CA2055613A1 - Poliovirus chimaeras - Google Patents

Abstract

A cassette vector suitable for use in constructing poliovirus chimaeras, which vector comprises, under the control of a promoter, a full length infectious cDNA of an attenuated strain of type 1 poliovirus having Sal 1 and Dra 1 sites flanking atigenic site 1 of the poliovirus (I), where the numbers represent the numbers of amino acids of the VP1 capsid protein and X represents intervening nucleotides of DNA, present in sufficient numbers to allow the vector to be digested with both Sal 1 and Dra 1, the said Sal 1 and Dra 1 sites being the only Sal 1 and Dra 1 sites in the vector.

Description

WO90/1514~ PCT/GB90/00~1 ~ 1 --POLIOVIRUS CHIMAERAS
The present invention relates to cassette vectors suitable for use in the pr~paration of poliovirus chimaeras.
The icosahedral poliovirus particle is composed of sixty copies of each of four capsid proteins, VPl - VP4, which enclose a positive sense single-stranded RNA genome of approximately 7500 nucleotides. Because of their importance in protective immunity the antigenic sites on the capsid 10 proteins of the three poliovirus serotypes have been studied in detail. These studies have revealed the existence of at least four independent antigenic sites, which induce the production of neutralising antibodies. Antigenic site 1 is a continuous epitope, comprised of residues 91 to 102 of lS capsid protein VPl. Sites 2, 3 and 4 are conformational, being composed of residues from more than one capsid protein. These sites can be readily located on the 3-dimensional crystallographic model of the virus where they form part of the surface topography.
As part of a wider study of poliovirus antigenicity relevant to the development of new and improved poliovirus vaccines, we have previously reported the construction of a - type l/type 3 poliovirus chimaera (Burke et al Nature 332, 81-82, 1988). This virus, which exhibits dual antigenicity, 25 was constructed by the replacement of antigenic site 1 of - the Sabin type 1 poliovirus vaccine strain by the corresponding region of a type 3 s~rain using oligonucleotide-directed mutagenesis (Kramer et al, Nuc.
Acids Res. 12, 9441-9456, 1984) on an infectious full-length 30 Sabin 1 cDNA clone (Stanway et al, J. Virol. 57, 1187-1190, 1986). The virus induced an immune response against both type 1 and type 3 polioviruses in mice, rabbits and primates.
The Sabin strain of type 1 poliovirus has an 35 established safety record as a vaccine. This, coupled with extensive experience of its manufacture and control, make the Sabin 1 vaccine strain a particularly attractive vector . .

, , . . . - . . -, . . , . ~ :

~:

WO90/t514~ PCT/GB90/00~l ZC`55~

for use as a vehicle for the expression of potentially important epitopes from other pathogens. Since polivoirus is able to induce a mucosal as well as a systemic immune 5 response the approach may be of considerable value where the pathogen in question infects via a mucosal surface where secretory antibodies may play a role in protection from infection.
The cassette approach to n vitro mutagenesis has 10 been reported before for poliovirus (Kuhn et al, Proc. Natl.
Acad.~Sci. USA 85, 519-523, 1988~. It has been employed in the construction of antigenic site 1 chimaeras based upon the neurovirulent Mahoney strain of poliovirus (Martin et al, EMB0, J. 7, 2839-2847, 1988; Murray et al, Proc. Natl.
15 Acad. Sci USA 85, 3202-3207, 1988). The cassette approach was also employed in EP-A-0302801 in preparing hybrid type 1 poliovirus in which a heterologous epitope replaces the C3 epitope which is normally exposed on the surface of the capsid of the poliovirus.
A cassette vector has now been constructed which allows rapid and extensive modification of antigenic site 1 of the Sabin 1 poliovirus vaccine strain, Pl/LSc 2ab.
~ Unique restriction endonuclease sites flanking antigenic '! site 1 have been engineered into a full-length infectious 25 Sabin 1 cDNA clone with minimal alteration to the coding sequence. This facilitates replacement of this region by oligonucleotides encoding foreign amino acid sequences.
Results indicate that this region is highly flexible in terms of number and sequence of amino acids which can be 30 acco~modated. The approach has general applicability to any atter.uated strain of poliovirus type 1.
Accordingly, the present invention provides a cassette vector suitable for use in constructing poliovirus chimaeras, which vector comprisès, under t~e control of a 35 promoter, a full length infectious cDNA of an attenuated strain of type 1 poliovirus having Sal 1 and Dra 1 sites flanking antigenic site 1 of the poliovirus as follows :' :

-WO90/1514~ PCT/GB90/00~1 55~

... GTC GAC - X - TTT AAA ...
Sal l Dra l S where the numbers represent the numbers of amino acids of the VPl capsid protein and X represents intervening nucleotides of DNA, present in sufficient numbers to allow the vector to be digested with both Sal l and Dra l, the said Sal l and Dra l sites being the only Sal l and Dra l lO sites in the vector.
This cassette vector can be employed to present foreign antigenic determinants. Foreign epitopes can be inserted at antigenic site l to replace VPl amino acid ;~residues 94 to 102, thereby obtaining poliovirus chimaeras - 15 capable of acting as epitope presentation systems, for example vaccines. The cassette vector has the additional advantage that the Sal 1 and D~a 1 sites are unique to the entire vector, allowing replacement of the region flanked by ~these sites in a single step and thus obviating the need for -20 subcloning steps in the construction of recombinant cDNAs.
The amino acid change at position 102 from aspartic acid to ;phenylalanine, resulting from the creation of the Dra l site, does not affect the viability and growth properties of the vector.
Preferably the cassette vector comprises an infectious full length cDNA clone of the Sabin strain of poliovirus type 1 into which the Sal 1 and Dra l sites have been engineered. In such circumstances, X represents the codons for amino acid residues 94 to lOl of the VPl capsid - 30 protein of Sabin type l. A suitable spacer region X is one which represents a DNA sequence enccding VPl amino acid residues 94 to lOl of-the attenuated strain of type l poliovirus being used. X can, however, d~note a DNA
r sequence from which one or more of these codons is missing ; 35 or, indeed, represent a longer sequence. Typically X
~consists of from 6 to 30 nucleotides, for example from 9 to ;:.
. .
; ' .. `, .. .

, .
. - , ^,~ '. . , - . ' .: . -WO90/15145 PCT/GB90/00~1 Z(~55~`~3~

24 nucleotides.
The cassette vector is typically a plasmid. The plasmid generally comprises an origin of replication, so 5 that it is replicable in a host which harbours it.
Typically the host is a microbial host such as a strain of bacterium e.g. E. coli. The plasmid also generally comprises a marker gene such as an antibiotic-resistance gene. A preferred plasmid is pCAS1. E. coli MC1061 10 harbouring pCASl has been deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB
on 25th May 1989 under accession number NCIMB 40148.
Cassette vectors according to the present invention are, like pCAS1, generally double-stranded. The nucleotide 15 sequence, and amino acid sequence according to the one letter code (Eur. J. Biochem. 138, 9-37, 1984), for pCASl and other type 1 vectors which do not have missing any site 1 codons in the region of antigenic site 1 is:

T V D N S A S T K N R F K L F
ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT
TGGCAGCTGTTGAGTCGAAGGTGGTTCTTATTCAAATTTGATAAA
SalI PraI
A cassette vector according to the invention may be 25 prepared by first engineering the Sal 1 and Dra 1 sites into a full length infectious cDNA of an attenuated strain of type 1 poliovirus. This may be achieved by subcloning a partial fragment of the cDNA into a single-stranded cloning vector such as one of the M13 vectors and creating the Sal 1 30 and Dra 1 sites by site-directed mutagenesis using appropriate oligonucleotides. The modified fragment is then reintroduced into the cDNA from which it has been derived.
The cDNA ~ay be provided with a promoter, for example a T7 promoter. Alternatively some full length cDNAs are ~ 35 infectious in which case a promoter is not strictly - necessary. The cDNA is introduced into a vector having no Sal 1 and Dra 1 sites. The vector may be pFBI 2 (Pharmacia) which has been modified to remove its three Dra 1 sites.

... .

:, .

.
.
.:
.~ .
. . .

