CA2077446A1 - Cloning and production of human von willebrand factor gpib binding domain polypeptides and methods of using same - Google Patents

Abstract

The subject invention provides non-glycosylated, biologically active polypeptides which comprise the vWF (von Willebrand Factor) GP1b binding domain. These polypeptides may be used to inhibit platelet adhesion and aggregation in the treatment of subjects with conditions such as cerebrovascular disorders and cardiovascular disorders. This invention also provides expression plasmids encoding these polypeptides as well as methods of producing by transforming a bacterial cell and recovering such polypeptides. In addition, the subject invention provides methods of treating and preventing cerebrovascular, cardiovascular and other disorders using these polypeptides to inhibit platelet aggregation.

Description

W091~13093 ~ Q ~ 7 ~ ~ ~ PCT/US91/01~16 ':.
.
; G~Ib BINDIyG DOMAIN POI,YP~P~ ND ~ET~OD~ OF ~81N~
Background of the Invention This application is a continuation-in-part of U S. Serial No. 487,767, filed March 2, l990, the contents of which are hereby incorporated by reference into the present disclosure.

Throughout this application various publications are ~ referenced within parentheses. The disclosures of these - 15 publications in their entiretie~ ~re hereby incorporated by reference in this application in order to more fully - describe the state of the art to which this invention pertains.
..
This invention relates to the cloning and produc~ion of human von Willebrand Factor analogs and methods of using such analogs.
. ' Structural Features of von Willebrand Factor Von Willebrand Factor (vWF) is a large plasma protein which is synthesized in the endothelial cells which form the inner surface lining of the blood vessel wall, and by megakarocytes, the precursor of platelets. Large amounts o~
vWF are found in platelet ~-granules, whose contents are released into the blood upon platelet activation. Newly synthesized vWF in endothelial cells may enter the blood via ; two alternative pathways. Part is secreted constitutively into the blood, mainly as disulfide-linked dimers or small multimers of a 250,000 dalton subunit. Alternatively, part enters secretory organelles called Weibel-Palade bodie~.
The vWF stored in Weibel-Palade bodies is highly multimeric, ranging in size from that of a dimer to multimers of 50 or WO91/13093 ~ 7 7 ~ ~ ~ PCT/US91~0141 ~2 .~', .

more subunits, and can be released from the cell~ by treatment with secretatogues, such as thrombin. The highly multimeric vWF is the most e~fective in pro~oting platelet adhesion.
The gene encoding vWF has been isolated and shown to be greater than 150 kb in l~ngth. It is composed of over 20 exons. The vWF mRNA is approximately 9000 bases in length and encodes a pre-pro-vWF of 2813 amino acids. Residues l-22 form a processed leader s~quence which pre~umably iscleaved a~ter entry of the protein into the rough endoplasmic reticulumO The N-terminal portion of the pro-vWF (741 amino acids) is the pro-peptide which is not present in mature vWF. This peptide is present in the blood and has been shown to be identical to a blood protein previously known as von Willebrand Antigen II (vW AgII3.
::~ The pro--peptide is essential for the multimerization of vWF.
;~- Cells into which a vWF cDNA containing only mature vWF
~ sequences have been introduced produce only dimers. No :; 20 function is known for the propeptide/vW AgII.
. . ' DNA sequence analysis has demonstrated that the pro-vWF
: pr~cursor i~ co~posed of repeated domain ~ubunits. Four difrersnt domains have been identified. Mature vWF con~ists .... .
Z5 of three A type, three B type, and two C type domains.
- There are al~o two complete and one partial D type domain.
-. The pro-peptide consists of two D type domains, leading to the speculation that it may have associated ~unctions.

Mature vWF is a multivalent molecule which has binding sites for several proteins. One of the binding sites recognizes . the platelet glycoprotein Ib (GPIb). Using proteolytic digests this site has been localiæed to the region between .~ amino acid re~idues 449 and 728 of mature vWF. In addition, vWF has a~ least two collagen binding site~, at least two .

wo gl/13093 2 0 7 7 lt e ~ PCT/US91/01416 . ..

heparin binding sites, a Factor YIII binding cite, and a RGD
site which binds to the platelet GP IIb/IIIa receptor.

Involvement Of~vWF In Platelet Adhesion ~o Subendo~Leliu~
: . 5 Evidence that vWF, and specifically, the binding o~ vWF to the platelet GPIb receptor, is essential for normal plat~let adhesion, is based on both clinical ob~ervations and in vitro studies. Patients with the bl~eding disorder von Willebrand Disease (vWD) have reduced l~vels o~ vWF or ar~
completely lacking in vWF. Altern~tively, they may have defective vWF. Another disorder, B~rnard-Souli~r Syndro~e (BSS), is characterized by platelet~ lacking GPIb receptors.
.' . 15 The in vitro system whi~h most closely approximate~ the ; environment of a damaged blood vessal consi~ts of a p~rfusion chamb~r in which an everted blood vessel segment (rabbit aorta, hu~an po~t-~orte~ xenal ar~ery~ or the hu~an umbilical artery) is exposed to ~lowing blood. Aft~r stripping off the layer of ~ndothelial cells from the vessel, blood is allowed to ~low through the cha~berO The extent o~ platelet adhesion is estimated directly by .~ morphometry or indirectly using radiolabeled platelets.
:' Blood from patients with VWD or BSS doe~ not ~upport 2s platelet adhe on in this system while normal blood does, indicating the need for vWF and platelet GPIb. ~oreover, . addition of monoclonal antibodies to GPIb prevent~ platelet adhesion as well. The vWF-dependence of platelet adhesion ; is more pronounced under conditions o~ high shear ratea, such as that present in arterial ~low. Under conditions of low shear rates, platelet adhe~ion may be facilitated by other adhesion proteins, such as fibronectin. PQssibly, the adhesive ~orces provided by these other protein~ are not adequat~ to ~upport adhesion at high shear forces, and vWF
dependence becomes apparent. Also, ~he multim~ric nature of .
.' : .
,_~,.. ,,..... , . . ,. , ,..... ,. ,. . . ........ . . ,.. , . . , ~

, . . . .

wo gl/13093 2 ~ ~ 7 ~ 4 PCTJUS91/0141( the vWF may provide for a stronger bond by binding ~ore sites on the platelet.

About 20% of patients from who~ clots have been removed by S angioplasty or by administration o~ tissue plasminogen activator (tPA) suffer re-occlusion. This is presumably the result of damage to th~ endothelium during the treatment which results in the adhe~ion o~ platelets to the affected region on the inner surface of the vessel. This i~ followed . lO by the aggregation o~ many layers of platelets and fibrin : onto the previously adhered platelets, forming a thrombus.

To date none of the anti-platelet aggregation agents described in the literature prevent the initial platelet adhesion to the exposed sub-endothelium thereby preventing subsequent clot formation.
, : The subject invention provide~ non-glycosylated~
biolo~ically active polypeptides which comprise the vWF (von Willebrand Factor) GPlb binding domain. These polypeptides may be used inter alia to inhibit platelet adhesion and aggregation in the treatment o~ subjects with conditions .
such as cerebrovascular disorderc and cardiov~cular disorders. This invention also provides expre~sion pla~mids encoding these polypeptides as we'l as methods of producing by transforming a bacterial cell and recovering such ;~ polypeptides. In addition, the subject invention provides ;~ methods of treating and preventing cerebrovaecular, cardiovascular and other disorders using these polypeptides . .to inhibit platelet aggregation.

'' :' .
. ~

., , . ''~
., :

, ....... .. ' ,. :: . !, . , ' ' ' : ' ,' . ' ~ . ,, WO~1/13093 2 G ~ 7 ~ ~ ~ PCT/~91/01416 : -5-: 3u~mary of_tho T~ve tio~ :

This invention provides a non-glycosylated, biologically :
actiYe polypeptide having the a~ino acid s~quanc~: :
.. '- .
X-A-[Cys Ser Arg Leu Lu Asp Leu Val Phe Leu Leu Asp Gly Ser Ser Arg Leu Ser Glu Ala Glu Phe Glu Val Leu Lys Ala ~ Phe Val Val ~sp Met ~et Glu Arg Leu Arg Ile Ser Gln Lys :~
: 10 TrP Val Ax~ Val Ala Val Val Glu Tyr His Asp Gly Ser His Ala Tyr Ile Gly Leu Lys Asp Arg Lys Arg Pro Ser Glu heu ~rg Arg Ile Ala Ser Gln Val ~ys ~yr Ala Gly Ser Gln Val Ala 5er Thr Ser Glu Val Leu Lys ~yr ~hr Leu Pha Gln Ile Phe Ser Lys Ile Asp Arg Pro Glu Ala Ser Arg Ile Ala Leu Leu Leu Met Ala Ser Gln Glu Pro Gln Arg Met Ser Arg Asn Phe Val ~rg Tyr Val Gln Gly Leu Lys Ly~ Lys Lys Val Ile Val Ile Pro Val Gly Ile Gly Pro Hi~ Ala Asn Leu Ly~ Gln I}e Arg Leu Ile Glu Lys Gln Ala Pro Glu A~n Lys Ala Phe Val Leu Ser Ser Val Asp Glu Leu Glu Gln Gln Arg Asp Glu : 20 Ile Val Ser Tyr Leu Cys]-B-COOH
wherein X is NH2-methionine- or NH~-;
.. ~ . .
; A is a sequence of at least l, but less than 35 a~ino : 25 acids, which se~uence is present in naturally occurring vWF, the carboxy terminal a~ino àcid of which i~ the tyrosine ~508 shown in Figure 12;

B is a sequence of at least l, but less than 211 amino acids, which sequence i5 present in naturally occurring vWF, the amino terminal a~ino acid of which is the aspartic acid #696 shown in Figure l~; and :
.
,~ the two cysteines included within the bracketed sequence ~ 35 are joined by a disulfide bond. .
., ~' ,, .

.

, , . ~ , ,~ , : . ..

WO91/~3093 ~ ~ 7 ~ ~ ~, PCT/US91/0141 In addition, the subject invention provides a method of producing any of the above described polypeptides which comprises transforming a bacterial cell with a~ expression plasmid encoding the polypep~ide, culturing th~ re~ulting bacteria~ cell so tha~ the cell produces the polypeptide encoded by ~he plasmid, and recovering tha polyp~ptide so produced.

:Furthermore, the subject invention provides a pharmaceutical composition comprising an amount of any of the above-: described polypeptides ~ffective to inhibit platelet ~ .
: aggregation and a pharmaceutically acceptable carrier. The subject invention al~o provides a ~ethod of inhibiting platelet aggregation which co~prises contacting pla~elets with an amount of any o~ the above-described polypeptides effective to inhibit platelet aggregation. In addition, the subject invention provides ~ethods of treating, preventing or inhibiting disorders such as cerebrovascular or cardiovascular disorders or thrombo~is, comprising administering to the subject an amount of any of the above-described polypeptide~ e~fective to treat or prevent such disorders.

-; The subject inv2ntion also provides a method for recovering : 25a purified, biologically active above-described polypeptide which comprises:
.~' . .
(a) producing in a bacterial cell a first polypeptide having the amino acid 30sequence of the polypeptide but lacking .
, the disulfide bond;
~, .
(b) disrupting the bacterial cell so as to ~ :
produce a lysate containing the first :~
35polypeptide;
. . .

2 ~ 7 7 i~ 4 ~ PCT/US91/01416 ~7~ :
.~ . ' "'~

. (c) treating th~ lysate so as to o~tain i`
inclusion bodie~i containing the first . polypeptide; , -~` '''"'.
5(d) contacting the inclusion bodies from step (c) so as to obtai~ the first polypeptide in soluble form;

(e) treating the resulting ~irsk polypeptide 10so as to form the biologically active polypeptide;
.~. , .
: ~ (f) recovering the biologically acti~re polypeptide so f ormed; and .I~ 15 . : (g) purifying the biologically active poly-.. peptide so recovered. :~
,1, .
'~. ..

. .
.1~ , . i .
~, .
:, ~' "' .~
~1 .
'! ..
.. ' , ~:, ' ' ' , .
. ~ . ' `
':' ' ' "
' ..

3 ~ 7 7 ~) PCT/US9t/0141' Bri~ De~or~ption o~ tha Fl~ure~

Flqure 1: Construction of pvWlP
:
This figure shows the construction of plasmid pvWlP. A
series of vWF cDNA clones in A gtll (isolated from a human :. endothelial cell cDNA library~ were isolated. On~ cDNA
clone covering the entire GPIb binding domain was subcloned into the EcoRI site of pUCl9. The resulting plasmid, pvWlP, contains a 2.5 Xb cDNA insert.

