequences of the PCR products that were generated as described in Example 2.
The preliminary map showed that the entire DNA polymerise gene is contained in two XmaI fragments. Most of the gene, including the 5'-end, resides on ~
an approximately 2.6 kb ~,I fragment. The remainder of the gene (arid the 3'-end) resides on an approximately 4.2 kb ~I fragment. The two ~I fragments containing the entire Tma DNA polymerise gene were cloned into plasmid pBS
13+"~
(also called pBSMl3+j as described below. , About 40 micrograms of ~m genomic DNA were digested to completion with Xm . The Xmal digest was size-fractionated via electroelution. Slot blot analyses of a small portion of each fraction, using Y 32p-ATp-kinased DG224 and DG225 probes, identified the fractions containing the 4.2 kb 3'-fragment (hybridizing with DG224) and the 2.6 kb 5'-fragment (hybridizing with DG225). Fractions were concentrated via ethanol precipitation and then ligated with Xmai-digested pBS 13+
(Stratagene).
Ampicillin-resistant transformants were selected on nitrocellulose filters and the filters probed with Y-32P-ATP-kinascd DG224 or DG225 probe as appropriate. Plasmid DNA was isolated from colonies that hybridized with probe. Restriction analysis was performed to confirm that fragments were as expected and to dcterinirte orientation of fragments relative to the pBS 13+ vector.
DNA sequence analysis of the cloned fragments was performed using the "universal" and "reverse" sequencing primers (which prime in the vector, outside the restriction site polylinker region). In addition, for ~'-clones, the primers used to determine the DNA sequence of the DG154-1~5/DG160-163 667 by PCR clone were employed. Preliminary DNA sequence analysis confirmed that the desired DNA
fragments containing the Tma DNA polymerise gene had been cloned From the preliminary DNA sequence, further sequencing primers were designed to obtain DNA sequence of more internal regions of the fragments. In addition, to facilitate D:~A sequence analysis, several deletions of the two XmaI
B

fragments were made. For both orientations of the 2.6 kb 5'-fragment, EcoRI, SacI, and X~I digests were each diluted and ligated under conditions that favored intramolecular ligation, thus deleting DNA between the vector F~gRI, ~I, and X~I
sites and the corresponding sites in the ~ ~I fragment. Such internal deletions allow ready DNA sequence analysis using the "universal" or "reverse"
sequencing primers.
Similarly, a deletion of the 4.2 kb 3'-fragment was made, fusing the ~~HI
site of the vector with the III site approximately 650 by from the ~ Pol I
internal ~I site in that clone ($~r~r HI and $gIII have identical GATC cohesive ends that ligate readily with one another). This deletion allows for DNA sequence analysis of the 3'-end of the ~ Pol I gene.
Restriction site analysis reveals that both the 2.6 kb 5'-fragment and the 4.2 kb 3'-fragment lack NcoI, l~leI, and ~I restriction sites. Knowing the ATG start and coding sequence of the Tma Pol I gene, one can design oligonucleotides that will alter the DNA sequence at the ATG start to include an l~gI, T~I, or ~I restriction site ._ via oligonucleotide site-directed mutagenesis. In addition, the mutagenic oligonucleotides can be designed such that a deletion of sequences between the j~
promoter in the pBS 13+ vector and the beginning of the Tma Pol I gene is made concurrent with the inclusion of an T~eI or t~gI recognition sequence at the ATG start.
The deletion of sequences between the l~c promoter in the vector and start of the r~ Pol I gene would also eliminate the restriction site in the deleted region, thus making it convenient to assemble the entire coding sequence in an expression plasmid using conventional skill in the art (see, e.g., synthesis protocols for pDG
174 - pDG 181 in U.S. 5,789,224, U.S. 5,693,517, U.S. 5,641,864, U.S. 5,618,711, U.S.
5,561,058, U,S. 5,407,800 and U.S. 5,310,652 (Patent Family A), and Example 5).

PCR With Tma DNA Po erase About 1.25 units of the ~ DNA polymerise purified in Example 1 is used to amplify rRNA sequences from Tth genomic DNA. The reaction volume is 50 ~tl, and the reaction mixture contains 50 pmol of primer DG73, 105 to 106 copies of the Tth genome (--2 x 105 copies of genome/ng DNA), 50 pmol of primer DG74, 200 ~Nl of each dNTP, 2 mM MgCl2, 10 mM Tris-HCI, pH 8.3, 50 mM KCI, and 100 ~tg/ml gelatin (optionally, gelatin may be omitted).
The reaction is carried out on a Perkin-Elmer Cetus Instruments DNA Thermal Cycler. Twenty to thirty cycles of 96'C for 15 seconds; 50'C for 30 seconds, and 75'C for 30 seconds are carried out. At 20 cycles, the amplification product (160 by in size) can be faintly seen on an ethidium bromide stained gel, and at 30 cycles, the product is readily visible (under UV light) on the ethidium bromide stained gel.
B