W090/15l45 PCT/GB90/00~1 ~55~ ;
,~ . , Alternatively, the Sal 1 and Dra 1 sites can be provided by using a polymerase chain reaction (PCR) method.
The published method of "overlapping PCR" (Recombinant PCR
5 by R. Higuchi in l'PCR Protocols: A guide to methods and applications", editors Innis, Gelfand, Sninsky and White, Academic Press, 1990) can be employed. This method overcomes the use of a single-stranded vector for site-directed mutagenesis by the application of the PCR to lO introduce, via degenerate oligonucleotides the Sal 1 and Dra l~restriction sites.
In order to obtain a cassette vector in which the spacer region X is modified, i.e. which does not include the normal codons for VPl amino acid residues 94 to 101, a 15 cassette vector prepared as just described is digested with Sal 1 and Dra 1 and an appropriate DNA fragment is ligated with the digested vector. Alternatively, such a vector may be obtained by site-directed mutagenesis or by the PCR
method.
A modified spacer region X can therefore be provided by digesting a cassette vector according to the invention with Sal 1 and Dra 1 and ligating a double-stranded DNA fragment comprising the desired nucleotide - sequence X into the digested vector such that the Sal 1 and 25 Dra l sites of the vector are retained. Alternatively, the region separating the Sal 1 and Dra 1 sites may be engineered into a full length infectious cDNA of an attenuated strain of type 1 poliovirus. The cDNA is provided with a promoter, for example a T7 promoter, and is 30 introduced into a vector having no Sal 1 and Dra 1 sites.
Where it is wished that X comprises one or more further restriction sites unique to the cassette vector, the vector into which the cDNA is introduced must not also cont~in these sites.
A cassette vector according to the invention is preferably an expression vector. The full length infectious poliovirus cDNA is therefore generally provided in a vector with a promoter and other transcriptional and translational .
:' .
.. . . . ... .
. . - -.. . .. .

2~;5~

control sequences required for expression. The vector into which a cDNA is cloned may be the plasmid pJM1 or a similar vector based on pAT153 from which the gene encoding 5 tetracycline resistance has been removed and replaced by a gene cassette encoding kanamycin resistance. This gene -cassette may be from the transposon Tn 903. The plasmid therefore carried both kanamycin and ampicillin resistance genes. The latter gene is totally removed and replaced by 10 the poliovirus cDNA above. The extreme 3' end of the vector may be provided with a Mlu 1 restriction site.
A cassette vector can be constructed in which X
represents a nucleotide sequence which results in a frameshift for the downstream poliovirus coding sequence.
15 This prevents the recovery of virus in which the region between the Sal 1 and Dra 1 sites has not been modified by the provision of a nucleotide sequence which restores the reading frame.
The nucleotide sequence denoted by X therefore 20 contains 3n-1 or 3n-2 nucleotides, in which n is an integer of at least 1. Typically n is an integer from 2 to 10, for ; example from 3 to 8. A suitable vector is provided in - particular when n is 4. X may denote any nucleotide sequence provided the result is a frameshift in the - 25 downstream poliovirus coding sequence.
A cassette vector can also be constructed in which X includes at least one restriction site, such as a Sst II, ~; Not I or Mlu 1 site. The or each restriction site should be the only site of that type in the vector or at least in the 30 poliovirus coding sequence. The provision of a unique restriction site within the spacer region X allows the digestion of the ligation reaction (vector plus oligonucleotide/restriction fragment insert). Self re-~ ligated vector is digested by the restriction enzyme for : 35 which a site is provided within the spacer region X. The ; recovery of self re-ligated vector can therefore be ~ significantly reduced, if not prevented altogether.

. .

, .. ~ :, , : .,. -., - ,,. , , ... ' , : ' , ,, ~ .

.: , , , . , , . ~ , :

WO90~1514~ PCT/~B90/00~1 ~ 2~55~3 A cassette vector can further be constructed in which a stop codon is provided in the spacer region X. This ensures that the protein encoded by the cassette vector is 5 prematurely terminated and can not be recovered. The stop codon can be introduced in conjunction with a frameshift by providing a nucleotide sequence X having a length of 3n-2 nucleotides. The nucleotides of the Dra 1 site then provide the stop codon as follows.
*
TT TAA A
where * denotes the stop codon. A cassette vector can be provided which incorporates within the spacer region X any combination of a frameshift, a unique restriction site and a 15 stop codon. A particularly preferred plasmid in which all three are present is pCAS7, which is double-stranded. E.
coli MC1061 harbouring pCAS7 were deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB
on 18 April 1990 under accession number NCIMB 40277. The 20 nucleotide sequence, and amino acid sequence according to the one letter code, for pCAS7 is shown in the accompanying Figure in which:
(a) shows the Sst2 and Mlul sites and * denotes a ~i stop codon;
~b) shows the Sall and Dral sites (underlined) and * denotes the stop codon;
(c) shows how the poliovirus coding sequence can be restored to the correct reading frame: and (d) shows the provi~ion of a Mlul site at the 30 extreme 3' end of the poliovirus coding sequence.
The cassette vectors of the invention can be ~ employed to present foreign antigenic determinants. Foreign - epitopes can be inserted at antigenic site 1 to replace VPl amino acid residues 94 to 102, thereby obtaining poliovirus 35 chimaeras capable of acting as epitope presentation systems, e.g. vaccines.
Poliovirus chimaeras which present a foreign amino . ' , : . ' .: . '. " ' '., . . ' ' , ' , ''' : : : .": ' . . , .: ' : ~. . ' . '. ', .', ', . . ' : .. ' . :
.: . . : . . . , , . , . .: . .
, . . : ,. . . . . . . . .
,. . : , ., :, ... , ,. :

WO90/1~145 PCT/GB90/00~1 ~"~ ` ~ ~

acid sequence at antigenic site l are prepared by a process comprising:
(i) providing a double-stranded DNA fragment which 5 encodes the amino acid sequence and which has a 5'-Sal l cohesive end and a 3'-blunt end;
(ii) digesting a cassette vector according to the invention with Sal 1 and Dral and ligating the fragment from step (i) with the digested vector; and (iii) obtaining live virus from the modified vector obtained in step (ii).
Step (i) is generally conducted by constructing a double-stranded DNA fragment by synthesising complementary oli~onucleotides and annealing the oligonucleotides. The l5 oligonucleotides may be boiled together for from 2 to 5 minutes, for example for about 3 minutes, and allowed to cool to room temperature. Alternatively, a restriction fragment may be provided.
In step (ii) the DNA fragment, for example the 20 annealed oligonucleotides, is ligated with a cassette vector which has been digested with Sal l and Dra l to excise the intervening DNA. E. coli may then be transformed with the ligation mix. Where the spacer region X contains a site for a restriction enzyme and the site is unique to the cassette 25 vector, the ligation mix is digested with the restriction enzyme. This is to prevent recovery of the re-ligated parental cassette vector. The ligation mix is screened for - the presence of the recombinant vector.
Live virus is recovered from the modified full 30 length cDNA by production of a positive sense RNA. The vector incorporating the foreign DNA fragment is cut by a restriction enzyme outside the Sabin l cDNA. The promoter - controlling transcription of the cDNA then enables RNA to be obtained. A T7 promoter is particularly suitable for 35 dire~ting transcription in vitro (van der Werf et al, Proc.
Natl. Acad. Sci. USA 83, 233~-2334, 1986). The recovered -~ RNA may be applied to tissue cultures by standard techniques .

. , .
. . -. , . , ~ . . - , -~ ' ' ' `. , ' . , .

WO90/15145 PCTtGB90/00~1 ~ 5 ~
g tKoch, Curr. Top. Microbiol. Immunol. 61, 89-138, 1973).
For example, the ~NA can be used to transfect Hep2C
monolayers. After 4 to 6 days incubation, virus can be 5 recovered from the supernatant of the tissue culture.
Any foreign amino acid ~equence may be inserted in this way into antigenic site l of an attenuated strain of poliovirus type l. The foreign amino acid sequence may be composed of from 5 to 50 amino acid residues, for example lO from 6 to 30 residues or from 8 to 20 residues. By "foreign" is meant that the amino acid sequence is different from the amino acid sequence of antigenic site l of the attenuated strain of type l poliovirus being employed.
Typically the foreign amino acid sequence is not an amino 15 acid sequence derived from a poliovirus.
The foreign amino acid sequence comprises an epitope to which it may be desired to raise monoclonal or polyclonal antibodies. A monoclonal antibody may be produced by any known method. For example, a mouse, rat, 20 rabbit or non-human primate is innoculated with the recombinant virus of the invention. After a sufficient time has elapsed to allow the host animal to mount an immune response, antibody producing cells, e.g. the splenocytes are removed and immortalized by fusion with an immortalizing 25 cell line such as a myeloma cell line. The resulting fusions are screened for antibodies to the foreign amino acid sequence. The antibodies may be, for example, of the IgG or IgM type. Polyclonal antiserum may also be produced u~ing known methods, using, for example, the animals 30 mentioned above.
The epitope may be flanked by one or more spacer amino acid residues at either or each end. From l to 4 - spacer residues may be provided at either or each end. The spacer residues may be A or G residues or a combination of 35 both. Alternatively residues from the original poliovirus ~, sequence may be employed.
; An epitope may be provided to any known or predicted antigenic determinant which is capable of raising "

., ~ ' ', .: ' ' ' , ' ' "" ': . ' ........................ ' : : : .
. : . . ; . . : :