~: Fi~re 2: Construction of pVwF-vA
. ~
This ~igure shows ~he construction of plasmid pv~F-VA1. A
~; 15 synthetic oligomer containing an ATG initiation codon - located be~ore the amino acid glu-437 (i.e., the 437th a~i~
~; acid in the vWF protein shown in Figure 12) was ligated to plasmid pvWlP digested with NdeI and Bsu36I. The resulting plasmid was designated pvWF-VA1, and has been deposited in . coli strain S~930 under ATCC Accession No. 68530.
, ::
. Fiqure 3: Construction of ~vWF-VB~ :
., , :
This figure shows the construction of plasmid pvWF~VBl. A
. 25 synthetic oligomer containing an ATG initiation codon located before the a~ino acid phe-443 (see Figure 12) was ::
ligated to plasmid pvWlp digested with NdeI and Bsu36I. The resulting plasmid was designated pvWF-VB1. :

; 30 Fi~ure ~: Construction of pvWF-VA~

This figure shows the construction of plasmid pvWF-VA2. A
. synthetic oligo~er containing a TAA termination codon located after the amino acid lys-728 (see Figure 12) was ligated to plasmid pvWF-VAl digested with HindIII and XmaI.

W~ 13093 2 ~ 7 7 ~ PCT/US91/01416 The resulting plasmid was designated pvWF-V~2.

Fiqure s: construction of pvwF-vB2 This figure shows the construction of plasmid pvWF-vB2. A
synthetic oligomer containing a T~A termination codon was ligated to plasmid pvWF-VBl dige ted with HindIII and XmaI.
The resulting plasmid wa~ designated pvWF-VB2.

~ 10 ~lgy3~_~: construction of pvWF~VA3 ;' This figure shows the construction of plasmid pvWF~VA3. An NdeI-~coRV fra~men~ was isolat~d fro~ plasmid pvWF-Y~2 and ; ligated to plasmid pM~-945 (constructed as described in : 15 Figure ll) digested with Nd~I and PvuII~ The plasmid ob~ained was designated pvWF-VA3. The plas~id expresses VA, a vWF ~PIb binding domain polypeptide which includes amino , acids 437 to 728 (see Figure 12) under the control of the ,, ~;2 PlP2 prom~ter.
Fi~ur~ 7: Co~st~uctlon o~ vWF-V~3 :
;, This figure shows the construction of plasmid pvWF-VB3. An NdeI-EcoRV fragment was isolated from plas~id pv~F-VB2 and li~ated to plasmid pMF-945 digeste~ with NdeI and PvuII.
~i The plasmid obtained was designated pvWF-VB3. The plasmid : expresses VB, a vWF GPIb binding domain polypeptide which : includes amino acid~ 443 to 728 under the control of the deo , PlP2 promoter.
Fiqure 8: ~5~ uQtion oS pvWF VC3 This figure shows the construction o~ plasmid pvWF-VC3. A
synthetic linker was ligated to pvWF-VA3 digested with NdeI
and TthlllI. The plasmid obtained was designated pvWF-VC3, '~ f .'; .

'`':' ' '' . ' " , ~

' :' ' .: , . " : . ', . ' . ,' WO91/13093 2 0 7 7 '~ PCT/US91/0141 ,~ --10--':
., and has been deposited with the ATCC under ATCC Accession - No. 68241. The plasmid expresses VC (also referred to as VCL or VC3), a vWF GPIb binding domain polypeptide which includes amino acids 504 to 728 (see Fi~ure 12) under the control of the deo PlP2 promoter.

: F~y~e 9: Construction of pvWF-VI~

:~- This ~igure shows the construction of plasmid pvWF-VD3, A
synthetic linker was ligated to pvWF-VA3 digested with NdeI
and TthlllI. The plasmid obtained was designated pvWF-VD3.
The plasmid expresses VD, a ~WF GPIb binding domain poly-~; peptide which includes amino acid6 51~ to 7~8 (see Figure 12) under the control of the deo PlP2 promoter.
; 15 :
I~S~Y2Q L~: Relakive Aliqnment of Plasmids ~xpressinq vWF-Ç~LEi~inq Do~ain Po~ype~tide~
, This fi~ure shows the relative alignment o~ the plasmids : 20 expressing the vWF-GPIb binding domain polypeptides. Also shown on the top two line~ are representations o~ the vWF
cDNA and the location of the GPIb binding domain coding region within the cDNA.

iqs~ construotion of Plasmid pMF 945 : ~his figure shows the construction of plasmid pMF-945.Plas~id pEFF-920 (in EQcherichia ço~i S~930, ATCC Acces~ion No. 67706) was cleaved with Bgl~I and NdeI, and the large . 30 fragment was isolated. This ~xagment was ligated to tbe small 540 bp fragment produced by cleaving plasmid pMF-5534 . (ATCC Acc~sssion No. 67703) with BglII and NdeI. This produces plasmid p~F-945 which harbors the PAR sequence a~d in S ~ and 3' order the deo PlP2 promoter sequences, the modi~ied deo rlbosomal binding site with an enhancer .' ..
.'" '. .

WO91/13093 2 0 7 7 '~ ~ ~ PCT/US91/01416 s~quence, a p~H analog coding seguence and the TlT2 transcription termination sequence~. Plasmid pMF-945 i~ a high level expressor of pGH analog protein.

~lgY~ 3~: Translated c~A Sçquence o~ Mature Hu~an vw~

This figure which consist~ of Figures 12A, 12B, 12C, 12D, 12E, 12F, 12G and 12H ~how~ the ~ransla~ed cDNA ~quence of mature human von Willebrand Factor. ~ ;

This se~uence was compi}ed using the data disclosed by Verweij, C.L., et al., EMB0 ~ournal ~: 1839-1847 (1986) and Sadler, J.E., et al., Proc. Natl. Acad. Sci. ~: 6394 6398 . (lg85). This nucleotide sequence commences with nucleotide number 2519 (where nucleotide 1 relates to the start of the coding sequence for th~ signal peptide) and terminates with nucleotide 8668, a total of 6150 nucleotide6 encoding mature vWF consisting of 2050 amino acid6. The translated amino acid sequence commences with amino acid number 1 and terminates with a~ino acid nu~ber 20S0. The corresponding nucleotide and a~ino acid designation~ are used throughout this application.

Fi~ur~ 13, I~slated _Sequ~nce of VC, th~_ vWF GPlb ~indi~Lq ~o~ain___Polypep~ide ~xpressed by ~lasmids ~vWF-VC3 and pvWF-VC~
..
Thls figure shows the translated æequence of the von :;
Willebrand Factor GPIb binding domain polypeptide expre6~ed ;
by plasmids pvWF-VC3 (ATCC Accession No. 68241) and pvWF-YCL
(ATCC Accession No. 68242).

The first codon ATG encodi~g the translation initiation codon m~thionine has been added to tha nucleotide sequence corresponding to nucleotidas 4028 to 4702 of the sequence of WO9l/13093 ~ PCT/US91/0141 Figure 12. This sequence encodes a polypeptide ~ontaining ~;
225 amino aci~s (plu~ the initiation methionin~
correspondi~g to amino acid Leu 504 to amino acid Lys 728 of ; Figure 12, i.e. 226 amino acids in total.
~igure 1~: Construction o~ pvWF-V~L

This figure show~ the construction of pla~mid pvWF-VCL.
Plasmid pvWF~VC3 was di~ested with ~indIII and StyI and the 860 base pair fragment isolated. This fragment wa~ ligated with the large fragment isolated from the HindIII~StyI
dig~st o~ plasmid pMLR-100, The resulting plasmid was dasignated pvW~-VCL and deposited in ~ ~300 (F-) with the ATCC under ATCC Accession No. 6824~ This plas~id expresses VCL, the same vW~ GPIb binding domain polypeptide : ~:
as pvWF~VC3 (methionine plus amino acids S04-728), however .
und~r con~rol of th~ APL promot~r and the ~Q ribosomal bindinq site.
: ' "
~i~ure t5: Constructlon o~ Plasmld ~vWF-VE~ ;
.. . .
Plasmid pvWF-VA2 was digested wi~h NdeI and PstI and the large fragment isolated. Synthetic oligomers No. 2 and No. ::
3 (~hown in Figure 16) were treated with T4 polynucleotide kinase. The lar~e pvWF-VA2 fragment wa~ then ligated with synthetic oligomers No. 1 and No. 4, ~shown in Figure 16) and with kinased oligomers No. ~ and No. 3. The resulting plasmid was designated p~WF-YE2.

Figu~e _16: Synthetic Oli~omers Used in Cons~ruc~ion Q~ :
DvW~F-VE2.

. .
This figure shows tha four synthetic linkers (Nos. 1-4j used in construction of pvWF-VE2. ~-, .,, :~

. .. ... ., ~ .
.. . .
. .

2 Q 7 7 ~ ~ r3 . WO91/130~3 PCT/U~9t/01416 ~13-.
ou~ l7: Construction Q~ WF-V~3 _ Plasmid pvWF-VE2 was digested with NdeI and HindIII and the small 770 bp fra~ment isolated and ligated with the large : 5 fragment isolated from the NdeI-~indIII digest of plasmid pMLK-7891. The resulting plasmid was designated pvWF-VE3.

Fiq~rQ--l8: Construction of Pl~smid pvWF~V~

Plasmid pvWF-VE3 was digestPd with XmnI, treated with : bacterial alkaline phosphatase (BAP), and further dige~ted with NdeI and HindIII. Plasmid pMIK-100 was dige~t~d with ~deI and ~indIII and treated with BAP. The two dige~ts were mixed and ligated, producing plasmid pvWF-VEh which expr~sse~ the DNA ~equence corresponding to amino acids 469-728 of mature vWF under the control of the 1PL promoter and the cII ribo~omal binding ~ite.
..
~$gure 19: The Ef~ec~ o~_VÇ~ on BJV-I~duç~ Aqqreqa~ion in_Human Platele~ Rich Plasma ~
This figure provides the results of a standardized von Willebrand Factor (vWF)-dependent aggregation a~say u~ing human PRP.
:; :
~qur~ ~o~ fect o~ YC~ on BJV Induçed ~q~re ~tion :- in Rat PRP
This figure provide~ the results of a standardizQd von ~ Willebrand Factor (vWF)-dependent aggregation assay using ;~ rat PRP.

.

.

.
.

. . .

- .. , , .: . : -- . - , . .. .
- :. .. . .

WO91J13093 2 0 7 ~ g PCT/~S9l/0141 -P~talla~ De~c~ptin~ ;C ~ ~ve~ o~
' :.
The plasmids pvWF-VC3, pvWF-VCL and pvWF-VAl were d~posit~d in Escheric~ i pursuant to, and in satisfaction o~, the requirements Qf the Budapest Treaty on the International Recognition of the Deposit o~ Microorgani~ms for the Purposes of Patent Procedure with the American Type Culture .
Collec~ion (~TCC), 12301 Par~lawn Drive, Rockvill~, Maryland :~
20852 under ATCC Accession Nos. 68241, 68242 and 68530, respectively.

This invention provides a non-glycosylated, biologically active polypeptide having the amino acid ~equence:
. ~
: 15 X-A [Cys S2r Arg Leu ~eu Asp Leu Val Phe Leu Leu Asp Gly ; Ser Ser Arg Leu Ser Glu Ala G1U Phe G1U Val LRU Lys Ala :
Phe Val Val Asp Met ~et Glu Arg ~eu Arg Il~ Ser Gln Lys Trp Val Arg Val Ala Val Val Glu Tyr His Asp Gly Ser His Ala Tyr Ile Gly Leu Lys A6p Arg Lys Arg Pro Ser Glu Leu .~ 20 Arg Arg Ile Ala Ser Gln Val Lys Tyr ~la Gly Ser Gln Val Ala Ser Thr Ser Glu Val Leu Ly~ Tyr Thr Leu Phe Gln Ile Phe Ser Lys Ile Asp Arg Pro Glu Ala Ser Arg Ile Ala Leu .~ Leu Leu Met Ala Ser Gln Glu Pro Gln Arg Met Ser Arg Asn Phe Val ~rg Tyr Val Gln Gly Leu Lys Lys Ly~ Lys Val Ile ; 25 Val Il~ Pro Val Gly Ile Gly Pro His Ala Asn Leu Lys Gln Ile Arg Leu Ile GlU Lys Gln Ala Pro GlU Asn Lys Ala Phe Val Leu Ser Ser Val Asp Glu Leu GlU Gln Gln Arg A~p Glu Ile Val Ser ~yr Leu Cys]-~-COOH
.-.:
'' 30 wherein X is NH2-methionine- or NH2-;

, A is a sequence o~ at least 1, bUt less than 35 amino acids, which sequence is present in naturally occurring . human vWF, the carboxy terminal amino acid of which is the tyrosine ~508 shown in Figure 12;

.