WO 92/03556 ~ ~-~, PGT/US91/05753 -.~,.
~~95 .Y

The PCR may yield fewer non-specific products if fewer units of T~ DNA
polymerise are used (i.e., 0.31 units/50 wl reaction). Furthermore, the addition of a non-ionic detergent, such as laureth-12, to the reaction mixture to a final concentration of about 0.5% to 1% can improve the yield of PCR product.
Primers DG73 and DG74 are shown below:
DG73 SEQ 117 NO: 14 5' TACGTTCCCGGGCCTTGTAC
DG74 SEQ ID NO: 15 5' AGGAGGTGATCCAACCGCA
Vectors for Tma DNA Polvmerase A. Mutasenesis of the 5' and 3' Ends of the Tma Pol I Gene The 5' end of the Tma gene in vector pBS:Tma7-1 (ATCC No. 68471, later renamed pTma01) was mutagenized with oligonucleotides DG240 and DG244 via oligonucleotide site-directed mutagenesis. Plasmid pBS:Tma7-1 consists of the 2.6 kb 5' I fragment cloned into vector pBS 13+. Resultant mutants from both mutageneses had deletions between the ATG of (3-galactosidase in the pBS+
vector and the ATG of ~ Pol I so that the Tma coding sequence was positioned for expression utilizing the vector ~ promoter, operator, and ribosome binding site (RBS).
Both sets of mutants also had alterations in the second and sixth colons for Tma Pol I
to be more compatible with the colon usage of ,~. Eli without changing the amino acid sequence of the encoded protein. In addition, DG240 placed an ~I restriction site at the ATG
start of the coding sequence (5'CATATGI, and DG244 placed an ,~I restriction site at the ATG start of the coding sequence (5'CCATGG). DG240 mutant candidate colonies were screened with [y32P]-labelled oligonucleotide DG241, and DG244 mutant candidate colonies were screened with [y32P]-labelled oligonucleotide DG245.
Plasmid DNA was isolated from colonies that hybridized with the appropriate probes, and mutations were confirmed via restriction analysis and DNA sequence analysis. The DG240 mutant was named pTmaS'Nde#3 and later renamed pTma06. The DG244 mutant was named pTmaS'Nco#9 and later renamed pTma07.
The 3'-end of the Tma Pol I gene was mutagenized in pBSTma3'11-1 BamBgl (ATCC No. 68472, later renamed pTma04) with mutagenic oligonucleotide DG238.
Plasmid pBSTma3'11-1 BamBgl was constructed as described in Example 3 by cloning the 4.2 kb 3' ~I fragment into pBSl3+, digesting the resulting plasmid with ~~HI and III, and circularizing by ligation the large fragment from the digestion.
DG238 inserts EcoRV and sites immediately downstream of the TGA stop colon. Mutant colony candidates were identified with [~2P]-labelled oligonucleotide DG239. Plasmid DNA isolated from positive colonies was screened for appropriate WO 92/03556 ~ ~ ~ ~ ~ ~ ~ PGT/US91/05753 ,...
restriction digest patterns, and the DNA sequence was confirmed. Une correct plasnud obtained was designated as pTma3'mut#1 and later renamed pTma05.
B. Assembling the Full-Len~~h Gene in a lac Promoter Vector For purposes of studying low level expression of ~ Pol I in ~. ~ and 5 possible complementation of ~. ~i polymerise mutants by r~r Pol I (where high level expression might kill the cell, but where low level expression might rescue or complement), the ~n Pol I gene was assembled in the pBS 13+ cloning vector. An 300 by ~I to EcoRV fragment from pTma3'mut#1 was isolated and purified, following agarose gel electrophoresis and ethidium bromide staining, by excising an 10 agarose gel slice containing the 300 by fragment and freezing in a Costar spinex filter unit. Upon thawing, the unit was spun in a microfuge, and the liquid containing the DNA fragment was collected. After ethanol precipitation, the fragment was ligated with each of the two 5'-mutated vectors, pTmaS'Nde#3 and pTmaS'Nco#9, which had each been digested with A~718, repaired with Klenow and all 4 dNTPs (the reaction 15 conditions are 56 mM Tris-Cl, pH 8.0, 56 mM NaCI, 6 mM MgCl2, 6 mM DTT, 5 ~tM
dNTPs, and 11 units of Klenow at 3TC for 15 minutes; then inactivate at 75'C
for 10 minutes), and then further digested with Xm The ligation was carried out in two steps. To ligate the sticky ends, the conditions were 20 ~g/ml total DNA, 20 mM Tris-Cl, pH 7.4, 50 mM NaCI, 10 mM
20 MgCl2, 40 ~.M ATP, and 0.2 Weiss units T4 DNA ligase per 20 ~tl reaction at 0'C
overnight. To ligate X718-digested, Klenow repaired blunt ends with EcoRV-digested blunt ends, the first ligations are diluted 4 to 5 fold and incubated at 15'C in the same ligation buffer, except 1 mM ATP and 10 Weiss units of T4 DNA ligase are used per 20 ~tl reaction. Ligations were transformed into DG101 host cells.
25 Candidates were screened for appropriate restriction sites, and the DNA
sequences around the cloning sites was confirmed. The desired plasmids were designated pTma08 (j~,~I site at ATG) and pTma09 ~I site at ATG).
C. Assembling the Full-Length Gene in P~l3xnression Vectors The following table describes PL promoter expression vectors used for 30 assembling and expressing full-length ~ Pol I under the control of ~, PL
promoter.
Olieonucleotide Duy~lexes Vector Site RBS* AsuII+/-** ned into nDG160 61 Am at ATG Clo or X rTn et***

pDG 174 ICI T7 - DG 106/DG 107 Amp 35 pDG 178 I~I N - DG 110/DG 111 Amp pDG182 ~I T7 + FL42/FL,43 Amp pDG184 ~I N + FL44/FL.45 Amp pDG185 VII N + FL,44/F'L45 Tet Wt~'t/03556 2 0 8 9 4 9 ~ p[T/L1S91/05753 "RBS - Phage T7 gene 10 or lambda gene N ribosome bind site.
** AsuII sites destroyed by digestion with ~.SI, repair with HIenow, and ligation of the repaired ends.
*** Antibiouc resistance determinant ampicillin or tetracycline.
The five vectors in the table are derivatives of plasmid pDG 160, if ampicillin resistant, or pDG161, if tetracycline resistant. Plasmids pDG160 and pDG161 and the scheme for constructing, vectors similar to the pDG vectors shown in the table are described in Patent Family A. The vectors confer ampicillin or tetracycline resistance and all contain the 8-toxin positive retroregulator from Bacillus thuringiensis and the same point mutations in the RNA II gene that render the plasmids temperature sensitive for copy number.
The probes and oligonucleotides described in the Table are shown below.
DG240 SEQ ID NO: 16 5'CCATCAAAAAGAAATAGTCTAGCCATATGTGTTTCCTGTGTGAAATTG
DG241 SEQ ID NO: 17 5'AAACACATATGGCTAGAC
DG244 SEQ ID NO: 18 5'CCATCAAAAAGAAATAGTCTAGCCATGGTTGTTTCCTGTGTGAAATTG
DG245 SEQ ID NO: 19 5'AAACAACCATGGCTAGAC
DG238 SEQ ID NO: 20 fGCAAAACATGGTCGTGATATCGGATCCGGAGGTGTTATCTGTGG
DG239 SEQ ID NO: 21 5'CCGATATCACGACCATG
DG106 SEQ ID NO: 22 5'CCGGAAGAAGGAGATATACATATGAGCT
DG107 SEQ ID NO: 23 5'CATATGTATATCTCCTTCTT ' DG110 SEQ ID NO: 24 5'CCGGAGGAGAAAACATATGAGCT
DGI11 SEQ ID NO: 25 5'CATATGTITTC'TCCT
FL42 SEQ ID NO: 26 5'CCGGAAGAAGGAGAAAATACCATGGGCCCGGTAC
FL43 SEQ ID NO: 27 5'CGGGCCCATGGTATTTTCTCCZTCT'T
FI,44 SEQ ID N0: 28 5'CCGGAGGAGAAAATCCATGGGCCCGGTAC
FL45 SEQ ID NO: 29 5'CGGGCCCATGGATTTTCTCCT
A three-fragment ligation was used to assemble the Tma Pol I gene in the vectors. The vectors are digested with ~I and either NCI (pDG174, pDG178) or NcoI (pDG 182, pDG 184, pDG 185). The 5' end of the r ~ Pol I gene is from pTmaS'Nde#3 digested with N~igI and ~aI or pTmaS'Nco#9 digested with 1~c I and Xmai. The 3' end of the gene is from pTma3'mut#1 digested with ~~I and EcoRV
and the -300 by fragment purified as described above.
The plasmid pDG 182 shown in the Table and the scheme above were used to construct expression vector pTmal3. The plasmid pDG184 and the scheme above were used to construct expression vectors pTmal2-1 and pTmal2-3. Plasmid pTmal2-3 differs from pTmal2-1 in that pTmal2-3 is a dimer of.pTmal2-1 produced B

