JPH05506646A - Cloning and production of human von Willebrand factor and methods for its use - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Cloning and production of human von Willeplant factor, and methods for its use [Background of the invention] This application is filed in U.S. Patent Application No. 486,767, filed March 2, 1990. This is a partial continuation application. This parent application is incorporated by reference into the disclosure of this application.

Throughout this application, various publications are cited in parentheses. These publications This entire disclosure is intended to more fully describe the state of the art to which this invention pertains. Incorporated into this application by reference.

The present invention relates to the cloning and production of human von Willeplant factor analogs, and and how to use such analogs.

Structural features of Huonville-Plant factors Von Willeplant factor (vWF) forms the inner surface of the lining of the blood vessel wall. Giant plasma proteins are synthesized by megakaryocytes, which are precursors of platelets, in endothelial cells. It is A large amount of vWF is present in platelet α-granules, and these Released into the blood upon activation. Newly synthesized vWF in endothelial cells is It can be introduced into the blood via two selectable routes. Some of them are mainly disulfides as linked dimers or small multimeric subunits of 250,000 daltons , secreted into the blood as constituents. Or, some parts are in Waibeluparado type ( Introduced into secretory organelles called Weibsl-Palade bodies) be done. v W F stored in the Waibel-Ballard body is a dimer ~50 or more It is a highly multimeric subunit with a size ranging from can be released from the cells by treatment with secretagogues. high volume The body, vWF, is most effective in promoting platelet adhesion.

The gene encoding vWF has been isolated and is greater than 150 kb in length. It has been shown that This gene is composed of more than 20 exons. v WF mRNA has a length of approximately 9000 bases and is a protein consisting of 2813 amino acids. Code repro v W F. Residues 1-22 indicate that the protein is present in the rough endoplasmic reticulum. The leader to be processed, which will probably be cleaved after being introduced into - form an array. The N-terminal protein of pro-vWF (741 amino acids) is This is a propeptide that does not exist in mature vWF. This peptide is present in the blood; Blood protein already known as viruplant antigen II (vW Ag1l) is shown to be the same as The propeptide is indispensable for vWF multimerization. It is vital. Cells introduced with vWF-CDNA containing only mature vWF sequences produces only dimers. The function of propeptide/vWAgll is unknown. stomach.

Analysis of the DNA sequence reveals that the pro-vWF precursor consists of repeated domain subunits. It is shown that it consists of

Four different domains have been identified. Mature vWF has three A-type domains , consists of three B-type domains and two C-type domains. Also, two complete There is a full type domain and one partial type domain. There are two propeptides consisting of a D-type domain, and the domain would have a function related to this. This leads to the idea of

Mature vWF is a multivalent molecule with binding sites for multiple proteins. one Two binding sites recognize platelet tube protein]b (GPIb). Protein content eliminated According to the results using chromatography, this binding site is located between amino acid residues 449 and 7 of mature vWF. It is localized between 28 and 28. In addition, vWF has at least two collagen binding sites. at least two heparin binding sites, one factor It has an RGD site that binds to the plate GP Ilb/l1la receptor.

Involvement of vWF in platelet adhesion to the subendothelial layer For normal platelet adhesion, vW Evidence that binding of F, particularly vWF, to platelet GPlb receptors is essential. Based on both floor observations and in vitro studies. Fu, a bleeding disorder Patients with Onovir-Plant's disease (vWD) have low levels of vWF or Completely lacking WF. Or they may have a defective vWF. other Bernardeau-Soulier syndrome (Bernard-Soulier syndrome) is a disease of Sy++d+ome　;BBS) is produced by platelets lacking CPIh receptors. characterized.

The in vitro system that most closely approximates the environment of the lesion defect is the inverted vascular section (rabbital aorta). It consists of a perfusion chamber in which the human post-mortem renal artery or human peritoneal artery) is exposed to blood flow. be. After stripping the layer of endothelial cells from the blood vessel, blood is allowed to flow through the chamber. It will be done. The extent of platelet adhesion can be determined directly by morphometry (mo ``phomelry''). or indirectly using radiolabeled platelets. normal Blood supports platelet adhesion, but blood from patients with VWD or BSS Does not support board adhesion. This indicates the requirement for vWF and platelet GPlb ing. Furthermore, the addition of a monoclonal antibody against GPIb can improve platelet adhesion. prevent. The vWF dependence of platelet adhesion is due to high shear such as exists in arterial blood flow. It is more obvious under the condition of deformation rate. Under conditions of low shear deformation, platelets Adhesion may be facilitated by other adhesive proteins such as fibronectin. cormorant. Presumably, the adhesion provided by these other proteins is due to high shear forces. Sometimes it is not sufficient to support adhesion and vWF dependence becomes apparent. Also , the multimeric nature of VWF allows it to bind to more sites on platelets. , would provide a stronger bond.

by angiogenesis or by administration of tissue plasminogen activator (tPA). Approximately 20% of patients who have their clots removed suffer from reocclusion. This is probably During treatment, the endothelial system is damaged, resulting in platelet adhesion to the affected area on the inner surface of the blood vessel. This is probably because it is being carried away. This is followed by many layers of platelets and fibrin. The platelets aggregate on top of the platelets that previously adhered to form a thrombus.

To date, prevention of initial platelet adhesion to the exposed subendothelial layer and thereby No antiplatelet aggregation agents that prevent subsequent clot formation have been described in the literature. Not yet.

The present invention comprises a vWF (von Willeplant factor) GPIb binding domain. , which provides biologically active polypeptides that are not glycolylated. Ru. These polypeptides are useful for diseases such as cerebrovascular and cardiovascular disorders, among others. used to inhibit platelet adhesion and aggregation in the treatment of patients with obtain. The present invention also provides expression plasmids encoding these polypeptides. and transform the plasmid into bacterial cells to produce such polypeptides. The present invention provides a manufacturing method by recovering In addition, the present invention inhibits platelet aggregation. These polypeptides can be used to treat and inhibit cerebrovascular disorders and other diseases. Provide a way to prevent it.

[Summary of the invention]

The present invention relates to a non-glycolylated biologically active protein having the following amino acid sequence: X-A-[Cys Sar Arg Lau L au Amp Lau Val Phs Lau Iau AJP GIYTr p Vllll Arg Val Jua Val Val Glu? fl:　 Hls Jup GIYsar H1m 1a Tyr X1m GIY La u LYII Amp Arq LY8 λrli Pro sar Glu Lau entering rg Arg Eng 1/En 1a S@r Gin’tFal Lys Tyr Enter 1a Gly Sar Gin ValAla sar Thr S @r　Glu　Val　xAu　Lym　’! 'yr　Thr　Lau　Ph5 i Gin Engineering 1 Ph @ Sar Lys Zla Enter gp Arg Pro Glu Jua Sar Entering 1/1aTAuLauLauM@t Ala S@r Gin Glu Pro Gin Arg Mat Sar λr9 λmnPh@Val Arg Tyr Val Gin Gly L au Lys Lye Lye Lym’Val 1sVal Ila Pr o Val Gly Engineering No. 1 Gly Pro 1! is enter 1a λgin L au Lysi Gin Engineering 1 @ ArgLau Engineering is Glu LY8 Gin Alm? 1:OGlu Juln L7m Ala Ph*Val Lau S@r S@r val AJIP Glu Iau Glu Gin Gi n Arg MP Glu Engineering @ Val Sar’! 'yr　'xAu　C ysl-B-■1 However, in the above, X is NH2-methionine-1 or NH2-; A is at least one and a sequence of fewer than 35 amino acids, which sequence is present in natural vWF. and its carboxy-terminal amino acid is tyrosine #508 shown in Figure 12. Ru; B is a sequence of at least 1 and less than 211 amino acids; exists in natural vWF, and its amino terminal amino acid is the amino acid shown in Figure 12. Spartic acid #696; also The two cysteines contained in the sequence in parentheses are linked by a disulfide bond.

In addition, the present invention provides a method for producing any of the above polypeptides. This method is , transform bacterial cells with an expression plasmid encoding this polypeptide. and the resulting bacterial cells are coated with the plasmid. culturing to produce the polypeptide to be loaded, and the polypeptide thus produced. and collecting the lipeptid.

Furthermore, the present invention provides an effective amount of any of the above polypeptides to inhibit platelet aggregation. and a pharmaceutically acceptable carrier. The present invention is and a sufficient amount of one of the above polypeptides to inhibit platelet aggregation. A method of inhibiting platelet aggregation is provided, comprising contacting with a platelet aggregation. In addition, The present invention treats diseases such as cerebrovascular or cardiovascular disorders or thrombosis, A method of preventing or inhibiting such diseases, which is effective in treating or preventing such diseases. Provided is a method comprising administering to a subject an amount of one of the above polypeptides. provide

The present invention also provides a method for recovering the purified biologically active polypeptide. There it is, (having the above amino acid sequence of the polypeptide in a bacterial cell, and the above amino acid sequence of the polypeptide; producing a first polypeptide lacking a disulfide bond; (b) disrupting the bacterial cell and using a lysate containing the first polypeptide; (C) processing the lysate to obtain the first polypeptide; (d) obtaining an inclusion body containing; contacting the clathrate from step (c) to obtain the soluble first polypeptide. (e) treating the obtained first polypeptide to obtain a biologically active polypeptide; forming a peptide; (1) the biologically active polypeptide thus formed; recovering the peptide; (g) purifying the biologically active polypeptide thus recovered; Provide a method for

[Brief explanation of the drawing]

Construction of ul:pvWIP This figure shows the construction of plasmid pvWIP.

A series of vWF-cDNA clones in λ111 (human endothelial cell cDNA library) (isolated from Lee) were isolated.

One cDNA clone covering the entire GPlb binding domain was pUc1 It was subcloned into the EeoR1 site of 9.

The resulting plasmid pvWIP contains an inserted 2.5 kb cDNA. Ru.

Figure 2: Construction of pVWF-VAl This figure shows the construction of plasmid pvWF-VAI. Amino acid Glu- 437 (i.e., the 473rd amino acid in the vWF protein shown in Figure 12) A synthetic oligomer containing the initiation codon ATG located in front of Nd5i and B ligated into the su361 digested plasmid pvWIP. The obtained output The lasmid was named pvWF-VAI and was introduced into E. coli strain Sφ930. It has been deposited with ATCC accession number 68530.

Figure 3: Construction of pvWF-VB1 This figure shows the construction of plasmid pvWF-VBI It shows the construction of Located before amino acid Ph5-443 (see Figure 12) Synthetic oligomers containing the start codon ATG were quenched with Nd5l and Bsu361. plasmid pvWIP.

The resulting plasmid was named pvWF-VB.

Figure 4 + Construction of pvWF-VA2 This figure shows the construction of plasmid pvWF-VA2. Amino acid L7s- Synthetic oligomer containing the stop codon TAA located after 728 (see Figure 12) into plasmid pvWF-VAI digested with H1ndlll and Xmal. Reigate. The resulting plasmid was named pvWF-VA2.

Figure 5: Construction of pvWF-VB2 This figure shows the construction of plasmid pvWF - Shows the construction of VB2. A synthetic oligomer containing a stop codon TAA is into plasmid pvWF-VBI digested with Hindll+ and Xll1xl. Reigate. The resulting plasmid was named pvWF-VB2.