W~ 91/130~3 ~ ~ 7 7 ~ PCr/US91/0141~ ~

. B is a sequence of at least 1, but less than 211 amino ;: acids, which sequence is present in naturally occurri~g : human vWF, the amino terminal amino acid of which is the . aspartic acid #696 shown in Figure 12; and : 5 the two cysteines included within the bracketed ~e~uence are joined by a disulfide bond~ The bracketed sequence comprises amino acids ~509-~695 of Figure 12.

In one embodimen~, this polypeptide has the amino acid sequence:
X-[Le~l His Asp Phe Tyr ~ys Ser Arg Leu Leu Asp Lau Val ` Phe Leu Leu Asp Gly Ser Ser Axg Leu Ser Glu Ala GlU Phe - GlU Val Leu Lys Ala Phe Val Val Asp Met Met G1U Arg L~U
Arg Ile Ser Gln Lys Trp Val Arg Val Ala Val Val G1U Tyr ; His Asp Gly Ser HiS Ala Tyr Ile Gly Leu Lys Asp Ary Lys Arg Pro Ser Glu Leu Arg Arg Ile Ala Ser Gln Val Lys Tyr Ala Gly Ser Gln Val Ala Ser Thr Ser Glu Val L~u Lys q~rr . .
~, Thr Leu Phe Gln Ile Phe Ser Lys Ile Asp Arg Pro Glu Ala .. 20 Ser Arg Ile Ala Leu Leu Leu Met Ala Ser Gln GlU Pro Gln Arg M~t Ser Arg Asn Phe Val Arg Tyr Val Gln Gly Leu Lys i Lys Lys Lys Val Ile Val Ile Pro Val Gly }}e Gly Pro His ~la Asn Leu Lys Gln Ile Arg Leu Ile Glu Lys ~ln Ala Pro Glu Asn Ly ~Ala Phe Val Leu Ser Ser Val Asp &lU Leu Glu Gln Gln Arg Asp Glu Ile Val Ser Tyr Leu Cys Asp Lou Ala Pro Glu Ala Pro Pro Pro Thr Leu Pro Pro Asp Met Ala Gln . Val Thr Val Gly Pro Gly Leu Leu Gly Val Ser Thr Leu Gly Pro LysJ-COOH
.. . .
wherein X is NH2- or NH2-methionine-, preferably NH2-methionine-.

'~ The bracketed sequence comprises amino acids #504-~728 of Figure 12.

, 091/13093 ~ ~ 7 7 ~ ~ ~ PCT/US91/0141 . -16-: .
. One skilled in the art to which the subject invention pertains can readily make such polypeptides usin~
recombinant or non-recombinant DNA technique~, The polypeptides may be constructed using recombinant DNA
technology. One means for obtaining the polypeptides is ~o express nucleic acid encoding the polypeptides in a suitable host, such as a bacterial, yeast, or mammalian c~ll, using methods well known in the art, and recovering the polypeptide after it has been expressed in such a host.

Examples of vectors that may be usied to express the nucleic acid encoding the polypeptideqi are viru~ie~ such as bacteriophages (such as phage lambda), cosmids, plasmids, and other recombination vectors. Nucleic acid ~olecule~ are inserted into vector genomes by methods well known in the art. For example, using conventional restric~ion enzyme sites, insert and vector DNA can both ~e exposed to a : restriction enzyme to create complementary ends on both ::; 20 molecules which base pair with each other and are then ligated together with a ligase. Alternatively, linker~ can be ligated to the insert DNA which correspond to a ;. restriction site in the ~ector DNA, which i9 then digested with the restriction enzymie which cuts at that site. Other . 25 means are also available.
:
: Vectors comprising nucleic acid encoding the polypeptides .... .
may be adapted for expression in a bacterial cell, a y~ast cell, or a mammalian cell which additionally comprise the regulatory elements necessary ~or expression of the nucleic - acid in the bacterial, yeast, or mammalian cells so locatedrelative to the nucl~ic acid encoding the polypeptide as to permit expression thereof. Regulatory elements required for expression include promoter sequences to bind RNA polymerase ~;
and transcrip~ion initiation sequences for ribosome binding.

.~ . .
~....................... .

WO91/13093 2 ~ 7 7 ~ ~ ~ PCT/US91/01416 For example, a bacterial expression vector may includ~ a promoter such as the A PL or deo promoters and for transcription initiation the CII or deo ribosomal binding sites. Such vectors may be obtained commercially or assembled from the sequences de~cribed by method well known in the art, for example the ~ethods described above for constructing vectors in general. ~ .

: In addition, non-recombinant techniques such as chemical : l0 synthesis, synthetic DNA or cDNA may be used to obtain the above described polypeptides. One means of isolating the polypeptide is to probe a human genomic library with a : natural or artificially designed DNA probe, using methods well ~nown in the art. DNA and cDNA ~olecules which encode the polypeptide may be used to obtain complementary genomic DNA, cDNA or RNA from human, mammalian or other ani~al sources, or to isolat0 related cDNA or genomic clones by the ~ screening of cDNA or genomic librarie6.

: 20 The subject invention further provides a pharmaceutical ~:~ composition comprising an amount of any o~ the above-.. described polypeptides effective to inhibit platelet aggregation and a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutically acceptable ~i carrier" encompasses any of the standard pharmaceutical carriers. Such carriers are well known in the art and may i~clude, but are in no way and are not intended to be limited to, any of the standard pharmaceutical carriers such as phosphate buffered saline solutions, water, emulsions such as oil/water emulsion, and various types of wetting agents. Other carriers may also include sterile solutions, tablets, coated tablets, and capsules.

Typically such carriers contain excipients such as starch, :, .

. .
. ~
, . ~' .,. ' ., . ; . - , - ~ , .

: WO91/130~3 2 ~ 7 ~ v PCT/US91/0141 milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium or calcium stearate ~ talc ~
vegetable fats or oils, gum5, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well known conventional m~thods.

The composition has an amount sufficient to result in a -: lO blood concentration of 0.06 to 58 ~M, preferably between : about 0.06 and 29 ~M, for example 0.23 to 23 ~M. Expressed in di~erent terms, the amount should be O.l to lO0 mg/Kg . body weight, preferably O.l to 50 mg/Kg body weight, for exa~ple G.4 to 40 mg/XG hody weight. . :.
~:i The administration of the composition may be effected by any ::
of the well known methods, including but not limited to intravenous, intramuscular, subcutaneou6 and oral administration.
; 20 : This invention also provides a method of inhibiting platelet aggregation which comprises .contactinq platelQts with an ., amount of any of the above-described polypeptides e~fective to inhibit plate~et aggregation so as to inhibit platelet : 25 ag~regakion.

. This invention also provides expression plasmids encoding :. the above-described polypeptides. In one embodiment, the expression plasmid encoding the polypeptide with the brack- .
,~ 30 eted sequence, i.e. amino acids #504-~728 of Figure 12, is designated pvWF-VC3 and is deposited under ATCC Acces~ion No. 68241. In another embodiment, the expre~sion plasmid encoding a polypeptide with the bracketed sequence, i.e.
amino acids #504-#728 of Figure 12, is desiqnated pvWF VCL . -~
and is deposited under ATCC Accession No. 68242 :.

.. . .- . . . . . .. .
., ~ . . ~............ . . ...
.. ,~ , .... . ... . . .

. ,` . .
. ' .
W~9~130~3 2 ~ 7 7 f~ PCT/US91/01416 ': ' - The expression plasmids of this înv~ntion further co~prise suitable regulatory elements positioned within the plasmid relative to the DNA encoding the polypeptide so as to effect expression of the polypeptide in a suitabl~ host cell,- such - 5 as promoter and operators, e.g. deo PlP2 and A PLOL ~
ribosomal binding sites, e.g. deo and C~x, and repressors.
Other suitable regula~ory elements include, for ex~mple, the lac, trp, tac, and lpp promoters (European Patent : hpplica~ion Publication No. 0303972, published Februar~ 22, ::. 10 1989).
', The suitable regulatory elements are positioned within ~he plasfflid relative to the DNA encoding the polypeptide so as to effect expression o~ th~ polypep~ide in a suitable ho~t . 15 cell. In preferred embodiments of the invention, the r' regulatory elements are positioned close to and upstream of ~ the DN~ encoding the pol~peptide~
.
The expression plasmids of this invention may be introduced into suitable host cells, preferably bacterial ho~t cells.
Preferred bacterial host cells are l~5e~-Lh~ RDll cells-Examples of suitable Escherihia coli c~lls are strains S~930 or 4300, bu~ other ~ richia coli strains and o~her bacteria can also be used as host cell~ for the pla6~id~.
Such bacteria include Pseudomonas ae~uqinosa and ~a~ill~
subtilis.

The bacteria used as hosts nay be any strain including auxotrophic (such as A1645), prototrophic ~such as A4255), ., 30 an~ lytic strains; F+ and F- strains; s~rains harboring the cI857 repressor sequence o~ the A prophage (such as A1645 and A4255); and strains deleted for the deo repr2.~ors and the deo gene (see European Patent Application Publication No. 0303972, published February 22, 1989). Escherichia oli strain A4255 (F~) has been deposited under ATCC Acce~sion .

:. .

WO 91tl3093 2 ~ 7 ~ pcr/us91/ol4l~ `

:

No~ 53468, and Esch~ri~hia ~Qli strain A1645 has been deposited under ATCC Acce~sion No. 67829.
, Th~ invention provides a bacterial cell which comprises these expression plasmids. In one embodiment, the bac~erial cell is an Escherichia coli cell. In preferred embodiments, `~ the invention provides an E@he~ichia çoli cell contalning the plasmid designated pvWF-VA1, deposited in ~ eli strain S~930 with the ATCC under ATCC ~ccessi~n No. 68530; pvWF-VA3; pvWF-VB3; pvWF-VC3, deposited in E. coli strain S~930 with the P~TCC under ATCC Accession No. 68241; pv~F-VI)3; or - pvWF-VCL, deposited in E. coli ctrain 4300(F-) with the ATCC
under ATCC Accession No. 68242.
,., : .
All the E. coli host strains described above can be "cured"
of the plasmid~ they harbor by methods well-known in the art, e.g. the ~thidium bro~ide method describ2d by R.P.
Novick in Ba~teriol. Review ~3, 210 (1969).
- ., .
In addition, the subject invention provides a method of producing any of the above-described polypep~ide~ which comprises transforming a bacterial cell with an expression ;
plasmid encoding the polypeptide, culturing the resulting bact~rial cell so that the cell produces the polypeptide encoded by the plasmid, and recovering the polypeptide so produced.

Furthermore, the invention provides a method of treating a subject with a cerebrovascu}ar disorder which comprises ; 30 administering to the subject an amount o~ any of the polypeptides of the invention effective to inhibit platelet aggregation.
. ':
Also provided is a method of treating a subject with a cardiova~cular disorder which comprises ad~inistering to the .

....... ... . ~ , . . . ~ , . , , ~ , ..................... . .
; ~` ~ ' . . , .. . ! : :

WO91/13093 2 0 7 7 ~ ~ ~ PCT/US91/01416 :, .
. .
subject an amount of a polyp~ptide effective tn inhibit platelet aggregation. Example~ of cardiovascular disord~rs susceptible to treatment include acute myocardial infarction or angina.
Further, the subject invention provides method of inhibiting platelet aggregation in a subject prior to, durin~, or a~ter the subject has undergone angioplasty, thro~bolytic ; treatment, or coronary bypass surgery which comprises administering to the subject an amount of a polypeptide of the invention effective to inhibit platelet aggregation.
.
.~. The invention also provldes a method of maintaining blood vessel patency in a subject prior to, during, or a~ter the ; 15 subject has undergone coronary bypass surgery, which comprises ad~inistering to ~-he subject an amount o~ ~ poly-peptide of the invention e~fective to inhibit platelet aggregation.

The invention also provide~ a method of treating a subjec~
having cancer which comprises ad~inisteri~g to the subject ~ an amount of a polypeptide of the invention effect~ve to .: retard tumor metastasis.
:,...
The invention also provides a method of inhibiting thro~bosi~ in a subject which comprises administering to the subject an amoun~ of a polypeptide of the invention e~fective to inhibit the thrombosis. The thrombosis may be associated with an in~lammatory response.
In addition, the subject invention provides a polyp~ptide of the invention ~ound to a solid matrix.