WO 92/03556 ~ 0 $ 9 4 ~ ~ PCT/US91/05753 ..-during the same ligation/transformation protocol. The plasmid pDG185 and the scheme shown above were used to construct expression vector pTMal 1.
Even though a vector may contain the entire polymerise coding sequence, a shortened form of the enzyme can be expressed either exclusively or in combination with a full length polymerise. These shortened forms of ~ DNA polymerise result from translation initiation occurring at one of the methionine (ATG) colons in the coding sequence other than the 5'-ATG. The monomeric pTmal2-1 plasmid produces, upon heat induction, predominantly a biologically active thermostable DNA
polymerise lacking amino acids 1 through 139 of native ~ DNA polymerise. This approximately 86 kDa protein is the result of translation initiation at the r~thionine colon at position 140 of the ~ coding sequence and is called MET140.
In shake flask studies under the appropriate conditions (heat induction at 34'C
or 36'C, but not 38'C), the multimeric pTmal2-3 expression vector yielded a significant level of "full length" DNA polymerise (approximately 97 kDa by SDS-PAGE) and a ::.naller amount of the shortened (approximately 86 kDa) form resulting from translation initiation at Met 140. Amino-acid sequencing of the full length ~
DNA polymerise indicated that the amino-terniinal methionine was removed and the second-position alanine was present at the N-tcrminus.
Recombinant DNA Polymerise was purified from ~. ~ strain DG 116 containing plasmid pTmal2-3. The seed flask for a 10 L fermentation contained tryntone (20 g/1), yeast extract (10 g/1), NaCI (10 g/1), ampicillin (100 mg/1), and thiamine (10 mg/1). The seed flask was innoculated with a colony from an agar plate (a frozen glycerol culture can be used). The seed flask was grown at 30'C to between 0.5 to 2.0 O.D. (A6~). The volume of seed culture inoculated into the ferznentor is calculated such that the bacterial concentration is 0.5 mg dry weight/liter.
The 12.5 liter growth medium contained 60 mM K2HP04, 16 mM NaNla4HP04, 10 mM citric acid, and 1 n.lM MgS04. The following sterile components were added: 2 g/1 glucose, mg/1 thiamine, 2.5 g/1 casamino acids, 100 mg/1 ampicillin, and 100 mg/1 methicillin.
Foaming was controlled by the addition of propylene glycol as necessary, as an antifoaming agent. Airflow was maintained at 21/min.
The fermentor was inoculated as described above, and the culture was grown at 30'C for 4.5 hours to a cell density (A68o) of 0.7. The growth temperature was shifted to 35'C to induce the synthesis orecombinant ~ DNA polymerise. The temperature shift increases the copy number of the pTmal2-3 plasmid and simultaneously derepresses the lambda PL promoter controlling transcription of the modified Tma DNA
polymerise gene through inactivation of the temperature-sensitive cI repressor encoded by the defective pmphage lysogen in the host. The cells were grown for 21 hours to an optical density of 4 (A68o) and harvested by centrifugation. The resulting cell paste was stored it -70' C.

Recombinant ~ DNA polymerise is purified as in Example 6, below.
Briefly, cells are thawed in 1 volume of TE buffer (50 mM Tris-Cl, pH 7.5, and 1.0 mM EDTA with 1mM DTT), and protease inhibitors are added (PMSF to 2.4 mM, leupeptin to 1 ~tg/ml, and TLCK to 0.2 mM). The cells are lysed in an Aminco french pressure cell at 20,000 psi and sonicated to reduce viscosity. The sonicate is diluted with TE buffer and protease ,inhibitors to 5.5 X wet weight cell mass (Fraction I), adjusted to 0.3 M ammonium sulfate, and brought rapidly to 75'C and maintained at 75'C for 15 min. The heat-treated supernatant is chilled rapidly to 0'C, and the E_. ,~li' cell membranes and dentaured proteins are removed following centrifugation at 20,000 X G for 30 min. The supernatant containing ~ DNA polymerise (Fraction II) is saved. The level of Polymin P necessary to precipitate >95% of the nucleic acids is deternnined by trial precipitation (usually in the range of 0.6 to 1% w/v).
The desired amount of Polymin P is added slowly with rapid stirring at 0'C for 30 min. and the suspension centrifuged at 20,000 X G for 30 min. to remove the precipitated nucleic acids. The supernatant (Fraction III) containing the DNA polymerise is saved.
Fraction III is applied to a phenyl separose column that has been equilibrated in 50 mM Tris-Cl, pH 7.5, 0.3 M ammonium sulfate, 10 mM EDTA, and 1 mM DTT.
The column is washed with 2 to 4 column volumes of the same buffer (A~o to baseline), and then 1 to 2 column volumes of TE buffer containing 100 mM KCI
to remove most contaminating ~. ~1' proteins. Tma DNA polymerise is then eluted from the column with buffer containing 50 mM Tris-Cl, pH 7.5, 2 M urea, 20% (w/v) ethylene glycol, 10 mM EDTA, and 1 mM DTT, and fractions containing DNA
polymerise activity are pooled (Fraction IV).
Final purification of recombinant Tma DNA polymerise is achieved using heparin sepharose chromatography (as for native or MET284 recombinant DNA
polymerise), anion exchange chromatography, or affigel blue chromatography.
Recombinant Tma DNA polymerise may be diafiltered into 2.SX storage buffer, combined with 1.5 volumes of sterile 80% (w/v) glycerol, and stored at -20°C.
Expression of a Truncated Tma Polymerise MET284 As noted above, expression plasmids containing the complete ~n gene coding sequence expressed either a full length polymerise resulting from translation initiation at the start codon or a shortened polymerise resulting from translation initiation occurring at the methionine codon at position 140. A third methionine codon that can act as a translation initiation site occurs at position 284 of the Tma gene coding sequence. Plasmids that express a DNA polymerise lacking amino acids 1 through of native ~ DNA polymerise were constructed by introducing deleting corresponding regions of the Tma coding sequence.