WO90/1514~ PCT/GB9OtO0~1 2~55~3~
-- 10 -- .
neutralising or non-neutralising antibody. The foreign amino acid sequence may for example comprise an antigenic determinant capable of raising neutralising antibody to a 5 pathogenic organism. The epitope may be derived from a virus, bacterium, fungus, yeast or parasite. More especially, the epitope may be derived from a type of human immunodeficiency virus (HIV) such as HIV-l or HIV-2, hepatitis A or B virus, human rhinovirus such as type 2 or 10 type 14, herpes simplex virus, poliovirus type 2 or 3, foot-and-mQuth disease virus, influenza virus, coxsackie virus, the cell surface antigen CD4, Chlamydia trachomatis, RSV and HPV e.g. HPV 16. The epitope may be the CD4 receptor binding site from HIV, for example from HIV-1 or -2.
15 Examples of specific epitopes are shown in the Examples.
For reasons which are not entirely clear, not all foreign amino acid sequences enable viable viruses to be obtained. Whether or not a viable virus presenting a particular epitope can be obtained can be determined by 20 carrying out the process steps (i) and (ii) and by seeking to obtain viable virus according to step ~iii). Where a foreign sequence does not give rise to viable virus, it may be possible to alter the sequence slightly to that viable virus i5 produced, e.g. by shortening or lengthening the 25 se~uence or by substituting one or more amino acid residue.
Alternatively, viable chimaeras may be recovered following the modification of other regions of the particle, for example surface adjacent residues. A test may therefore need to be undertaken to see if a particular foreign amino 30 acid sequence will give rise to viable virus.
The poliovirus chimaeras that are obtained can be used as vaccines. They may therefore be formulated as pharmaceutical compositions further comprising a pharmaceutically acceptable carrier or diluent. Any carrier 35 or diluent conventionally used in vaccine preparations may be employed. For example, the presently used live attenuated poliovirus strains are stabilised in a solution of lM MgC12.

..... - . .. , ,. . . . . : . . - -.. : , ., : : . : . , ~, 2~S~ 1.3' ' ' ' The poliovirus chimaeras may therefore be used to prevent infections and/or diseases in a human or animal.
The chimaeras may also be administered for therapeutic 5 reasons. For this purpose, they may be administered orally, as a nasal spray or parenterally, for example by subcutaneous or intramuscular injection. A dose corresponding to the amount administered for a conventional live poliovirus vaccine, such as from 105 to l06-5TCID50, lO may be given although the dose will depend upon a variety of factors including the viability and replicative capacity of the poliovirus chimaera.
The ~ollowing Examples illustrate the invention.
ExamDle l: Construction of casse~e vector ~CASl - 15 Taking advantage of codon degeneracy, the nucleotide sequence of Sabin l cDN~ in the region 2740-2800 was searched for sequences at which restriction endonuclease sites unique to the cDNA could be introduced with minimal alteration to the amino acid sequence. It was observed that ; 20 a Sal l site at nucleotide 2753 could be created without alteration to the amino acid sequence and that this site would be unique within the virus ~eguence. Similarly a ~; unique Dra l site could be created at position 2783 ; resulting in the replacement of aspartic acid tVPl residue 25 102) by phenylalanine.
The synthetic oligonucleotides 5'-GGAAGCTGAGTTTCGACGGTTATAATGG-3' and 5'-CACTGTAAATAGTTTA _ CTTATTCTTGG-3' (bases inducing changes ~ underlined) were used to create Sal l and Dra l restriction .'~, " . . . ~ . . . . ........................ . . . ......... . . ..; . ~ . . ... . . . . . . . .....

W O 90/1514S PC~r/GB90/00841 r ~ `; ~;;
2C~S~ 3 sites at positions 2753 and 27B3 respectively on a 3.6kb ~pn 1 partial fragment (nucleotides 66-3660) of an infectious Sabin 1 cDNA (Stanway et al, J. Virol. 57, 1187-1190 1986) subcloned in M13mpl8, using the gapped-duplex mutagenesis technique (Rramer et al, Nuc.
Acids Res. 12, 9441-9456, 1984). The alterations made to the antigenic site were confirmed by dideoxy cha~n termination sequencing.
The nucleotide and amino acid equence of poliovirus Sabin 1 illustrating changes introduced in the con~truction of pCAS1 are shown below. Nucleotides 27S0-2794 of the cDNA
sequence of the viral sense strand are shown, together with the location of the introduced restriction sites. The resulting amino acid change to phenylalanine from aspartic acid at position 102 is shown in parenthesis.

91 (F) 105 T V D N S A S ~ X N R D K L F
ACC GTG GAT AAC TCA GCT TCC ACC AAG AAC AAG GAT AAG CTA TTT
GTC GAC TT~ AAA
Sal 1 Dra 1 The mutated fragment was introduced into a full-length 1 cDNA of Sabin type 1 onto which a T7 promoter had previously been engineered at the extreme 5~ end. This full-length clone was subsequently transferred into vector pF3I 2 (Pharmacia), which had been modified to remove its 3 Dra 1 sites at positions 2052, 2071 and 2763, by insertion .
'~

SUBSTITUTE SHEET

` . , , -. .. .,, . ~ .,~ . , ,. , ~ :. .: ' . .
. . .: ~
, ~ ' ~.' .. .
,, .

WO90/15145 PCT/GB90/00~1 2(~5~.5~.3 of an Eco R1 linker following Dra 1 digestion. An Eco R1 -Sal 1 fragment carrying this ~odified full-length poliovirus clone was ligated into Eco R1-Xho 1 digested pFBI 2-derived vector thereby destroying this Sal 1 site. The re~ulting plasmid, pCASl, therefore contained a full-length Sabin 1 cDNA under the control of a T7 promoter ~nd in which the introduced Sal 1 and Dra 1 sites were unique.
~ Recovery of infectious virus from Nael linearised pCAS1 was achieved following transfection of Hep 2C
monolayers with transcripts produced in vitro by T7 RNA
polymerase (Stratagene) as previously described (van der Werf et al, Proc. Natl. ~cad. Sci. USA B3, 2330-2334, l9B6).
The genomic sequence of recovered virus was verified by primer extension sequencing of viral RNA (Rico-Hesse et al, Virology, 160, 311-322, 1987). The single substitution of aspartic acid for phenylalanine at residue 102 had no apparent effect on virus viability. Furthermore the design of the cassette was such that the altered amino acid would be lost upon insertion of replacement sequences.

.
Example 2- Construction of a chimaeric poliovirus containinq - residues 735-752 of the transmembrane ~lycoprotein qp41 of .
HTLV-IIIB
The residue numbers 735-752 are those as defined by Kennedy et al, Science 231, 1556-1559, 1986. 100 n~ each of ~; complementary oligonucleotides encoding the HIV-1 sequence of choice were boiled for three minutes and allowed to cool ;' .
. .

~''' SUBSTITUTE SHEET

. . . ....... .

: '~ "`'. '.' ' . ' '.'' ' " ;'''~,...... ' "''' : '" ' " ' . ' . : .

WO90/t~145 PCT/GB90/00~1 Z ~ ~ 5 ~ 4 ~;
to room temperature. The oligonucleotides were:
TCGACCGCCCTGA~GGCATCGAGGAAGAGGGCGGTGAGCGCGATCGTGATCGTTCG;

and GGCGGGACTCCC~TAGCTCC~TCTCCCGCCACTCGCGCTAGCACTAGCAAGC.

Aliquots of this annealed mix were then ligated with Sal l - Dra 1 digested pCAS1. Competent E. coli were transformed with the ligation mix ~nd screened for the pres~ence of a recombinant plasmid containing the HIV
sequence inserted. The resulting recombinant pla~mid, pS1/env/3 was linearised with NaeI, which cuts within vector sequences of the construct, and used as a template in a T7 transcription reaction (van der Werf et al, Proc. Natl.
Acad. sci. USA 80, 5080-5084, 1983) prior to transfection of sub-confluent Hep2C monolayers.
After three to four days a cytopathic effect was observed. The RNA sequence of approximately 200 bp spanning antigenic site 1 of the recovered chimaeric virus S1/env/3 was confirmed by primer directed ch~in termination sequencing. The nucleotide and amino acid sequence of the region of antiqenic site 1 of pC~S1 and of the corresponding region of pSl/env/3 are shown below. Bql 1 and Pvu 1 ~estriction sites, introduced into pS1/env/3 to aid in the screening of recombinant plasmids, are shown underlined as are the Sal 1 and Dra 1 sites in pCAS1.

. .
.. ' .

... .
~ T ~ E.