The invention also provides a mathod of treating a subject suffering from platelet adhasion to damaged vascular . . ~

.; . . .
.. . . .

WO91/13093 ~ ~ 7 ~ PC~/USgl/0141f ^
--22-- .
. .
; . ' ' . surfaces which comprise~ administering to the ~ubject an - amount of the polypeptide of the invention effective to inhibit platelet adhesion to damaged vascular surfaces. '~1 The invention also provides a method of ~ prevenking platel~t .. adhesion to a prosthetic material or device in a subject which comprises administering to the subject an amount of the polypeptide of the invention effective to prevent platelet adhesion to the material or device.
'~ 10 The invantion also provides a method of inhibiting re-occlusion in a subject following angioplasty or thrombolysis - which comprises ad~inistering to the subj ect an amount of the polypeptide of the invention effective to inhibit rç-occlusion~ .:
,^ ~ .,.
;. The invention also provide~ a method of preventing vaso-occlusive cri~e~ in a subject ~uf~ering from sickle cell anemia which comprises ad~inistering to the subject an ' 20 amount of the polypeptide of the invention effective to prevent vaso-occlusive crises. `-.
..
The invention also provides a method of pr~venting . .
art~riosclerosi~ in a subject which comprise~ administering to the subject an amount of the polypeptide of the invention ~:
: effective to prevent arteriosclerosis.
':', The invention also provides a method of thrombolytic treatment of thrombi-containing, platelet-rich aggregates in .~ 30 a subject which comprises administering to the subject an amount of the pol~peptide of the invention effective to treat thrombi-containing, platelet-rich aggregat~

The invention also provides a method of preventing platelet activation and thrombus ~ormation due to high shear ~orces .,, . .
.
~...... . . ~

~71~

;, ' ~, in a ~ubjec~ auffering from steno~ed or partially ob~tructad arteries which co~pri~es administering to the sub~ect an amount of the polxpeptide of the invention effective to prevent plat~let activation and thrombus formation.5 The invention also provide~ a method of preventing thrombin-i induced platelet activation in a ubject which comprises administering to the subj~ct an amount of the polypeptide of the i~vention effective to prevent thrombin-induc~d platelet activation.

The invention also provides a method of preventing stenosis as a r~sult of smooth muscle proliferation following vascular injury in a subject which comprise~ administering : 15 to ~he subj~ct an amount of the polypeptide of the invention effective to prevent stenosi~.
,, The invention also provides a method f or recovering a :; purified, biologically active polypeptide of the invention . 2 0 which comprises:

(a) producing in a bacterial cell a first : polypeptide having the amino acid sequence of the polypeptide but laoking the disulfide bond;

(b) disrupting the bacterial cell so as to produce a lysate containing the first : polypeptide;
(c) treating the lysate so as to obtain -. inclusion bodies containing the f irst , polypeptide;
.' .
(d) contacting the inclusion bodies fro~ step 2 0 7 ~
W091~13093 PCT/VS91tO14~( -24- :.
~ .
. -. .
(c) so as to obtain the ~ir~t polypeptide in soluble form;
.! ~ ' (e) treating the resulting fir~t polypeptide so as to form the biologically active polypeptide;

(f) reco~ering the biologically active polypeptide so ~ormed; and ~g) purifying the biologically active poly-peptide so recov~red.
- . .
Step (e) may comprise contacting the polypeptide with a thiol-containing compound and disulfide so as to re~old and reoxidize the polypeptide. Preferably, the thiol-containing compound is glutathione, thior~doxin, B-mercaptoethanol or cysteine. : `

The contacting of step (d) may be effected in the pre~ence I of a denaturant such a~ guanidine hydrochloride or ur~a.

.~ The recovery o~ the polypeptide in step (f) may co~prise removing ~he denatura~ by dialysis.
In step (g), the biologically active polypeptide may be puri~ied by cation exchange chromatography.

The first polypeptlde may also be purified by cation xdhange chromatography afteF step (d)-~: ' -:~;

2~77~
wog1/130s3 -25- PCT/US91/01416 ~ ,.
The examples which follow are ~et forth to aid in understandin~ the invention but are not int~nded to, and should not be so con~trued as to, limit its scope in any way. The examples do not include detailed de~criptions for S conventional methods employed in the construction of vectors, the insertion of genes encoding polypeptides of intsrest into such vectors or the introduction o~ the resulting plas~ids into bacterial hosts. Such methods are well-known to those skilled in the art and are described in numerous publications including Sambrook, Fritsch and . ~aniatis, Molecular Clonin~: A ~aborato~y__~an~Al, 2nd v Edition, Cold Spring Harbor ~aboratory Press, USA, (1989).

B~AXP~8 All the references to map positions correspond to the identically numbered position~ along the tran~lated nucleotide sequence of mature human von Willebrand Factor shown in Figure 12.
~am~ Clon.inq and Ex~ression Qf vWF ÇPlb 3indin~
Do~ain Polypeptides ."
. cVN~ Cloni~ of ~uman vWF GP~b Bindinq Domain .~ 25 human endothelial cDNA library (obtained from CLONTECH
Laboratorie~, Inc.) in 1 gtll was screen~d for human vWF
positive ~equences using two synthetic DNA probes. The probes were synthesized according to th~ published DNA
sequence (Sadler et al., Proc. Nat. Acad. Sci. 82: 6394-8 (l985) and Verweij et al., EMBO J. 3: 1829-47 (1986)) of .: human vWF ( f lanking 5' end and 3' end of the vWF domain . known to bind the GPIb receptor) (see Figure 12).

The synthetic probes have the following s~uence~: .
~"''' '.:

; ' ' . , . ., . . ' , ~ ,,, ! ..

WO 91/13093 PCr~US91/0141 S~q~nce ~Y~h~

CCAGGACGAACGCCACATCCAGAACCAT~GAGTTCCTCTT 4700-4739 .
A series of vWF cDNA clones coverin~ the entir~ GPIb binding domain were identified and isolated. The cDNA fragments wer~ subcloned into EcoRI site of pUC-19 ~New England Biolabs, In~.). One of the subclones, d~signated pvWlP
: (Figure 1), contains a 2.5 Kb insert. This 2.5 Kb insert covers the entire GPIb bindinq domain extending from 550 bp upstream of the ~PIb binding site to 1100 bp downstream of the GPIb binding ~sita. ~The subclone pvWlP ha~ also been .-~ designated pvWF-lP)O

ManA~i~ulation of ~DNA Coding ~Qr h~e~vWF Gp=:1;b_~j,rl5~

:; In order to obtain expression of the GPIb binding domain in Escheri~hia çoli under the regulation of the ~9Q PlP2 promoter, the cDNA fragment of vWF, derived fro~ plac~id pvWlP was used for further manipulations a~ describad below.
~` ~s indicated preYiously, the vWF tryptic digest fragment . that bind6 the GPIb receptor is from amino acid Y~l ~49 to amino acid ~ 728~

.; 25 A. Subcloning of the 5' end of vWF GPIh binding domain and ::. addition of a translation initiation codon ATG.
.;
Plasmid pvWlP has two convenient restriction site~ at the 5' end. Bsu36I which cuts at the DNA sequence oorresponding to amino acid Ser (445), and TthlllI which cuts at amino acid (514). Synthetic fragments of variou~ size were designed that in~ert an ATG translation initiation codon at .~ the 5' end as well as additional amino acids. This was done first, in order to maxi~ize the chances of obtaining high ; 35 levels o~ e~pression. Second, they are a first step towards '~ ' , , .. , ., ., .. , ,~ .. . , ., . ,. . , . .. ... ~ ~ . . , W~91/13093 ~ ~ 7 J ~ PCT/U~91/01416 ,"
reducing the size o~ the vWF GPIb bindiny domain peptide down to the minimal size needed, possibly eliminating c~llagen and heparin binding sites which may ultimately interfere with the function of th~ product.

Al. ~
`' ` .
Synthetic oligomers with the sequen::es:
` 10 5' - TATGGAG~TGGCTGGCCGGCGTTTTGCC - 3~
3' - ACCTCCACCGACC~GCCGCAAAACG&AG~ - 5' - ~ Nd eI Bsu3 6 I
. .
were ligated to plasmid pvWF-lP digested with NdeI
and Bsu36I (see Figure 2) . The plasmid obtained was designated pvWF-V~l. Plas~id pvWFiVAl has been Dlaintained in E. col i strain S~930 and W~8 depoaited under ATCC Accesaion No. 68530.
: 20 A2. Amino acid Phe 44~ at S' end -, Synthetic oligomers with the sequence~:

5' - T~TTTGCC - 3' ; 3' - ACAAACGGAGT - 5' were ligated to plas~id pvWlP digeated with NdeI
`~ and Bsu36I (see Figure 3). The plasmid obtained :`
was designated pvWF-VBl.
~ , .:
:'' ',' , ''; ';'.

, , .
~ . .. .

., ':

; , , : ' ' ' ' . ` . ' .' " ' ' ` ` . .. ' ` ' . ', ' ` . ' ' ' . .'' " ;',' . . . ' ' . . ': . . . ` , ' ' " ' . " . :

WO91/13093 2 ~ 7 7 ~ ~ ~ PCT/US91/0141 : ~2~-' ,~ ,.
~:
B. Subcloning of the 3' end of vWF GPIb binding domain, : .
introduction of translation stop codon.

Bl. Int~oduction of stop ~odon in plasmi~ pvwF-vA

A synthetic oligomer with the sequence:

.~ 5'-CCGGGGCTCTTGGGGGTTTCGACCCTGGGGCCCAAG~GATATCA-3' 3'-CCGAGAACCCCCAAAGCTGGGACCCCGGGTTCATTCTATAGTTCGA-5' . ~ , : was ligated to an XmaI and HindIII dige~ted plasmid pv~F-VAl (se~ Figure 4). The plasmid obtained was designated pvWF-VA2. This newly con~tructed plasmid contains a translation termination codon .' TAA adjacent to amino acid 728 (Lys) and EcoRt' site.

B2. Introd~tion of tran.sl~.~Q~ stoJæ_codon an ~l~s~id ~: 20 Ly~E~

, ! ~ `.
; A cynthetic oligomer with the sequence: ~

,, :. 5'- CCGGGGCTCTTGGGG m CGACCCTG&GGCCCAAG~ ATATC~ - 3' : ; 25 :3' - CCGAÇAAC~CCAAAGCTGGGACCCCGGGTTCATTCTATAGTTCGA - 5' was ligated to plasmid pvWF-VBl digested with XmaI and HindIII. The plasmid obtained was de~ignated pvWF-VB2 (see Figure 5). .
Expression of the yWF GPIb bindina domain in Esche~ichia .:.
coli In order to obtain expression of the vWF GPIb binding domain ~: :
various expression plasmids were constructed based on a deo , ~
,:
~" , .

WO91/13093 2 0 7 7 ~ 4 ~ PCT/US91/01416 ~ -29-,:' ~ PlP2 constitutlve pro~oter system.

.
. 1. E~ession o~_~ v~
:' 5 An NdeI-EcoRY ~ragment was i601ated fro~ plasmid pvWF-VA2 and ligated into plas~id pMF-945 ~see Figure 11~ digest~d .` 10 with N~eI and PvuII ~see Figure 6). The plasmid obtained was designated as pvWF-VA3 and was maintained in ~ her ~ s~rain S~930.

"1~ 15 2.

,~ Qn plasmid pvwF-v~2) ., j .
An NdeI~EcoRV frag2ent was isolated from plasmid pvWF-VB2 ~, 20 and ligated into plasmid pMF-945 digested with NdeI and ~i, PvuII (~ee Figure 7). The plas~id obtained wa~
~ : designated as pvWF-V33 and was ~alntained in scheri~hia ::
i~ ÇQli strain S~930.
: 25 3. E~pression of a vW~ GE~Ib bindinq domain pol~ p~i~q ~' includin~amino ~id Leu so~ to aDIino acid~ys 72~ tba~çd : ~n expression plasm~d ~ A~
., .
I 30 A synthetic oligomer with the sequence: . .
.. :
5' - T~TTGCACGATTTCTACTGCAGCA~GCTACTGGACC - 3' 3' - ACAACGTGCTAAAG~TGACGTCGTCCGATGACÇTG~_- 5' ~ ! .. :
NdeI TthlllI :
:.;
..