Figure 6: Construction of pvWF-VA3 This figure shows the construction of plasmid pvWF-VA3. Plasmid pvW The Nd5l-E coR17 fragment was isolated from F-VA2, and Ndel and Plasmid pMF-945 (as described in Figure 11) was digested with (constructed with). The resulting plasmid was pvWF-VA3 It was named. This plasmid is under the control of the deoPIP2 promoter. In this case, VA, i.e., vWF-G containing amino acids 437-728 (see FIG. 12) PIb binding domain polypeptide. Shows construction. Nd! from plasmid pvWF-VB2! iE coRV7ra The Nd! Plasmid pM digested with I and pvull It was ligated to F-945. The obtained plasmid was called pvWF-VB3. Name Saleta. Under the control of deoP, P2bromo-9, this plasmid VB, the vWF-GPIb binding domain polypeptide containing amino acids 443-728. Expresses putide.

Figure 8: Construction of pvWF-VC3 This figure shows the construction of plasmid pvWF-VC3. The synthetic linker is Nd! Plasmid pvWF-V digested with l and tthllll Reigate to A3. The obtained plasmid is pvWF-VC3 It has been deposited with the ATCC under accession number 68421. deo Under the control of the PIP2 bromotor, this plasmid converts into VC (VCL or or VCB), which contains amino acids 504-728 (see Figure 12). A VWF-GPlb binding domain polypeptide is expressed.

Figure 9 + Construction of pvWF-VD3 This figure shows the construction of plasmid pvWF-VD3. synthesis Plasmid pvW in which the linker was digested with Ndel and Tlhlll+ It was ligated to F-V A3. The resulting plasmid was pvWF-VD It was named 3. dso　P,　Under the control of the P2 promoter, this plus Mid is VD, i.e. VWF-GP containing amino acids 513-728 (see Figure 12) Expressing the lb binding domain polypeptide.

This figure shows a plasmid expressing a VWF-GPlb binding domain polypeptide. Showing relative alignment. In addition, the top two lines contain vWF-cDNA and the corresponding The location of the region encoding the GPIb binding domain in the cDNA is shown. ing.

Construction of plasmid pMF-945 The construction of F-945 is shown.

Plasmid I) EFF-920 (Esh*richia coli S φ930, ACTT reception number No. 67706) is B gll+ and Nd 5l and the larger fragment was isolated. This fragment is Plasmid pMF-5534 (ATCC reception number No. 67703) was transferred to Bg The smaller of 540 bp produced by cleavage with ll+ and NdeI ligated into fragments. This allows the PAR array and the 5″ and In the order of 3゛, dto　P　IF　2 promoter sequence, enhancer sequence. The modified de.

liposome binding site, pGH analog encoding sequence and TT transcription termination sequence. The integrated plasmid pMF-945 is produced. Plasmid pM The F-945 group is an expression product that expresses pHG analog proteins at high levels.

Figure 12: Translated cDNA sequence of mature human vWF Figures 12A, 12B, 12C, This figure consists of 12D, 12E, 12F, j12G and 12H. The translated cDNA sequence of von Willeplant factor is shown. This array is Vsrveii, C, L,, et tl,, EMBOJoonIl 5: 18 39-1847 (1986), and 5adlsr, J, E, et! 1. , Proc, N111. Acxd, Sci, 82:6394- 6398 (1985). This nucleotide sequence The column is nucleotide number 2519 (where nucleotide 1 is the signal peptide) starting at nucleotide 8668 (relative to the start of coding of the code sequence) It ends with A total of 6150 nucleotides make up 2050 amino acids. It encodes a mature vWF consisting of This translated amino acid sequence is an amino acid It starts with the number 1 and ends with the amino acid number 2050. Through this application, this The corresponding nucleotide and amino acid designations are used.

Translated sequence of the binding domain polypeptide This figure shows the plasmid pvWF-V C3 (ATCC reception number No. 68241) and pvWF-VCL (AT Huonville plant expressed by CC accession number No. 68242) The translated sequence of the Factor G P Ib binding domain polypeptide is shown. figure 12 for the nucleotide sequence corresponding to nucleotides 4028-4702 of the sequence Then, the first codon ATG, which codes for translation initiation, i.e., the methionine codon, is added. It is being The sequence is from amino acid tea 504 to amino acid L7s 7 in Figure 12. 225 amino acids corresponding to 28 (plus the starting methionine), i.e. 22 in total It encodes a polypeptide containing 6 amino acids.

[Dl 4: pvWF-VCL) Construction This figure shows the plasmid pvWF-V The construction of CL is shown. Plasmid pvWF-VCL is H1ndlll-S Digested at +71 and an 860 base pair fragment isolated. This fragmen isolated from the old ndlll-S+71 digest of plasmid pMLK-100. was ligated with the larger fragment. The obtained plasmid is p It was named v W F - V CL and was submitted to ATCC with the number 68242. It is entrusted to me. This plasmid is VCL, i.e. pvWF-VC3 (methionine (amino acids 504-728) plus the same vWF-GPIb binding domain polypeptide. peptide, which is driven by the λPL promoter and the control of the liposome binding site. It will be done under your command.

Figure 15 = Blasmi)’pvWF-VE2 (7) Construction plasmid pvWF-VA2 was digested with Ndel and Psfl and the larger fragment was isolated.

Synthetic oligomers No. 2 and No. 3 (shown in Figure 16) are T4 polynucleotides. treated with otidokinase. The larger pvWF-VA2 fragment is , then synthetic oligomers No. 1 and No. 4 (shown in Figure 16), and key The oligomers were ligated with enzyme-treated oligomers No. 2 and N003. obtained The resulting plasmid was named pvWF-VH2.

This figure shows the four synthetic linkers (Nos, 14) is shown.

Figure 17 = Construction of plasmid pvWF-VH2 Plasmid pvWF-VE2 is Nd digested with el and H1ndlll, the smaller fragment of 770 bp was isolated. This fragment was derived from the Ndel- ligated with the larger fragment isolated from HiIIdl11 digestion. Ta. The obtained plasmid was named pvWF-VH2. -V E 3 is digested with X+ul, and bacterial alkaline phosphatase ( BAP) and further digested with Ndel and Hindll. On the other hand, Lasmid pMLK-100 was digested with Nd5l and H1Ildll and BAP processed with. These two digests are mixed and ligated to create a plasmid pv. WF-VEL was manufactured. The thus obtained plasmid contains the λPL promoter and cII liposome binding site, amino acid 4 of mature vWF. 69-729 is expressed.

Figure 19: VCL against BJV-induced aggregation in human platelet-rich plasma (PRP). Impact of This figure shows standardized Huonville Plant Factor (vWF) using human PRP. Provides the results of the dependent agglutination test.

This figure shows the standardized Fonville-Plant factor (vWF) using rat PRP. ) provide the results of the dependent agglutination test.

[Detailed description of the invention]

In accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure In order to meet this requirement, plasmids pvWF-VC3, pvWF-VCL and p　v　W　F　-V　A1 is Esh! +1 Introduced into chia coli In the form, No, 6824L, No, 68242 and No, 68530, respectively. The reception number is 12301 Park Row, Rockwill, Mayland 20852. Donate to NDrive's American Type φ Culture φ Collection (ATCC). Entrusted.

The present invention relates to a non-glycosylated biologically active protein having the following amino acid sequence: X-A-[Cys Sar Arg Lau L au Asp Lau Van’ Pbn Lau Lau Asp GlyS @r Sar Arg Lau Sar Glu 1a Glu PM Gl u Van Lau Lys 1aPh* Val Val Asp Mat N@t-Glu JLrg'XAu Arg Ila By Gin Ly gi Trp Val enter rg Val enter 1a Val Val Glu Tyr Hls Agp Gly 13w H1s included 1a Tyr 1m Gly Lau Lys Asp Arg LYII rqPro Sir Glu LauArg hxq 工1・Ala 5cGin Val Lys T’f! ” Ala GIY Sur Gin Valλla Sir Thr Sar Glu Val II @u Lylk’! 'yr　TIFn''　Lau　Pb S Gln IlaPha Sm Lys Engineering/Agp Arg Pro G lu Ala sar Enter r9 Work 1m Enter 1a tauL@u Lau Ma t Ala Sar Gin Glu Pro Gin Arg Mat Sa rλrv entering 1nPh@Val Arg 'I'yr Val Gln Gly XJu Lys Lyg Lys Lys Val HlsVal Engineering 1@P ro Val Gly Engineering Is GlyPro His Ala Ajn La u Lys Gin 1-person rq 11au m1g1 Glu Lylk G in 1a pro Glu Ajln LYII AIJI Ph@Val Lau Sar Sar Val Agp Glu Lau Glu Gin Gin Arq AJlp Glu Engineering@Mal Sar Tyr Lau CYs]-B-■However, in the above, X is NH-methionine-1 or NH2-; A is at least one and a sequence of fewer than 35 amino acids present in natural vWF; And its carboxy-terminal amino acid is tyrosine #508 shown in Figure 12; B is a sequence of at least 1 and less than 211 amino acids; exists in natural vWF, and its amino terminal amino acid is the amino acid shown in Figure 12. Spartic acid #696. Also, The two cysteines contained in the sequence in parentheses are linked by a disulfide bond.

The bracketed sequences include amino acids #509-#695 shown in Figure 12. Prepare.

In one example, the polypeptide has the amino acid sequence below.

X-[Lau Hls Asp PbS Tyr CYs Sar Arq L au Lsu enter lip Iau ValPh@Lau Lau enter sp G ly　5＠r　Sar　r9　L・u　Sar　Glu　1a　GLu　P h*Glu Val Lau Lys Ala Pbn Val Val As p Mat at Glu)kXq’L4uλr9 1m Sar Gi n Lys Trp Val Arg Val enter 1a Val Val Gl u TyrHis Ajp Gly Sir Hls 1aTyr 1m Gly Lau Lys lip Arq LysArg Pro Sar Glu　Lau　Arg-Arg　・Ala　5ar　Gin　Val　Ly e Tyr included 1a Gly Sar Gin Val Ala 5@x Thr Sar Glu Val Lau Lys yrThr Lau PbS Gln l@PbS Sar Lys 1m in sp Arg Pro G lu Enter 1aSer hrq Engineering 1・Enter 1a XAu Lau Lau Mat Ala Sex Gin Glu Pro GlnArg Mat Sar Arg　Ajn　Ph@Val　hxq　Tyr　Val　Gin　Gly　L au　1LyssLyis　Lys　Lys　ValIla　Val　Hls　 Pro Val 01711m Gly Pro Him included 1a Asn La u Lys Gin Engineering 1 @ Arg Iau Engineering 1a Glu Lys Gi n Enter 1a Pr.

Glu Asn Lys 1a Ph@Val Lau 5ar Sar V al Enter sp Glu Lau GluGln Gin Arg ksp Gl u Engineering 1m Val Sar Tyr Lau Cys Ajp Lau λ1 aPro Glu included 1a Pro Pro Pro Thr L+au Pr o Pro enter sp Mat enter 1a GinValThr Val Gly Pro Gly Lau Lau Gly Val Sar Thr tau GlyPro Lys]-COOH Here, X is NH- or NH2-methionine-, preferably NH2- It is methionine.

The bracketed sequence comprises amino acids #504-#728 of Figure 12. .

A person skilled in the art to which the present invention pertains will be able to use recombinant or non-recombinant DNA techniques. Such polypeptides can be easily produced.