.. . . . . . :

WO90/lS145 PCT/GB90/00~1 ~``'"` 2~55~3~
`,, , pCASl T V D N S A S T K N K F K L F
ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT
SalI DraI

pS1/env/3 T V D R P E G I E E E G G E R D R D R

TGGCAGCTGGCGGGACTCCCGTAGCTCCTTCTCCCGCCACTCGCGCTAGCACTAGCA
`:
Bqll Pvul S K L F
` TCGAAACTATTT

Example 3: Characterisation of Sl/env/3 The antigenic properties of S1/env/3 were investi~ated. The virus was neutralized by poliovirus type 1 polyclonal antisera, and by monoclonal antibodies directed ; 20 against antigenic sites 2 and 3 of the Sabin 1 strain (data not shown). However monoclonal antibodies specific for antigenic site 1 of Sabin 1 did not neutralize the chimaeric virus. The monoclonal antibodies failed to recognize the chimaera in antigen blocking tests (data not shown), thus 25 confirming that this site was altered in the chimaera.
The recent observation that the structure of antigenic site 1 may influence poliovirus host range prompted us to investigate the interaction of S1/env/3 with the poliovirus receptor. Sl/env/3 infection of Hep2C
.:: .
30 monolayers was blocked by a MAb ~pecific for the receptor (Minor et al, Virus Res. 1, 203-212, 1984), thus demonstrating that the chimaera still used the normal ~ .

.

..
- .
:~, ~, , ' .`. '~ ~' '.: .. .. ' WO90/t5145 PCT/GB90/00~1 s ;., ~ ' ~ - _ 16 -poliovirus ce ~u~ar receptor for attachment and entry into cells.
The ability of S1/env/3 to absorb out the HI
neutralizing activity of antipeptide monoclonal antibodies or of human immune sera was investigated. Preincubation o~
antibodies with sucrose cushion purified S1/env/3 abrogated the neutralization of ~TLV-IIIB by the IgM monoclonal antibodies ~Mab) ED6 and LA9 which were raised against the corresponding qp41 peptide, amino acids 735-752 (as defined above). Preincu~ation with S1/env/3 also reduced the neutralization of HTLV-IIIB by five of six human immune sera. In contrast the neutralization of HTLV-IIIB by ~n IgG1 MAb ~110.3), mapping to the type specific loop in the second conserved region of env (amino acids 307-321) was not inhibited by S1/env/3. Moreover, preincubation with Sabin type 1 poliovirus had no effect on the neutralization of HTLV-IIIB by ED6, LA9, 110.3 or the human immune cera.
; - The results are ~hown in Table 1 below, where they are expressed as the reciprocal of the serum dilution giving >90% reduction in ~IV titre 5Weiss et al, Nature 324, 572-575, 1986) followin~ pre-incubation of the MAbs or human $mmune sera with culture medium (Mock), Sabin 1 or S1/env/3.
Human immune sera numbered 1-6 represent anonymous HIV+
blood donors. 5xlO~ TCIDso units of sucrose purified Sl/env/3 or Sabin 1 were preincubated with a 1:10 dilution ^~. of the ED6, ~A9, a 1:100 dilution of 110.3 and a 1:1 ~ dilution of each human serum for 1 hour at 37C. Residual .~ .

,',- . .:'' ' '''., ' ', ',. . ,.', . . ~ . ; ~ . ::

WO90/15145 PCT/GB90/00~1 .
2~e;S~3 .. , . ~ , ~ ;, i`
- 17 - 4, ~

HIY-neutralizing activity was determined by incubating dilutions of the antibody/virus mixture with 103 infectious units ~TCIDso) of HTLV-IIIB for 1 hour at 37C. 100 ~1 of medium containing 2xlO-~ C816~ cells were added, and the presence of syncytia recorded after 4~ hours a~ an indication of HIV infection.

Table 1: Sl/env/3 inhi~ition of HTLV-IIIB neutralization ~TLV-IIIB neutr~lization titre - pre-inc~bation with Mock Sabin 1 S1/env/3 : Monoclonal Antibodies i 110.3 1000 1000 1000 -`~ Human Sera ~"~5 1 160 160 20 . ,.
`. 4 B0 60 20 i 6 ao 80 80 The immunogenic potential of S1/env/3 was investigated by raising antisera in rabbits. Neutralizing activity against HIV-1 was determined by infectivity ~:' , .
. . ~ . .
,, :

. .
SUB JTITUTE SHEET
.

-~ . , . . .. . .: . :

' '' 4~ PCT/GB90/00~1 2~55i3 18 -inhibition and plaque reduction assays. All ~ntisera showed neutralising activity against RTLV-IIIB confirming that the chimaera has immunogenic potential. Antiserum Rl which contained the highest ~nti-poliovirus activity wa~ further tested ~gain~t a range of HIV-l isolate~. This antiserum neutralized the entire test panel at various titres, including the African isolates CBL4 (Tanzania) and Z84 (Zaire). The neutralizing titres observed in both neutralization assays used were in good agreement.
Antisera R7 and R8 also neutralized the HIV-l isolates tested (HTLV-IIIRF or Z84), though the titres observed were lower against both HIV-l and Sl/env/3.
Pre-immune sera and hyperimmune Sabin l rabbit antisera displayed negligible neutralizing activity against any of the HIV-l isolates. The HIV-l neutralizing activity of antiserum Rl was absorbed out by pre-incubation with the chimaera, but not with Sabin l, confirming that the ~ctivity was induced by ~he gp41 epitope and not by a chan~e cross-reactive polioviru6 epitope. Antiserum Rl was also tested for its ability to inhibit early syncytial formation in a mixture of HTLV-I~I9 p~oducing cells and uninfected C8166 cells, a T cell line sensitive to ~IV-mediated fusion.
Antiserum ~1 was found to inhibit HIV-induced cell fusion, though at lower titre than that determined by virus inhibition (data not ~hown).
Table 2 below shows the results of neutralization of HIV-l infectivity and inhibition of syncytium formation by ~ .

,~

~ ~'7T ~

. .: . . ~ . , .. . , . . . : -. ~

WOgO/IS145 ~PCT/GB90/00~1 ~ 9 _ 2c~5~si3`'' ~
S1/env/3 antisera. Rabbit R1 was imm`unised intradermally with O.lml tapprox. 10~ TCIDso ml ') of sucrose purified S1/env/3 in complete Freunds adjuvant, and boosted subcutaneously at two week intervals with the same virus preparation in incomplete Freunds adjuvant. Rabbits R7-R9 (S1/env/3) and R19-R21 (Sabin 1) were immunised intramuscularly with O.Sml of tissue culture fluid ~approx.
10~ TCID50 ml~1~ in complete ~reunds adjuvant, And boosted at t~wo week intervals in a similar manner. Neutralization titres were determined by incubatin~ 1 of heat inactivated antiserum with 40~1 of virus supernatant containing 103 infectious units of HIV-1 at 37C for 1 hour.
Residual HIV-1 infectivity was measured by the infectivity inhibition assay (Weiss et al, 1986) described in relation to Table 1. Antiserum R1 was also tested for ~IV-1 neutralising ac~ivity in a plaque reduction assay ~Harada et al, Science 229, 563-565, 1985) on the sensitive ~T4 cell line. The results obtained by this independent assay are shown in brackets. Results are expressed as the reciprocal of the serum dilution giving >90% reduction in HIV infectivity or plaque formation. Also shown is the reciprocal neutralisation titre of Sl/env/3 antisera with ,;
100 TCID~o units of the homolo~ous virus. nt - not tested.

.
.: .

: .

', : - .

.:
': .~ . . .
, '. ~. .
'~; . , ~ '': . . .: :
.. . . .
'. . ' ' ,: . . . , . . : ' 2~55~ PCT/GB90/00~1 .
"~ 20 - ~ ;
~able 2: Neutralization of ~IV-1 ~nfectivit~ and inhibition of syncytium form~tion bY Sl/env/3 antiser~

Reciprocal neutralization titre Virus strain Antiserum Rl IIIB IIIRF SF2 SF33 C~L4 Z84 Sl/env/3 pre-immune ~10 <10 <10 C10 <10 <10 <10 final bleed 80 80 80 40 10 40 ~28960 (40) (40) (160) (40) (80) (40) pre-immune <10 <10 nt nt nt <10 <10 final bleed 20 40 nt nt nt 40 >2560 pre-immune <10 <10 nt nt nt nt <10 final bleed 40 20 n~ nt nt nt >2560 ::: pre-immune <10 <10 nt nt nt nt <10 : final bleed 40 10 nt nt nt nt 1280 R19, R20 and R21 pre-immune ~10 post-immune <10 Monoclonal antibodies were raised against S1/env/3, and their reactivity with S1/env/3 but not the parental Sabin 1 was demonstrated in anti~en blocking tests (data not shown). Four MAbs specific for S1/env/3 were characterized in terms cf their rea~tion with several HIV-1 isolates. One MAb ~1577) displayed neutralizing activity against all ~IV-1 isolates tested, including the three African strains CBL4, Z84 and Z129. Monoclonal antibodies lS75 and 1583 displayed a more restricted respone neutralizing only ~ome of the .
isolates, suggesting that.they recognize a defined epi~ope ':', -:

.'' , ,: - - . . . . . . . .

