CA2038742A1 - Procedure for the detection of pathogens using dna probes - Google Patents
Procedure for the detection of pathogens using dna probesInfo
- Publication number
- CA2038742A1 CA2038742A1 CA002038742A CA2038742A CA2038742A1 CA 2038742 A1 CA2038742 A1 CA 2038742A1 CA 002038742 A CA002038742 A CA 002038742A CA 2038742 A CA2038742 A CA 2038742A CA 2038742 A1 CA2038742 A1 CA 2038742A1
- Authority
- CA
- Canada
- Prior art keywords
- dna
- pathogen
- detection
- sequence
- hybridization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
Abstract:
Disclosed are novel methods by which a rapid, multisample, non-radioactive procedure to detect pathogens, such as Plasmodium flaciparum parasites, in biological fluids including human blood samples is achieved. The detection is bases on the use of parasite specific DNA probes and sandwich hybridization technique employing microtitre plates. The high sensitivity and specificity of these assays and the ease with which they can be performed enables on to use them for routine analyses of a large number of blood and other coloured tissue samples of vertebrates and invertebrates.
Especially, these assays can be used to detect the presence of P.falciparum. The procedure described is amenable for application in a wide variety of DNA detection analysis using non radioactive DNA probes. In regard to detection of P.falciparum, the invention also relates to novel DNA
fragments and hybridisation probes based on such fragments.
The invention provides a diagnostic kit on the basis of the novel methods.
Disclosed are novel methods by which a rapid, multisample, non-radioactive procedure to detect pathogens, such as Plasmodium flaciparum parasites, in biological fluids including human blood samples is achieved. The detection is bases on the use of parasite specific DNA probes and sandwich hybridization technique employing microtitre plates. The high sensitivity and specificity of these assays and the ease with which they can be performed enables on to use them for routine analyses of a large number of blood and other coloured tissue samples of vertebrates and invertebrates.
Especially, these assays can be used to detect the presence of P.falciparum. The procedure described is amenable for application in a wide variety of DNA detection analysis using non radioactive DNA probes. In regard to detection of P.falciparum, the invention also relates to novel DNA
fragments and hybridisation probes based on such fragments.
The invention provides a diagnostic kit on the basis of the novel methods.
Description
) 7 l~ ~
Disclosed are no~l method3 by which ~ rapid, multisample, non-radioactive procedure to detect pathogons, 3uch as Plasmodium falciparum paxa~itas, in biological fluid~
insluding human blood samples i~ achieved. Th~ detection i8 based on the use o~ parasite speci~ic DNA probe~ and sandwich hybridization ~echnique employing ~icrotitre plate~. The high sensitivity and specificity of these assays and the ease with which they can be performed enable one to use them for routine analyses o~ a large number o~ blood and other coloured tissu~ samples o~ vertebrates and invertebrates.
E~pecially, these assays can bc u~ed to detect th~ presence of P.falciparum. The procedure described is amenable for application in a wide variety o~ DNA detection analysis using non radioactive DNA probes. In regard to d~tection of P.falciparum, the invent~on also relates to novel DNA
~ra~ments and hybridisation probes based on such fragments.
The in~ent.ion provides a diagnostic kit on the basis of the novel methods.
t 2~7 ~1~
~AC~RO~ND 0~
~alaria i~ caus~d by protozoan parasiteu b~longing to the genus Pla~modiu~. Th2 li~ cyale o~ ~he paras~te occurs in two phase~ - th~ a~exual pha~ ln v~rtebrates and th~ sexual phase in mos~uito (usually o~ the genus ~nophsles)O The ~our species of Plasmodium respon~ible f~r human malaria are P.falciparum, P.vivax, PJmalarias and P.ovale. ~mong these, the first two are the most common. P.~alciparum causes the most severe form of malaria which in S0~3 instances is fatai.
Furthermore, this parasite al~o develops re3i~tance to tha commonly used antimalarial drugs.
The current method of diagnosis of ~alaria i~ by blood smear examination. This method is laborious and also reguires expertise. Further, a skilled microscopi~t i8 allowed to examine a maximu~ of sixty slides a day. Diagnosis by serology may also be done, but becaus~ o~ the persistence of antibodies current infections cannot be distinguished ~rom past infections(l). Hence, the search for a new generatior. of diagnostic tests has included the possibility of detectin~
parasite nucleic acids as indicative of the presence of the parasite. Theoretically such a test should reguire very little blood (5-50 ul) that can be obtained from a ~inger prick, and should be sensitive and rapid. As few as 50 parasites in 10 ul of blood can be detected by nucleic acid hybridization (2). Hundreds of samples can be analyzed in a 2 ~ 3 ~ 2 day w~h 80m~ initlal tralning. Th~ sen~ltiY~y oP ~h0 a~y enablea ~ho test to b~ UBed ln blood b~n~ Por the ~creening o~ blood to bQ u~ed ~or trans~u~lon.
Nucl~lc acid hybridizat~on could also be per~or~ed ~n lnsect tissue samples in order to id~nti~y th~ ve~tor sp~cia~ a~ ~
carrior. Such in~ormation would help to inte~ y vector control ~easures in order to limit the geog~aphic ~pread o~
malaria. Alternatively, chemoprophylaxi~ ~ay b~ ~doptsd ~n suc~ areas and evaluatlon o~ thi~ strategy ~ay be accomp-lished using nucleic acid hybridization. Tha procedure describ~d in this patent appl~c~t$on provid~s an e~ic~ent means of accomplishing parasit~ detection us1ng nu~leic acid hybr$dization technique~.
The detection method described by the present invention can be used generally to detect the presence of pathogens in blood, tissues, samples and body fluids of humans ~s well as of vertebrates and invertebrates in general such ~s cattles and insects.
The said pathogens may De e.y. bacteria, viru. and parasites such as of the Plasmo~ium genus especially P.falciparum and P.vivax.
As further examples of patho~ens can be mentioned Shigella, e.g.
Shigella flexneri, Shigella dysenteriae, Shigell~ sonnei, and Mycobacterium tuberculosis.
~3~7i~
Althoug~ the ~pQcific exa~ple~ ln the present appllcation relata to P.~lc~parum, it wlll be under~tood that the detect~on method i~ gonerally applica~le as outlinsd abov~.