The polypeptides described above may be constructed using recombinant DNA technology. This polypep One means of obtaining tide is by using methods well known in the art. The nucleic acid encoding the polypeptide is transferred to bacteria, yeast, or mammalian cells. expression in a suitable host such as a host, and after expression in such a host The goal is to recover the repeptide.

Examples of vectors that can be used to express the above polypeptides include bacteriophore (such as λ phage), cosmids, plasmids and other recombinant vectors. be. The nucleic acid molecule is inserted into the vector genome by methods well known in the art. entered. For example, using conventional restriction enzyme sites to - Expose both pieces of DNA to restriction enzymes to create complementary base-paired ends on both molecules. created and then ligated with ligase at zero. Alternatively, control in the vector DNA A linker corresponding to the restriction enzyme site may be ligated to the inserted DNA. This is then digested with a restriction enzyme that cuts at that site. Other means are also used It can be done.

comprising a nucleic acid encoding the above-mentioned polypeptide; Necessary for expression of the nucleic acid in mammalian cells.

A regulatory element is provided at a location that allows expression of the nucleic acid encoding said polypeptide. The vectors are suitable for expression in bacterial, yeast or mammalian cells. can be done. The regulatory elements required for this expression include proteins that bind RNA polymerase; Includes a motor sequence and a transcription initiation sequence for liposome binding.

For example, bacterial expression vectors include Promoters and CII or deo liposome binding sites for transcription initiation may be included. Such vectors are commercially available or generally available in the art. described by methods well known in the art, such as those previously described for constructing vectors. It can be assembled from the sequences described.

In addition, non-recombinant techniques such as chemical synthesis, synthetic RNA or cDNA can be used to It can be used to obtain repeptides.

One means of isolating polypeptides is by using methods well known in the art. By using natural or artificially designed DNA probes, human genome probe the library. DN encoding the polypeptide The A molecule and cDNA molecule are complementary DNA molecules from human, mammalian or other animal sources. nomDNA5 to obtain cDNA or RNA, or cDNA or genome Related cDNA or genomic clones by screening libraries can be used to isolate

The present invention further provides an effective amount of any of the above polypeptides to inhibit platelet aggregation. and a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutically acceptable protein" refers to any standard pharmaceutical carrier. Includes Reochi. Such carriers are well known in the art and are subject to equivalent limitations. Although not intended to be Any standard pharmaceutical carrier such as emulsions, and various types of wetting agents can be used. may be included. Other carriers also include sterile solutions, tablets, coated tablets and capsules. obtain.

Typically such carriers include starch, milk, sugar, clay of some kind, gelatin, starch, etc. Thearic acid or its salts, magnesium stearate or potassium stearate Lucium, talc, vegetable fats or oils, gums, glycols, or other known may contain a diluent, such as a diluent. Such carriers may also carry flavorings and colorings. It may also contain agents or other ingredients. Compositions comprising such carriers have conventionally been It is formulated by known methods.

The composition may contain 0.06 to 58 μM, preferably about 0.06 to 29 μM, e.g. ．． It has a sufficient amount to give a blood concentration of 23-23 μM. say it in a different way For example, this amount is 0.1-100 mg/Kg body weight, preferably 0.1-50 mg /Kg body weight, for example 0.4-4hg/)g body weight.

Administration of the composition can be carried out by any known method, which includes Includes, but is not limited to, intravenous, intramuscular, subcutaneous, and oral administration. However, the present invention also provides a method for treating platelets in blood cells so as to inhibit platelet aggregation. contact with any of the above polypeptides in an amount sufficient to inhibit plate aggregation. A method of inhibiting platelet aggregation is provided.

The invention also provides expression plasmids encoding the above polypeptides. one In one embodiment, the parenthesized sequence, i.e., amino acid #504-1 of FIG. The expression plasmid encoding the polypeptide with 724 is pvWF-VCL. It has been deposited with ATCC accession number 68242.

Expression plasmids of the invention further express polypeptides in appropriate host cells. located within the plasmid in relation to the DNA encoding the polypeptide. with appropriate adjustment elements placed. Such adjustment elements include, for example, Promoters and operators such as deo P, P2 and λPLOL, e.g. Liposome binding sites such as Badeo and C11, and repressors include It will be done. Among other suitable regulatory elements include, for example, Iac-, 1ap-, tac- and 1pp-promoter (European Patent Application Publication No. 0303972 issue, published February 22, 1989).

These appropriate regulatory elements direct expression of the polypeptide in the appropriate host cell. is located within the plasmid in relation to the DNA encoding the polypeptide. Ru. In a preferred embodiment of the invention, the regulatory element encodes a polypeptide It is located close to and upstream of DNA.

The expression plasmid of the invention can be expressed in a suitable host cell, preferably a bacterial host. can be introduced into cells. Preferably used as a host cell for baclasmid can. Such bacteria include P+tudomonas ae+ugio osx and one Bacillus subti.

Bacteria used as hosts can be auxotrophic strains (such as A1645), auxotrophic strains (such as A1645), Vegetative strains (like A4255) and lytic strains; F and F-strains; λ profile Cl857 rebreather+ strains that have integrated sequences (such as A1645 and A4255); and deo Strain with deleted presser and deo genes (European Patent Application Publication No. 0303) No. 972, published February 22, 1989). Eshuichi x eoli^4255 (F+) stock has ATCC reception number No. 53468 It has been deposited in Esherichix C.

1i A1645 strain has been deposited with ATCC accession number No. 67829.

The present invention provides bacterial cells equipped with these expression plasmids. one In the example, the bacterial cell is an Escherichix eoli cell. be. In a preferred embodiment, the present invention is named pvWF-VA1. plasmid (E, ATCC accession number No. 6 in E. coli strain Sφ930) 8530); pvWF-V3A; pvWF-VB3; p vW cells are provided.

All of the above E. coli host cells can be prepared using methods well known in the art, such as R. Bact! by P. Noyick! riol, Review 33.21 Plasmids introduced by the ethidium bromide method described in 0F+969) can be removed.

In addition, the present invention provides a method for producing any of the polypeptides described above, comprising: transforming a bacterial cell with an expression plasmid encoding the peptide; obtained such that the cell produces the polypeptide encoded by the plasmid. culturing the bacterial cells produced and recycling the polypeptides thus produced. Provided is a manufacturing method comprising:

Furthermore, the present invention provides a method for treating a subject with a cerebrovascular disorder, the method comprising: , administering an amount of any polypeptide of the invention effective to inhibit platelet aggregation. Provides a method that includes the following:

Also, a method for treating a subject with a cardiovascular disorder, the method comprising: comprising administering an amount of a polypeptide of the invention effective to inhibit plate aggregation. A method is provided. Examples of cardiovascular disorders for which this treatment is possible include acute myocardial infarction; or include angina pectoris.

Additionally, the present invention provides a , in a manner that inhibits platelet aggregation in a subject during or after receiving and the polypeptide of the present invention is administered to the subject in an amount effective to inhibit platelet aggregation. A method comprising administering a peptide is provided.

The present invention also provides a A method for maintaining vascular patency in a subject, the method comprising: comprising administering an amount of a polypeptide of the invention effective to inhibit the provide a method.

The invention also provides a method of treating a subject with cancer, the method of treating the subject with tumor development. administering an amount of a polypeptide of the invention effective to delay the provide law.

The invention also provides a method of inhibiting thrombosis in a subject, the method comprising: comprising administering an amount of a polypeptide of the invention effective to inhibit thrombosis. provide a method.

The thrombosis may be accompanied by an inflammatory response.

In addition, the invention provides polypeptides of the invention attached to a solid matrix. Ru.

The present invention also treats subjects suffering from platelet adhesion to damaged blood vessel surfaces. A method for inhibiting platelet adhesion to the surface of a damaged blood vessel, the method comprising: A method is provided comprising administering an effective amount of a polypeptide of the invention.

The invention also prevents platelet aggregation to prosthetic materials or devices in a subject. A method for preventing platelet adhesion to said material or device, said method comprising: provides a method comprising administering an amount of a polypeptide of the invention effective for.

The invention also inhibits re-occlusion in a subject following angioplasty or thrombolysis. A method comprising: administering to the subject an amount of the potion of the present invention effective to inhibit reocclusion; A method comprising administering a repeptide is provided.

The invention also prevents the development of vascular occlusion in subjects suffering from sickle cell anemia. A method comprising: administering to the subject an amount of the present invention effective to prevent the onset of vascular occlusion; A method comprising administering a polypeptide of the invention is provided.

The present invention also provides a method for preventing arteriosclerosis in a subject, the method comprising: comprising administering an amount of the polypeptide of the invention effective to prevent arteriosclerosis. We provide a method for

The present invention also provides thrombolysis of platelet-rich aggregates containing thrombin in a subject. A method of therapeutic treatment in which the subject is treated with platelet-rich clots containing thrombin. administering an amount of a polypeptide of the invention effective to treat provide law.

The invention also provides a method for treating patients suffering from arterial stenosis or partial arterial occlusion. , a method for preventing platelet activation and thrombus formation caused by high shear force, the method comprising: The polypeptide of the present invention is administered in an amount effective to prevent platelet activation and thrombus formation. A method comprising administering a peptide is provided.

The invention also provides methods for preventing thrombin-induced platelet activation in a subject. A method for preventing thrombin-induced platelet activation in the subject. provides a method comprising administering an amount of a polypeptide of the invention effective for.

The present invention also inhibits stenosis in a subject as a result of smooth muscle proliferation following vascular injury. A method for preventing stenosis, comprising: administering to the subject an amount of the present invention effective to prevent stenosis. A method comprising administering a polypeptide is provided.

The invention also provides methods for recovering purified biologically active polypeptides of the invention. The law is (a) in a bacterial cell, having the amino acid sequence of the polypeptide and disulfide; producing a first polypeptide lacking a fido bond; (b) disrupting the bacterial cell and using a lysate containing the first polypeptide; (c) processing the lysate to obtain the first polypeptide; (d) obtaining an inclusion body containing; contacting the clathrate from step (e) to obtain the soluble first polypeptide. (e) treating the obtained first polypeptide to obtain a biologically active polypeptide; forming a peptide; (1) the biologically active polypeptide thus formed; recovering the peptide; (g) purifying the biologically active polypeptide thus recovered; Provide a method with which

Step D) involves refolding and reoxidizing the polypeptide. contacting the repeptide with a thiol-containing compound and a disulfide. obtain. Preferably, the thiol-containing compound is glutathione, thioredoxin, β- Mercabutethanol, or cysteine.

Step (dl contacting is carried out in the presence of a denaturing agent such as guanidine hydrochloride or urea) It can be done in

Recovery of the polypeptide in step (1) includes removal of the denaturing agent by dialysis. It can be rare.

In step (g), the biologically active polypeptide is cation-exchanged. May be purified by chromatography.