WO90/t5145 PCT/GB90/00~1 Z~i~3`

within the qp41 735-782 region, that is less well conserved.
Monoclonal antibody 1578 displayed no ~IV-l neutralizing activity, suggesting that it recognised an epitope formed from both ~IV-1 and poliovirus amino acids.
The neutralization of RIV-1 infecti~ity by S1/env/3 monoclonal antibodies ~s shown in T~bl~ 3. Murine monoclonal antibodies were raised as descr$bed by Fergusson _ al, J. ~en. Vir~l, 65, 197-201 (1984), and screened aga~nst S1/env/3 and Sabin 1 in ~ntigen bloc~ing tests~ The S1/env/3 and HIV-1 neutralizing activity of the ascites from four hybridomas was determined. Results are expressed as the reciprocal of the MAb ascitic fluid dilution giving >90 reduction in HIV-1 titre, or neutralizing 100 TCID~o units of Sl/env/3.
, Table 3: Neutralization of HIV-1 infectivitv by S1/env~3 monoclonal antibodies Monoclonal Antibody - ~eciprocal Neutralization titre Virus Strain Mab IIIB IIIRF SF33 CBL4 Z84 Z129 S1/env/3 1575 40 20 40 10 lO <10 2560 1577 40 160 80 20 20 1~ 640 1578 <10 <10 <10 <10 <10 <10 640 1583 40 40 20 <10 <10 <10 >28960 The specificity of the ~IV-1 immune response to i~ S1/env/3 was demonstrated by Western blotting and by a . - .
, SUBSTITUTE SHEET

~,; . , ' . ~ :. , . : -WO90/t5145 PCT/GB90/00~1 $~i~;3`
;y~ 22 -peptide binding assay. Antiserum R1 reacted with the envelope glycoprotein precursor gpl60 and gp41 in Western blots whereas pre-immune ~era was negative. All the rabbit antisera bound specif~cally to a linear synthetic peptide corresponding to the ~T~V-III3 epitope prei~ient on the SI/env/3 chimaera whereas they falled to bind to a 15 amino acid pept~de derived from the type spec~fic neutralization epit~ope on gp~20 (residues 307-321). Pre-immune sera and control rabbit hyperimmune Sabin 1 antisera (R19, 20, 21) displayed no specific binding to either the gp41 or gpl20 derived peptides. The three SI/env/3 monoclonal antibodies which neutralized ~IV-1 (1575, 1577, 1583) also reacted with the gp41 735-752 peptide in peptide binding assays (data not shown).

Example 4: Construction of chimaeric polioviruses containinq amino acid sequences from hepat_tis A virus, rhinovirus tvpes 2 and 14 and coxsackie B4 virus Short sequences of hydrophilic amino acids, as chown in Table 4, from the capsid protein VP1 of Hepatitls A
virus (Najaran et al, Proc. Natl. ~cad. Sci. USA
82,2627-2631, 1985), which might constitute potential antigenic sites, were inserted into the Sal 1-Dra 1 digested pCASl vector accordinq to the procedure described in Example 2. Appropriate oligonucleotides were annealed by boiling -and allowing to cool to room temperature prior to ligation into Sal l-Dra 1 digested pCASl. T7 transcripts prepared . ., ~
.

, . ., ,,;

5 PCT/GB90/00~1 - 23 _ 2 ~
from the resulting recombinant plasmids were used to transfect Hep 2C monolayers (van der Werf et al, 1986). All plasmids containing the Hepatitis A virus inserts gave rise to viable virus 24-36 hours post-transfectlon. The sequence of each recovered v1rus was confirmed by sequencing viral RNA (Rico-Hesse et al, 1987).
Similarly oligonucleotides corresponding to known or predicted epitopes from human rhinovirus (HRV) serotypes 2 (Skern et al, Nuc. Acids Res. 13, 2111-2126, 1985) ~nd 14 (Stanway et al, NUC. Acids Res. 12, 7~59-7875, 1984) ~nd from the capsid protein VPl of Coxsackie B4 virus (Jenkins et al, J. Gen. Virol. 6~, lB35-1848, 1987) were ligated into pCAS1. Resultinq plasmids were tested for viability as above. Sequence analysis of genomic ~NA confirmed that recovered viruses had the expected modifications of antigenic site 1. In one case, however, a recombinant ; plasmid containing an insert sequence tmarked *) from Coxsackie B4 virus did not produce viable virus upon repeated transfection although the DNA sequence of the engineered site was correct.

.

:

:

~, ..

:.......................................................................... .

, . .
. , ~ : '., .
:- .. :;.' :
. ~.: ,:;:

~ .24 -Table 4: Amino acid sequences inserted into PcAsl and their origin Virus Amino acid sequence Location Sabin 1 NSAST~NRD VP1 94-102 Sabin 3 NEQPTTRAQ VPl 92-100 ~epatitis A (N)EQNPVD(D) VP1 15-20 ~DL~GRANRGRMD VPl 29-41 TFNSNN~EY VP1 99-108 NSNNKEYT~D) VPl 111-118 (N)ATDVDG(KD) VPl 150-155 NTRRTGN(~D) VP1 191-197 (N)G~GDRTDS VPl 217-224 Rhinovirus 2 ~LEVTLANY VPl 81-89 ; 14 ~DATGIDNHREA VPl 85-96 14 (N)MYVPPGAPNP(D) VPl 151-160 ~ 14 (N)~LI~AYTPPGARGPQD VP3 126-141 - Coxsackie ~4 (N)SAESNNL(D) VPl 81-87 ~--IYIKYSSAESNNL~ VPl 75~87 .~ Residues in parenthesis correspond to amino acids which have been retained from the wild-type Sabin 1 sequence.

Example 5: Construction of further viable poliovirus ::
chimaeras Following the procedure described in Example 2, viable poliovirus chimaeras were constructed by inserting l annealed complementary oligonucleotide encoding the epitopes ;, shown below into the Sal 1 - Dra 1 digested pCAS1.

.~ .

"
. .

SUB~TITUTE SHEET

WO9Otl5145 PCT/GB90/00~1 ,~i~, 1 - 25 - ~ 3 HIV-l Sl/env~1 GGDMRDNWRSELY residues 469-482 Sl/env/4 NMWQEVGRAMYAPPISG residues 423-439 Sl/env/5 AAPRNPRNRA (-ve strand) residue~ 48-57 (Numbering of residues is according to the sequence of the molecular clone NY5/LAV-l as referenced in "AIDS and ~uman Retroviruses lg88" compiled by G. Myers, ~os Alamos, US).
` gp41 residues 598-609 according to Gnann et al, J.
Virol. 61, 2639-2641, 1987 (D) L G L W G C S G
TC GAC CTG GGG TTG TGG GGT TGC TCT GGA
L I C T T
AAG CTT ATT TGC ACC ACT
: CD4 Sl/CD4/1 NQGSFLTRGPSR~ND residues 64-78 (Numbering of residues is according to Maddon et al, Cell 42, 93-104, 1986 quoting the unprocessed polypeptide) Herpes Simplex Virus type 1 e Sl/HSV/1 LRMADPNRFRGRDL residues (gD) 9-22 ~r (Numbering of residues is according to Minson et al, J. Gen.

`~ Vi~ol. 67, 1001, 1986) -Influenza Virus . .
A S;./flu/1 NACRRGPGSGFFS residues ~HA) 137-149 (Numbering of residues is according to the sequence of Aichi/2/6P~(X-31) reported in Laver et al, Nature 283, , :~''," .

., .
~SlJ~ T~ E SHEET

..
" . ~ . , , . . .

WO90/15145 PCT/GB90/00~1 : ~2~5~3 - 26 -., , , . ,~
454-457, 1980).

Haemagglutinin residues lB6-200 (site B) according to Wiley et al, Nature 289, 373-378, l9B1 (D) S T N Q E Q T S

TC GAC AG~ ACT AAC CAG GAA CAG ACC ~CA
.
L Y V Q A S G

CTG TAC GTG CAG GCA TCA GGA
.
Poliovirus type 2 Sabin strain S1/2 NDAPTRRAS VP1 residues 94-102 (Numbering of residues is according to Minor et al, J. Gen.
Virol. 67, 1283-1291, 1986) Chlamydia trachomatis serovar A MOMP VAG~ERDPVA MOMP A no. 2 , VAGLENDPVA MOMP A no. 1 serovar B MOMP NNFNQTKVSNGAFV MOMP B
serovar C MOMP TRTQSSSFNTAgLI (non-viable) serovar L2 NENHATVSDS MOMP L2 , ~; (MOMP - major outer membrane protein; epitopes are according to Baehr et al, Proc. Natl. Acad. Sci. USA 85, 4000-4004).

Foot-and-mouth disease virus V~1 40-49 VRVTPQNQIN FMDV5/6 . .
*VP 140-160 AVPNLRGDLQVLAQRVARTLP FMDVABCD
-~.
~ VPl 142-153 NLR~D~QVLAQ FMDV1/2 . . .
~ VPl 147-156 DLQVLAQRVA FMDV3/4 , , :, . .