WO~ 3093 ~7 ~ 3 Pcr/us9l/0141~-:
. .
:
: was ligated tQ plasmid pvhlF-VA3 digested with NdeI and ~; TthlllI. The plasmid obtained wa~ designated a~ pvWF-VC3 ~ ~see Figure 8). Plasmid p~WF-VC3 is maintained in ~ch~- .
.~ ~ighi~_~Qli strain S~930 and has been deposited with the ~ S ATCC under Accession No. 68241 (also see Fi~ure 13), .:

4.
.includina aDIino açid_~eu 513 to_amino a~id L~Ls 728 (~as '", 10 ' -' ' A synthetic oligomer wi h the sequenc~:
.~
:` 5 ' - T~CTGGAC - 3 ' 3 ' - ~CGAC~C:G~- 5 ' NdeI TthlllI
. 1:
~' was ligated to plasmid pvWF-VA3 digested with NdeI and TthlllI. ~he plasmid obtained was design~ted pvWF-VD3 (see Figure 9). Plasmid pvWF-VD3 is maintained in ~scherichi~ c~li strain S~930.

; .
.: : xDrçssion of vWF-GPIb bin~ina do~in ~Q~æept.~d~ -i The relati~e align~ent of the expression plasmids i~ shown , in Figur~ 10. Plasmids pvWF-VA3, pvWF-VB3, pvWF-VC3 and ... .
pvWF-VD3 in ~b~ CI~ strain S~930 were used in order .
.: to analyze the levels of expression of the various vWF-GPIb binding domain peptides. The clones obtained were grown in ! LB medium containing Amp ~100 ~g/ml) at 37C for 48 hours.
... .
After 48 hours growth bacterial cells were harvested and centrifuged for 2 minutes at 10,000 RPM. Pellet~ were dissolved in 1/10 volume of 50 mM Tris HCl pH=8~0. Sample .' .
.

:.. - . . . . . . . .

W091/13093 31~ ~ 7 Q ~ ~ pcT/uss1Jo14l6 buf~er (containing SDS and B-~ercaptoethanol3 wa~ added.
Samples were boiled for lO minutes and loaded on a 10% SDS
polyacrylamide gel. The expr~ion of the vWF ~PIb binding domain polypeptides in clones pvW~-VA3, pvWF-VB3 and pvWF-VD3 was low relative to the bacterial total prot~ins. ThevWF polypeptides ~ro~ these clones were detectable by Western blot analy~i~ using co~mercially available polyclonal vWF antibody (Dekopatt~ a/s, Glostrup, De~mark~.
However, clones originated from ~~ç~ichia cQll ~train . S~930 transformed with plasmid pvWF-VC3 expressed the vWF
GPIb binding domain polypeptide (amino acid Leu 504 to amino `- acid Lys 728 plus methionine) at high levels ~as a major ~: band) detectable upon Coomassie staining.
.
. 15 ~sche chia coli strain S~930 harboring plasmid pvWF VC3 was deposited with the ATCC under Acce~ion No. 68241.
, .I SubRequently, an inducible plasmid wa~ constructed which contains th~ same vWF coding r~gion a~ pvWF-VC3, Qxpres~ed : under the control of th~ A PL promoter and the.deo ribosomal binding ~ite (6ee Figure 14). This new plasmid, designated . pvWF-VCL, proved to be a high expre~sor of VCL, the ~WF GPIb . binding domain polypeptide ~ethionine plus amino acid Leu 50~ to amino acid Lys 728). Thi~ pla~mid was deposited in ~s~ s~u~ gli train 4300 with the ATCC und~r Acc~Rion No. 6~242. ~sche~içhi~ coli strain 4300, constructed from ~ ~35~ C~ l strain ATCC Accession No. 1243~ a wild-:~ type, F-, biotin dependent ~train, har~oring the A cI857 ~ tempera~ure-sensitive repre~sor. (A third plas~id construct ; harboring the same vWF ~oding region under the control o~
the A promoter and the cI~ riboso~al binding ~ite did not :: express any vWF peptide detectable by Coomassie staining.) The NdeI-HindIII insert of pvWF-VCL can be conveniently subcloned into other expression vectors such as comm~rcially ~, wo 91/13093 2 9 7 7 ~ pcr/us9~ 41 - available pUCl9 for production o a series of polypeptide~
which include the same amino acid ssqlaence from amino acid ., 509 (cys) to amino acid 695 (cys) and have the same. biological activity.
,. .
' ' .
.
"
.. . .
,;:, :.
!
. . ' ~ .
'`' :
,`. :
~" .
>' ~''":
,:., '.
~"" ' .
~ .
~ ', , .
~'`','' ~ '., !; :

., .

;' ' ' '~.

`

r -:, .

.~ .

. ~:, . . : ~,: :

WO91/13093 ~ 0 7 ~ PCTIUS91/01416 . ~33-. ~ ~

During scale-up fermentations of clone pv~F-VC3 it was ~ound ., 5 that the host tends to lose the plasmid due to instability.
The loss of plasmid~ caused a reduction in vWF GPIb binding : domain polypeptide expres~ion. It was found necessary to maintain continuous ~elective pressure (i.e., continuou~ :
addition of Ampicillin) in order to maintain plas~id copy numb~r and to maintain th~ ~xpr~ssion levelæ. Large scale , . fermentation wa~ carried out for 12 hours.

Fermentation was carried out in the following growth medium: ~
, ' N-Z amino AS20 gr -~:
,rl Yeast extract lO gr NaCl 5 gr '` 2.5 gr ~gSo47H2ol.o gr a o Anti ~oam 0.4 ml ..
. :.. .
Fructose (5Q%) was added to the growth medium at final concentration of 150 ml/liter and Ampicillin (lO0 mgtml3 was pumped continuou~ly into the Per~entor (total of 8 2s ml/liter~. Fermentation was carried out for 12 hour~ at :. 37o~ ~ :
' i PurifiÇ.ati ~ ps ~ eptides . .
.. . .
Cells were harvested after 12 hours fermentation and centri-fuged. The bacterial pellet obtained was re6uspznd~d in bu~fer t50 mM Tris pH=8.0, 50 mM NaCl, 1 ~M EDT~, lmM DTT
(dithiothreitol), 1 mM PMSF (Phenylmethylsulfonyl fluoride) .; and 10% Glycerol]. A~ter additional centrifugation and sonication the vWF GPIb binding d~ain polypeptide was found ' :

':
~ .
,' , . . .

WO91/13093 2 ~ i PCT/US91/0141 ~34-, in the pellet.

- The ~WF GPIb binding domain polypeptide was further purified .,~ by solubilization of the pellet in 8~ Urea containi~g lO mM
DTT, 25 ~M Tris pH-8 and 1 mM EDTA at room temperature. The solubilized pellet was fractionated on a DEAE cellulose ion . exchange colu~n chromatography. (Elution buffer as above except 0.5 mM DTT).
' .
The vWF GPIb binding domain polypeptide was eluted at 150 mM
~ NaCl. After dilution to 50 mM NaCl (in the above buffer) -.i the partially purified peptide was loaded on a Q-Sepharo~e column. ~lution from the Q Sepharose column was carried out at various NaCl concentrations (step elution). The Y~F GPIb :.
binding domain peptide was pooled in four pea~s which eluted .. at lO0 ~M, 200 mM, 250 ~M and 500 m~ NaC~. All four peaks were dialyzed against lS0 mM NaCl and 50 mM Tri~ pH=8 for 36 . hour~. During the dialy~is the Urea concentrati3n of the ~, dialysis solution was reduced in a linear gradient from 6M
:~ 20 Urea to no Urea.

~ . .

; .

~"''`, .'. .
;~' .
,'" ' ,;

.:
~, : ...... . , =. . . . ................ . . . .

'', ~' , ' ' . ~ "

, ~ . "' ' . . .

WO91/13093 2 0 7 7~ pCT/~S91/01416 ~ .
. `
E8~P~ E~iological . ~ct~ityQf~vWF Gl?lb ~
.~olypeptides ~-Platelet Aaareaation ~ss~

;,~
~; Human plasma-d rived vWF was purified ~rom hu~an outdated blood bank pl~sma according to ~. Loscalzo and R.I. Handin, Biochemistry ~: 3880-3886 (1984). The purified plasma-derived vWF was concentrated by ~icon lO0,000 out-off filter me~brane, to a final concentration of 0.25 mg/ml.
" .::
Asialo_vWF ~reParation: -:
,.~, . -~
The puri~ied plasma-derived huMan vWF was desialyated according to L. DeMarco and S. ~hapiro, J. Clin. Inv~t.
321-328 (1981) with the following ~odifications:
.
: 20 l. The Neura~inidase used was from Yibri~_~hol~ kype ;i II (Sigma).
: ., 2. The reaction mixture contained 0.2 ~nits enzyme/ mg pr~tein and proteas~ inhibitors according to the following con¢entration~: Benza~idine (20 mM), , Leupeptin (15 ~g/ml) and Aprotinin 20 (U~ ml). The asialo-vWF was used for p}atelet aggregation with-out any further purification.
.~, ' ' .
Platele~ a~a~e~at.~on - I~duced by ~sialo-vWF
:.
As stated aboYe, soluble vWF does not bind to plat~let~ via the GPIb receptor. Asialo-vWF, obtained by neuraminidase treatment to remove sialic acid residue~, readily binds to platelets via GP~b. Presu~ably, the desialation lower~ the . , .
, " .", ,~

: '~ , ' .
,':

W091t1309~ 2 ~ 7 7 ~ PCT/US91/0141 : ~et negative charge on the vWF, allowing it to bind to the negatively charged GPIb receptor. Asialo-vWF binding to - platel~ts causes activation, release of ~DP, and GP IIbl . IIIa mediated aggregation. Platelet aggregation induced by ;, 5 asialo-vWF was carried out with 200 ~l of PRP (Platelet-rich plasma) lFu~imura Y., Pt al., J. Biol. Chem. ~ 381-385 .~ (19~6)) and 39 ~g/ml o~ asialo-vWF (~inal concentra~ion) in :
a Lumi aggregometer. The re~ults of inhibition o~ platelet aggregation with VC, the vWF GPIb binding dom~in polypep~ide, are summarized in Tabl2 I.
,; I , .
VC (also ref~rred to a~ VCX, or VC3) is a vWF GPIb bindin~
domain polypeptide which includes methionine plus amino acids 504-728 (see Figure 12).
vWF-Ristoce~in induced platelet a~5~re~ation Ristoc:etin-induc~d platelet aggregation in th~ pre3ence of purified human intact vWF was carried out with washed human platelet~ ac:cording to Fujimura Y. et al., J. Biol. Chem.
~,: 381-385 (1986).
; ; .
The results of inhibition of platelet aggregation induced by .. ristocetin in the pr~sence of intact vWF are s=arized in Tabl II. Additional results using the~e assays are d-i~cribed in ~:xa~ple 5.

,;

:- :

'.-:

WO91/13093 2 ~ 7 7 ~ PCT/US91/01416 -37- :

.,~ .
'.,; ~h~

Inhibition of Asialo-vWF Induced Platelet Aggregation ~ (In PRP) by VC, a vWF GPIb Binding Domain Polypeptide ., S ' ,. 1~ ~ ~ ~
::~ VC % Inhibition of I .:
Q-Sepharo~e Frac-. tiQn concentration Platelet Aggrega- ¦ ~
~M l tion :::
,, ~ ._-- . - ':.:
200 ~ NaCl 6 76 64 ~: ' . I
~50 mM NaCl 6 82 73 . ~ _ ~ .:
~ ~ 9 79 `. .
;
': :
`:, ,, ~

.'.' '.
' .~ .
:, : , "1' ' ' ~il . .. .
,,~. '-, .

. ,.

~,............ . ..
,:

., : .

.,. , , - . . . .: :~ ,., , . . ... : .. , : : , . .

WO91/13~93 2 ~ 7 ~ i PCT/US91/01 '.
' ~L~
, ' .
Inhibition of Ristocetin Induced Platelet Aggregation ; 5 by VC, a vWF GPIb Binding Domain Polypeptide ¦ Q-Sepharose Frac- VC % Inhibition of ¦ tion concentration in Platelet Agyre . ~ gation ~ _ . , .
200 mM NaC1 10 76 ~ ., l 250 =M NaC ¦ 10 66 ¦

.. . _ ,, ~ ....
¦ 500 =M NaC I 10 100 0.25 38 I ~ , .
.~ Dialysis Bu~f~r 0 0 . 1 (control) ., ~' ' i , ~

, .. ,.. ,, . , . ~ ,- :

' ;. . ' ' ~ , ''' ': ' . ' ' ' ' ~ "' ' '' ,~ ~, , , ;~ , ' ' :
," ~, .. . .