The first polypeptide is subjected to cation exchange chromatography after step (d). It can also be purified by

The following examples are provided to aid in understanding the invention, and are intended to assist in understanding the invention. However, it is not intended to limit the scope of the present invention, and it should not be construed as such. No. Examples of these include constructing vectors, generating genes encoding the polypeptide of interest; Insertion of the gene into such a vector or transfection of the resulting plasmid into a bacterial host. It does not include a detailed description of the conventional methods used in the implementation of the system. This way Such methods are well known to those skilled in the art and include Samb+ook, F+1tsch and Maniajis, Mo1tcula+C1oniB: A Lgborxlo r7 Manual, 2ad Edition, Co1d SpringHar Many publications including bo "Labo+alo+7　Po5t, USA (1989) written on the item.

example All reference numbers to map locations refer to the human adult Vonville Plasma shown in Figure 12. corresponds to the position number along the translated nucleotide sequence of the agent.

cDNA cloning of the human VWF-GPlb binding domain. human endothelial cD in λ gill for human vWF positive sequences using The NA library (obtained from Kronchik Laboratories) was screened. was nged. This probe is based on human vWF (known to bind to the GPIb receptor). (flanking the 5′ and 3′ ends of the vWF domain) DNA sequence (Sadleret if, , Proc, Nal, Acxd , Sci, 82+6394-8 (1985) and Verviie I! +,, EMBO1,3+1829-47 (1986)) (see Figure 12). (see).

These synthetic probes have the following sequences: sequence nucleotides AAATCDingGGCAGTGCTCAGGGTCACTGGGATTCAAGG TGAC3863-3902CCAGGACGAACGCCACATCCAGA ACCATGGAGTTCCTCTT 4700-4739 entire GPIb binding A series of ■WF-cDNA clones covering the domain were identified and isolated. . This cDNA fragment was transformed into pUC-19 by New England Biolabs. It was subcloned into the E C0R1 site of the company. The sub named pvWIP One of the clones (Figure 1) contains a 2.5 Kb insert. b in this 25 Inserts range from 550 bp upstream of the GPIb binding site to 1+00 bp upstream of the GPIb binding site. Covers the entire GPIb binding domain up to bp downstream. (The sub Clone pvWIP is also named pvWF-IP).

Manipulation of DN A encoding the vWF-GPlb binding domain dso P, P GPIb binding in Escherichia coli under the control of the 2 promoter. To obtain expression of the binding domain, the vWF derived from plasmid pvWIP was The cDNA fragment was used for further manipulations described below. As shown earlier In addition, a tryptic fragment of vWF that binds to the GPlb receptor is Acid ■λ1449 to amino acid L7s 728.

A, Subcloning and translational opening of the 5′ end of the vWF-GPlb binding domain. Addition of the start codon ATG The plasmid pvWIP contains two convenient restriction enzymes at the 5′ end. It has elementary parts. DNA corresponding to amino acid 5er (445), cut at the sequence Bsu361, which cleaves with amino acid Axp (514), and T+hll, which cleaves with amino acid Axp (514) It is ll. Inserting an ATG translation initiation codon at the 5' end along with additional amino acids Synthetic fragments of various sizes were designed. First, this is a high-level This was done to maximize the chances of getting expression. Second, these are vWF-GP Reduce the size of the Ib binding domain peptide to the minimum required size and possibly collagen binding sites and heparin binding that may ultimately interfere with product function. This is the first step in removing the body part.

A synthetic oligomer with the following sequence was digested with Ndel and BI036+ ligated into plasmid pvWF-IP (see Figure 2). Obtained plasmid The code was named pvWF-VAI. This plasmid pvWF-V A1 HaE, maintained in Co11 stock Sφ930, ATCC reception number No. 68530.

51-τ and τ-〇CC-3' Kot - Person C entry ^ CGGAGT - Digested by 5'Ndel and Bsu361 ligated into the plasmid pvWIP (see Figure 3). Obtained plasmid was named pvWF-VB1.

B, Subcloning of the 3-terminus of the vWF-GPlb binding domain and translation termination. Introduction of stop codon B1. Introduction of stop codon into plasmid pvWF-vIA A synthetic oligomer with the following sequence was digested with Xmal and Hiodll. plasmid pvWF-VA1 (see Figure 4). The obtained plastic The sumid was named pvWF-VA2. This newly constructed plasmid , amino acid 728 (Lys) and a translation stop codon T adjacent to the EcoRV site. Contains AA.

A synthetic oligomer with the following sequence was digested with Xmal and Hindll. plasmid pvWF-VB1. The obtained plasmid was p It was named vWF-VB2 (see Figure 5).

To obtain expression of the vWF-PGIb binding domain, the mouse PIP2 constitutive promo Various expression plasmids have been constructed based on the data system.

1. Amino acid Glu 437 to amino acid L1s 728 (plasmid pvWF - based on VA2) containing the vWF plasmid pvWF-VA2 to Nd! l -E coRV fragments were isolated, Ndel and Pvul (see Figure 6 ) into plasmid pMF-945 (see Figure 11).

The N de I-E coRV7 fragment was isolated from the plasmid pvWF-VB2. Plasmid pM isolated and digested with Nd5l and Pyull (see Figure 7) It was ligated to F-945. The obtained plasmid was called pvWF-VB3. and was maintained in the Eshsrichix coli Sφ930 strain.

A synthetic oligomer with the following sequence was digested with Ndel and Tlhlll. plasmid pvWF-VA3. The obtained plasmid is p It was named vWF-VO2. Plasmid pvWF-VC3 is Esh Deposited with ATCC under e+iNo. 68241 (see also Figure 13) .

5'-TJCTGACC-3' Ko' type tλCg; instrument included, -51 Nda Engineering Tthxlxx 3 into plasmid pvWF-V digested with Ndel and T + hllll. Igated. The obtained plasmid was named pvWF-VD3 (see Figure 9). (see). The relative alignment of the plasmid pvWF-V expression type plasmids is shown in Figure 10. It is. Plasmi maintained in E+he+ich order coli Sφ930 strain pvWF-VA3, pvWF-VB3, pvWF-VO2, and and pvWF-VD3 are linked to various vWF-PGIb binding domain polypeptides. It was used to analyze the expression level of peptides.

The obtained clone contained Amp (1009 g/ml) for 48 hours at 37°C. The cells were grown in LB medium.

After 48 hours of growth, bacterial cells were harvested and incubated at 10.00 ORPM for 2 minutes. Centrifuged. The pellet was prepared using 1/10 volume of 50 mM Tris-HC1 (pH =8.0). Sample buffer (SDS and β-mercaptoester) (containing tanol) was added. Samples were boiled for 10 min and lO%S Run on DS polyacrylamide gel. Clone pv WF-VA 3. pvWF-VB3, pvWF-VD3i:: vWF/PGI Expression of the b-binding domain polypeptide is lower than that of the entire Bacterium IJ protein. won. However, Esheric cells transformed with plasmid pvWF-VC3 Clones generated from hia coli Sφ930 strain were stained with Coomassie ( vWF-PGlb binding domain polypeptides at detectable high levels (as the main band). Generates peptide (amino acid Leu 504 to amino acid L7s 728 + methionine) It appeared.

E+he+1ehia coli Sφ9 introduced with plasmid pvWF-VC3 The 30 strains were deposited at ATCC with accession number 68241.

Subsequently, an inducible protein containing the same vWF coding region as pvWF-VC3 A plasmid was constructed and the control of the λPL promoter and senior-liposome binding site (See Figure 14).

This new plasmid, named pvWF-VCL, GPIb binding domain polypeptide (methionine + amino acid Leu 504-A Expressor (!xptssso+) that expresses amino acid L7s (72g) at high levels It was proven that.

This plasmid was introduced into Escherichilcoli strain 4300. It was deposited with the ATCC under accession number 68242. ATCC reception number N o, 12435 E+hcrichii coli strain constructed from Octopus-sustaining strain and has a λc 1857 temperature sensitive repressor.

(Encoding the same vWF under the control of the λ promoter and all liposome binding sites) A third plasmid construct with a region that is detectable by Coomassie staining No vWF was expressed. ) Nd of pvWF-VCL! The I-H1ndllll insert contains amino acid 509 (Cr s) to amino acid 695 (Cys) and the same biological Commercially available pUc was used to produce a series of active polypeptides. It can be subcloned into other expression vectors such as 19.

While performing scaled-up fermentation of clone pvWF-VC3, A tendency was found for the host to lose the plasmid due to its instability. Plasmi The expression of VWF-GPlb binding domain polypeptide is reduced by the loss of VWF-GPlb binding domain polypeptide. It will be done. Continuous selection is necessary to maintain plasmid copy number and maintain expression levels. It may be necessary to maintain selective pressure (i.e. continuous addition of ampicillin). discovered. Large scale fermentation was carried out for 12 hours.

Fermentations were carried out in the growth medium described below.

NZ Amino AS 20gr Yeast extract 10gr NaC15gr K2HPO42.5gr MgSO3” 7 H201,0gr Antifoaming agent 0.4ml Fructose (50%) was added to the growth medium at a final concentration of 150 IQl/liter. Ampicillin (100 mg/ml) was also continuously pumped into the fermenter. (8 ml/liter in total). Fermentation was carried out at 37°C for 12 hours.

Purification of polypeptides Cells were harvested after 12 hours of fermentation and centrifuged. Obtained bacteria verve The cells were resuspended in buffer (5 mM Tris pH-8, 0, 50 mM). M NlCl, 1mM EDTA, 1mM DDT (dithiothreitol), 1mM PMSF (phenylmethylsulfonyl fluoride) and 10% glycerol ). vWF-GPIb in the pellet after additional centrifugation and sonication. A binding domain polypeptide has been discovered.

This vWF-GPIb binding domain polypeptide was dissolved at 10 mM D at room temperature. TT, 25 ml containing Tris pH-18 and 1mM EDTA Further purification was achieved by solubilizing the pellet in 8IIIM urea. Possible The solubilized pellet was subjected to DEAE cellulose ion exchange column chromatography. - Fractionated above. (Elution buffer was as above except for 0.5mM DTT) ).

vWF-GPIb binding domain polyheb titanium 150mM NaCl elution It was. After dilution to 50 mM NiCl (in the above buffer), partially purified The peptides were applied to a Q-Sepharose column. Various concentrations of NaCl , the elution from the Q-Sepharose column was performed (step elution). vWF-G PIb binding tomainheftitha, husband k 100 d, 200 QIM, 25 The four peaks eluted at 0 d and 500 mM NaCl were pooled.

All four peaks were combined with 150 mM NaCI and 5001 M Tris pH Dialyzed against -8 for 36 hours. During this dialysis, the urea concentration of the dialysis solution was 6M urine. There was a linear decrease from urea to the absence of urea.

J, Loscxlroud RoI, Handin, Biochemisl +723: Old blood bank plasma according to 3880-3886 (1984) We purified vWF from human plasma. This purified plasma-derived vWF is Con100.000 cut-off membrane to a final concentration of 0.25mg/ωI Concentrated.

Preparation of asialo-vWF Purified plasma-derived human vWF is L, DeMa+co　o+d　S.

5hxpi+o, 1. Cl1n, Invenl, 68+321-328 (1981) and with the following modifications.

1. The neuraminidase used is Vibrio cholux It type. .

2. The reaction mixture contains 0.2 units enzyme/B protein and protea according to the concentrations below. Contains enzyme inhibitors: benzamidine (20d), leupeptin (15Mg). /ml), and aprotinin 20 (υ/ml). Asia Low v W F is more It was used for platelet aggregation without purification.