PRIOR ART
Nucleic acid (DNA and RNA) ba~ed hy~ridisation ~8 now being used in a numbar of clinical diagno~i~. Initially thi~
technology utilised radioactively labelled probes. Though the sensitivity of the diagnosis in th~ radioactive format is satisfactory this method i5 not popular in the clinical laboratories owing to the precaution~ and regulations necessary in radioactive material hanaling. Hence there is an urgent need for non ladioactive detection in th~s field o~
pathogen detection by nucleia acid hy~ridisation~ One of the most popular method of non isotopic detection is ba~ed on the incorporation of biotin enzymatically (3) or photochemically into the nucleic acid probes (4). The hybrid~ that bind the biotin labelled probes can then be easily detected with complexes of avidin or streptavidin a~d .suitable enzy~es like phosphatase or peroxidase. Tho~gh the above mentioned non isotopic method looks attractive it has llot been yet popular. A few important problems remain to be solved. The major problems relate to the colsured background and the state of purity of the target ~JA. Most DNA based diagnostics are done on membrane filter~ (either nitrocellulose or nylon). Body ~luids like blood which are ~ ~ 3'~
to be tested ~or th~ pxe3encQ o~ pathogen~ wh~n ~p~tted directly on the me~b~ane ~llt~r to i~moblll~ ~he D~ 'e~v0 an indell~le coloured mark whlch ~aka~ the sub3eguent aolour developm~nt after hybridi~ation ~1~08t lmpo3~iblo. T~u~ the only alt2rnative left i~ potting pure DNA ob~aln~d ~rom the pathogens that are present in thQ ti~SU~ or body fluid.
Since isolation of ~NA involves a procedure which includes centrifugation and precipitation, it severely curtall~ the feasibility of a r~pid multisampla diagnosis. For a preferable diagnostic procedure based on nuclei~ acid hybridisation the following conditions are essential.
E8BE~NTIAL~ OF A 1;001:~ 1)~ BA8~D N~JLTI~a~lPI~ DI~IO~IC
P~OCl~I)U~.
1. It should be based Qn non radioactive detection 2. It should use small amount of blood (a drop fro~ a finger prick).
Disclosed are no~l method3 by which ~ rapid, multisample, non-radioactive procedure to detect pathogons, 3uch as Plasmodium falciparum paxa~itas, in biological fluid~
insluding human blood samples i~ achieved. Th~ detection i8 based on the use o~ parasite speci~ic DNA probe~ and sandwich hybridization ~echnique employing ~icrotitre plate~. The high sensitivity and specificity of these assays and the ease with which they can be performed enable one to use them for routine analyses o~ a large number o~ blood and other coloured tissu~ samples o~ vertebrates and invertebrates.
E~pecially, these assays can bc u~ed to detect th~ presence of P.falciparum. The procedure described is amenable for application in a wide variety o~ DNA detection analysis using non radioactive DNA probes. In regard to d~tection of P.falciparum, the invent~on also relates to novel DNA
~ra~ments and hybridisation probes based on such fragments.
The in~ent.ion provides a diagnostic kit on the basis of the novel methods.
t 2~7 ~1~
~AC~RO~ND 0~
~alaria i~ caus~d by protozoan parasiteu b~longing to the genus Pla~modiu~. Th2 li~ cyale o~ ~he paras~te occurs in two phase~ - th~ a~exual pha~ ln v~rtebrates and th~ sexual phase in mos~uito (usually o~ the genus ~nophsles)O The ~our species of Plasmodium respon~ible f~r human malaria are P.falciparum, P.vivax, PJmalarias and P.ovale. ~mong these, the first two are the most common. P.~alciparum causes the most severe form of malaria which in S0~3 instances is fatai.
Furthermore, this parasite al~o develops re3i~tance to tha commonly used antimalarial drugs.
The current method of diagnosis of ~alaria i~ by blood smear examination. This method is laborious and also reguires expertise. Further, a skilled microscopi~t i8 allowed to examine a maximu~ of sixty slides a day. Diagnosis by serology may also be done, but becaus~ o~ the persistence of antibodies current infections cannot be distinguished ~rom past infections(l). Hence, the search for a new generatior. of diagnostic tests has included the possibility of detectin~
parasite nucleic acids as indicative of the presence of the parasite. Theoretically such a test should reguire very little blood (5-50 ul) that can be obtained from a ~inger prick, and should be sensitive and rapid. As few as 50 parasites in 10 ul of blood can be detected by nucleic acid hybridization (2). Hundreds of samples can be analyzed in a 2 ~ 3 ~ 2 day w~h 80m~ initlal tralning. Th~ sen~ltiY~y oP ~h0 a~y enablea ~ho test to b~ UBed ln blood b~n~ Por the ~creening o~ blood to bQ u~ed ~or trans~u~lon.
Nucl~lc acid hybridizat~on could also be per~or~ed ~n lnsect tissue samples in order to id~nti~y th~ ve~tor sp~cia~ a~ ~
carrior. Such in~ormation would help to inte~ y vector control ~easures in order to limit the geog~aphic ~pread o~
malaria. Alternatively, chemoprophylaxi~ ~ay b~ ~doptsd ~n suc~ areas and evaluatlon o~ thi~ strategy ~ay be accomp-lished using nucleic acid hybridization. Tha procedure describ~d in this patent appl~c~t$on provid~s an e~ic~ent means of accomplishing parasit~ detection us1ng nu~leic acid hybr$dization technique~.
The detection method described by the present invention can be used generally to detect the presence of pathogens in blood, tissues, samples and body fluids of humans ~s well as of vertebrates and invertebrates in general such ~s cattles and insects.
The said pathogens may De e.y. bacteria, viru. and parasites such as of the Plasmo~ium genus especially P.falciparum and P.vivax.
As further examples of patho~ens can be mentioned Shigella, e.g.
Shigella flexneri, Shigella dysenteriae, Shigell~ sonnei, and Mycobacterium tuberculosis.
~3~7i~
Althoug~ the ~pQcific exa~ple~ ln the present appllcation relata to P.~lc~parum, it wlll be under~tood that the detect~on method i~ gonerally applica~le as outlinsd abov~.