~' 2089495 Plasmid pTmal2-1 was digested with BsuHl (nucleotide position 848) and indIl? (nucleotide position 2629). A 1781 base pair fragment was isolated by agarose gel purification. To separate the agarose from the DNA, a gel slice containing the desired fragment was frozen at -20'C in a Costar spinex filter unit. After thawing at room temperature, the unit was spun in a microfuge. The filtrate containing the DNA
was concentrated in a Speed Vac concentrator, and the DNA was precipitated with ethanol.
The isolated fragment was cloned into plasmid pTmal2-1 digested with T~I
and ~;dIII. Because ~I digestion leaves the same cohesive end sequence as digestion with 1, the 1781 base pair fragment has the same cohesive ends as the full length fragment excised from plasmid pTmal2-1 by digestion with ~I and it dIII. The ligation of the isolated fragment with the digested plasmid results in a fragment switch and was used to create a plasmid designated pTmal4.
Plasmid pTmalS was similarly constructed by cloning the same isolated fragment into pTmal3. As with pTmal4, pTmalS drives expression of a polymerise that lacks amino acids 1 through 283 of native ~ DNA polymerise; translation initiates at the methionine colon at position 284 of the native coding sequence.
Both the pTmal4 and pTmalS expression plasmids expressed at a high level a biologically active thermostable DNA polymerise of molecular weight of about 70 kDa;
plasmid pTmalS expressed polymerise at a higher level than did pTmal4. Based on similarities with ~. ~(i Pol I Klenow fragment, such as conservation of amino acid sequence motifs in all three domains that are critical for 3'-5' exonuclease activity, distance from the amino terminus to the first domain critical for exonuclease activity, and length of the expressed protein, the shortened form (ME'T284) of Tma polymeras°
should possess 3'-5' exonuclease and proof reading activity but lack 5'-3' exonuclease activity. However, initial SDS activity gcl assays and solution assays for 3'-5' exonuclease activity suggested significant attenuation in the proof reading activity of the polymerise expressed by ~. ~ host cells harboring plasmid pTmalS.
MET284 ~ DNA Polymerise was purified from ~. ~ strain DG 116 containing plasmid pTmalS. The seed flask for a 10 L fermentation contained tryptone (20 g/1), yeast extract ( 10 g/1), NaCI ( 10 g/1), glucose ( 10 g/1), ampicillin (50 mg/1), and thiamine ( 10 mg/1). The seed flask was innoculated with a colony from an agar plate (a frozen glycerol culture can be used). The seed flask was grown at 30'C to between 0.5 to 2.0 O.D. (A6go). The volume of seed culture inoculated into the fermentor is calculated such that the bacterial concentration is 0.5 mg dry weight/liter.
The 10 liter growth medium contained 25 mM KH2P04, 10 mM (NH4)2S04, 4 mM sodium citrate, 0.4 mM FeCl3, 0.04 mM ZnCl2, 0.03 mM CoCl2, 0.03 mM CuCl2, and 0.03 mM
H3B03. The following sterile components were added: 4 mM MgS04, 20 g/1 glucose, 20 mg/1 thiamine, and 50 mg/1 ampicillin. The pH was adjusted to 6.8 with NaOH
and 2Q8~4~5 50 controlled during the fermentation by added NH40H. Glucose was continually added by coupling to NH40H addition. Foaming was controlled by the addition of propylene glycol as necessary, as an antifoaming agent. Dissolved oxygen concentration was maintained at 40%.
The fermentor was inoculated as described above, and the culture was grown at 30°C to a cell density of 0.5 to 1.0 X lOlo cells/ml (optical density [A~] of 15). The growth temperature was shifted to 38°C to induce the synthesis of MH
TT284 ~ DNA
polymerise. The temperature shift increases the copy number of the pTmalS
plasmid and simultaneously derepresses the lambda PL promoter controlling transcription of the modified ~ DNA polymerise gene through inactivation of the temperature-sensitive cI repressor encoded by the defective prophage lysogen in the host.
The cells were grown for 6 hours to an optical density of 37 (A~o) and harvested by centrifugation. The cell mass (ca. 95 g/1) was resuspended in an equivalent volume of buffer containing 50 mM Tris-Cl, pH 7.6, 20 mM EDTA and 20% (w/v) glycerol. The suspension was slowly dripped into liquid nitrogen to freeze the suspension as "beads" or small pellets. The frozen cells were stored at -70°C.
To 200 g of frozen beads (containing 100 g wet weight cell) were added 100 ml of 1X TE (50 mM Tris-Cl, pH 7.5, 10 mM EDTA) and DTT to 0.3 mM, PMSF to 2.4 mM, leupeptin to 1 ~.g/ml and TLCK (a protease inhibitor) to 0.2 mM. The sample was thawed on ice and uniformly resuspended in a blender at low speed. The cell suspension was lysed in an Aminco french pressure cell at 20,000 psi. To reduce viscosity, the lysed cell sample was sonicated 4 times for 3 min. each at 50°!o duty cycle and 70% output. The sonicate was adjusted to 550 ml with 1X TE containing 1 mM
DTT, 2.4 mM PMSF, 1 ~tg/ml leupeptin and 0.2 mM TLCK (Fraction I). After addition of ammonium sulfate to 0.3 M, the crude lysate was rapidly brought to 75°C in a boiling water bath and transferred to a 75°C water bath for 15 min.
to denature and inactivate ~. ~ host proteins. The heat-treated sample was chilled rapidly to 0°C and incubated on ice for 20 min. Precipitated proteins and cell membranes were removed by centrifugation at 20,000 X G for 30 min. at 5°C and the supernatant (Fraction II) saved.
The heat-treated supernatant (Fraction II) was treated with polyethyleneimine (PEI) to remove most of the DNA and RNA. Polymin P (34.96 ml of 10% [w/v], pH
7.5) was slowly added to 437 ml of Fraction II at 0°C while stirring rapidly. After 30 min. at 0°C, the sample was centrifuged at 20,000 X G for 30 min. The supernatant (Fraction III) was applied at 80 ml/hr to a 100 ml phenylseparose column (3.2x12.5 cm) that had been equilibrated in 50 mM Tris-Cl, pH 7.5, 0.3 M ammonium sulfate, 10 mM EDTA, and 1 mM DTT. The column was washed with about 200 ml of the same buffer (A~o to baseline) and then with 150 ml of 50 mM Tris-Cl, pH 7.5, 100 mM
KCI, 10 mM EDTA and 1 mM DTT. The MET284 Tma DNA polymerise was then 20~940~