, . . , . . . ~ . , ! . , .-' " - .' . '. .- ' " ' ' "' '' " '' ". ~. . ' ' ~. ' ' . ', ' ' ' . ''. "' " ' ' '" ' ' '." '.~' ' . , WO90/1514~ PCT/GB90/00~1 `.
- 27 ~ ' 2, ~5~13 (Numbering of residues is according to the sequence of lR
strain as reported by Forss et al, Nuc. Acids Res. 12, 6587-6601, 1984 apart from the entry marked * which is an epitope identified by Bittle et al, Nature 298, 30-33, 1982 and Pfaff et al, EM~O J. l, ~69-874, 1982).

Human Panillomavirus tvne 16 (HPVl6) , ~
Ll rès~dues 269-284 according to Patel et al, J. Gen. Vi~ol.

70, 69-77, 1989 ~D) E N V P D D L Y I
TC GAC GAA AAC GTG CCA GAC GAC TTG TAC ATT
K G S G S T A
AAA GGA TCA GGA TCC ACC GCA

Respiratory Syncytial Virus (RSV) Fusion glycoprotein (Fl) residues 221-229 according to Trudel et al, J. Gen Virol. 68, 2273-2280, i987 (D) (N) I E F Q Q K N N R
TC GAC AAC ATT GAA TTC CAG CAG AAA AAC AAC AGA.
, ., "

:; .

',','' .--.
.'~',' .

,o,i :: .. - . . .. ~ : -. . , ,, . ., : . : . , . . . : .
.. .. . . . . . . . .

WO 90/15145 PCl'tGB90/00841 ~, t~"~ 2~3 - ' I

ExamPle 6: Construction of cassette vector PCAS7 Cassette vector pCAS1 is described in Example 1.
pCAS7 was obtained from pCAS1 as follows:
5(a) The Sall and ~ral sites are maintained in the same position as pCASl, as is the remainder of the Sabin 1 poliovirus sequence which is unmodified (see point d).
(b) The region separating the Sal 1 and Dra 1 sites has been modified in the following way; 1) The 10 poliovirus sequences have been removed and, 2) replaced with oligonucleotides containing two restriction sites unique to Sabin 1 which 3) result in the introduction of a "frameshift" i.e. the polyprotein reading frame is not maintained, thereby preventing the recovery of virus in 15 which the region separating the Sal 1 and Dra 1 has not been modified. To further ensure the latter, we have also introduced a stop codon that will be read immediately following the frameshift, therefore prematurely terminating the polyprotein.
~c) The plas~id vector in which the poliovirus sequence is cloned has been changed. The new vector is called pJM1, and is based upon pAT 153, from which the gene ~,~ encoding tetracycline resistance has been removed, and - replaced with a gene cassette encoding kanamycin resistance 25 (from the transposon Tn903). This vector therefore carries ~oth kanamycin and ampicillin resistance genes, but the latter is totally removed and replaced with the Sabin l sequence. This vector has proved to be far more stable than ~; the original one used for pCASl (which was the commercially ` 30 made pF81), and results in faster growing colonies which contain few, if any, deleted plasmids.
(d) The extreme 3' end of the poliovirus sequence has been slightly modified by the addition of a Mlul - restriction site (through since this lies outside the poly-35 A tail it could be considered a vector restriction site into which the poly-A tail is cloned). The recognition sequence of ~lul is A'CGCGT, and cleaves between the A and the C. We , ;,.'~
.. - .. ,. .. . . - .. - ,. : . , . . - :
, .. . ~ . . . .. , . . - , .
.: - , : . ., , . . . . , ~
- . .. . . . .
. . ,; , . , .. . .. : . , . . - .: :
: : , .. . , .: .. .: .
~. . . , . , . . . . ; . , ..
: ,, . : , ,. : ;

WO90~1~145 PCT/GB90/00~1 - 29 - 2~ 3 therefore cut recombinant (chimaeric) cDNA~s with Mlul prior to producing runoff transcripts for transfection.

Exam~le 7: Construction of viable Poliovirus chimaeras usinq Following the producedure described in Example 2, the following constructs have been generated with pCAS7.
All these chimaeras are viable.

Name Sequence amino acid numbers 10 a) Containing sequences derived from HIV-1 gpl20. (Unless otherwise stated all ~IV-l sequences are based upon the BRU
isolate catalogued by Myers et al., 1989 (AIDS and Human Retroviruses, 1989. Los Alamos National Laboratory, Los Alamos USA), and originally sequenced by Wain-Hobson et al 15 1985 Cell 40: 9-17. Some of the chimaeras are variations upon particular sequences eg. Sl/env/2a. The only exceptions to this are S1/env/2b which is based upon the MN
. ,~
isolate -~equence, and Sl/env/6 and Sl/env/7 which are respectively based upon the MAL and ELI isolates. All these 20 isolates are catalogued in the Myers et al 1989 reference).
Sl/env/2a LGIWGCSGKLICTT 598-611 Sl/env/2b LGFWGCSGKLICTT 598-611 :Sl/env/3 DRPEGIEEEGGERDRDRS 735-752 -S1/env/6 NMVAGRKAIYAPPIERN
25 S1/env/7 NTWQGYGQAMYAPPIEG
S1/env/8 NSASQRGPGRAFTRNKF
Sl/env/9 APPISGQISCSSNID 441-455 S1/env/10 LPCRIKQFINMWQEVG 421-436 b) Containing sequences derived from HIV-l nef , .~J 30 Sl/nef/l VRERMRRAEPAADG 16-29 ~ .
,Sl/nef/2 LEAQEEEEVGFPV 58-70 `~ Sl/nef/3 GLEGLIHSQRRQDILD 97-112 Sl/nef/4 VPVEPDKVEEANKGEN 146-161 --, ., , ~

: , . , ., .: , : . , . . .:

. :. - , , -: ~. - :

W090/15145 PCT/GB90/00~1 , 2~5~i13 '~` ' - 30 ~ !
c) Containing sequences derived from HIV-2 gpllO (Based upon the original sequence by Guyader et al 1986 Nature 326:
662-669, catalogued by Myers et al 1989) 5 Sl/env/ll NTWHKVGRNVYLPPREG
1.
d) Containing sequences derived from SIVmac251 (Based upon the original sequence by Franchini et al 1987 Nature 328:
539-543, catalogued by Myers et ~1., 1989) 10 Sl/SIV/2 NTWHKVGKNVYLPPREG
.' e) Containing sequences derived from human CD4 (Based upon the original sequence by ~addon et al 1986, Cell 42: 93-104) Sl/CD4/3 NQIKILGNQGSFLTKGPSKLNDRAD 32-56 Sl/CD4/3i NQIKILGNQGSFLTRGPSKLNDRAD 32-56 15 f) Containing sequences from Hepatitis A Virus (Originally sequenced by Emini et al 1985 J. Virol 55: 836-839) HepA VPl constructs Sl/H18 VDTPWVEKESALS 166-178 Sl~Hl9 ITLSSTSNPPHGL 111-123 ,. .
-20 Exam~le 8: Antiaen chimaera of poliovirus induces antibodies aaainst HPV16 ;;The growth characteristics and antigenicity of the HPV16 chimaera of Example 5 were investigated. This chimaera was designated S1/HPV16/Ll. Growth characteristics ,25 were assessed in Hep-2c cells. Confluent Hep-2c monolayers in 35-mm tissue cultures dishes (Sterilin) were washed twice with phosphate-buffered saline (P~S) and infected at a ;,multiplicity of infection of 10 PFU per cell. Separate culture dishes were infected with poliovirus type 1 Sabin 30 strain and S1/HPV16/Ll.
Virus was adsorbed for 13 minutes at rsom temperature, and then pre-warmed medium was added and the plates were incubated at 34C. At regular points of time ~
.
.'~' .
, ......................................................................... .
~ . .