PRIOR ART
Nucleic acid (DNA and RNA) ba~ed hy~ridisation ~8 now being used in a numbar of clinical diagno~i~. Initially thi~
technology utilised radioactively labelled probes. Though the sensitivity of the diagnosis in th~ radioactive format is satisfactory this method i5 not popular in the clinical laboratories owing to the precaution~ and regulations necessary in radioactive material hanaling. Hence there is an urgent need for non ladioactive detection in th~s field o~
pathogen detection by nucleia acid hy~ridisation~ One of the most popular method of non isotopic detection is ba~ed on the incorporation of biotin enzymatically (3) or photochemically into the nucleic acid probes (4). The hybrid~ that bind the biotin labelled probes can then be easily detected with complexes of avidin or streptavidin a~d .suitable enzy~es like phosphatase or peroxidase. Tho~gh the above mentioned non isotopic method looks attractive it has llot been yet popular. A few important problems remain to be solved. The major problems relate to the colsured background and the state of purity of the target ~JA. Most DNA based diagnostics are done on membrane filter~ (either nitrocellulose or nylon). Body ~luids like blood which are ~ ~ 3'~
to be tested ~or th~ pxe3encQ o~ pathogen~ wh~n ~p~tted directly on the me~b~ane ~llt~r to i~moblll~ ~he D~ 'e~v0 an indell~le coloured mark whlch ~aka~ the sub3eguent aolour developm~nt after hybridi~ation ~1~08t lmpo3~iblo. T~u~ the only alt2rnative left i~ potting pure DNA ob~aln~d ~rom the pathogens that are present in thQ ti~SU~ or body fluid.
Since isolation of ~NA involves a procedure which includes centrifugation and precipitation, it severely curtall~ the feasibility of a r~pid multisampla diagnosis. For a preferable diagnostic procedure based on nuclei~ acid hybridisation the following conditions are essential.
E8BE~NTIAL~ OF A 1;001:~ 1)~ BA8~D N~JLTI~a~lPI~ DI~IO~IC
P~OCl~I)U~.
1. It should be based Qn non radioactive detection 2. It should use small amount of blood (a drop fro~ a finger prick).
3. Most of the çomponents used ~n the diagnostic kit should be stable at room temp~rature.
4. Exact micropipeting o. individual components should be avoided.
5. Centrifugation and precipitation steps should be avoided.
6. It should requlre minimum train~ng for successful operation.
By the present invention a detection method is provi~ed which fulfills all these criterLa~
T~.e pr~sent invantion 18 ~mm~rl~d ln the ~ollowing clau~es~
1. A ~ingl~ ~trand~d DNA ~ragmsnt (~3) hav~ng th~ 3e~uenc~
gl~en he~ow :
AGGTCTT~TGACTAACrAA>CTTAAC~AACTAACTTAGGTCTTACT$T~ACTAAAC~
or it~ compli~entary strand or the corr~ponding double stranded sequence, It i~ pre~rred to U8~ thQ ~ingle stran~ed ~NA.
2. .~ DNA fragment as defined by clause 1 or contiguous seg~ent th~reof which i~ at least greater than 20 basQa or base p~irs in length.
3. ~ ~NA fragment according to clauses 1 or 2 in single stranded form.
4. A hybridization probe comprising a D~A fragment as define~l in clause 1 and 2.
5. A hybridization probe accor~in~ ~o clause 4 which i~
labelle~l hy a group capable of colo~lri~net.ric detecti onO The na~ure cf t:his group is not critical for . hi~ invention.
6. R hybridi~ation probe according to clausQ 5 wherein the .abelle~ group ~or colourimetric detection is biotin. Biotin is a p~eferred reporter group.
By the present invention a detection method is provi~ed which fulfills all these criterLa~
T~.e pr~sent invantion 18 ~mm~rl~d ln the ~ollowing clau~es~
1. A ~ingl~ ~trand~d DNA ~ragmsnt (~3) hav~ng th~ 3e~uenc~
gl~en he~ow :
AGGTCTT~TGACTAACrAA>CTTAAC~AACTAACTTAGGTCTTACT$T~ACTAAAC~
or it~ compli~entary strand or the corr~ponding double stranded sequence, It i~ pre~rred to U8~ thQ ~ingle stran~ed ~NA.
2. .~ DNA fragment as defined by clause 1 or contiguous seg~ent th~reof which i~ at least greater than 20 basQa or base p~irs in length.
3. ~ ~NA fragment according to clauses 1 or 2 in single stranded form.
4. A hybridization probe comprising a D~A fragment as define~l in clause 1 and 2.
5. A hybridization probe accor~in~ ~o clause 4 which i~
labelle~l hy a group capable of colo~lri~net.ric detecti onO The na~ure cf t:his group is not critical for . hi~ invention.
6. R hybridi~ation probe according to clausQ 5 wherein the .abelle~ group ~or colourimetric detection is biotin. Biotin is a p~eferred reporter group.
7. A hybridization probe according to clause 5 wherein the labelled group for colourimetric detection is a chro~ophoric reporter group.
8. A method for detecting a pa~hogsn present in blood or other body fluid comprising of the fo'lowing 8tep8:
a) Lysing a blood sample in a solution containing Guanidine hydrochloride (GuHCl), Sodium lauryl sareos~n~ (SLS) and Triton~ 100*
b) Denaturing the DNA present in the said blood sample suitably by heating and performing solution hybridization in presence of a hybridization probe which hybridizes with DNA
of t:he said pathogen.
*Trade-mark ~s~71~r~
c~ C~pturing th~ hybrids ~or~d in ~tep 8 ~b) in ~icro~ltre pl~te co~ted wit~ ~ hybridiz~tion pro~ which ha~
a nuclaotido ~equ~nce ~ap~bl~ o~ hybrldi~ing to th~ ~ame strand of gsno~ic DNA ~bat ~he hybridzat~on prob~ U~9~ ~n ~tap n (b) binds. In a pre~erred embodi~nt, s~peaiAlly ~or detec~icn o~ ~r~lçl~Lg~, the nualeotld~ sequence u~d ln coatin~ the microtlter plata i~ identical to ~he ~equenc~ o~
the hybridization probe us~d in ~tep 8(b~.
d) Washing the microtitre plate with ~ solution comprising Standard Sallne Citr~te (S~C~, Sodiu~ dodecyl Sul~ate ~SDS) and Triton-X-100.
e) Detection of the presence of th~ hybrids by colourimetric methods~
a) Lysing a blood sample in a solution containing Guanidine hydrochloride (GuHCl), Sodium lauryl sareos~n~ (SLS) and Triton~ 100*
b) Denaturing the DNA present in the said blood sample suitably by heating and performing solution hybridization in presence of a hybridization probe which hybridizes with DNA
of t:he said pathogen.