Asialow vWF-induced platelet aggregation As mentioned above, soluble vWF is associated with CPI Does not bind to platelets through b receptors. Alkaline residues are removed by neuraminidase treatment. Asialo-vWF obtained by removing the group easily binds to platelets via GPIb. match. Presumably, desialylation lowers the net negative charge on vWF, making it more negatively charged. GP who did it! b allows binding to receptors. Asialo-VWF binds to platelets undergoes activation, ADP release and GP Ilb/ll11-mediated aggregation. vinegar. Platelet aggregation induced by Asialow vWF was measured using a Lumi aggregometer (Lumi). 200 μm of PRP (platelet rich plasma) (Fuiimu+x Y,, et xl,, J, Biol, Chem, 261 :381-385 (1986)) and 39 μg/ml asialo-v W F (final concentration). VO2 or VWF-GPIb binding domain polypep The results of inhibition of platelet aggregation with Tide are shown in Table 11:W.

VC (also called VCL or VCB) is methionine + amino acid 504-7 28 (see Figure 12). Platelet aggregation induced by vWF-ristocetin Fuiimu+a Y, tl a Ill, J. Biol, CheIll, 261:381-385 (198611 Therefore, using washed human platelets and in the presence of purified intact human VWF. Ristocetin-induced platelet aggregation was performed in .

Inhibition of ristocetin-induced platelet aggregation in the presence of intact human vWF. The results are summarized in Table I+. - Additional results using these tests are described in Example 5 .

Achieve-1 VC, asialo-vWF induction by vWF-GPIb binding domain polypeptide Inhibition of platelet aggregation Table 11 VC, ristocetin-induced blood thinning by vWF-GPIb binding domain polypeptide Inhibition of plate aggregation Example 4: In the oxidized and folded biologically active Example 2, Fermentation of cells introduced with plasmid pvWF-VC3 was described. Following is an example The preferred plasmid, pvWF-VCL, was constructed as described in 1. and was maintained in the E. coli^4300 strain. This host/plasmid system λP, for a vector containing a gene expressed under the control of a promoter, the essential Fermented as is known in the art. For example, simultaneous transfer EPO Patent Publication No. 173.289 (published March 5, 1986), No. 73-7 Example 5 on page 4 (without addition of biotin, thiamine, trace elements and ampicillin) See. This improved purification of vWF-GP1b binding domain polypeptides In the method, the cell base of the above fermentation of A4300/pv WF-V CL is used. Lett was used.

In this improved method, purer and more active polypeptides are produced. The general scheme of the process flow is , consisting of the following steps A and -H.

A, Cell disintegration and pellet suspension: sonication and 5011IM Th1 s pH-8, 0, 50mM NaCl.

lmu EDT, 1mM DDT, 1mM PMSF and 10% glycerol Centrifugation of the cell suspension in the cell suspension allows for WF-GPIv binding as described in Example 2. A pellet containing the domain polypeptide is obtained.

This pellet containing the clathrate has a final concentration of 8M urea after dissolution, 20 d DTT, 20+nM HH’ES pH-8, and 100 dNaCl As such, it is dissolved in solution at approximately 10% w/v. The obtained solution is further processed as follows. Purified by ion exchange chromatography as described below. Or, The clathrate was solubilized in a buffer containing 6M guanidine hydrochloride, followed by urine The buffer can be exchanged directly. This clathrate may also include, for example, urea, guanidine hydrochloride or or at different concentrations of any other denaturing agent or in the absence of a denaturing agent. Can be dissolved at extremes of pH.

B. Cation Exchange Chromatography: This step removes most contaminants. The vWF-GPIb binding domain polypeptide is produced with greater than 90% purity. will be built. Any cation exchange method (e.g. carboxymethyl) is used in this step. CM-Sephas high performance chromatography (Pharmacia) ) is preferred.

The functional group is a sulfone group such as carboxymethyl, phospho group or sulfopropyl. It can be. The matrix is an inorganic compound, synthetic resin, polysaccharide, or It can be based on organic polymers. Possible matrices include agarose, cellulose Lulose, trisacrylic, dextran, glass peas, oxirane acrylic beads, acrylamide, agarose/polyacrylamide copolymer (Ultra gel) or hydrophilic vinyl polymer (fractogel). For special embodiments , the polypeptide was mixed with 8M urea, 1mM DTT, 20a+M HEP ESpH-8,100d CM-Sephas FF color equilibrated with NlCl It can be hung on the screen. Pure polypeptide, 8M urea, IIIMDTT, 20 Elute in mM HEPES pH-8 and 200 mM NaCl.

Up to about 300 D28o units per 1111 CM-Sepharose FF Solubilized inclusion bodies can be loaded. At this ratio, the eluted polypeptide is typically eluted from the cation exchange step above at a concentration of 4-50D28o/ml. The polypeptide solution was treated with 6M guanidine hydrochloride (GuC) to disrupt aggregates. I). The polypeptide was then dissolved in 2M GuCl, pH 5-11. , preferably 20mM HEPES pH 8,0,1muGSSG (oxidized glutathione) to 0.050 D28o/ml. This mixture is , left overnight at room temperature. The product was washed with Sepharose 12 before further processing. Gel filtration on high performance protein liquid chromatography (FPLC) such as Analyzed by As a result of analysis, this protein concentration is approximately 30% correctly acidic. reduced monomers and 70% of S-linked dimers and multimers. It has been shown that oxidized monomers and incorrectly oxidized monomers can be reproducibly determined. It was done. The higher the protein concentration, the higher the absolute value of correctly oxidized monomer. yields are obtained, but the formation of S-linked dimers and multimers is increased. Therefore, the percent yield decreases. For example, a protein of 0.10D28o/a11 The concentration gives only 20% correctly oxidized monomer. o, 0250D Decreasing the concentration to 280/ml results in 35-40% correctly oxidized sevens. mer is obtained, but the absolute yield per liter of oxidation is lower. Gu oxidation Instead of carrying out the oxidation in Cl, the oxidation may be carried out in urea or any other denaturing agent. good. It is also possible to use suitable buffer conditions where e.g. pH 1 ionic strength and hydrophilicity are varied. Under certain conditions, the absence of denaturing agents may be used. The preferred concentration of urea is 0.5M- in the range of 10M, preferably 4M, and the preferred oxidizing agent is 0.01mM-5m M range, preferably 0.1 mM G55G. Others like Cu C12 oxidizing agents may also be used, or using only air oxidation without adding an oxidizing agent. Good too. For scale-up, 4M urea is currently required for this oxidation step. preferred.

D. Concentration: The oxidation product is Millibore's rMINITAN J or rPELLIcONJ. A tangential flow ultrafiltration system equipped with a 30K cut-off membrane like the system The stem preferably concentrates to about 0D28o-1. matter is relatively The filtrate is clean and most contaminants are large enough not to pass through the 30K membrane. is completely transparent. Therefore, it is possible to reuse the filtrate to carry out the oxidation. be. A large plate of 2M GuCI is significantly more expensive, so this is a significant savings. is brought about. Oxidation performed in reused solution and freshly prepared 2M GuC There is no detectable difference in the oxidation products by FPLC analysis between the oxidation performed in won.

E. Dialysis Is it necessary to reduce the GuCB level or urea concentration to less than 110 ID? this is , 20mM HEPES pH 8, dialyzed against 100mM NaCl This is achieved by This dialysis is performed by changing the buffer solution 2-3 times in the dialysis tube. It was. However, Tangiensha small flow ultrafiltration system with IOK cutoff membrane Also performed by diafiltration against the same buffer in the obtain.

During dialysis, as the concentration of GuCl (or urea or other denaturing agent) decreases, A white precipitate is formed. This precipitation includes the S-S produced by step D. linked dimers, reduced monomers, misoxidized monomers, and Approximately 80% of the tan contains contaminants of the species co-eluted from the cation exchange step. Contains Paku. Approximately 100% of the upper groove is the correct density of 0.20D 280 oxidized and folded monomer, which accounts for approximately the protein yield in step D. It is 20%. Contaminants and undesirable forms of protein as a result of dialysis are selected. The selective precipitation was surprising and unexpected.

The yield of correctly oxidized monomers can be significantly increased by recovery from precipitation . This is done as follows. The solution is clarified by centrifugation. Store the supernatant. The pellet was treated with DTT to reduce the S-8 bond and as described above. It is re-oxidized. The pellet is 6M GuCl.

20+nl BEPES pH 8, 150mM NaCl, 20mM OTT Dissolved in minimal volume. This solution contains lmM (instead of 20mM) D Cefazo Nox G25 in a similar lysis buffer containing only TT. It was passed. Next, this eluate was diluted to oD280-o, o5, and the above Processed as in steps C, D and E. Additional purified monomer is obtained. This operation can be repeated two or more times, as long as it is possible. All supernatants were then combined. Ru.

F, cation exchange The combined supernatant of step E dialysis was 20 d EIEPES pH 8,100 m Concentrated by binding to CM Sepharose in M NiCl. Elution is 2001M! IEPEs pH 8, 400mM NaCl. salt concentration Despite the high 3mg by this method Concentrations down to 1/ml have been achieved, but this is not the upper limit. Or this step The top is 10mM Tris-HCI pH 7,4, 15011M NlCl Among others, binding heparin-Sepharose can also be used. heparin-cepharos Elution from 1001&l Tris-HCI pH 7, 4, 50hM 1h This is done using cI.

G. Dialysis: The product of the previous step was mixed with 20mM HEPES pH 8, 150mM NzCl Dialyzed against

H1 preservation: At this stage, the purified vWF-GPIb binding domain polypeptide is frozen. Can be freeze-dried. When reconstituted in a volume of water equal to the volume before lyophilization, The resulting solution contains only monomeric protein on FPLC, with no dimers and other No trace of multimers was shown.

In a particular embodiment of this method, the following steps were performed.

11101 m of inclusion body (net dry weight of 0.43 g) has a final volume of 1001 8 M urea, 20mM DTT, 20gM IIEPEs pH 8, I00+o Dissolved in MNaCI.

b) This protein contains 8M urea, IiM DTT, 20a+M HEPES pH Applied to a CM Sepharose column equilibrated with 8,1,00mM NlCl. Ta. Protein in 8M urea, 20a+M HEPES pH 8, 1mM DTT It was eluted with 200111M NlCl and stored.

C) The saved eluate from the previous step was treated with 61 GuCI to remove aggregates. and then 21 GuCI, 20mM HEPES pH 8°0, 1mM Diluted to 0050D28o in G55G. Oxidation was carried out overnight at room temperature. ( Note that this oxidation step can also be performed in the presence of urea instead of GuCl) d) The oxidation products are removed in the ultraviolet rays on a rMINITAN J unit with a membrane at 30 Concentrated to 0D280'' by filtration.

e) The concentrate from the previous step was added to 20mM HEPES while adding buffer three times. Dialyzed against 100mM NaCl, pH 8. During dialysis, the concentration of GuCl A white precipitate formed as the temperature decreased. The precipitate is removed by centrifugation. , was reprocessed once as described above. Supernatants were combined.

f) The combined supernatant was 20mM l! EPES pH8,100d NiCl It was concentrated by binding to CM Sepharose in the medium. Polypeptide is 20m M BEPES pH 8, eluted in 400mM NaCl and stored at 4°C. Ta.

g) Save the eluate from the previous step in 20mM HEPE at 4°C. Dialyzed against S pH 8.

h) After dialysis, purified vWF-GPIb binding domain polypeptide (VCL ) was lyophilized.

Analysis of VCL 1. Amino acid sequence analysis of VCL purified as above revealed the N-terminal sequence. The sequence was revealed to be Msl-Ltu-His-Asp-Phe. child This is the predicted sequence according to Figure 12, with a methionine residue at the N-terminus. .