, , - ,. .- . , . , ,, . : . .
. - . . .. . . .... ... .
, W090/15145 PCT/GB90/00~1 - 31 - 2~ 3 over a period of 15 hours, medium was aspirated and the cells were washed twice in PBS before being scraped from the dish into a 1.5 ml tube. Cells were pelleted and then lysed 5 by being resuspended in 0.1 ml of buffer containing 0.1 M
Tris (pHl.5), 0.1 mNaCl, 1.5 mM NgC12 and 0.25% (vol/vol) Nonidet P-40 (Sigma Chemical Co, St. Louis, Missouri, US).
Virus titres in the lysate were determined by plaque assay on Hep-2c cells grown in six-well dishes 10 (Corning Glass Works, corning, New York, US). Sl/HPV16/Ll repli`cated slightly less well than the unmodified Sabin 1 in hep-2c cells, producing a titre of 1o8-4 compared with 109 for Sabin 1. The plaques formed by S1/HPV16/L1 were indistinguishable in size from those of Sabin 1.
The antigenic character of S1/HPV16/L1 was examined by a standard neutralisation assay (Jenkins et al, J.
Virol., March 1990, 54(3), 1203-1206). Sl/HPV16/Ll was neutralised by the anti-HPV16 monoclonal antibodies (Mabs) 8C4, ID6 and 5A4, which are specific for peptide 269-284 of ~ 20 Ll-HPV16, and by a polyclonal serum raised against a ; L1-HPV16/~-galactosidase fusion protein. However, the virus was not neutralised by Mabs which recognised other regions of L1-HPV16.
In a radioimmunoprecipitation assay, a 1/400 25 dilution of Mab 5A4 recognised Sl/HPV16/Ll, whereas Mab IC6 failed to react at a dilution of 1/10. Neither antibody recognised Sabin 1. This suggests that the antigenicity of the HP~16 sequence expressed on the surface of poliovirus closely resembles that of the papillomavirus capsid antigen 30 found in infected cells, although it was of interest that one Mab specific for peptide 269-2~4 (3D1) did not neutralise and failed to recognise the chimaera in a radioimmunoprecipitation assay. The chimaera was also ` neutralised by polyclonal Sabin 1 antiserum and by Mabs 35 raised against Sabin 1 antigenic sites 2 and 3. As expected, the chimaera was not neutralised by a site 1-specific Mab (955).

- . ............................ . .

, ' . :' ' . ~:.' . . , , :

W090/15145 PCT/GB9~iU0841 Z~S~S~3 ~
t~ - 32 Infection of Hep-2c-monolayers by Sl/HPVl6/Ll was blocked by a Mab specific for the cellular receptor of polioviruses (Minor et al, Virus Res. 1, 1984, 203-212).
5 This demonstrated that the chimaera retained its capacity to bind to an enter cells via the normal route used by polioviruses. ~his observation also suggests that the extensive modification of antigenic site l did not confirm novel receptor-binding properties on the virus.
The immunogenicity of Sl/HPVl6/Ll was assessed in rabbits by subcutaneous inoculation in adjuvant. Sequential bleeds from each of three animals showed an increase in antibodies which neutralised the chimaera. The sera also showed an increase in reactivity in ELISAs against the 15 ~-galactosidase/Ll-HPVl6 fusion protein (amino acids 172 to 375) and the Ll-HPVl6 peptide 269-284. Similar results were obtained when a different fusion protein of tryptophan E
synthatase and Ll-HPV16 residues l to 505 were used as a solid phase target. No reactivity against Ll-HPVl6 peptides 20 299 to 313 and 329 to 343 was observed.
Since HPVl6 can not as yet be cultured in vitro, large amounts of purified virions are unavailable for immunological assay. The ability of the rabbit antisera raised against Sl/HPVl6/Ll to recognise HPVl6 virions was ' 25 therefore tested by immunoperoxidase staining of HPVl6-positive human biopsy material. Representative rabbit antisera raised against Sl/HPVl6/Ll (third bleed serum from - a rabbit~ contained antibodies which detected HPVl6 antigen - in human tissue whereas pre-immune rabbit antiserum did not 30 contain such antibody. Immune rabbit antisera to Sabin type l did not react with any tissue sections.

~ .
."~ .
, .. . . ... .

.
. : , ,~. . , - ,. ..

WO90/15145 PCT/GB90/On841 _ 33 _ 2~5~13 The invention further relates to cassette vectors generally. A cassette vector is a construct that allows the rapid and extensive modification of a specific region of a protein. The coding sequence for this specific region is delineated by the presence of flanking S' and 3' restriction sites. Modification of the region is achieved by digestion of the cassette vector at the 5' and 3' sites and ligation of the digested vector with a DNA fragment with suitable complementary ends. This fragment is usually a pair of annealed complementary oligonucleotides but may be a purified restriction fragment or a suitably prepared PCR product.
, We have now devised a cassette vector which simplifies the modification of a specific region of a protein. According to the present invention, there is provided a cassette vector which comprises a coding - sequence for a polypeptide and in which a pre-selected region of the coding sequence is defined by flanking 5' and 3' restriction sites which are unique to the vector, wherein the said pre-selected region is composed of such a nucleotide sequence that:
;(a) recovery can be prevented of self-ligated vector after digestion of the cassette vector with the - 25 restriction enzymes which cut at the flanking 5' and 3' restriction sites; and/or (b~ the cassette vector is incapable of expressing the said polypeptide.

, .'~

~I lB~TlTUTE SHEET
.. . . - . . .
. . ., , .. . ~.
-- ~ . .: . - . :
'. ' ' ~ ' '. ~ ' ., . " . ~' .. .. , . .. .
.`: . . - - :. . . . ... . . .

WO~0/15145 PCT/GB90/00~1 2C\5~ .3 . r j r~
; ~ - 34 -The cassette vector may encode any polypeptide.
The polypeptide may be a viral capsid protein or a therapeutically active protein, for example a protein capable of exhibiting activity in a human or animal. The polypeptide may be a prokaryotic or eucaryotic protein.
The cassette vector may comprise a cDNA, for example a poliovirus cDNA such as the cDNA of an attenuated strain of type l poliovirus.
A pre-selected region of the coding sequence is defined by 5' and 3' restriction sites unique to the vector. These sites may be engineered into the coding sequence by site-directed mutagenesis or by PCR as described previously. In one aspect, the nucleotide lS sequence of this pre-selected region is constructed so that recovery of self-ligated vector can be prevented after the vector has been cut at the flanking 5' and 3' restriction sites. The use of molecular genetic procedures such as the use of phosphatase to prevent re-ligation of the cut vector, or the gel purification of the cut vector fragment, all theoretically prevent the reformation of the cassette vector. In practice, however, they are not infallible and considerably increase the vector preparation time.
~- Furthermore, they often decrease ligation efficiency -.......................................................................... -~' ,. ..
. ~, ~,.

SUB~T,--, UTE SHEET

~_' ' , ' "' ' .
' . ' ' . , ' ~ ' . ': . , .. . ' WO90/151~5 PCT/GB~0~0~
5S'~13 t 1 ,, ~, I

for example due to the presence of contaminating nucleases on agarose gels.
According to the invention, recovery of the S parental cassette vector can be prevented by providing at least one restriction site within the pre-selected region of the coding sequence and ensuring that this or each such site`is unique to the coding sequence and, preferably, unique to the entire cassette vector. The site may be a Sst II, Not I or Mlu I site. The provision of a unique restriction site within the pre-selected region of the coding sequence means that, upon digestion of a ligation mixture of a vector cut at the 5' and 3' restriction sites and of a DNA fragment insert with the enzyme which cuts at the uni~ue restriction site, the pre-selected region is cut. The enzyme should not of course cut the DNA fragmentO
The recovery of self re-ligated vector can therefore be prevented.
In a second aspect, the nucleotide sequence of the pre-selected region of the coding sequence is constructed so that the polypeptide encoded by the entire coding sequence can not be expressed. The pre-selected region must be modified for the entire coding sequence to be expressed properly. The coding sequence for the ~ 25 polypeptide is not provided as an :.

~ TEF ~ T ~ 5 ~ F~T
:- . . . , . . ............. :, - - : .

. : , . ~ . . . - . . : . :
,, ,, . : -:

..

WO90/15145 PCT/GB90/00~1 $.~
2~55~3 - 36 -open reading frame for the full length of the sequence.
This can be ensured either by introducing a frameshift in the pre-selected region of the coding sequence or by providing a stop codon within that region. Both a frameshift and a stop codon can be introduced.
As mentioned above, a cassette vector allows modification of a specific region of a protein. In a cassette vector according to the invention, the protein coding sequence on each side of this region must be maintained. However, the coding sequence for the specific region of the protein it is wished to modify should not be maintained completely. Indeed it is irrelevant what the coding sequence is as it will be replaced. The nucleotide sequence spanning the region of the polypeptide coding sequence that is to be replaced can therefore be constructed so that it results in a frameshift in the downstream nucleotide sequence and, in particular, in the polypeptide coding sequence downstream of the flanking 3' restriction site. Alternatively or additionally, a stop ; codon can be provided within the nucleotide sequence - spanning the region of the polypeptide coding sequence that is to be replaced. Whichever approach is adopted, it is then impossible for the full length protein coding sequence to be translated.

" !
' '`' ' ',`

;"C t ' ., , . : ' ~ ' ' : -', , .' . . . ~ :
I ' :. ~ '. . . ' .. , ' WO90/1514~ PCTlGB90/OO~i t ~ 2C`S~

A protein for which it is desired to modify a specific region can be represented by the formula (I):
X-Y-Z (I) in which Y represents the amino acid sequence of the region to be modified and X and Z represent the amino acid sequences of the remainder of the protein. The corresponding coding sequence may be represented by the formula (II):
X'-Y'-Z' (II) in which Y' represents the nucleotide sequence encoding the region of the protein to be modified and X' and Z' represent the nucleotide sequences encoding the remainder of the protein. A cassette vector according to the invention can comprise the nucleotide sequence of formula (III):
: X'-Y " -Z' (III) : wherein Y'' is flanked by unique 5' and 3' restriction :. si~es and:
(al) Y' and Y!' do not contain the same number of . nucleotides and the difference in the number of nucleotides ^ is indivisible by 3; and/or . (bl) Y'' comprises a stop codon.