*Trade-mark ~s~71~r~
c~ C~pturing th~ hybrids ~or~d in ~tep 8 ~b) in ~icro~ltre pl~te co~ted wit~ ~ hybridiz~tion pro~ which ha~
a nuclaotido ~equ~nce ~ap~bl~ o~ hybrldi~ing to th~ ~ame strand of gsno~ic DNA ~bat ~he hybridzat~on prob~ U~9~ ~n ~tap n (b) binds. In a pre~erred embodi~nt, s~peaiAlly ~or detec~icn o~ ~r~lçl~Lg~, the nualeotld~ sequence u~d ln coatin~ the microtlter plata i~ identical to ~he ~equenc~ o~
the hybridization probe us~d in ~tep 8(b~.
d) Washing the microtitre plate with ~ solution comprising Standard Sallne Citr~te (S~C~, Sodiu~ dodecyl Sul~ate ~SDS) and Triton-X-100.
e) Detection of the presence of th~ hybrids by colourimetric methods~
9. A method according to clause 8 wherein the hybridization probe is as defined in Clause 2 and 3. In a preferred aspect the invention is used in the detection of plasmodial species.
10. A method according to clause 8 and 9 wherein th~ ~inal concentration Or the reagents in step 8 (a) ars as ~ollow~ :
a) Guanidine hydrochloride : Between 1.0~ - 3.OM
b) Sodiu~ lauryl sarcosin~ : Between 0.2% - 0.5~ W/v / N/v c) Triton-X-100 : Between 0.2% - 0.5~ v/v / v/v The above represent preferred interval~
a) Guanidine hydrochloride : Between 1.0~ - 3.OM
b) Sodiu~ lauryl sarcosin~ : Between 0.2% - 0.5~ W/v / N/v c) Triton-X-100 : Between 0.2% - 0.5~ v/v / v/v The above represent preferred interval~
11. A method according to clause~ 8 and 9 wherein the ~inal concentration in ~tep ~ ~e) are a~ follow~ .
a) Standard Saline Citrate - 0.5 X - 2.5 X SSC
b) Triton-X-100 - 0.2% - 0.5% V/V
c) Sodium dodecyl S~lphat.e - 0.2% - 0.5% W/V
The above represent preferred intervals.
a) Standard Saline Citrate - 0.5 X - 2.5 X SSC
b) Triton-X-100 - 0.2% - 0.5% V/V
c) Sodium dodecyl S~lphat.e - 0.2% - 0.5% W/V
The above represent preferred intervals.
12. A method according to clause 8-1 wherein the lysing solution is used both as a solubilising agent and as hybridization solution.
2 ~ ~3(J
2 ~ ~3(J
13. A ~othod accord~n~ to cle~ 8 to 12 wher~in 2X ~C 1 u~d to ~omoY~ ~on~p~ci~i¢ ~ybrl~.
1~. A ~sthod accQrding to ol~u~ 8 an~ 14 wh~ln ~rlton-x-100 and 8D~ ~r~ u~o~ ~or t~ re~o~al o~ t~ ¢olour~n~
~at~ri~l orl~lnati~g ~ro~ th~ blood.
15. A ~ethod according to ~1~U~Q~ 8 to 1~ wher~ln the pathogen i8 P.~alclpa~un.
16. A msthod sccord~ng to clau es 8 to 14 whorein the pathogen is P.vivax.
17. A method according to clauses 8 to 14 wherein the pathogen is Shigella.
18. A method according to clauses 8 to 14 wherein the pathogen is Mycobacterium ~uberculosis.
19. A diagno.stic kit for the detection of a given nucleotide sequence prescnt ir. a target polynucleotide sequence on the basis of the method accc.rding to clauses 8 to 18.
2 ~ 3 J 'J li ~
239~0~683 In drawings which illustrate embodiments of the invention, Figure 1 shows the oligo f63 that was designed from the consensus repeated sequence (21 base repeat) of P-falciparum, Figure 2 shows the steps of DNA bases sandwiched hybridization as follows:
A: Solution hybridization.
B: Depicts microtitre well coated with the probe f63.
C: Capture hybridization.
D: Capture hybrids after washing and ready for colour development~
and Figure 3 gives a key to active elements illustrated in Figure 2 as follows:
A: biotinylated f63 DNA
B: genomic P.falciparum DNA
C: f63 DNA
- 9a ~ ~ 3 ~ 3~
~RI~ h~ Na ~8~D ~A~D~C~ $~Ig~IO~
Background:
In the non radioactivQ ~orm~t the Pinal ~ode o~ detsct~on i~
the d~velopment o~ a colour eithQr soluble or in~oluble depending on the nature of the substrate used in the reaction catalysed by eith~r alkaline phosphatase or horse radish peroxidase.Therefore it is essential to remove the residual coloured material from the target DNA as W811 as inactivating the endogenous enzyme. This ~akes spotting blo~d directly cnto membrane ~ilters (as i~ done in th~ radioactive ~.ybridisation format) useless ~ince the removal of residual blood stains from the filter i8 almoAt ~possible.To circumvent this problem we have used the ~icrotitr~ plate format coupled with sandwich hybridisation, the basic principle of which is described below.
It has been shown earlier that one o~ the characteristics of t P.falciparum genome is that it contains a 21 base pair repeat ~hat is present in tandem in a lar~e region of the genome (5-6). The fraction of the genome represented by this repeated sequence is about 1%. Comparisons of several clones containing this repeat sequence have indicated a consensus 21 base pair repeat sequence. Based on this consensus sequence ~0 2 i~3 t.,~ ~J ~ ~ 2 W8 hava design0d and con~tructed a 63 ~er ollgonucl~otida probe (ds~iqnated ~63 hQrea~t~r)~ It con~lsts o~ three 21 ~r~ in tandQ~ whlch ~r~ ~ax~lly r~pre~ent~d i~ th~
repeat~d 3eguence~ o~ th~ P.~alcip~ru~ DNA (~g.l). m e preferred U8e 0~ single ~trandad DN~ a~ ~ probe an~ ~t~ ~a~d lenqth is based on the ~ollowing reasoningc ~ingle stranded DNA is superior to double stranded as a probe becau~e lt hybridise3 only to the target DNA. In cass of double stranded DNA there is a greater probability of sel~ hybridisation thu~
reducing the effective concentration of the prv~e that i8 required to bind the target DNA. This clearly establishes the superiority of the single stranded probe in its cost effectiveness as it is required in a much lower amo~nt for hybridisation. 0~ the several methods that are availabie to make single stranded DNA, oligonucleotide ~ynthesis is most convenient.
For detection of pathogens other than P.falcipa~umc oe has to design an optimal DNA probe which i8 repeat~d in the pathogen DNA. This hybridization probe can th~n be used in a similar detection protocol of sandwich hybridization which is given below specifically for P.falciparum.