2. Testing of VCL on polyacrylamide gel under non-reducing conditions Therefore, VCL has a lower apparent molecular weight than under reducing conditions (β-mercaptoethanol). It has become clear that electrophoresis occurs depending on the amount. From dense to less dense morphology This shift is consistent with reduction of disulfide bonds.

Such an intramolecular bond is formed between cysteine at positions 509 and 695. Ru. (This shift in molecular weight is not large enough to correspond to reduction of intermolecular bonds. do not have. ) vWF-GP1b binding domain polypeptide prepared as described in Example 4. The repeptide was named VCL and was tested for biological activity as described below. It was done.

1. Ristocetin-induced platelet aggregation (RIPA) RIPA test requires 2 x 10" platelets /ml platelets, 1/ml Ig/ml plasma vWF and 1 mg/ml ristocetin. The reaction mixture was carried out as described in Example 3 in a reaction mixture containing

A series of concentrations of VCL were tested and the IC50 of VCL in three tests was 0.2 It was determined to be -0.3uM. 100% inhibition was achieved at approximately 1 μM VCL.

2. Asialo vWF-induced platelet aggregation The Asialo vWF-induced platelet aggregation test is performed using a Lumi aggregometer with a 200 μl blood sample. As described in Example 3 using plate-rich plasma (PRP) and lOμg/l of asialo vWF. I did as I did. A series of concentrations of VCL were tested and the VC in this test The IC5o of L was determined to be 0.15 gM. Also, 0.5. CZMI is complete Totally inhibited.

3. Effect of VCL on preformed aggregates preformed by RIPA The effect of VCL on aggregation was tested. Aggregation occurs in the absence of VCL. Formed as described in paragraph (1) above. VCL at a concentration of 05 gM By adding up to a certain degree, the agglomeration collapsed instantly.

4. Inhibition of thrombin-induced platelet aggregation The thrombin-induced platelet aggregation test was performed using 0.025 units/ml thrombin and It was performed using raftan-prepared platelets. A series of concentrations of VCL were tested; The IC5o of VCL in this test was determined to be 0.3 μM. went in parallel In experiments, VCL was used to direct [125I]-labeled thrombin to platelets. This is a surprising effect since it had no effect on inhibiting binding.

5. Effect on platelet deposition under flow conditions: inverted naked human motion inside the flow cell Platelet deposition can be measured in a model system consisting of pulses. Human whole blood or arterial blood flows over the segment. After 10-15 minutes, flow was stopped and platelet deposits were detected microscopically. was measured. The IC5o of VCL in this system was determined to be approximately 1 μM.

All the above results are summarized in Table II+.

Ristocetin-induced platelet aggregation or asialo vWF-induced platelet aggregation, ristocetin The inhibitory activity of VCL on vWF binding and platelet adhesion induced by The disulfide bond between cysteine and cysteine 695 was lost upon reduction. some In the experiment, reduced VCL precipitated out of solution.

Table II+ Biological activity of CVL, vWF-GPIb binding domain polypeptide Example 6: Construction of plasmid pvWF-VEL vW slightly longer than pvWF-VCL We planned to construct a plasmid expressing the F-GPIb binding domain portion. this The construction is shown in Figures 15-18 and described in the Brief Description of the Figures.

A, Construction of pvWF-VF6 Plasmid pvWF-VA2 (constructed as shown in Figure 4) was and Pstl and the larger fragment was isolated. Shown in Figure 16 Four synthetic oligomers were prepared. No. 2 and No. 3 are 5' - treated with T4 polynucleotide kinase to add phosphate.

The larger fragment of pvWF-VA2 is shown in FIG. four oligomers (two kinased and two non-kinased) and Reigate. The resulting plasmid shown in Figure 15 is pvWF-V Plasmid pvWF-VE2 was deleted with Ndel and H1adll, named E2. A 770 bp fragment containing the vWF-GPlb binding domain was isolated. Separated. Plasmid pMLK-789] also contains Nd5l and H1ndl The larger fragment was isolated. The obtained plasmid ( (shown in Figure 17) was named pvWF-VH2.

C. Construction of plasmid pvWF-VEL Plasmid pvWF-VE3 is Xmn1 and dephosphorylated by bacterial alkaline phosphatase (BAP). , then digested with Ndel and Hindll. Plasmid pMLK-70 0 was digested with Ndel and H1Ildll and dephosphorylated with BAP.

These two digests were ligated and the plasmid pvWF- Obtained VEL. This plasmid λPL promoter and CI+liposome binding site Expressing a DNA sequence corresponding to amino acids 469-724 of mature vWF under the control of do. Presumably, the protein also contains an N-terminal methionine residue. G.C.C. By changing to OCA (which also encodes alanine), Ala-473 A conservative base change was introduced in This changes GCCTGC to GCATGC. A 5ph1 site was introduced into the gene.

By expressing pvWF-VEL in E. coli 4300 (F”), A 29 kD protein that strongly reacts with anti-vWF monoclonal antibody is produced, Hereinafter, this will be referred to as VEL.

In Examples 1 and 4, a novel VWF-GPIb binding domain named VCL The production and purification of in polypeptides was described. VCL or other VWF-GP Regarding some of the anticipated uses for Ib binding domain polypeptides, see below. Explain. Pharmaceutical compositions containing VCL or other polypeptides are A suitable pharmaceutically acceptable drug can be prepared using methods and carriers known in the art. may be formulated with a suitable carrier.

1. The above VCL composition is used to prevent platelet adhesion to damaged blood vessel surfaces. (see subsection 5 of Example 5).

2. The above VCL compositions can be used for disruption of platelet Lynch aggregation (e.g. 5, subsection 3).

3. The VCL composition described above is useful for preventing reocclusion following angioplasty or thrombolysis. (rBellinguel a1., PNAS, USA, 84:8100-8104 (1987), Buta von Birp Prevention of occlusive arterial thrombosis by murine monoclonal antibody against runt factor.” checking).

4. The VCL composition described above may be used within a narrowed or partially occluded artery; Used for platelet activation and prevention of thrombus formation due to high shear forces at bifurcation points. ([Person el xl, Blood 2:625-62 8 (19g?), shear-induced platelet aggregation is caused by von Willeplant factor and platelet membrane. Requires Glycoproteins Ib and I1b-111a).

5. The above VCL composition can be used for angioplasty or by thrombin activation of platelets. can be used for the prevention of thrombosis and reocclusion after thrombolysis (rFus tet e, t xl, J, Am, Co11, Cxrdiol, 12: 78A-84A (1988), Antithrombin after myocardial perfusion in acute myocardial infarction. Treatment).

6. The above-mentioned VCL composition is effective for platelet adhesion to prosthetic materials and blood flow on prosthetic materials. Can be used for the prevention of platelet aggregation (rBadimouel!+,,1 ．． of Biomalerials Applications, 527-48 (1990), Platelet interactions on prosthetic materials - Platelets on PTFE ``The Role of Von Willeplant Factor in Interactions'').

7. The above VCL composition prevents intramyocardial platelet aggregation in unstable angina patients. (“Daviesel xl, Ci+cul[io n 73: 41g-427 (1986), unstable patients suffering from sudden ischemic cardiac death. Intramyocardial Platelet Aggregation in Patients with Angina).

8. The above VCL compositions may be caused by angioplasty, thrombolysis or other causes. Can be used for the prevention of vasospasm and vasoconstriction following arterial injury ( [am sl at,.

Ci "culNion 75+ 243-248 (1987), vasospasm is a small blood Is it related to plate deposition? "checking).

9. The VCL composition described above is useful for preventing restenosis following angioplasty or thrombolysis. (rMacBrids 5tal, N, Eng, L of Mtd, 318: 1734-1737 (198g), Successful Coronary Vascularization Restenosis after plastic surgery).

10. The above VCL composition is effective in preventing vaso-occlusive crisis in sickle cell anemia. (rWicket II, J, Cl1n, Inves t, 80: 905-910 (1987), Large Flow Under Controlled Flow. Onvirplant multimers normally inhibit the adhesion of sickle red blood cells to human endothelial cells. ).

11. The above VCL composition is used for the prevention of thrombosis associated with inflammatory responses. ( rEsa + oIl, Sci! nc! 2351348-1352 ( (1987), "Regulation of the Innate Anti-Aggregation Pathway").

12. The above VCL composition can be used for the prevention of arteriosclerosis (rFu sler st! +,, C1rculation Res, 51:587-5 93 Fl, 982) in normal pigs and pigs with fonovirplant disease. arteriosclerosis).

13. The above VCL composition can be used as an anti-metastatic agent (rKifagx va el 11. , Cs+csr Res, 49:537-541 (19 89).

Thrombin-dependent and thrombin-independent blood clots induced by tumor cells Involvement of platelet membrane glycoprotein Ib and llb/l1la complex in platelet aggregation "checking).

For these studies, VCL, vehicle control (vehicle control) Cle control) was freshly prepared in sterile water (2.2 mg/ml stock). Created.

A. Platelet aggregation (PRP) This is a standard format using human or rat platelet-rich plasma (PRP). This is an architectural factor (v　W　　　) dependent agglutination test. Undivided at various concentrations Picture Botrobus Jararaka Red Venom (Bofhrops jxr! rgcx y enom: BJ A collective response is obtained. This Botrobus jalaraca venom is produced by Botrocetin (b olhrocstin) and further thrombin-like components, or lystocetin Contains risjocelin. Ristocetin (1.5mg/m +) By using as an agonist, 43 μg/ml VCL inhibited human PRP. stopped clumping. Up to 5.0 mg/ml of stocetin can be determined as D1 of rat PRP. No significant aggregation occurred. Using this assay system using BJV as an agonist, VCL slightly inhibited the human PRP response at 83 μg/ml. (Fig. 19), but did not inhibit runt PRP (Fig. 20).

Ristocetin is a suitable agonist for inducing vWF-dependent aggregation in rats. It can be concluded that there is no. In addition, ex vivo, It is not possible to monitor the effects of VCL using BJV-induced aggregation of PRP. be.

However, VCL inhibits vWF-dependent aggregation in human PRP in vitro. inhibit.

B. Platelet thrombin receptor assay This assay uses thrombin-induced platelet procoagulan h (pro-coxgulan). lz+u) and is briefly described below. . Washed human platelets were treated with CaC12, factor Xa, prothrombin, and human Incubate for 60 minutes at 28°C in buffer containing α-thrombin. to At the end of this period, a fixed amount (to prevent further thrombin generation) 52238 and EDTA. After 15 minutes at room temperature , terminate the 52238 reaction using acetic acid and read the absorbance at 405 nm. Ru. The amount of 32238 divisions directly attributable to added human α-thrombin was determined by All results were evaluated by including a control without thrombin. Decrease this value. VCL was tested in this assay at a final concentration of 0.1 mg/ml. I tried it.

This assay is suitable for both thrombin inhibitors and thrombin receptor antagonists. Be sensitive. In the presence of VCL, thrombin generation is controlled (n-2) It was 114% of the total.

Therefore, we hypothesized that VCL is a thrombin receptor antagonist in this system. I conclude that it is not.

This method essentially consists of 5hod et al., Thtoa+b, Rts.

45505-515 (1987). we use in our routine An overview of the method used is given below.