WO91/13093 2 Q 7 ~ PCT/~S91/01416 ,: .
':
ampl~ ~:
:
An Improved Me~hod o~ ~b~aining Pure.. ~idiz~d. FQlded ~nd ~ioloqica~l~ Active vWF GPIb ~in~inq ~om~in-~Q
In Example 2, fermentation of cells harboring plasmid pv~F
VC3 was described. Sub~equently, a preferred plasmld, pvWF-VCL was constructed as descri~ed in Example 1 and ~aintained in E.coll strain A430G. This ho t/plasmid syste~ was : :
fermented essentially as known in the art for vectors containing a gene expressed under control o the APL
promoter, see, for example coassigned EPO Patent Publication No. 173,280j published March 5, 1986, Example 5, pages 73 74 ~without added biotin, thiamine, trac~ ~lements, and ampicillin~O. In thi~ improved method of purification of vWF
GPIb ~inding domain polypeptide, a cell pellet o~ the above ~ fermentation o~ A4300/pvWF-VCL was used.
; . .In this improved method a purer and more active polypeptide :, 20 is produced than by the method disclosed in Example 2. The ..
general scheme of the downstream process con~ists of steps A through H as ~ollows:
.,, :
A. Ce~l dis~p~ion and sus~ension o~ pellç~: A pellet :: 25 containing the vWF GPIb binding domain polypeptide is obtained as described in Example 2, by sonicAtion and .
centri~ugation of a cell suspension in 50mM Tris-HCl - pH-8, 50mM NaCl, lmM EDTA, lmM DTT, lmM P~SF, and 10%
Glycerol.
' 30 The pellet containing the inclusion bodies i8 di6solved - at about 10% w/v in a solution such that the final concentrations after dissolution are 8M urea, 20mM DTT, 20mM HEPES pH 8, and lOOmM NaCl. The resulting solution may be further purified by ion exchange chromatography as ,~ :
..

. . :

W091/13~93 PCr/U~91/014:
;~ -40;
'' ' .

des~ribed below. AltQrnatively, the inclu~ion bodie~ may be solubilized in a buffer containi~g 6M guanidine hydrochloride followed by bu~fsr exchange to urea. Th~
inclusion bodies may also be dissolved at diff~rent : 5 concentration~ of urea, guanidine hydrochloride or any other denaturant or in the ab~nce of d~naturants, ~or example, at extremes o~ pH.

B. ~ : This tep eliminate~
most of the contaminant~ and produces the vWF GPIb binding domain polypep~ide at greater than 90% purity.
Any cation excha~ge (eOg. carboxymethyl) method may be used in this ~tep, bu~ CM-Sepharo~e fa~t flow (Pharmacia) ~-; chromatography is preferred. ~he functional group may be ~! ~15 carboxymethyl, a phospho group or sulphonic ~roups such as sulphopropyl. The matrix may ~e based on inorganic co~pounds, synthetic resina, polysaccharides, or organic polymer~; possible ~atrice~ are agaro~e, cellulo~e, : trisacryl, dextran, glass beads, oxirane acrylic beads, ~ 20 acrylamide, agarose/polyacryla~ide copoly~er (Ultrogel) ,.1 or hydrophilic vinyl polymer (Fractogel)0 In a specific ~ embodiment, tha polypeptide i8 loaded onto a C~-Sepharose ,' FF coIumn equilibrated with 8H urea, lmM DTT, 20~M HEPES
,` pH 8, lOO~M NaCl. Pure polypeptida elutes in 8~ uraa, ~' 25 lmM DTT, 20mM HEPES pH 8 and 200m~ NaCl. Up to about 30 OD280 unit~ of solubilized inclusion bodi~6 may be loaded ~'~ per ml CM-Sepharose FF. At this ratio the eluted ; polypeptide typically has a concentration of 4-5 D280/~
C. oxi~a ion/Re~olding: The polypeptide solution eluted ~rom the cation exchange step above i6 treated with 6M
guanidine hydrochloride (GuCl) to disrupt any aggregates.
The polypeptide is then diluted to 0. 05 OD280/ml in 2 GuCl, p~ 5-11, pre~erably 20mM HEPES pH 8, O.lmM GSSG

. . .

.

- ... ,. ~ - . . . .

, . ' , '' ' .' ' ' ' ' ~ . , ' " '' , "', ' , '' ,' ' . ' "' ~ ~ 7 ;~
WO 91/13093 PCr/US91/01416 (glutathione, oxidized form), Thi~ mixture is allowed to ~tand overnight at room temperature. The products are analyzed by gel filtration on fast protein liquid chromatography (FPLC) such as Supero e 12 before . 5 proceeding. Analy8i8 show~ that this protQin .; concentration reproducibly yields about 30% correctly oxidized monomers, and 70% S-linked dimers and ~ultimers, ~ as well as reduced and incorrectly oxidized ~ono~ers. A
: higher protein concentration gives a higher absolute yield of correctly oxidized monomers but a lower peroentage yield due to increased ~ormati~n o~ S-linked dimers and multimers. For example, a protein concen~ration of 0.1 OD280/ml yields only 20% corre~tly : oxidized monomers. Reducing the concentration to 0~025 : 15 OD280/~l yield~ 35-40% correctly oxidized ~onomers but a ; lower absolute yield per liter oxidation. Oxidation~ ~ay . also be performed in urea instead o~ in GuCl, or in any other denaturant or in the absence of denaturants under . .
,. appropriate buffer conditions in which, for example, pH, ionic strength, and hydropho~icity are varied. The pre~erred concentration of urea is in the range 0.5~ to lOM, preferably 4M, and the preferred oxidant i~ GSSG in the range O.OlmM ko 5~M preferably O.lmM. Other oxidants such a~ CUC12 may be used or al~ernatively no oxidant may be added, thereby u~ilizing air oxidatiun only. For ~cale-up, 4~ urea is the pre~ently preferr~d solution for the oxidation step.
. . .
D. Concentration: The oxidation products are concentrated, .l 30 pre~erably to about OD2~0=1 by a tangential flow ultra-.~ filtration system with a 30X cutof~ membrane, fiuch as a "MINITAN" or "PELLICON~ system of ~illipore. The ..
`~ filtrate is ~uite clear a6 the material i8 relatively clean and most o~ the contaminants are large enough not to pass through the 30K me~brane. It is thus pos~ible to ~ :.

WO91J13093 ~ 77!~g PCT/US91/0141-reuse the filtrate for p~rforming o~idations. This results in con~iderable ~avings since large YOlUme8 of 2M
GuC} are quite expensiv~. No difference in the oxidation products of oxidations performed in reused versus freshly prepared 2M GuCl wa~ detectable by FPLC analy9is.

E. ialYsis: It is neces ary to reduce the GuCl or urea concentration to less than lOmM. Thi~ is achieYed by dialysis against 20mM HEPES pH8, lOOmM NaCl. The dialysis was performed in dialysis tubing with 2~3 changes of buffer, but may be alternatively performed by diafiltration against the same buffer in a tangential r~ flow ultrafiltration system with a lOK ~W cutoff membrane.

~! During dialysis, as the concentration o~ GuCl (or urea or other denaturant) decrea~e6, a white przcipitate ~orms.
Thi~ precipitate contains about 80~ of the protein yielded by step D comprising S-S li~ked dimers, reduced and incorrectly oxidized monomer and ~ome contaminants which coeluted fro~ the cation exch nqe ~tep. Th~
~upexn tant i8 nearly 10~% corractly oxidized and .
refolded monomer at a concentration of 0.2 OD280/ml, which is about 20% of the prot~in yield o~ step D. This ~elective precipitation o~ contaminants and undesirable ~! forms of the protein as a res~lt of dialysis was surprising and not predictable. The yield of correctly oxidized monomer can be greatly increased by recovery from the precipitate. This is done as follows: the solu~ion i~ clarified by centrifu~ation. The supernatant : is saved, and the pellet i~ treated with DTT to reduce ~-S bonds and reoxidized as described qbove. The pellet is dis60lved in a minimal volume of 6~ GuCl, 20ml HEPES
:

.. , . . . ... , ~ ................................. . ~.
.~ .. ... ; . .

WO91~13093 2 ~ ~ 7 ~ p~/US9l/01416 , pH 8, l50mM NaCl, 20mM DTT. The solution was pas6ed through Sephadex G25 in a buffer si~ilar to the dissolution buffer but containing only lmM DTT (in3tead of 20mM). The eluate is then diluted to OD280=0- 05 and treated as in steps C, D and E above. This procedure may be repeated more than once a~ long as additional purified monomer is obtained. All of the sup rnatants are then ~- combined.
,'~ ' ', .1 lO F. Ca~io ~ chanqe: The combineid supernatant of the dialysate of step E is concen~rated by binding to CM
::, Sepharose in 20mM HEPES p~8, lOO~M NaCl. Elution i8 With 20m~ ~EPES p~8, 400mM NaCl. The elua~e is exclusively monomeric despite the high sal~ concentration.
.~ 15 Concentrations o~ up to 3 mg/ml have been achieved by this method and that is not the upper limit. This step .~ can alternatively be perfor~ed with iHeparin-~epharose which also binds the purified monomer in lO~M ~ris pH
7.4, lSOmM NaCl. Elution from Heparin-Sepharose i8 performed using lOmM Tris-HCl pH 7.4, 500mM NaCl.

.:
~' G. Dialysis: The product of the previou step is dialyzed againit 20mM HEPES pH8, 150mM NaCl.
:
.'~ ' ' H. Storage: At this stage the purified vWF GPIb binding ~: do~ain polypeptide may bei lyophilizQd. Upon reconstitution in a volume of water equal to the volume . 30 before lyophilization, the resultant solution contains . exclusively monomeric protein showing no traces of di~er6 :~ or other multimers on FPLC. :
.: ' '' In a specific embodiment of this method the following procedure was per~ormed:
,,, ' .

,, .

W~9t/130~3 2 ~ 7 ~ PCT/US91/0141 : a) l0 gm inclusion bodie~ (comprising 0.43 g net dry weight) were dissolved in a final volu~e o~ l00~l 8M urea, .~ 20mM DTT, 20m~ HEPES p~ 8, l00 ~M NaCl.
:
b) The protein was loaded on~o a CM S~pharose column equilibrated with 8M urea, l~M DTT, 20m~ ~EPES pH 8, l00mM
-`~ NaCl. The protein eluted at 200m~ NaCL in ~M urea, 20mM
HEPES pH 8, lm~ DTT, and was ~aved.

c) The saved eluate of the previou~ ~t2p was treated with ; 6M GuCl to eliminate any a~gregat~s, and was then dilu~ed : to 0.05 OD280tml in 2M GuCl, 20~M HEPES pH 8, 0.l~M GSSG.
Oxidation was performed ov~rnight at room ~emperature.
(Not~ that the oxidation ~t~p can be performed in th~
; 15 presence of urea in~tead of GuCl.) : d) The oxidation products were concentrat~d to OD280=1 by ~ ultrafiltration on a "~INITAN~ unit containing a 30X
:~ membrane.
: 20 e) The concentrate of the previou~ step wa~ dialy~d with three buffer changes againsk 20mM HEPES pH 8, l00mM NaCl.
; During dialysi~, as the GuCl conc~ntration decreased, a whi~e precipitat~ formed which wa~ removed by centri~ugation and reprocessed once as described above. The supernatants wer~ combined.

f) The c~mbined supernatants were concentrated by binding to CM Sepharose in 20~M HEPES pH 8, l00mM NaCl. The pol ~ eptide was eluted in 20m~ HEPES, pH 8, 400mM NaCl and stored at 4C.

; 35 g) The saved eluate fro~ the previous ~tep was dialyzed .
. . .
,. . - . : . 1 i . . . ~

WOs~J13~93 2 ~ PCT/~S91/01416 ., , ~
., ~ .
-: ayainst 20mM HEPES pH 8, 150~ Na~l a~ 4C.

; h) A~ter dialysis, the purified vWF GPIb binding domain ::
-~ polypeptide, designated VCL, W2S lyophilized.
.
.' ~naly~s~s o~ VC~
1. Amino acid s~quence analyRis of VCL purified a6:.
described above revealed ~hat the N-terminal sequence is ~ ~et-Leu-His-Asp-Phe which is the expected sequence according r:'., 10 to Figure 12 with the addition o~ an N-terminal methionine residue~

; 2~ Examination of VCL on polyacryla~ide gels revealed that . VCL electrophoreses at lower apparent molecular weight under :: 15 non-reduci~g conditions than under reducing condition~
,. . . .
~ (beta-mercaptoethanol). This shift fro~ compact to less compact configur tion i8 consi~tent with the reduction of a .~ disul~ide bond. Such an intramolecular bond is formQd , between the cysteine8 at position~ 509 and 695. (The ~hift ,, 20 in molecular weight is not large enough to be con~istent with the reduction of an inter~olecular bond.) ,~ .