The basic protocol for the sandwich hybridisation is given below.( Also explained pictorially in Fig.2 2~ 3~
c~a~ O~C~IVB DI~ 8~ oa~
I~a3rl3~r~o~ Ill ~ B~OOD ~ ~AalD~I~ }~3RID~A~0211 Add ons drop og~ blood sampl~ (50 ul) Pro~ nger prick in a small pla~tic: tUb2 conta~ining I.y~ing sQlutioJ2 and bio-f63 probQ
( $) ~ix well Phase 1 (ii) Heat in E~oiling water bath ~or two min~te~
( i i i ~ Leave at roola tempexatura ~ r fs~r a ~ini~um o~ our hours Para~3ite DNA-bio-f 63 probe hybr~ ~1 See Fig.2. Plate A
~i) Trans~er the mixtur~ from the t~ :~r. Phase 1 to w~lls in ~ rotitr~ plate~ precoated with unl akelled ~-63 probe Phase 2 (See Fig. 2. Plate B) ~ii) Allow to s~nd at rooD~
~ temperatur~ ~or overnigh'c.
CAPTURED
HYBRI D
See Fig.2. Plate C
(i) Wash microtitre plate wells frGm phase 2 with 2 x SSC
con ain n~ 0.2% SDS and 0.2%
Triton ~ lOO
Phase 3 (ii~ Repsat wash procedure four times c-ach time let stand wash }~ufler for 5 ~inutesO
(iii) Let stand in each well APB-l solu~ion for 30 minutes at room tenlp2rature.
(iv) Add one drop o~ APB-l contain~ng streptavidin Alkalir,~ phosphatase conjugate.
(v) Let stand ~or 30 minute~ at roo~ te~p~rature.
.
.
.
7 ~
I (Yi) D~3card ~olution ln th~ W8118.
Phase 4 1 ~vli) L~t ~tan~ APB-l solution (without B~A~ in ~h w~ or 5 ~inut~a and di~c~r~ ~olution.
!~iii) Repe~t abo~e op~ration ~our t~
Captured hybrid ~ix~ ~in~ each well w$th APB-2 ready for solution.
detection by colorimetry ~x) ~dd enzy~e sub~trate in AP~-2 ~olution.
Fig.2 Plate D
(xi) Let stand at room te~p~rature ~or atlea~t 120 minutes.
~xii) ~ead absorbancy at 410 nm in ~ microtitre plate reader.
., ~ r ~olour with absorbancy Phase 5 ~al~es higher ~han 0.2 ~ denote~ presence of Analysis of ~ par~s.i~e TQXt Result~ ~ Absence of parasite DNA sho~ld giv~ an absor~ancy value of less than o.l The success of this ~ethod depends on the ~act t~t P.falciparum DNA remains nearly undegraded duri~g the process.In the sol~tion hybridisation step biotinylated f6~
binds to P.falciparu~ D~A and would proceed to near completion, the rat~ of solution hybridisation being much , ~'~3$~2 ~a3ter when co~pared to ~mobill3~d target DNA. Th~
a~ficiency o~ c~ptur~ hybridi~at~on 1~ directly proportional to tha lQngth o~ ~h~ P.~aloipaxu~ DNA. In th~ ~xtro~e li~lt it can be ~een th~t i~ the P.~lc~paru~ DNA 18 ~ot~lly undegraded then even a ~eagr2 0~03~ o~ captu~e hybridisation can bring do~n all the hybrid complex.
In the ~a~a of other pathogen~, ~he e~ficiency o~ capture hybridiz~tion will depend on the number oP time~ the probe i~
repeated in the pathogen gencme.
239~0-683 ~OTOC~ ~0~ ~O~-IBO~O~Ia D~CT~0~ 0 ~t.oo~ aa~
1. Preparation o~ the probQ:
The pro~e for coating ~h~ mic,rotitre plata~: The 63 ~er oligonucleotida( f63 ) was syn~he~ised u~ing the automated DNA synthesi~r(Appli~d Biosyste~ 340A).
LabelQd probe ~or detectlng the th~ hybrid~: Biotlnylation of f63 was done by photobiotinylation using photobiotin a~etate according to published procedures.
2.Coating of microtitre plates:
All the wells in the microtitrQ plate ~Dynatech, Polyvinyl chloride) are coated with varying amounts(luq to lOng) o~ ~-53 in 50 ul vol~m~ contalnins 0.1 ~ ~gC12~ The coatinq is done overnight following whi.ch the ~icrotitre plate is exposed under germicidal W lamp ~40 watts) at a di~tanc~ of 10 cms, for 5 minutes to immobilise DNA. T~Q contents o~
~he wells are discarded subsequently and the wells are washed with 2X SSC buffer. Unoccupied sites site~ in each of the ~ells are blocked by carrying out prehybridisation in a buffer (200 ul/well) containing 2X SSC, 5X Denhardts, 0.5%
Triton-X-100, 0.5% SDS and 5n ugJml salmon sper~ DNA. The prehybridisation is carlied ~ut for 4-6 hours at room temperature. The coated plates can be stored at this stage in room temperature *Trade-mark 3. Coll~ction o~ ~lo~d ~ample8 ~nd ~o~u~ion hybrldl~tlon:
Blood ~a~ple~ (50 ul aliquot~) ~ro col~0ct~d gro~ ~ ~inqer prick, dlrectly into 50 ul oY a ~olutlon contalning 4 guanidine hydrochlor~de (Gu ~Cl), 0.5% ~odlu~ lauryl sarcosine (SLS) and 0.5~ Triton-X-lOO. Thi~ ~olution ~180 contain 5 n~ of oligonucleotide probe (biotinyla~ed ~-63).
This mixture i heated ~or 5 minutes at 95 dag C and then kept at room temperatur~ for 4-6 hour~ for the solution hybridisation to o~cur.
4. capture hybLidisation:
After solution hybridisat~on i~ over, the contents o~ the eppendorf tubes are transferred into the w0118 of th~
microtitre plate that are precoated with unlabelled f-63.
This sandwich hybridisation(captur~) is allowed to go ~or 24 hours. During tnis phass, hybrid~sation occur~ between the f-63 coated onto the plate and the rest G~ the complementary sites available in the hybrid. The hybrid is a long piece of target DNA carrying the biotinylated f-63 i~ certain locations leaving behind other complementary sites. ~See Fig~ 2).