Rats are labeled with 1111n platelets and 125I fibrinogen. large back Cut the artery using modified Spencer Wells forceps. and tighten for 1 minute. After a 45-minute reperfusion period, the injured vessel was removed and Wash with citrate and count. Results are expressed as mg blood equivalents. Bu Differences in radiolabel accumulation between racebo and drug-treated animals were calculated and expressed as % inhibition. Was.

For the evaluation of VCL, the route of administration was by single dose intravenous injection. VC L was used at doses of 2 mg/kg (n-5) and 4 mg/kg (n-3). there was. It was administered one minute before tightening. The vessels were then reperfused for 20 minutes. . Antithrombotic effects were evaluated at the final time point of 20 minutes of reperfusion. to save compounds , a reduction in reperfusion time (compared to routine) was planned. Appropriate carrier control (n-5 for both doses) was evaluated.

Under these conditions, vCL inhibits thrombus formation in this model. can be seen (Table ■). At a dose of 4 mg/kg, inhibition of thrombotic platelets ("'I n) appears to be for the component. Other changes reached statistical significance. not present. Therefore, VCL exhibits antithrombotic effects in this rat arterial model. vinegar.

In conclusion, VCL is dose-dependent in this rat model of arterial thrombosis. It shows possible antithrombotic effects.

3. Consideration This data indicates that VCL interacts with human platelet vWF receptors and therefore appears to inhibit platelet aggregation in PRP. However, platelet aggregation Significant differences exist between species (rats vs. humans) when comparing the inhibition of aggregation.

The species specificity and causal mechanisms of this effect remain to be investigated. Not yet. At a practical level, the effect of VCL on aggregation is correlated with arterial thrombosis. This is because we are analyzing ex vivo samples. means that it is impossible. Therefore, in the rat arterial thrombosis model The analysis and interpretation of the in vivo efficacy of VCL as an antithrombotic in humans is dependent on this factor. Therefore, it has become complicated.

Although GPlb has binding sites for both vWF and thrombin, Regardless, any effect of VCL on thrombin binding to GPlb is It does not change into an antagonistic phenomenon of bottle-induced procoagulant expression.

Overall, VCL exhibits antithrombotic effects in a rat arterial thrombosis model. this Inhibition is due to the interference of vWF by utilizing its binding to its receptor. Probably.

star-y Arteries in rat dorsal aorta Effect of VCL on thrombus formation Results were expressed as mean % inhibition standard error. The number of test groups is indicated in the table. and in all cases compared to a group of 5 control animals. Convert to % inhibition Statistical analysis was performed on the raw data prior to analysis. NS - Not statistically significant.

Figure・1 Figure 2 Synthetic ten thousand sesame Nd” BSU 361 Figure 4 Figure 5 Figure 6 Figure 8 Figure 9 Nclel T:h 1111 Figure 10 daygure11 Figure 12A ξ藖駈S 葺验 3 さ 9H ξF RU 3 YO 55 giant lungs! Sui-buki section; Iris agricultural three soups 3 wil S item 2 divination; 3 eyes total 3 □ Trust market plan i eye word door Rinji Length of life = father-in-law 1 late (b) ξ Explosion Fukijiru fortune telling I Fukiji Shoulder 5th day silicosis 3n sankyo Zpi 5 straw S roof 5 cases of silicosis, eyes ■! Fukitsu ζF BA J3 Giho U Our 3rd Lung Division Suzuki ! Thatched 5”j3zg Main building 33 That day j division section! The buds that say that that day = Mi ξ Mo lung 3 ■ Nme Shiruichi Gome;me 3 i<i#a:B xgEF;9,;i;sg” ;-B　＜3　EF-:3　ig3　＜E-juice;Menokan-i-KaoriZF Section A-fuki ZF3 degree ξ Entrustment Ug Entrustment ξ Fuki and Ichigo: F8 Entrustment? people Figure 12A (continued) ξ genus 3 2 Gozago 3 Ji Go = 娑 yo 8 ZE, p; group 5 mitafuki ξX goy2mi=poor=? Death 2; i53 t’li ga its revision door 3shi J3 Kyōgai 5 Miyofuki 100 2 3. Seven so-called? $85 刹53 Revised Divination ■ Setsuba city, five reeds Revised I valley fortune telling service I'm so proud! '5; 5 cff 1st Trust 53: Eyes 3yo■ δ Kaoru 5 Big Juice ξ 535 珪3-buki;Kunigai self-H5mi ! Eye J3 Kei3min ξM 5C4 Figure 12B Fortune = Eye 3 Iris 33 ÷ Roof 1H Total limbs Z Togaiba 53 cities 3 roofs 1 roof; leather lung meter ξ Tsuta 3 Yo 3 eyes Zr meter ZF ji revision 1 Kaoru Figure 12B (continued) O 33 Lung-crazy consignment horse City ゛33 ζ Mojiru entrusted to the limb a respect department ξ Shoroku City S eye section layer roof ￥耘；舅5郎J国日ト菖；覨 Section, 2E, 7H Chang ES Fuki Z Jinjiru The shadow; eyes SF Juice yo Kaoru? Washi soup 53; Eye 1353 Fuki SF 斃 I love you so much! Embryo swelling Pillar 35: Mixing = Fukishi eyebrows Ikkokuryoku Shuji 5 Corpses■ ! Eagle vassal! Eye UU δ Kotaku ZF Trust 3 To 555I Fukijukei = Iris! Fart, limb = sworn eyebrows 3 Yo I mouth sage Visiting Kei? Tomi A Minno 3-layer roof Figure 12C 335 eyes of trust, budding father-in-law = 55 giant ξ irises Sth; 1 irises and 5 thatched buds! Fuki revise; Kaoru Nofu Fu Noro ZFi Yumikagi Adventure S City 1st jo, 9F City 353 Jiyuki 5 Mimigi Tou 5 Mikyō　”: Mutou Drunken Sieve i eye 6 slow δg = eye 5 giant furrow = ji? irises #E <A Fart Memi ζh, W Longing ": Eye Iji ■ 3 roasted 5 Sagi Sagi Dosen Muyuu Shuji = eyes: F! , ``Ej　j!'': 9 ff Yukichi Nikko from Yukichi Nikko 3 Mechanism Ug Fume revision 5 city book 3I embryo 3rd eye d roof City juice; F; ZF = pi soup soup change! Shoubatsu Late Uhiro Vassal country; Admiration base 3E Note = Item a3 jU 5:5 Figure 12C (continued) Niji A stable Niji Z and 15-Tsuta Figure 12D Gibara Kikyo! Basic; Entrustment ξ菖#E: (5C4ACi Seiyo-buki! Leather! Pregnancy; 3rd turf Sango 3o! E scale Uru a3 city ridge =JiyiF's interpretation of JiI's fart! E-yo 'i 100 AE farming words! 3) 目Ushibamekubari Yumikei 5buki;me d iD r Fukii 13me city Figure 12D (continued) 3rd oracle i gu; 5E City crazy fortune-telling: 3? irises 5 3 Ebud: 3 city S Yumijiru; cloudy i Tomi 5yo I 葺脣A pi hiroka Mother E to 3 δ Luxury eyes Koki! decline ■ A hundred spoons of dead bodies; Fee　　　　　　　　　　　　　　　　　　5　;81 Enryo soup soup conversion;; poverty.

i eye 5 zaro 5 mi δz; 8 self 8 title 3 soup bako commotion? irises Saba S Arts Z To 5 Yo Ship Lung Crazy i-fuki 3 Iris Niragi Hyakku Z Takumi S eyes 3 irises i folk eyebrows E corpse ξ 3 fees ξ且8H5外絋王 Figure 12E Takukei 1 Takumi Giga E3, ``Eye Juice Lung Sho E3 Figure 12E (Continued) ■Gi-kuni Yoto City S-buki J-kuni O 3 Giant Minkei i3E Lung Jikae Yo-fuki fortune-telling adventure Pillar layer 3 fortune-telling Fortune-telling word 3535 Mi-yo lunggi-buki CnP z-ki 9 #! : (LE mad<733 koi; kobai; bud Ikumekkei 5mi ζF layer E Section = Ayame and 5 countries 5 destruction fortune telling shime Giraku r’Fz　；B 市3目2と Masao 53 Kei 8S language ξ菖 ；Kairijiru City Tenson=Ki5mi =; Juice 1 Hiro ZF iE well ξ100■ Kyousei Sako Safugi 1 Figure　12F Division = Kikiya 5 Kyo Division = and Kakutaku 2 Sakae ζF trust 3N juice spitting father-in-law exchange Kajirukei = and soup i eye! Bastakukei:X Separate Kaoru Slow ■Lung 3 Lung Juice 3 Eye West Crown ! Go? Iris; 31 crazy C:; i 100 3rd item 5F) A”a neck 3 Pak lung lung gibuki crazy shrine divination lung ZF lung juice δgu=F lung i Pigi bladder Shirugumo 3 Takuko 3; Bag 5mi Shirukeichi Takuno Gon Taku 5 Kagejiru N Shoubu Kaoru Detour 1 divination 3 ζH2g, c3 kei 1fuki? Migo E fart Ui; aE 53 part jU < wilting Long divination hole ridge ■ Sako 3rd objective Eξ Roof limb 3 Chang! Noh 3 3 Yoji Sangon Sanoichi ξth O 3rd Eye 28 Sieve Figure 12F (continued) Division <　5　:j’r”4　aD　: Explosive; 5β no β foot zago) white yo8 go g ; 8 ε 8 82 = fixed 53 23 mipi division salmon ξ irises division stock Lung 53 Silice people 5ZV ≧ ! Bashi Yoji 31 Taku 51 ■ Chang 3δ Koichi 5o 3 卜! eye length = E section lung ξ mini F! coma juice 5 concave correction month I eyes plan i people ! Meguryoku S Meguryaku;gu Silica Pneumonia Division Ohashi 5yo Sb soup daily routine S roofing section 5th adventure! Basinen Entrustment Message 3 Recommended words 2 Fart 3 yo 5; 3E crazy 3 eyes Figure 12G ~ ko no he ko 0 ro (o 1ψ ~ 2 no ~ zo 0 no kuku<: ,, o :　ψ　Q　Ql　Saψ　Todo　Todo　Reward Sa　Draw Sa　-Todo f+　-1 ”＋　-Sa　-Todo--Sa　-Sa　-Sa111(J gl(j OIJ ΦQ clcJ one leg enb 11110 L-CJ EC:2'id 28o+u -μ　(Roku mouth 0← KuQ　ω←　Roro lung mad pillar shell 53 lung 1 Edited by Fukii ! Fixed period'' - 8 troughs 3 to 3 days ξth 3rd day The cantering eye is the i eye, the j eye is the steering wheel, the rudder is the steering wheel. 3 to lungs and 3 se juice weighing material silicosis 3 cell lung aggravation lung job 5 crowns Chang and 93 Shijirui +nOL(JW(Jeu c←-ro)’’;u’G:8’X?δ> So-called?　2　;Please; 8.0 juice 5 straw 5 mi its juice, `` 柕g Basic juice meter Needle hole 3 zhuang craftsmen who are in the middle of the day? 5 Shizagoyo 8 Chang lung co-based edition Grass eyes 5 atrophy δ so 33 groups 3 ■ lungs; sac 3 irises liver plan 3 Figure 12G (continued) 87　菰8　し　Su　8　菰8　agi! CJ (J←G＜Q←Q← <(-<) Yu Goo 68 Centipede G Go 55 Miyo; Leather ZE Revised 5th stone roof 5s lung Ichigibuki lung e Fukigo 3 fermentation lung 5 years old, 2 years old! Fuki 3 Fukisaji a3 Fortune-telling■33rd order genus basakagi bladder Z soup 1 convex lung 3 sagging Po eyes 5 eyes yo 8 yo white 28 feet; 2Figure 12H Please correct the stain! 2 days ago 'B: Foot Mi H = po -.