.: ': ~ .

.

:

Wog~/l3093 2 ~ 7 ~ PCT/US91/014 ~6-Ex~ 5:

Bioloqical AçtivitY o~ V~L. a vWF GPI~ ~iD~i~gL dQma m PolY~Ptide The vwF GPIb binding domain polypeptide produced as described in Exa~ple 4 was designated VCL and wa~ assayed for biological activity as described below.

1. Ristocetin induced platele5~suc:~b ~:~Yl~l8le~L

: RIPA assay was performed as describ~d in Example 3 in a reaction mix containing 2X108 platelets/ml, l~g/ml plasma - vWF, and lmg/ml ristocetin. A seri~ of concentrations of : 15 VC~ was tested and the IC50 f VCL in 3 as~ay~ was determined to be o.2-0.3~M. 100~ inhibition wa~ achieve~
with abou~ l~M VCL.

.
2. Asi~lo v~ quced pl~telet a~e~iQn Asialo vWF induced p}atelet aggregation a~say wa~ perfor~ed as describ2d in Example 3 with 200~1 platelet-rich plas~a (PRP) and 10~ 1 a~ialo-vWF in a Lumi aggregometer. A
series of concentration of VCL wa3 tested and ~he IC50 Or VCL in thi~ an~ay was determined to be 0.15~M, and complete - inhibitisn by 0.5 ~M.

3. ~~e~æt of VCL on Prefo~med aqgre~ates :, .
The effect of VCL on preformed aggregates made by RIPA was tested. Aggregates were formed as in paragraph (1) above in : the absence of VCL. Addition o~ VCL to a concentration of 0.5~M disrupted the aggregates instantaneously.

: .

, : , . :~
:. ~ . : : . . . .. . . .

, , : .: ., - ,. .

W091/~3093 2 ~ 7 ~ l~ 4 ~ PCT~US91/01416 .
.
4. ~
, .
~`. Thrombin induced platelet aygregation a~say wa~ perfor~ed using 0.025 unit/ml thrombin and stractan prepared platelets. A serie~ o~ concentration~ of VCL was tested and the IC50 f VC1 in this as~ay was determined to be 0.3~M.
This is a surpri ing effect, ~ince in a parall~l e~periment, VCL wa~ not effectivP in inhibiting direct binding of [l~SI]
: labelled thrombin to platPlets. ..
~; 10 ~ 5. ~~e~ o~Lplatel~t deeosi~ion unde~ çon~itiQ~-Q~-f~
'"' ':
In a model y~tem consisting of an everted denuded human umbilical artery in a ~low cell, platelet deposition ~ay ~e determined. ~hole human blood flows ov~r the artery fragmentO A~ter 1.0-l5 minutes, the flow ia stopped and platel~t deposition i8 deter~in~d micro~copically. The IC50 of VCL in this system was determin~d to be about l~M.
`~
All the above results are um~arized in Table I~
.
:, .
The inhibitory activity o~ VCL on ri~tocetin~induced or asialo ~WF-induced platelet ag~regation, ristocetin-induced vWF bindingj and platelet adhesion was lo~t upon reduction of the ~i ulfi~e bond between the cysteine~ at po~ition~ 509 and 695. In some experiments, the reduced YCL precipitated out of solu~ion.
~, ., .
.'''' ',:

. ......................................................................... .

.; .
' .
.. , . , . , , j , ,, . . , ~ . . :.

4 ~ , ~
WO gl~l3093 PCr/US91/0141 4~--;. , .

TAB~E I I I
Biological Activity of VCL, a vWF GPIb Binding Domain Polyp~ptide.
_ ~ ~=
Example S A~ay ~M VC:L
~Paragraph No.) ~ - ~ _ l Ristocetin induced ICso=0 . 2-0. 3 .- platslet aggregation Asialo vWF induced IC5~=0. 15 platelet aggregation ~ ., ,~
3 Thrombin induced IC50= 3 platelet aggregation .
4 Dissolution of 0~. 5 pref ormed aggr~gates . . . . - .. - ....... -. ._ Platelet deposition IC50=
under conditions of ~ ~ __ ., .

:

.:
~. ' .
.- , . . . .. .. ., . :.-: ~. .... , .. , . .. .. ,- . , . . -, -- . - : ~
., ' : ., ' .. , ~ ' ' . ''. '. ;' . " . . ' . . : : ' " ': ' - WO91J130932 ~ 7 l '~ PCT/US91/01416 ~pl~ 6:
~ .
ConstrU~iQn Q~ plasm1d pvwF-v~E~
It was decided to construct a plasmid which expresses a slightly longer portion of the vWF GPIb binding domain than pvWF-VCL. The construction i8 ~hown in Figures 15-18 and described in the brief descriptions o~ the figure~. ~

A. Construc~ion of pvWF-VE~ ;
.
Plasmid pvWF-VA2 (constructed as shown in Figure 4) was digeste~ with NdeI and PstI and the larga ~rayment isolated. -Four synthetic oli~omers shown in Figure 16 were prepared.
Nos. 2 and 3 were ~reated with T4 polynucleotide kinase to add 5' pho~phate. The above mention~d large ~ragment of pvWF-VA2 wa~ ligated as shown in Figure 15 with the four oligo~ers (two kinased, and two non-kinased). The re~ulting plas~id shown in Figure 15 wa~ designated pvWF-VE2.

~. Construction o~ plasmid pvWF-V~3 ' Plasmid pvWF-VE2 was digested with NdeI and ~indIII and the ;~ 770 bp fragment containing the v~ GPIb binding domain was , isolatQd. Plasmid pMIX-7891 was al80 digested with NdeI and HindIII a~d ~he large ~ragment wa~ isolaked. The res~lting plasmid, shown in Figure 17, was designated pvWF-VE3.

C. CQnstrUction Qf Plas~id p WF-V~
. , .30 Plasmid pvWF-~E3 was digested with XmnI, dephosphorylated with bacterial alkaline phosphatase (BAP) and then digested with NdeI and HindIII. Plasmid pMIK-100 wa~ dig~sted with NdeI and HindIII and dephosphorylated with BAP. The two digests were then ligated to yield plasmid pvWF-VEL as shown in Figure 18. This plasmid expresses the DNA sequence Wo gl/130~3 2 ~J~ PCT/US91/0141 -50~

corre~ponding to amino acid6 469-728 of ~ature vWF under ths control of the 1PL promot~r and the cII riboso~al binding site. The protein probably also includes an additional N-terminal methionine residue. A confiervative base change was introduced into ala-473 changing GCC to GCA which also encodes alanine. This introdu~ed an SphI site into the gene by changing GCCTGC to ~CATGC.
:`:
Expression of pvWF VEL in E~ 1~2Li 4300(F ~ yi~lds a 29 kD
protein which reacts strongly with a ~onoclonal anti-v~F
antibody and will be referred to herein as VEL.

,~
,'~

:, .

'~ '' :.

~' ~
' , ' , ' . ~.
~ .
.', ~.

W091/13093 ~ ~7 ~ PCT/US91/01416 -51~

:
; Pharmaçeutic~l U~es o~ vWF GPIb Bindi~g.~ in_PQly~ç~tide ~ .
Examples 1 and 4 describe the production and puri~ication of a novel vWF GPIb binding domain polypeptide designated VCL.
: Some of the uses envisaged ~or VCL or for other vWF ~PIb : binding domain pol~peptides are described below.
Pharmaceutical compositions containing VCL or such other polypeptides may be ~ormulated with a suitable - pharmaceutically acoeptable carri~r using methods and carriers well known in the art.

: 1. The VCL composition described above may be u~ed for ~ 15 prevention o~ platel~t adh~sion to damaged vascular surfaces ~ (see Example 5, sub-section 5).

, : 2~ The VCL ~o~position described above may be u6ed for disruption of platelet-rich aggregates (see Example 5, subsection 3).
';' -3. The VCL composition described above may be used for prevention o~ re-occlusion following angioplasty or .. thrombolysis ~ea B~llinger et al., PN~S, USA, ~4: 8100-8104 .' 25 (1987), Prevention of occlusive coronary artery thrombosis by a ~urine ~onoclonal antibody to porcine von Willebrand .' Factor).
' .
4. The VCL composition described above may be used ~or prevention of platelet activation and thrombus fmrmation due ::.
to high shear force~ such as in s~enosed or partially ; obstructed arteri~s or at ~rterial bifur~ations ~sae Peterson et al., Blood ~: 625-628 (1987), Shear-induced .: platelet aggreg~tion requires von Willebrand Factor and platelet membrane glycoproteins Ib and IIb-IIIa). ~:

. ~

~ ~77'~ ~ ~
WO91/13093 PCT/~S91/0l4.

; 5. ~he VCL composition described above may be used for prevention o~ thrombosi~ and re~occlusion after angioplasty or thrombolysi~ due to thrombin activation o~ platelets (see Fuster et al., J. Am. Coll. Cardiol. l~: 7~A-84A $1988), Antithrombotic therapy after myocardial reperfusion in acute myocardial infarction).

. The VCL comps6ition de6Gribed above may be used for prevention of platelet adhesion to and aggregation on prosthetic materials (see Badimon et al., J. of Bio~aterials Applications, S: 27-48 (1990), Platelet interaction to prostheti materials - role of von Willebrand Factor in Platelet Interaction to PTFE).

7. The VCL co~position described above may be used for pr~vention of intramyocardial platelet aggregation in patienks with unstable angina (52e Davies Qt al., Circulation 73: 41S-427 (1986), Intramyocardial platelet aggregation in patients with unstable angina suffering sudden ischemic cardiac death).

8. The VCL composition described above may be used for prevention of va~ospa~m and va oconstriction following arkerial injury caused by angiopla6ty, thro~bolysis or other cau~e~ (see Lam et al., Circulation 75: 243-248 ~1987), Is , vaso~pasm related to platelet deposition?) .
,.......................................................................... . .
, 9. The VCL composition described above may be used for ; prevention of restenosis following angioplasty or thrombolysis (see McBride et al., N. Eng. J. of Med. ~
:.- 1734-1~37 (1988), Restenosis after succes~ul ~oronary - .
angioplasty).
"
;.~ 10. The VCL composition describ2d above may ~ u~ed for prevention of vaso-occlusive crises in sickle-cell anemia :
: ':

.-. -. . .. . . .. - - . , - . -. . - - .-, . ,.. . ., . , - . . . . .... . . .

' "" '" "' ' '' ' ' """ : ,.. ' . '. ' . '' . "'' i ~ "' . ' ''' ' " , ' , ', , ' 2 ~ ~ 7 ~ L~
W091/13093 PCT/US9l/0~416 ~' ..
(see Wick et al., J. Clin. Inve~t. ~0.: 905-910 ~1987), Unusually large von Willebrand multimers increase adhesion of sickle erythrocytes to human endothelial cell~ under controlled flow).
.. 5 11. The VCL composition described above may be used for prevention of thrombo~is associated with inflammatory response (see Esmon, science ~ 1348-1352 (1987), The ` regulation of natural anticoagulant pathways).
,' 10 .: 12. The VCL composition describ~d above may be used for :.~ prevention o~ arterio~clerosis (s~e Fuster et al., Circulation Res. 51: 587-593 (1982), Arteriosclerosis in ; nor~al a~d von Willebrand pigs).

:. 13. The VCL composition described above ~ay be used ~s . an antimeta~tatic agent (see Kitagawa et al.l Cancer Res.
:~ 4~: 537-541 tl989), Involvement of plat~let membrane . glycoprotein Ib and IIb/IIIa complex in thrombin-dependent :~ ZO and -independent platelet aggregations induced by tumor `~ cells).

,~ . .
~''''' .

., : .
. .
' ', :
~' ~

"',.
. . .
, .