eluted from the column with buffer containing 50 mM Tris-C1, pH 7.5, 2 M urea, 20%
(w/v) ethylene glycol, 10 mM EDTA, and 1 mM DTT, and fractions containing DNA
polymerise activity were pooled (Fraction IV).
Fraction IV is adjusted to a conductivity equivalent to 50 mM KCl in 50 mM
Tris-Cl, pH 7.5, 1 mM EDTA, and 1 mM DTT. The sample was applied (at 9 ml/hr) to a 15 ml heparin-sephamse column that had been equilibrated in the same buffer.
The column was washed with the same buffer at ca. 14 ml/hr (3.5 column volumes) and eluted with a 150 ml 0.05 to 0.5 M KCl gradient in the same buffer. The DNA
polymerise activity eluted between 0.11-0.22 M KCI. Fractions containing the pTmalS encoded modifed ~ DNA polymerise are pooled, concentrated, and diafiltered against 2.5X storage buffer (50 mM Tris-Cl, pH 8.0, 250 mM KCI, 0.25 mM EDTA, 2.5 mM DTT, and 0.5% Tween 20), subsequently mixed with 1.5 volumes of sterile 80% (w/v) glycerol, and stored at -20'C. Optionally, the heparin sepharose-eluted DNA polymerise or the phenyl sepharose-eluted DNA polymerise can be dialyzed or adjusted to a conductivity equivalent to 50 mM KCl in 50 mM
Tris-Cl, pH 7.5, 1 mM DTT, 1 mM EDTA, and 0.2% Tween 20 and applied ( 1 mg protein/ml resin) to an affigel blue column that has been equilibrated in the same buffer.
The column is washed with three to five column volumes of the same buffer and eluted with a 10 column volume KCl gradient (0.05 to 0.8 M) in the same buffer.
Fractions containing DNA polymerise activity (eluting between 0.25 and 0.4 M KCl) are pooled, concentrated, diafiltercd, and stored as above.
The relative thermoresistance of various DNA polymerises has been compared.
At 97.5'C the half life of native ~ DNA polymerise is more than twice the half life of either native or recombinant T~,a DNA (i.e., AmpliTaq~) DNA polymerise.
Surprisingly, the half life at 97.5'C of MET284 DNA polymerise is 2.5 to 3 times longer than the half life of native ~ DNA polymerise.
PCR tubes containing 10 mM Tris-Cl, pH 8.3, and 1.5 mM MgCl2 (for T~ or native ~ DNA polymerise) or 3 mM MgCl2 (for MET284 ~ DNA polymerise), 50 mM KCl (for ~, native T~ and MET284 ~ DNA polymerises) or no KCl (for MET284 ~ DNA polymerise), 0.5 ~t.M each of primers PCRO1 and PCR02, 1 ng of lambda template DNA, 200 ~,M of each dNTP except dCTP, and 4 units of each enzyme were incubated at 97.5°C in a large water bath for times ranging from 0 to 60 min. Samples were withdrawn with time, stored at 0°C, and 5 ~1 assayed at 75°C for 10 min. in i stindard activity assay for residual activity.
~ DNA polymerise had a half life of about 10 min. at 97.5'C, while native DNA polymerise had a half life of about 21 to 22 min. at 97.5'C. Surprisingly, the MET284 form of DNA polymerise had a significanlty longer half life (50 to 55 min.) than either ~ or native Tma DNA polymerise. The improved therrnoresistance of MET284 Tma DNA polymerise will find applications in PCR, 2(1~~~~~~ s2 particularly where G+C-rich targets are difficult to amplify because the strand-separation temperature required for complete denaturation of target and PCR
product sequences leads to enzyme inactivation.
PCR tubes containing 50 ~tl of 10 mM Tris-Cl, pH 8.3, 3 mM MgCl2, 200 ~M
of each dNTP, 0.5 ng bacteriophage lambda DNA, 0.5 ~M of primer PCRO1, 4 units of MET284 Tma DNA polymerase, and 0.5 ~tM of primer PCR02 or PL10 were cycled for 25 cycles using T~" of 96°C for 1 min. and T~,~~_~~,d of 60°C for 2 min.
Lambda DNA template, deoxynucleotide stock solutions, and primers PCRO1 and PCR02 were part of the PECI GeneAmp~ kit. Primer PL10 has the sequence: (SEQ
ID NO. 45) 5'-GGCGTACCTTTGTCTCACGGGCAAC-3' and is complementary to bacteriophage lambda nucleotides 8106-8130.
The primers PCRO1 and PCR02 amplify a 500 by product from lambda. The primer pair PCRO1 and PL10 amplify a 1 kb product from lambda. After amplification with the respective primer sets, 5 ~t.l aliquots were subjected to agarose gel is elecaophoresis and the specific intended product bands visualized with ethidium bromide staining. Abundant levels of product were generated with both primer sets, showing that MET284 ~ DNA polymerase successfully amplified the intended target sequence.
Exml Expression of Truncated Tma Polymerase As noted above, host ells transformed with plasmids that contain the complete ~ DNA polymerase gene coding sequence express a shortened form (MET140) of Tma polymerise either exclusively or along with the full length polymerise.
Mutations can be made to control which form of the polymerise is expressed. To enhance the exclusive expression of the MET140 form of the polymerise, the coding region corresponding to amino acids through 139 were deleted from the expression vector.
The protocol for constructing such a deletion is similar to the construction described in Example 6: a shortened gene fragment is excised and then reinserted into a vector from which a full length fragment has been excised. However, the shortened fragment can be obtained as a PCR amplification product rather than purified from a restriction digest. This methodology allows a new upstream restriction site (or other sequences) to be incorporated where useful.
To delete the region up to the methionine codon at position 140, an ,~hI site was introduced into pTmal2-1 and pTmal3 using PCR. A forward primer (FL63) was designed to introduce the S~hI site just upstream of the methionine codon at position 140. The reverse primer (FL69) was chosen to include an X~I at position 624.
Plasmid pTmal2-1 linearized with,~maI was used as the PCR template, yielding a 22s by PCR product.

Before digestion, the PCR product was treated with 50 ~g/ml of Proteinase K
in PCR reaction mix plus 0.5% SDS and 5 mM EDTA. After incubating for 30 minutes at 37'C, the Proteinase K was heat inactivated at 68'C for 10 minutes.
This procedure eliminated any T~ polymerase bound to the product that could inhibit subsequent restriction digests. The buffer was changed to a TE buffer, and the excess PCR primers were removed with a Ccntricon 100 microconcentrator.
The amplified fragment was digested wah ~I, then treated with Klenow to create a blunt end at the ~1 I-cleaved end, and finally digested with ~I. The resulting fragment was ligated with plasmid pTtnal3 (pTmal2-1 would have been s 10 suitable) that had been digested with'j~I, repaired with Klenow, and then digested with ~I. The ligation yielded an in-frame coding.sequence with the region between the initial NcoI site (upstream of the first methionine codon of the coding sequence) and the introduced S~h_I site (upstream of the methionine codon at position 140) deleted.
The resulting expression vector was designated pTmal6.
The primers used in this example are given below.
Primer ~,QID NO: Seauence FL63 SEQ ID NO: 30 5'GATAAAGGCATGCTTCAGCTTGTGAACG
FL69 SEQ ID NO: 31 5'TGTACTTCTCTAGAAGCTGAACAGCAG
Ex m 1 Fiiminatio_n_ of lnr~eti ri RRS in MET140 Exnrescion Vectors Reduced expression of the MET140 form of ~ DNA polymerise can be achieved by eliminating the ribosome binding site (RBS) upsatam of the methioninc codon at position 140. The RBS was be eliminated via oligonucleotide site-directed mutagenesis without changing the amino acid sequence. Taking advantage of the redundancy of the genetic code, one can make changes in the third position of codons to alter the nucleic acid sequence, thereby eliminating the RBS, without changing the amino acid sequence of the encoded protein.
A mutagenic primer (FT.64) containing the modified sequence was synthesized and phosphor;dated. Single-stranded pTma09 (a full length clone having an 1~I
site) was prepared by coinfecting with the helper phage 8408, commercially available from Stra:agene. A "gapped duplex" of single stranded pTma09 and the large fragment from the '~v II digestion of pBS 13+ was created by mixing the two plasmids, heating to boiling for 2 minutes, and cooling to 65'C for 5 minutes. The phosphorylated primer was then annealed with the "gapped duplex" by mixing, heating to 80'C for 2 minutes, and then cooling slowly to room temperature. The remaining gaps were filled by extension with Klcnow and the fragments ligatcd with T4 DNA ligase, both reactions B