Boss S Hyaku:. 0 ← 3 Shi-i; Nishijin straw bi C Mizan Taku Taku 5 sacks ξ 3 poor legs 3 eyes Scam; Tsu 35-ki hole and soup μkoishi-kun! blasphemy ；Embryo 3 Washiyome city 3 eyes Birth Yumikigi genus juice Shang 3 Setsu = Shijiru 5 Yoha soup meter Shibame aE a53 Yogo Kokuto 2 base lungs; The concubine of the eyes # a3 gE′:8. ip 53g, :3 <g, s 2d 103g slow The head of the language mayo otsucho 2 poor Word E edition 1333rd edition; 3 words book bud Figure 13 3 people 3 wil J le IA pi=fuki] Yumishiki Thief City Zpi 3rd grade=Kikii City; U3moku 珪3葺子3；瑺市；３lunggoyo　　　　　　　　　　　　　3目　5目术市汉：菖、``Babin Fukijiru! 3rd part of the roof■ ・ξ薖Zt divination oath”: Day of the month;’4 g country 5th U oracle a3. Father-in-law, 5th contract Mi base revision 5 group 5 ear lecture Kaorigi roof: Mi 3 is the oracle; Kunijiru l = oracle ξFAE F, ``51 oath 5 mi ξ base pig bladder; 芭gittan?'f-5'Fj-,g　;ig　<g :9　EE”5U　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　 ξ : Correction 3 Washi Z Tojiru! Ea ξF soup 5 items J Prophecy; Motoki ξ Adventure E3 Yo Shiru Shiru City 11t ■ -t ■ ii n - 1 t small - ot oi - - 1-rff"l 2 Q Loco [F] Lo-h to Ko-~ He-r two- n + - I; Figure 13 (continued) −〇　:l■　-ro Tameguchi Koro all-Φ←-ro ω く　−■　Σ く　Coro a+1+ for ψku Φ← One ω ←← Kuro −Q ；package y constant yo8 = foot Z-ni-so S-bukimetsu Kozan Pi Mad Noh Spout Ko〇　−←　Tameguchi δ〉　Self　6 pairs　za8 5 Explosive Iris Pneumonia 2 pairs Pi8 21:l;:effect Koro <(LCJ-LI Mouth← e＜ o← Tamero E CJ OCJ L (J Colo m+Q-<　m(J　LCJ Kuro Ro 0 Kuro −0 α mouth koroko<　>U Koro Koro Qro Koro procrastination The shrine is turned over = Eyes? × Hashira Kei = Self Vesical stone roof ξ iris 53 3rd and 2nd cloudy for the first time in a while! Thatch Figure 14 Figure 15 Figure 17 Figure 18 〉 Figure19 BJVfi degree (μg/ml) In the mouth - light transmission unit day gure 20 BJVJ degree (gg/ml) □Mu□Tai-song + VC, (E3 ug/m1) LTU - Light Transmission 22,T Submission of translation of written amendment (Article 184-8 of the Patent Act) Abstract The present invention comprises a vEF (von Wille Plant factor) GPIb binding domain. The present invention provides biologically active polypeptides that are non-glycosylated. these Bobebutide is used to treat subjects with conditions such as cerebrovascular and cardiovascular disorders. can be used to inhibit platelet adhesion and aggregation. The present invention also , provide expression plasmids encoding these polypeptides, and further of the polypeptide by transforming the polypeptide and recovering such polypeptide. A manufacturing method is provided. In addition, the present invention uses these polypeptides to improve platelet aggregation. Treat and prevent cerebrovascular system, cardiovascular system and other diseases by inhibiting Claims featuring a method of September 2, 1992

Claims (38)

[Claims] 1. A non-glycosylated biologically active protein with the following amino acid sequence: Ripeptide: [There is an array] However, in the above, X is NH2-methionine- or NH2-; A is at least one and a sequence of fewer than 35 amino acids, which sequence is present in natural vWF. , and its carboxy-terminal amino acid is tyrosine #508 as shown in Figure 12. ; B is a sequence of at least 1 and less than 211 amino acids; exists in natural vWF, and its amino terminal amino acid is the amino acid shown in Figure 12. Spartic acid #696; also Two cysteines included in the sequence within parentheses are linked by a disulfide bond. 2. A polypeptide according to claim 1, which has the following amino acid sequence: Polypeptide: [There is a sequence] In the above, X is NH2-methionine- or NH2-. 3. an effective amount of the polypeptide of claim 1 or 2 to inhibit platelet aggregation; A pharmaceutical composition comprising a peptide and a pharmaceutically acceptable carrier. 4. to inhibit platelet aggregation. contacting with the polypeptide of claim 1 or 2 in an amount , a method of inhibiting platelet aggregation. 5. An expression plasmid encoding the polypeptide of claim 1. 6. It is named pvWF-VC3 and has ATCC reception number No. Deposited at 68241 An expression plasmid encoding the polypeptide of claim 2. 7. It is named pvWF-VCL and has ATCC reception number No. Deposited at 68242 An expression plasmid encoding the polypeptide of claim 2. 8. A bacterium comprising the expression plasmid according to claim 5, 6 or 7. Terrier cells. 9. Escherichia coli cells according to claim 8. 10. A method for producing the polypeptide of claim 1, comprising: transforming bacterial cells with an expression plasmid encoding the cells are obtained such that they produce the polypeptide encoded by the plasmid. The process involves culturing the bacterial cells and recovering the polypeptides thus produced. A manufacturing method that includes: 11. A method for producing the polypeptide of claim 2, comprising: transforming bacterial cells with an expression plasmid encoding the cells are obtained such that they produce the polypeptide encoded by the plasmid. The process involves culturing the bacterial cells and recovering the polypeptides thus produced. A manufacturing method that includes: 12. A method for treating a subject with a cerebrovascular disorder, the method comprising: administering platelets to the subject; An effective amount of the polypeptide of claim 1 or 2 to inhibit aggregation. A method comprising administering. 13. A method of treating a subject with a cardiovascular disorder, the method comprising: An effective amount of the polypeptide of claim 1 or 2 to inhibit plate aggregation. A method comprising administering a. 14. 14. A method of treating a subject according to claim 13, wherein the cardiovascular How the disorder is acute myocardial infarction. 15. 14. A method of treating a subject according to claim 13, wherein the cardiovascular How the disorder is angina. 16. Before or after undergoing angioplasty, thrombolytic therapy or coronary artery bypass surgery A method of inhibiting platelet aggregation in a subject during or after receiving Claim 1 or 2 in an amount effective to inhibit platelet aggregation for the subject. A method comprising administering the polypeptide of paragraph 2. 17. Before, during, or after coronary artery bypass surgery, A method for maintaining vascular patency in a subject, the method comprising: inhibiting platelet aggregation; administering an effective amount of the polypeptide of claim 1 or 2 to A method that includes this. 18. A method of treating a subject with cancer, the method comprising: slowing tumor metastasis; Administering the polypeptide of claim 1 or 2 in an amount effective to A method comprising: 19. A method of inhibiting thrombosis in a subject, the method comprising: Administering an amount of the polypeptide of claim 1 or 2 effective to cause harm to the patient. A method that includes this. 20. A porous material according to claim 1 or 2 bonded to a solid matrix. Ripeptide. 21. How to treat subjects suffering from platelet adhesion to damaged blood vessel surfaces an amount effective to inhibit platelet adhesion to the surface of an injured blood vessel in the subject; A method comprising administering a polypeptide according to claim 1 or 2. . 22. A method of preventing platelet aggregation to prosthetic materials or devices in a subject. Therefore, the subject is provided with a drug effective to prevent platelet adhesion to the material or device. comprising administering the amount of the polypeptide of the invention according to claim 1 or 2. How to prepare. 23. Method of inhibiting reocclusion in a subject following angioplasty or thrombolysis Claims 1 or 2 in an amount effective to inhibit reocclusion to the subject. or a method comprising administering the polypeptide of paragraph 2. 24. How to prevent the development of vascular occlusion in subjects suffering from sickle cell anemia and the claimed amount is effective to prevent the development of vascular occlusion in the subject. A method comprising administering the polypeptide of paragraph 1 or paragraph 2. 25. A method for preventing arteriosclerosis in a subject, the method comprising: Administering the polypeptide of claim 1 or 2 in an amount effective to prevent A method that includes: 26. Thrombolytic treatment of thrombin-containing platelet-rich aggregates in subjects A method comprising treating the subject with platelet-rich aggregation containing thrombin. Administering the polypeptide of claim 1 or 2 in an amount effective to A method comprising: 27. In subjects suffering from arterial stenosis or partial arterial occlusion, high shear A method for preventing force-induced platelet activation and thrombus formation, the method comprising: Claim 1, or an amount effective to prevent platelet activation and thrombus formation. A method comprising administering the polypeptide of paragraph 2. 28. A method of preventing thrombin-induced platelet activation in a subject. and claim an amount effective to prevent thrombin-induced platelet activation to the subject. A method comprising administering a polypeptide according to claim 1 or 2. 29. Preventing stenosis as a result of smooth muscle proliferation following vascular injury in subjects Claim 1: A method of administering an amount effective to prevent stenosis in the subject. Or a method comprising administering the polypeptide of paragraph 2. 30. 20. The method of claim 19, wherein the thrombosis is associated with an inflammatory response. How to be accompanied. 31. Recovering the purified biologically active polypeptide of claim 1 A method, (a) in a bacterial cell, having the amino acid sequence of the polypeptide and disulfide; producing a first polypeptide lacking a fido bond; (b) disrupting the bacterial cell and using a lysate containing the first polypeptide; (c) processing the lysate to obtain the first polypeptide; (d) obtaining inclusion bodies containing; contacting the clathrate from step (c) to obtain the soluble first polypeptide. (e) treating the obtained first polypeptide to obtain a biologically active polypeptide; (f) forming a biologically active polypeptide so formed; Recovering putido; (g) purifying the biologically active polypeptide thus recovered; How to prepare. 32. 32. The method of claim 31, wherein the process of step (e) contacting the polypeptide with a thiol-containing compound and a disulfide. how to. 33. 33. The method of claim 32, wherein the thiol-containing compound is rutathione, thioredoxin, β-mercaptoethanol or cysteine. How to do it. 34. 32. The method of claim 31, wherein the contacting in step (d) A method performed in the presence of an agent. 35. 35. The method of claim 34, wherein the modifier is guanidine hydrochloride. How to be salt or urea. 36. 35. The method of claim 34, wherein in step (f) polypeptide A method in which the recovery of tide includes removal of the denaturing agent by dialysis. 37. 32. The method of claim 31, wherein in step (g) A method in which the polypeptide is purified by cation exchange chromatography. 38. 38. The method according to claim 37, wherein the second polypeptide is A method in which step (d) is followed by purification by cation exchange chromatography. .