5. Colour development:
After the san~wich hybridisation is over, the contents of the wells o~ the microtitre plate are discarded and wells are washed with a solution containing 2x Ssc, 0.2% SDS and 0.2%
~iJ~ 3tl~, Triton X-100, ~our tl~0~, ~ivo ~inut~ each ~t roo~
te~perature, During thla post hybridl~atlon wash, ~11 the coloured mat2rial5 are removed leav~ng behind the san~wlch hybrid. The well~ axe then blocX~d ~ith A.P 7.5 whlch i~ ~
~olution conta$ning 1~ NaCl, 100 ~ Tris-cl pH 7.5, 2 mM
~gC12, O.OS% Triton-X-100 and 3% BSA, for 30 mi~utes at roo~
temperature.
sandwich hybrid~ are then detected by using ~or exa~ple, Streptavidin-alkaline phosphatase con~ugate. The Streptavidin al~aline phosphatase con~ugate(l ug/~13 i3 added to A.P 7.5 buffer. 50 ul of t~i8 801ution (~P 7.5 buf~er containing streptavidin alkaline phosphatase) 18 added to each well and incubation continued ~or another 30 minute~ at room temperature. The exce~ unbound con~ugate ~s removed by washing four time~, five minutes each, at room te~perature with A.P 7.5 buffer without BSA.
Finally the wells are rinsed with A.P 9~5(substrate inc~bation buf~er containing lOOm~ Tris-Cl pH 9.5, 100 mM
NaCl and 50 mM MgC12). 50 ul of the substrate p-nitrophenyl i phosphate is added to A.P 9.5 at a concentration of lmg/ml and 50 ul of this solution is added to each well. The color ~evelopment is allowed to take place for 6-12 hours. The absor~ance (at 410 n.m.) are recorded, using a suitable plate reader( e.g. Dynatech plate reader).
The Te~t re~ult~ ar~ given ln tha ~ollowlng tabl~.
~ESULTS
(Ab~orbance at 410 m~
. .
Amount of parasite DNA ~mount ~ ~Ç~ çoated Q~ ~ic~b~te~la (T9/106* DNA) , ~
1 ug 500 ng 100 ng 10 ng 500 ng over over over over 2 5 0 ng ~ n 1~ n 12 5 n-3 " n 1~ n 6 3 ng " ~ n ~
31 ng n n n n 16 ng " ~ n 1 . 52~
~.5 ng 1.511 1.242 1.373 0.92g __________________________________________________________ 1 ug û.291 0.295 0.263 0.214 Human DNA
* T9/106 represent a chloroquine resistant P. falcipar.um clone.
Note : In human samples 50 ul of blood has about ~Onct of parasite (P. falciparum) DNA if the infection is about l~s .
The term "over" indicates an optical density above 2 . o.
1~. A ~sthod accQrding to ol~u~ 8 an~ 14 wh~ln ~rlton-x-100 and 8D~ ~r~ u~o~ ~or t~ re~o~al o~ t~ ¢olour~n~
~at~ri~l orl~lnati~g ~ro~ th~ blood.
15. A ~ethod according to ~1~U~Q~ 8 to 1~ wher~ln the pathogen i8 P.~alclpa~un.
16. A msthod sccord~ng to clau es 8 to 14 whorein the pathogen is P.vivax.
17. A method according to clauses 8 to 14 wherein the pathogen is Shigella.
18. A method according to clauses 8 to 14 wherein the pathogen is Mycobacterium ~uberculosis.
19. A diagno.stic kit for the detection of a given nucleotide sequence prescnt ir. a target polynucleotide sequence on the basis of the method accc.rding to clauses 8 to 18.
2 ~ 3 J 'J li ~
239~0~683 In drawings which illustrate embodiments of the invention, Figure 1 shows the oligo f63 that was designed from the consensus repeated sequence (21 base repeat) of P-falciparum, Figure 2 shows the steps of DNA bases sandwiched hybridization as follows:
A: Solution hybridization.
B: Depicts microtitre well coated with the probe f63.
C: Capture hybridization.
D: Capture hybrids after washing and ready for colour development~
and Figure 3 gives a key to active elements illustrated in Figure 2 as follows:
A: biotinylated f63 DNA
B: genomic P.falciparum DNA
C: f63 DNA
- 9a ~ ~ 3 ~ 3~
~RI~ h~ Na ~8~D ~A~D~C~ $~Ig~IO~
Background:
In the non radioactivQ ~orm~t the Pinal ~ode o~ detsct~on i~
the d~velopment o~ a colour eithQr soluble or in~oluble depending on the nature of the substrate used in the reaction catalysed by eith~r alkaline phosphatase or horse radish peroxidase.Therefore it is essential to remove the residual coloured material from the target DNA as W811 as inactivating the endogenous enzyme. This ~akes spotting blo~d directly cnto membrane ~ilters (as i~ done in th~ radioactive ~.ybridisation format) useless ~ince the removal of residual blood stains from the filter i8 almoAt ~possible.To circumvent this problem we have used the ~icrotitr~ plate format coupled with sandwich hybridisation, the basic principle of which is described below.
It has been shown earlier that one o~ the characteristics of t P.falciparum genome is that it contains a 21 base pair repeat ~hat is present in tandem in a lar~e region of the genome (5-6). The fraction of the genome represented by this repeated sequence is about 1%. Comparisons of several clones containing this repeat sequence have indicated a consensus 21 base pair repeat sequence. Based on this consensus sequence ~0 2 i~3 t.,~ ~J ~ ~ 2 W8 hava design0d and con~tructed a 63 ~er ollgonucl~otida probe (ds~iqnated ~63 hQrea~t~r)~ It con~lsts o~ three 21 ~r~ in tandQ~ whlch ~r~ ~ax~lly r~pre~ent~d i~ th~
repeat~d 3eguence~ o~ th~ P.~alcip~ru~ DNA (~g.l). m e preferred U8e 0~ single ~trandad DN~ a~ ~ probe an~ ~t~ ~a~d lenqth is based on the ~ollowing reasoningc ~ingle stranded DNA is superior to double stranded as a probe becau~e lt hybridise3 only to the target DNA. In cass of double stranded DNA there is a greater probability of sel~ hybridisation thu~
reducing the effective concentration of the prv~e that i8 required to bind the target DNA. This clearly establishes the superiority of the single stranded probe in its cost effectiveness as it is required in a much lower amo~nt for hybridisation. 0~ the several methods that are availabie to make single stranded DNA, oligonucleotide ~ynthesis is most convenient.