W,,A92/03556 2 p 8 9 ~ 9 5 PCT/US91/05753 taking place in 200 ~tM of each dNTP and 40 ~tM ATP in standard salts at 37'C
for 30 minutes.
The resulting circular fragment was transformed, into DG 101 host cells by plate transformations on nitrocellulose filters. Duplicate filters were made and the presence of the correct plasmid was detected by probing with a y32P-phosphorylated probe (FL6$). The vector chat resulted was designated pTmal9.
The RBS minus portion from pTmal9 was cloned into pTmal2-1 via an NcoI/~t I fragment switch. Plasmid pTmal9 was digested with , 1~I and ~t I, and the 620 by fragment was purified by gel electrophoresis, as in Example 7, above.
Plasmid pTmal2-1 was digested with VII, ~I, and ~I. The ~I cleavage inactivates the RBS+ fragment for the subsequent ligation step, which is done under conditions suitable for ligating "sticky" ends (dilute ligase and 40 EtM ATP).
Finally, the ligation product is transformed into DG 116 host cells for expression and designated pTmal9-RBS.
1$ The oligonucleoade sequences used in this example are listed below-Q~gQ SEQ ID NO: ,,tee uen,~
FL64 SEQ ID NO: 32 $'CTGAAGCATGTCTITGTCACCGGTTACTATGAATAT
FL6$ SEQ ID NO: 33 $'TAGTAACCGGTGACAAAG
xam 1 To effect translation initiation at about the aspartic acid colon at position 21 of the Tma DNA polymerise gene coding sequence, a methionine colon is introduced before the colon, and the region from the initial ~I site to this introduced methionine colon is deleted. The deletion process involves FCR with the same downstream primer described about (FL69) and with an upstream primer (FL66) designed to incorporate an 1~I site and a methionine colon to yield a $70 base pair product.
The amplified product is concentrated with a Centricon-100 microconcentrator to eliminate excess primers and bu:fer. The product is concentrated in a Speed Vac ""' concentrator and then resuspended in the digestion mix. The amplified product is digested with coI and Xt~I. Likewise, pTmal2-1, pTmal3, or pTmal9-RBS is digested with the same two restriction enzymes, and the digested, amplified fragment is ligated with the digested expression vector. The resulting construct his a deletion from the NCI site upstream of the start colon of the native ~ coding sequence to the new methionine colon introduced upstream of the aspardc acid colon at position 21 of the native Tma coding sequence.
Similarly, a deletion mutant can be created such that translation initiation begins at G1u74, the ~lutamic acid colon at position 74 of the native Tma coding seouence.
B

W(~/03556 2 p g 9 4 9 5 PCT/US91/05753 An upstream primer (FL67) is designed to introduce a methionine colon and an NcoI
site before G1u74. The downstream primer and cloning protocol used are as described above for the MET-ASP21 construct.
The upstream primer sequences used in this example are listed below.
S
0~~.~o SEO ID NO: a uence FL66 SEQ ID NO: 34 5'CTATGCCATGGATAGATCGCTTTCTACTTCC
FL67 SEQ ID NO: 35 5'CAAGCCCATGGAAACTTACAAGGCTCAAAGA
xam 1 10 ~xnression Vectors With T7 Promoters Expression efficiency can be altered by changing the promoter and/or ribosomal binding site (RBS) in an expression vector. The T7 GenelO promoter and RBS
have been used to drive expression of DNA polymerise from expression vector pTmal7, and the T7 GenelO promoter and the Gene N RBS have been used tn drive 15 expression of ~ DNA polymerise from expression vector pTmal8. The construction of these vectors took advantage of unique restriction sites present in pTmal2-1: an I~flII site upstream of the promoter, an ICI site downstream of the RBS, and a B~,~I site between the promoter and the RBS. The existing promoter was _ excised from pTmal2-1 and replaced with a synthetic T7 Gene 10 promoter using -20 techniques similar to those described in the p: cvious examples.
The synthetic insert was created from two overlapping synthetic oligonucleotides. To create pTmal7 (with T7 Gene 10 RBS), equal portions of and FR416 were mixed, heated to boiling, and cooled slowly to room temperature.
The hybridized oligonucleotides were extended with Klenow to create a full length 25 double stranded insert. The extended fragment was then digested with ~fIII
and I~I, leaving the appropriate "sticky" ends. The insert was cloned into plasmid pTmal2-1 digested with ~(II and 1~I. DG 116 host cells were transformed v; ith the resulting plasmid and transformanu screened for the desired plasm:~~ .
The same procedure was used in the creation of p i~mal8 (with Gene N RBS), 30 except that FR414 and FR418 were used, and the extended fragment was digested with AflII and B,~EI. This DNA fragment was substituted for the P~ promoter in plasmid pTmal2-1 that had been digested with A~III and _B~EI.
Plasmids pTmal7 and pTmal8 are used to transform ~. ~ host cells that have been modified to contain an inducible T7 DNA polymerise gene.
35 The oligonucleorides used in the construction of these vectors are listed below.
B