.,,., . ~ ,. ,, , ~ : , WO 91tl3093 ~ J ~ P~/US91/0141 l~ 8 1. ~ Vit~o 8~ud~ Z8gl For these studies VC~, or vehicle control, was made up fresh in sterile water (2 . 2 mg/ml stock) .
é
.; A. Platelet ~qqreqation ~PRP~

: lo This is a standardized von Willebrand Factor (vWF)~dependent aygregation assay using human or rat platelet rich plasma ~PRP). The addition of various concentrations of . unfraGtionated Bothrops jararaca venom (8JV), which includes :: botrocetin and an additional thrombin-like component, or l, 15 ristocetin results in an aggregatory response in the absence ; of any additional agent. Using ristocetin (1.5 mg/ml) as ~- the agonist 43 ~g~ml VCL abolished the aggregation of human ' PRP. Ristocetin up to 5.0 mg/ml did not cause measurable :;, aggregation of rat PRP. Using this assay sy~tem with aJV as the agonist VCL at ~3 ~g/~l slightly inhibited the re~ponse :
of human PRP (Figure 19) but not rat PRP (Figure 20).
, . ' ';' It is concluded that ristocetin is not a suitable agonist ~ for inducing vWF dependent aggregation in the rat. Further, .~ 25 it is not po~sible to monitor the effects o~ VCL çx vivo using BJV-induced ag~regation o~ rat PRP. However, VCL does inhibit vWF-depandent aggregation in human PRP in vitro.
.,, ': .
: B. ~l~telet Thrombin Receptor Assay ~;~
This assay measures the inhibition of thro~bin-induced platelet pro-coagulant expression and is briefly described :.
: below. Human washed platelets are incubated in a buffer which contains CaCl2, factor Xa, prothrombin, and human alpha-thrombin for 60 min at 28C. At the end of this .

. .

~':

2~77~

period an aliquot is tran~ferred into a buff~r containin~
~ S2238 and EDTA (to prevent any ~urther thro~bin generation).
r The S2238 reaction is terminated after 15 minutes at room temperature with acetic acid and the absorbance at 405 nm i 5 read. The amount of S2238 cleavage dir~ctly due to the added human alpha-thro~bin i8. e~timated by including a control which contain no prothrombin and this value is subtracted from all results. VCL was tested in this as~ay at a final concentration of 0.1 mg/ml.
:~ . }o This assay is sensitive to both thro~bin inhibitors and thrombin receptor antagonists. In the presence of VCL the thrombin generation was 114% of control (n=2).

We therefore conclude that VCL is not a thrombin receptor antagonist in this system.
. , ~
; 2. ~a_Vi~o ~tu~
,~ .
~r~erial ~h~ombo8iS M~Lel L~

This method is essentially a modification of the model of Shand et al., Thromb. Res. 45 505-515 (1987). The method we use routinely is outlined below.
Rats ar~ labelled with lllIn platelets and 125I f.ibrinogen.
The dorsal aorta is clamped, using modified Spencer-Well~
forcep6, for 1 minute. A~ter a 45 minute reperrusion period the damaged vessel is removed, washed in citrate and counted. Results are expres6ad as mg blood equivalents.
Di~ferences in radiolabel accumulation between placebo and ; drug-treated animals are calculated and expressed as a percen~age inhibition.

For the purpose of the evaluation o~ VCL the route of ....... , , . .. - . ~ . ~ . .

, ~ . ... . .......... . .

. : ~ ~ : ...

~ ~ 77!~
WO91t13093 PCT/US91/V141 -~6~

administration was by bolus intravenous injection. VCL was used at dose~ of 2mg/kg (n=5) and 4mg/kg (n=3). It was administered 1 minute prior to cla~ping. The ves~el was then reperfused for twenty minutes. The antithro~botic effect was assessed at the 20 minute end point of the reperfusion. The shortening of the reperfusion time (as compared to routine) was desi~ned to save compound.
Appropriate vehicle controls (n=s for both do~es) were assessedO
1 0 , , It can be seen that under these conditions VCL inhibits thromblls formation in this model (Table IV). The inhibition is seen ~or the platelet (~IIIn) component~ of the thrombu.
at the 4mg/kg dose. The other change~ do not reach statistical significance, thus VCL shows antithrombotic efficacy in this rat arterial model. .:

In conclusion, VCL exhibits an antithrombotic e~fect in thi~ ..
rat model of arterial thrombosis which may bei dose dependent. . :
- . . ,:
3. ~lsauss~on From the present data it appears that the VCL interacts with the human platelet vWF rec~ptor and hence inhibits platelet aggregation in human PRP. There ls however a marked difference between ~pecies (rat vs. human) when comparing inhibition of plate}et aggregation. The sp~cie~ sp~cificity o~ this e~ect and the causal mechanism were not investigated further. At a practical leveil thi~ meant we were unable to analyze ~_YiY~ samples in order to correlate khe effects of VCL on aggregation and arterial thrombosis.
Hence the analysis and interpretation of the m vivo ef~icacy of VCL as an antithrombotic in the rat arterial thro~bosis model is complicated by thi factor.

WO 91/13093 ~ PCr/U~91/01416 Despite GPlb pos~es~ing binding ~ites ~or both vWF and thrombin it would appear that any effects o* VCL on thrombin - binding to GPlb do not translate into antagonism of thrombin-indu¢ed pro-coagulant expres~ion.

Overall VCL shows an antithrombotic e~fect in the rat arterial thrombosis model. This inhibition may be due to its interf erence with the biT~ding o~ vWF to its receptor .

, , .
.'' ,.
~ ' ' ' ''.

,'~
.
~
, .
' . .

: . . . : . .. ;

~ ~ i7 ~

WO91/13~93 PCT/US91/014.

'~ ~ ,.
. . .
The Effect of VCL on Arterial Thro~bu~
Formation in the Rat Dorsal Aorta ::

:. .
96 INHIBITION I . :
1 _ _ ~ _. ' . ' . DOSE PL~TE~ETS P FIBRINOGEN P N l l0(~g/kg) I ::
_~_~ ~ . . ~.
4 6l 3 ~ ~,0 .Ol - 7 ~ .7 _ NS ~ ::
2 25.54 + 20.98 NS 2Z.78 + 13.~8 NS 5 ¦
_ ____ The result~ are:~xpre~sed a8 msan percentage i~hibition t stan~ard error. The number o~ ~xperiment~ in the treated groups are denoted in the table and in all cases were compared to a group o~ 5 control animals. Statistical ~ .
analysis was pQrformed on the raw data prior to trans~ormation to percentage lnhibition.NS c not ::;
, 20 stati~tica}ly signi~icant.
, .

' , .
~ , ~

:': ' .

~` ' '.
', ' ~' ','" ' . ~ , , .
....

Claims (38)

What is claimed is:

1. A non-glycosylated, biologically active polypeptide having the amino acid sequence:

wherein X is NH2-methionine- or NH2-;

A is a sequence of at least 1, but less than 35 amino acids, which sequence is present in naturally occurring human vWF, the carboxy terminal amino acid of which is the tyrosine #508 shown in Figure 12;

B is a sequence of at least 1, but less than 211 amino acids, which sequence is present in naturally occurring human vWF, the amino tsrminal amino acid of which is the aspartic acid #696 shown in Figure 12; and the two cysteines included within the bracketed sequence are joined by a disulfide bond.

2. A polypeptide of claim 1 having the amino acid sequence:

wherein X is NH2-methionine- or NH2-.

3. A pharmaceutical composition comprising an amount of a polypeptide of claim 1 or 2 effective to in-hibit platelet aggregation and a pharmaceutically acceptable carrier.

4. A method of inhibiting platelet aggregation which comprises contacting platelets with an amount of a polypeptide of claim 1 or 2 effective to inhibit platelet aggregation so as to inhibit platelet aggregation.

5. An expression plasmid encoding a polypeptide of claim 1.

6. An expression plasmid encoding a polypeptide of claim 2 designated pvWF-VC3 and deposited under ATCC Accession No. 68241.

7. An expression plasmid encoding a polypeptide of claim 2 designated pvWF-VCL deposited under ATCC
Accession No. 68242.

8. A bacterial cell which comprises the exprassion plasmid of claim 5, 6, or 7.

9. An Escheriohia coli cell of claim 8.

10. A method of producing a polypeptide of claim 1 which comprises transforming a bacterial cell with an expression plasmid encoding the polypeptide, culturing the resulting bacterial cell so that the cell produces the polypeptide encoded by the plas-mid, and recovering the polypeptide so produced.

11. A method of producing a polypeptide of claim 2 which comprises transforming a bacterial cell with an expression plasmid encoding the polypeptide, culturing the resulting bacterial cell so that the cell produces the polypeptide encoded by the plas-mid, and recovering the polypeptide so produced.

12. A method of treating a subject with a cerebrovascu-lar disorder which comprises administering to the subject an amount of a polypeptide of claim 1 or 2 effective to inhibit platelet aggregation.

WO 91/13093 PCT/US91/014?

13. A method of treating a subject with a cardiovascu-lar disorder which comprises administering to the subject an amount of a polypeptide of claim 1 or 2 effective to inhibit platelet aggregation.

14. A method of treating a subject in accordance with claim 13, wherein the cardiovascular disorder comprises acute myocardial infarction.

15. A method of treating a subject in accordance with claim 13, wherein the cardiovascular disorder comprises angina.

16. A method of inhibiting platelet aggregation in a subject prior to, during, or after the subject has undergone angioplasty, thrombolytic treatment, or coronary bypass surgery which comprises administer-ing to the subject an amount of a polypeptide of claim 1 or 2 effective to inhibit platelet aggregation.

17. A method of maintaining blood vessel patency in a subject prior to, during, or after the subject has undergone coronary bypass surgery, which comprises administering to the subject an amount of a poly-peptide of claim 1 or 2 effective to inhibit plate-let aggregation.

18. A method of treating a subject having cancer which comprises administering to the subject an amount of a polypeptide of claim 1 or 2 effective to retard tumor metastasis.

19. A method of inhibiting thrombosis in a subject which comprises administering to the subject an amount of a polypeptide of claim 1 or 2 effective to inhibit the thrombosis.

20. A polypeptide in accordance with claim 1 or 2 bound to a solid matrix.

21. A method of treating a subject suffering from platelet adhesion to damaged vascular surfaces which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to inhibit platelet adhesion to damaged vascular surfaces.

22. A method of preventing platelet adhesion to a prosthetic material or device in a subject which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to prevent platelet adhesion to the material or device.

23. A method of inhibiting re-occlusion in a subject following angioplasty or thrombolysis which com-prises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to inhib-it re-occlusion.

24. A method of preventing vaso-occlusive crises in a subject suffering from sickle cell anemia which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to pre-vent vaso-occlusive crises.

25. A method of preventing arteriosclerosis in a sub-ject which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effec-tive to prevent arteriosclerosis.

26. A method of thrombolytic treatment of thrombi-containing, platelet-rich aggregates in a subject which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to treat thrombi-containing, platelet-rich aggre-gates.

27. A method of preventing platelet activation and thrombus formation due to high shear forces in a subject suffering from stenosed or partially ob-structed arteries which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to prevent platelet activation and thrombus formation.

28. A method of preventing thrombin-induced platelet activation in a subject which comprises administer-ing to the subject an amount of the polypeptide of claim 1 or 2 effective to prevent thrombin-induced platlet activation.

29. A method of preventing stenosis as a result of smooth muscle proliferation following vascular injury in a subject which comprises administering to the subject an amount of the polypeptide of claim 1 or 2 effective to prevent stenosis.

30. A method of claim 19, wherein the thrombosis is associated with an inflammatory response.

31. A method for recovering a purified, biologically active polypeptide of claim 1 which comprises:

(a) producing in a bacterial cell a first polypeptide having the amino acid sequence of the polypeptide but lacking the disulfide bond;

(b) disrupting the bacterial cell so as to produce a lysate containing the first polypeptide;

(c) treating the lysate so as to obtain inclusion bodies containing the first polypeptide;

(d) contacting the inclusion bodies from step (c) so as to obtain the first polypeptide in soluble form;

(e) treating the resulting first polypeptide so as to form the biologically active polypeptide;

(f) recovering the bioloyically active polypeptide so formed; and (g) purifying the biologically active polypeptide so recovered.

32. A method of claim 31, wherein the treatment step (e) comprises contacting the polypeptide with a thiol-containing compound and disulfide.

33. A method of claim 32, wherein the thiol-containing compound is glutathione, thioredoxin, .beta.-mercaptoethanol or cysteine.

34. A method of claim 31, wherein the contacting of step (d) is effected in the presence of a denaturant.

35. A method of claim 34, wherein the denaturant is guanidine hydrochloride or urea.

36. A method of claim 34, wherein the recovery of the polypeptide of step (f) comprises removing the denaturant by dialysis.

37. A method of claim 31, wherein in step (g) the polypqptide is purified by cation exchange chroma-tography.

38. A method of claim 37, wherein the first polypeptide is purified by cation exchange chromatography after step (d).