For detection of pathogens other than P.falcipa~umc oe has to design an optimal DNA probe which i8 repeat~d in the pathogen DNA. This hybridization probe can th~n be used in a similar detection protocol of sandwich hybridization which is given below specifically for P.falciparum.
The basic protocol for the sandwich hybridisation is given below.( Also explained pictorially in Fig.2 2~ 3~
c~a~ O~C~IVB DI~ 8~ oa~
I~a3rl3~r~o~ Ill ~ B~OOD ~ ~AalD~I~ }~3RID~A~0211 Add ons drop og~ blood sampl~ (50 ul) Pro~ nger prick in a small pla~tic: tUb2 conta~ining I.y~ing sQlutioJ2 and bio-f63 probQ
( $) ~ix well Phase 1 (ii) Heat in E~oiling water bath ~or two min~te~
( i i i ~ Leave at roola tempexatura ~ r fs~r a ~ini~um o~ our hours Para~3ite DNA-bio-f 63 probe hybr~ ~1 See Fig.2. Plate A
~i) Trans~er the mixtur~ from the t~ :~r. Phase 1 to w~lls in ~ rotitr~ plate~ precoated with unl akelled ~-63 probe Phase 2 (See Fig. 2. Plate B) ~ii) Allow to s~nd at rooD~
~ temperatur~ ~or overnigh'c.
CAPTURED
HYBRI D
See Fig.2. Plate C
(i) Wash microtitre plate wells frGm phase 2 with 2 x SSC
con ain n~ 0.2% SDS and 0.2%
Triton ~ lOO
Phase 3 (ii~ Repsat wash procedure four times c-ach time let stand wash }~ufler for 5 ~inutesO
(iii) Let stand in each well APB-l solu~ion for 30 minutes at room tenlp2rature.
(iv) Add one drop o~ APB-l contain~ng streptavidin Alkalir,~ phosphatase conjugate.
(v) Let stand ~or 30 minute~ at roo~ te~p~rature.
.
.
.
7 ~
I (Yi) D~3card ~olution ln th~ W8118.
Phase 4 1 ~vli) L~t ~tan~ APB-l solution (without B~A~ in ~h w~ or 5 ~inut~a and di~c~r~ ~olution.
!~iii) Repe~t abo~e op~ration ~our t~
Captured hybrid ~ix~ ~in~ each well w$th APB-2 ready for solution.
detection by colorimetry ~x) ~dd enzy~e sub~trate in AP~-2 ~olution.
Fig.2 Plate D
(xi) Let stand at room te~p~rature ~or atlea~t 120 minutes.
~xii) ~ead absorbancy at 410 nm in ~ microtitre plate reader.
., ~ r ~olour with absorbancy Phase 5 ~al~es higher ~han 0.2 ~ denote~ presence of Analysis of ~ par~s.i~e TQXt Result~ ~ Absence of parasite DNA sho~ld giv~ an absor~ancy value of less than o.l The success of this ~ethod depends on the ~act t~t P.falciparum DNA remains nearly undegraded duri~g the process.In the sol~tion hybridisation step biotinylated f6~
binds to P.falciparu~ D~A and would proceed to near completion, the rat~ of solution hybridisation being much , ~'~3$~2 ~a3ter when co~pared to ~mobill3~d target DNA. Th~
a~ficiency o~ c~ptur~ hybridi~at~on 1~ directly proportional to tha lQngth o~ ~h~ P.~aloipaxu~ DNA. In th~ ~xtro~e li~lt it can be ~een th~t i~ the P.~lc~paru~ DNA 18 ~ot~lly undegraded then even a ~eagr2 0~03~ o~ captu~e hybridisation can bring do~n all the hybrid complex.
In the ~a~a of other pathogen~, ~he e~ficiency o~ capture hybridiz~tion will depend on the number oP time~ the probe i~
repeated in the pathogen gencme.
239~0-683 ~OTOC~ ~0~ ~O~-IBO~O~Ia D~CT~0~ 0 ~t.oo~ aa~
1. Preparation o~ the probQ:
The pro~e for coating ~h~ mic,rotitre plata~: The 63 ~er oligonucleotida( f63 ) was syn~he~ised u~ing the automated DNA synthesi~r(Appli~d Biosyste~ 340A).
LabelQd probe ~or detectlng the th~ hybrid~: Biotlnylation of f63 was done by photobiotinylation using photobiotin a~etate according to published procedures.
2.Coating of microtitre plates:
All the wells in the microtitrQ plate ~Dynatech, Polyvinyl chloride) are coated with varying amounts(luq to lOng) o~ ~-53 in 50 ul vol~m~ contalnins 0.1 ~ ~gC12~ The coatinq is done overnight following whi.ch the ~icrotitre plate is exposed under germicidal W lamp ~40 watts) at a di~tanc~ of 10 cms, for 5 minutes to immobilise DNA. T~Q contents o~
~he wells are discarded subsequently and the wells are washed with 2X SSC buffer. Unoccupied sites site~ in each of the ~ells are blocked by carrying out prehybridisation in a buffer (200 ul/well) containing 2X SSC, 5X Denhardts, 0.5%
Triton-X-100, 0.5% SDS and 5n ugJml salmon sper~ DNA. The prehybridisation is carlied ~ut for 4-6 hours at room temperature. The coated plates can be stored at this stage in room temperature *Trade-mark 3. Coll~ction o~ ~lo~d ~ample8 ~nd ~o~u~ion hybrldl~tlon:
Blood ~a~ple~ (50 ul aliquot~) ~ro col~0ct~d gro~ ~ ~inqer prick, dlrectly into 50 ul oY a ~olutlon contalning 4 guanidine hydrochlor~de (Gu ~Cl), 0.5% ~odlu~ lauryl sarcosine (SLS) and 0.5~ Triton-X-lOO. Thi~ ~olution ~180 contain 5 n~ of oligonucleotide probe (biotinyla~ed ~-63).
This mixture i heated ~or 5 minutes at 95 dag C and then kept at room temperatur~ for 4-6 hour~ for the solution hybridisation to o~cur.
4. capture hybLidisation:
After solution hybridisat~on i~ over, the contents o~ the eppendorf tubes are transferred into the w0118 of th~
microtitre plate that are precoated with unlabelled f-63.
This sandwich hybridisation(captur~) is allowed to go ~or 24 hours. During tnis phass, hybrid~sation occur~ between the f-63 coated onto the plate and the rest G~ the complementary sites available in the hybrid. The hybrid is a long piece of target DNA carrying the biotinylated f-63 i~ certain locations leaving behind other complementary sites. ~See Fig~ 2).