W~''2/03556 ~ ~ 8 9 ~ 9 5 PGT/US91/05753 FR414 SEQ 117 NO: 36 S'TCAGCTTAAGACTTCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTT-CCCTC
FR416 SEQ )D NO: 37 S 5'TCGACCATGGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGAAACC-GTTG
FR418 SEQ ID NO: 38 S'TCAGTCCGGATAAACAAAATTATTTCTAGAGGGAAACCGTTG
Example 11 Translational Cou In inQ
As described about, translational coupling can increase the efficiency of expression of a protein by coupling a short coding sequence just upstream of the initiation site of the coding sequence for the pmtein. Termination of translation of the upstream coding sequence leaves the ribosome in close proximity to the initiation site for the downstream coding sequence. The upstream coding sequence functions only to move the ribosome downstream to the start of the coding sequence for the desired protein.
Translationally coupled ~ expression vectors were constructed with the translation initiation signal and first ten colons of the T7 bactcriophage major capsid protein (gene 10) fused in-frame to the last six colons of ~. ~1'~ TrpE placed upstream of the ~ coding region. The TGA (stop) colon for TrpE is "coupled" with the ATG
(start) colon for the ~ gene, forming the sequence TGATG. A one base flame-shift is required between translation of the short coding sequence and translation of the Tma coding sequence.
In the example below, a fragment containing the T7 Gene 10-~. ~ TrpEITrpD
fusion product (the last 6 colons and TGA stop colon from TrpE along with the overlapping ATG start colon from TrpD) was transferred from a pre-existing plasmid.
One of ordinary skill will recognize that the T7 Gene 10-~. ~ TrpE~I'rpD
fusion product used in the construction of the transladonally coupled expression vectors can be constructed as a synthetic oligonucleotide. The sequence for the inserted fragment is listed below.
The T7 Gene 10-E. c2li TrpE~I"rpD fusion product was amplified from plasmid pSYC1868 with primers FL.48 and FL49. With primers FL51 and FL53, the 5' end of the ~ Pol I gene in pTma08 (a full length clone containing an 1~I site) was amplified from the ATG start colon to the MroI site downstream of the ATG
start colon. The primers FL51 and FL49 were designed to leave overlapping regions such that the two amplified products could be annealed and extended, essentially as B

s7 described in Example 10. The two amplification products were mixed, heaed to 95'C, slowly cooled to room temperature to anneal, and extended w ith ~aq polymerase.
the extended insert v: as amplified with primers FL48 and FL53 and then digested with ~I and ~I. Plasmid pTmal2-1 was digested with ~I and treated with calf intestine alkaline phosphatase to prevent re-ligation. The digested pTmal2-1 was ligated with the insert. DG 116 host cells were transformed with the resulting construct and transformants screened for the desired plasmid DNA. The resulting vector was designated pTma20.
The soqucnces of the oligonucleotide primers and the T7 Gene 10-~. ~f TrpEn'rpD fusion product (Gene 10 insert) arc listed below.
'm r SEO m NO: Seaue~c FL48 SEQ ID NO: 5'TCCGGACTITAAGAAGGAGATATAC

FL49 SEQ ID NO: S'AATAGTCTAGCCATCAGAAAGTCTCCTGTGC

IS FL51 SEQ )D NO: 5'AGACTZTCTGATGGCTAGACTATTTCIT _ FL53 SEQ ID NO: 5'CTGAATCAGGAGACCCGGGGTCTTTGGTC -GenelO insert SEQ B7 NO:
s'CTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATG
CATGCACAGGA~ACTTTCT~ATG
Exam I
Arg U tRNA Ex rcssion The pattern of codon usage differs between Thermotoga g~jg~~ and ~. ~.
In the Tma coding sequence, arginine is most frequently coded for by the "AGA"
codon, whereas this codon is used in low_ frequency in ~. ~ host cells. The corresponding "Arg U" tRNA appears in low concentrations in ~. ~I't. The low concentration in the host cell of Arg tRNA using the "AGA" codon may limit the translation efficiency of the ~ polymerase gene. The eff ciency of translation of the ~ coding sequence within an ~. ~ host may be improved by increasing the concenaation of this tRNA species by cloning multiple copies of the tRNA gene into the host cell using a second expression vector that contains the gene for the "Arg U"
tRNA.
The Arg U tRNA gene was PCR amplified from _E. Eli genomic DNA using the primers DG284 and DG286. The amplification product was digested with ~I
and ~~HI. The ~,IEI compatible vector pACYC184 was digested with ~I and ~FiI, and the Arg U gene fragment was subsequently ligated with the digested vector.
DG 101 cells were transformed, and the ligated vector was designated pARG0l.
Finally, DG116 host cells were co-transformed with pARG01 and pTmal2-1.
B

WO 92/U3556 2 0 8 9 4 9 5 p~/US91/05753 The oligonucleotide primers used in this Example are listed below Prim r SEO )17 NO: ~gg~e_nce DG284 SEQ >D NO: 43 5'CGGGGATCCAAAAGCCATTGACTCAGCAAGG
DG285 SEQ 1D NO: 44 5'GGGGGTCGACGCATGCGAGGAAAATAGACG
B

Claims (31)

CLAIMS:

1. A thermostable DNA polymerase enzyme having a molecular weight between about 97 and 103 kilodaltons that catalyzes the combination of nucleoside triphosphates to form a nucleic acid strand complementary to a nucleic acid template strand, wherein said enzyme is derived from the eubacterium Thermotoga maritima, has 3' to 5' exonuclease activity and has an optimum temperature at which it functions that is higher than about 60°C.

2. The thermostable DNA polymerase enzyme as claimed in claim 1, which has reverse transcriptase activity.

3. The thermostable DNA polymerase enzyme as claimed in claims 1 or 2, which exhibits activity from about 45°C to 90°C with an optimum temperature for activity of 75 to 80°C.

4. The thermostable DNA polymerase enzyme having the amino acid sequence encoded by the nucleotide sequence with SEQ ID NO: 1, which amino acid sequence is from amino to carboxy terminus:

5. A thermostable DNA polymerase enzyme as claimed in any one of claims 1 to 3 substantially identical to the amino acid sequence according to claim 4 or encoded by a nucleotide sequence substantially identical to the nucleotide sequence set forth in SEQ ID NO:1.

6. A thermostable DNA polymerase enzyme having an amino acid sequence substantially identical to the amino acid sequence of claim 4.

7. An enzymatically active N-terminal shortened fragment of the thermostable DNA polymerase enzyme as claimed in claim 4, which enzyme has an amino acid sequence encoded by SEQ ID NO:1, lacking up to 283 amino acids of the amino terminal sequence.

8. The fragment of claim 7, which has a molecular weight of about 70 or of about 86 kilodaltons.

9. The fragment of claim 7, which has the amino acid sequence from amino acids number 140 to 893 or amino acids number 284 to 893 in the amino acid sequence encoded by SEQ ID NO:1.

10. The fragment of any one of claims 7 to 9, that lacks 5' to 3' exonuclease activity or has attenuated 5' to 3' exonuclease activity.

11. The thermostable DNA polymerase enzyme claimed in any one of claims 4 to 6 or the fragment as claimed in any one of claims 7 to 10 which is modified by oxidation or reduction, whereby this modification does not destroy the DNA
polymerase activity or the 3' to 5' exonuclease activity of the resulting thermostable enzyme.