.' .

, .
. ,,. ~

, :

:' , ' ' -': - ' ' -: ~ ' ' ' . ': ' :'' '' ' ' ' ' " '", ' - ' ' ' .' ''' " " , ,. ' , "- ' ' : ' ~ ' , ' ,, ,: '' ' ' . ' . .' ' ' ': , . ~' :' . , .: , ' ' ," . :

i, ...~; !.;, , , ~, Z~55S~3 The number of nucleotides of the sequence Y'' must be sufficient to ensure that the cassette vector can be cut at both the 5' and 3' flanking restriction sites. Where Y' represents an integral number of codons, the nucleotide sequence denoted by therefore must contain 3n-1 or 3n-2 nucleotides, in which n is an integer of at least 1.
Typically n is an integer from 2 to 10, for example from 3 to 8. A suitable vector is provided in particular when n is 4.
The 3' flanking restriction site of the cassette vector may be a Dra 1 site. A stop codon can be introduced, typically in conjunction with a frameshift, by providing the Dra 1 site as follows:

" *
TT TAA A

where * denotes the stop codon.
The cassette vector is typically a plasmid. The ; plasmid generally comprises an origin of replication, so 20 that it is replicable in a host which harbours it.
`Typically the host is a microbial host such as a strain of bacterium e.g. E. coli. The plasmid also generally comprises a marker gene such as an antibiotic-resistance ~gene. Preferred cassette vectors and, in particular, 1~ 25 plasmid cassette vectors are poliovirus cassette vectors as mentioned previously, in particular pCAS7.
:;A cassette vector according to the invention can be i/prepared :....
', SUBSTITUTE S~!FET
., . .
.. . . . . .
- ` . : . .`

'' , ''. ' ` ' . ' , :: ; ' :` , ' ` . . .
. . .

WO90/1~14~ PCT/GB90/~
2~S~ 3 r ~, .7;
- 39 - ' i by first engineering flanking 5' and 3' restriction sites into a polypeptide coding sequence, and then cutting at the restriction sites and ligating an appropriate DNA fragment with the di~ested vector. Alternatively, the vector may be obtained by site-directed mutagenesis or by the PCR method.
The cassette vector is preferably an expression vector. A promoter and other transcriptional and translational control sequences are provided so that a recombinant protein can be expressed.
~ A recombinant vector which encodes a protein in which a specific region has been replaced by a different amino acid sequence can be prepared by:
(i) providing a double-stranded DNA fragment which encodes the different amino acid sequence and which has 5' and 3' ends compatible with the restriction sites digested in step (ii);
(ii) digesting a cassette vector according to the invention with the restriction enzymes which cut at the said flanking 5' and 3' restriction sites of the cassette vector; and (iii) ligating the fragment from step (i) with the digested vector obtained in step (ii).
Step (i) is generally conducted by constructing a double-stranded DNA fragment by synthesising complementary oligonucleotides and annealing the oligonucleotides. The oligonucleotides may be boiled together for from 2 to 5 minutes, for example for about 3 minutes, and allowed to cool to room temperature. Alternatively, a restriction fragment may be provided.
';

.1 .
:.
S~IBSTlTUTE SHEET
':

,.... . , ., ,,,,, ~ .
- , .
. .. .... .

, , ~ : . . . : :
... ... .

WO90/15145 PCT/GB90/00~l 2~5~i~3 i In step (ii), the cassette vector of the invention is digested with the restriction enzymes which cut at the 5' and 3' restriction sites which flank the portion of the cassette vector which is to be replaced. In step (iii), the DNA fragment from step (i) is ligated with the cut vector. If appropriate, the ligation mixture is digested with the restriction enzyme which cuts at a unique site provided within the nucleotide sequence of the cassette vector flanked by the 5' and 3' restriction sites. This is to prevent recovery of re-ligated cassette vector.
Any different nucleotide sequence can be provided in the cassette vector. The resulting recombinant vector can therefore encode a polypeptide having a different amino -~ 15 acid sequence in a specific region. The different amino acid sequence may be any foreign amino acid sequence as described previously. A chimaeric protein incorporating the different amino acid sequence can be expressed. A
-~- recombinant vector capable of expressing the chimaeric protein is introduced into a compatible host. Expression is allowed to occur.
Cells are transformed with the recombinant vector.
Any appropriate :' :., .
. .
.
. . , .. ~ , . . .
' - . :. ' ' : ' - ` :
:' , . , . ' : ~ . . :
' . ', . :
- . . : ~ , . - . .
- ,' WO90/1514~ PCT/GB90/00841 2C`~5S~L3 . "~ .
- 41 - i,~

host-vector system may be employed. The transformed host may be a prokaryotic or eucaryotic host. A bacterial or yeast host may be employed, for example E. coli or S.
cerevisiae. Cells of a mammalian cell line may be transformed. The transformed host is cultured under such conditions that expression of the chimaeric protein occurs.
This protein can be isolated and purified. It may be obtained in biologically pure form. It may be formulated as a pharmaceutical composition also comprising a pharmaceutically acceptable carrier or diluent.

'' ' I;

. ~, .

.1 :, :- .. . . . . , . : ; , . . .. .
:, . , , . , - . . .

Claims (17)

- 42 -

1. A cassette vector suitable for use in constructing poliovirus chimaeras, which vector comprises, under the control of a promoter, a full length infectious cDNA of an attenuated strain of type 1 poliovirus having Sal 1 and Dra 1 sites flanking antigenic site 1 of the poliovirus as follows where the numbers represent the numbers of amino acids of the VP1 capsid protein and X represents intervening nucleotides of DNA, present in sufficient numbers to allow the vector to be digested with both Sal 1 and Dra 1, the said Sal 1 and Dra 1 sites being the only Sal 1 and Dra 1 sites in the vector.

2. A vector according to claim 1, wherein X
represents the codons for amino acid residues 94 to 101 of the VP1 capsid protein.

3. A vector according to claim 1, wherein X
represents a nucleotide sequence which results in a frameshift of the downstream poliovirus coding sequence and/or which comprises a stop codon.

4. A vector according to claim 1, wherein X
represents a nucleotide sequence which comprises one or two restriction sites unique to the poliovirus coding sequence.

5. A vector according to claim 4, wherein the or each restriction site is unique to the vector.

6. A vector according to claim 1, which is a plasmid.

7. A vector according to claim 6, which is pCAS1 or pCAS7.

8. A process for the preparation of a poliovirus chimaera which presents a foreign amino acid sequence, which process comprises:
(i) providing a double-stranded DNA fragment which encodes the amino acid sequence and which has a 5'-Sal 1 cohesive end and a 3'-blunt end;
(ii) digesting a cassette vector according to claim 1 with Sal 1 and Dra 1 and ligating the fragment from step (i) with the digested vector; and (iii) obtaining live virus from the modified vector obtained in step (ii).

9. A pharmaceutical formulation comprising a pharmaceutically acceptable carrier or diluent and a poliovirus chimaera prepared by a process as claimed in claim 8.

10. A cassette vector which comprises a coding sequence for a polypeptide and in which a pre-selected region of the coding sequence is defined by flanking 5' and 3' restriction sites which are unique to the vector, wherein the said pre-selected region is composed of such a nucleotide sequence that:
(a) recovery can be prevented of self-ligated vector after digestion of the cassette vector with the restriction enzymes which cut at the flanking 5' and 3' restriction sites; and/or (b) the cassette vector is incapable of expressing the said polypeptide.

11. A vector according to claim 10, wherein the said nucleotide sequence results in a frameshift of the downstream polypeptide coding sequence and/or comprises a stop codon.

12. A vector according to claim 10, wherein the said nucleotide sequence comprises at least one restriction site unique to the polypeptide coding sequence.

13. A vector according to claim 11, wherein the or each said restriction site is unique to the vector.

14. A vector according to claim 10, which is a plasmid.

15. A process for the preparation of a recombinant vector, which process comprises:

(i) providing a double-stranded DNA fragment which encodes a foreign amino acid sequence and which has 5' and 3' ends compatible with the restriction sites digested in step (ii);
(ii) digesting a cassette vector according to claim 10 with the restriction enzymes which cut at the said flanking 5' and 3' restriction sites of the cassette vector;
and (iii) ligating the fragment from step (i) with the digested vector obtained in step (ii).

16. A process for the preparation of a chimaeric protein, which process comprises introducing a recombinant vector prepared by a process as claimed in claim 15 into a host and enabling expression of the chimaeric protein encoded by the recombinant vector to occur.

17. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a chimaeric protein prepared by a process as claimed in claim 16.