12. A modified thermostable DNA polymerase enzyme having 3' to 5' exonuclease activity and having an amino acid sequence which is modified by deletion, addition or alteration relative to an amino acid sequence of a reference thermostable DNA polymerase enzyme wherein the modified thermostable DNA polymerase is encoded by a nucleotide sequence substantially identical to SEQ ID NO:1 which modified thermostable DNA polymerase retains high temperature DNA polymerase activity and 3' to 5' exonuclease activity.

13. The thermostable DNA polymerase enzyme as claimed in claim 12, which is a fusion polypeptide.

14. A chimeric thermostable DNA polymerase enzyme, wherein one or two domains selected from the group of domains consisting of the 3' .fwdarw. 5' exonuclease domain, the 5' .fwdarw. 3' exonuclease domain and the DNA polymerase domain are from the polymerase enzyme having the sequence encoded by SEQ ID NO:1 and the other domain or the other two domains are substituted by codons 423-832 from the Taq DNA
polymerase or from the Tth DNA polymerase.

15. The thermostable DNA polymerase enzyme of any one of claims 4 to 6, the fragment as claimed in any one of claims 7 to 10, a modified thermostable DNA
polymerase enzyme as claimed in any one of claims 11 to 13, or a chimeric polymerase as claimed in claim 14, that comprises the sequence D-X-E-X3-L-X55-65-N-X3-D-X3-L-X65-75-Y-X3-D critical for 3' to 5' exonuclease activity, whereby X N represents the number (N) of non-critical amino acids between the specified amino acids.

16. A DNA encoding a thermostable DNA polymerase enzyme of any one of claims 4 to 6, the fragment as claimed in any one of claims 7 to 10, a modified form of said thermostable DNA polymerase enzyme as claimed in any one of claims 11 to 13, or a chimeric polymerase as claimed in claim 14.

17. The DNA having the nucleotide sequence of SEQ ID NO:1:

18. A DNA fragment of the thermostable DNA polymerase enzyme from the eubacterium Thermotoga maritima, which coding sequence has the nucleotide sequence of SEQ ID NO:1, lacking up to 849 nucleotides from the 5' end.

19. The DNA sequence of claim 18 having the nucleotide sequence from nucleotide number 418 to 2682 or from nucleotide number 850 to 2682 of SEQ ID
NO:1.

20. A DNA vector that comprises a DNA sequence as claimed in any one of claims 16 to 19.

21. A recombinant host cell transformed with a DNA vector as claimed in claim 20, which host cell is a strain of E. coli.

22. A method for purifying a thermostable DNA polymerase enzyme as claimed in any one of claims 1 to 6 or the fragment as claimed in any one of claims 7 to 10, said method comprising:
(a) preparing a crude cell extract from cells comprising said polymerase;
(b) adjusting the ionic strength of said extract so that said polymerase dissociates from any nucleic acid in said extract;
(c) subjecting the extract to hydrophobic interaction chromatography;
(d) subjecting the extract to DNA binding protein affinity chromatography;
(e) subjecting the extract to nucleotide binding protein affinity chromatography;
and (f) subjecting the extract to chromatography selected from the group consisting of anion exchange, cation exchange, and hydroxyapatite chromatography.

23. A method for the production of a thermostable DNA polymerase enzyme of any one of claims 4 to 6, a fragment as claimed in any one of claims 7 to 10, a modified form thereof as claimed in any one of claims 11 to 13, or a chimeric polymerase as claimed in claim 14, said method comprising the culturing of a host cell according to claim 21 and purifying the recombinant DNA polymerase from the medium or from the cells.

24. Use of an oligonucleotide probe directed to regions of dissimilarity between Thermus aquaticus polymerase and Thermotoga maritima polymerase, which regions include stretches of four or more contiguous amino acids from any one or more of the regions identified by the following amino acid coordinates (numbering is inclusive): 5-10, 73-79, 113-119, 134-145, 191-196, 328-340, 348-352, 382-387, 405-414, 467-470, 495-, 499, 506-512, 555-559, 579-584, 595-599, 650-655, 732-742, 820-825, 850-of the amino acid sequence encoded by SEQ ID NO:1 for retrieving a DNA
encoding a thermostable DNA polymerase enzyme from a thermostable organism, which DNA
polymerase enzyme has some properties of Thermus aquaticus polymerase and other divergent properties typical for Thermotoga maritima polymerase

25. The thermostable DNA polymerase enzyme purified by the method of claim 22 or produced by a method as claimed in claim 23.

26. A composition comprising a thermostable DNA polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, a modified form thereof as claimed in any one of claims 11 to 13, or a chimeric polymerase as claimed in claim 14 in a buffer and a stabilizing agent.

27. A composition according to claim 26, wherein said stabilizing agent is a non-ionic polymeric detergent.

28. Use of a thermostable DNA polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, or a modified form thereof as claimed in any one of claims 11 to 13, a chimeric polymerase as claimed in claim 14, or a composition according to claim 26 or claim 27 for amplifying a nucleic acid.

29. Use of a thermostable DNA polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, or a modified form thereof as claimed in any one of claims 11 to 13, a chimeric polymerase as claimed in claim 14, or a composition according to claim 26 or claim 27 for reverse transcribing RNA.

30. A process for amplifying a nucleic acid which process comprises:
(a) heating a duplex of said nucleic acid at a temperature sufficient to yield single-stranded molecules of said nucleic acid but not to a temperature which will irreversibly denature a thermostable DNA polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, or a modified form thereof as claimed in any one of claims 11 to 13, a chimeric polymerase as claimed in claim 14, or a composition according to claim 26 or claim 27;
(b) cooling products of step (a) to a temperature and for a time sufficient to promote hybridization of a primer to a single-stranded molecule resulting from step (a);
(c) maintaining a mixture resulting from step (b) for a temperature and a time in the presence of a thermostable DNA polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, or a modified form thereof as claimed in any one of claims 11 to 13, a chimeric polymerase as claimed in claim 14, or a composition according to claim 26 or claim 27 sufficient to synthesize an extension product of a primer complementary to a single-stranded molecule resulting from step (a); and (d) repeating steps (a) to (c) sufficiently often to yield an amplified amount of said nucleic acid.

31. A process for reverse transcribing an RNA which process comprises:
incubating an annealed primer and said RNA with a thermostable DNA
polymerase enzyme according to any one of claims 1 to 6, a fragment as claimed in any one of claims 7 to 10, or a modified form thereof as claimed in any one of claims 11 to 13, a chimeric polymerase as claimed in claim 14, or a composition according to claim 26 or claim 27 under conditions sufficient for said polymerase to catalyze formation of a DNA sequence complementary to a sequence of said RNA.