5. Colour development:
After the san~wich hybridisation is over, the contents of the wells o~ the microtitre plate are discarded and wells are washed with a solution containing 2x Ssc, 0.2% SDS and 0.2%
~iJ~ 3tl~, Triton X-100, ~our tl~0~, ~ivo ~inut~ each ~t roo~
te~perature, During thla post hybridl~atlon wash, ~11 the coloured mat2rial5 are removed leav~ng behind the san~wlch hybrid. The well~ axe then blocX~d ~ith A.P 7.5 whlch i~ ~
~olution conta$ning 1~ NaCl, 100 ~ Tris-cl pH 7.5, 2 mM
~gC12, O.OS% Triton-X-100 and 3% BSA, for 30 mi~utes at roo~
temperature.
sandwich hybrid~ are then detected by using ~or exa~ple, Streptavidin-alkaline phosphatase con~ugate. The Streptavidin al~aline phosphatase con~ugate(l ug/~13 i3 added to A.P 7.5 buffer. 50 ul of t~i8 801ution (~P 7.5 buf~er containing streptavidin alkaline phosphatase) 18 added to each well and incubation continued ~or another 30 minute~ at room temperature. The exce~ unbound con~ugate ~s removed by washing four time~, five minutes each, at room te~perature with A.P 7.5 buffer without BSA.
Finally the wells are rinsed with A.P 9~5(substrate inc~bation buf~er containing lOOm~ Tris-Cl pH 9.5, 100 mM
NaCl and 50 mM MgC12). 50 ul of the substrate p-nitrophenyl i phosphate is added to A.P 9.5 at a concentration of lmg/ml and 50 ul of this solution is added to each well. The color ~evelopment is allowed to take place for 6-12 hours. The absor~ance (at 410 n.m.) are recorded, using a suitable plate reader( e.g. Dynatech plate reader).
The Te~t re~ult~ ar~ given ln tha ~ollowlng tabl~.
~ESULTS
(Ab~orbance at 410 m~
. .
Amount of parasite DNA ~mount ~ ~Ç~ çoated Q~ ~ic~b~te~la (T9/106* DNA) , ~
1 ug 500 ng 100 ng 10 ng 500 ng over over over over 2 5 0 ng ~ n 1~ n 12 5 n-3 " n 1~ n 6 3 ng " ~ n ~
31 ng n n n n 16 ng " ~ n 1 . 52~
~.5 ng 1.511 1.242 1.373 0.92g __________________________________________________________ 1 ug û.291 0.295 0.263 0.214 Human DNA
* T9/106 represent a chloroquine resistant P. falcipar.um clone.
Note : In human samples 50 ul of blood has about ~Onct of parasite (P. falciparum) DNA if the infection is about l~s .
The term "over" indicates an optical density above 2 . o.
Claims (25)
1. A single stranded DNA fragment (f63) having the sequence:
AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTAACTTTAACTAAACT
or its complimentary strand for the corresponding double stranded sequence.
AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTAACTTTAACTAAACT
or its complimentary strand for the corresponding double stranded sequence.
2. A DNA fragment as defined in claim 1 or contiguous segment thereof which is at least greater than 20 bases or base pairs in length.
3. A DNA fragment according to claim 1 or 2 in single stranded form.
4. A hybridization probe comprising a DNA fragment as defined in claim 1 or 2.
5. A hybridization probe according to claim 4 which is labelled with a group capable of colourimetric detection.
6. A hybridization probe according to claim 5 wherein the labelled group for colourimetric detection is biotin.
7. A hybridization probe according to claim 5 wherein the labelled group for colourimetric detection is a chromophoric reporter group.
8. A method for detecting a pathogen present in blood or other body fluid comprising:
a) lysing a blood sample in a solution containing GuHCl, SLS and Triton-X-100*, b) denaturing the DNA present in the said blood sample and performing solution hybridization in presence of a hybridiza-tion probe which hybridizes with DNA of the said pathogen, c) capturing the hybrids formed in step b) in the said microtitre plate coated with a hybridization probe which has a nucleotide sequence capable of hybridizing to the same strand of genomic DNA that the hybridization probe used in step b binds, d) washing the microtitre plate with a solution com-prising SSC, SDS and Triton-X-100, e) detecting the presence of the hybrids by colour-imetric means.
a) lysing a blood sample in a solution containing GuHCl, SLS and Triton-X-100*, b) denaturing the DNA present in the said blood sample and performing solution hybridization in presence of a hybridiza-tion probe which hybridizes with DNA of the said pathogen, c) capturing the hybrids formed in step b) in the said microtitre plate coated with a hybridization probe which has a nucleotide sequence capable of hybridizing to the same strand of genomic DNA that the hybridization probe used in step b binds, d) washing the microtitre plate with a solution com-prising SSC, SDS and Triton-X-100, e) detecting the presence of the hybrids by colour-imetric means.
9. A method according to claim 8 wherein the denaturing step b) is carried out by heating.
10. A method according to claim 8 wherein the hybridiza-tion probe used in coating the microtitre plate has the same nucleotide sequence as the hybridization probe used in solution hybridization step b).
11. A method according to claim 8 wherein the hybridiza-tion probe is greater than 20 bases or base pairs in length and is in single or double stranded form.
12. A method according to any one of claims 8 to 11 wherein the final concentration of the reagents in step a) is as follows:
* Trade-mark a) Guanidine hydrochloride : Between 1.0M - 3.0M
b) Sodium lauryl sarcosine : Between 0.2% - 0.5% W/V
c) Triton-X-100 : Between 0.2% - 0.5% V/V
* Trade-mark a) Guanidine hydrochloride : Between 1.0M - 3.0M
b) Sodium lauryl sarcosine : Between 0.2% - 0.5% W/V
c) Triton-X-100 : Between 0.2% - 0.5% V/V
13. A method according to any one of claims 8 to 11 wherein the final concentration in step e) is as follows:
a) Standard saline citrate - 0.5 X - 2.5 X SSC
b) Triton-X-100 - 0.2% - 0.5% V/V
c) Sodium dodecyl sulphate - 0.2% - 0.5% W/V
a) Standard saline citrate - 0.5 X - 2.5 X SSC
b) Triton-X-100 - 0.2% - 0.5% V/V
c) Sodium dodecyl sulphate - 0.2% - 0.5% W/V
14. A method according to any one of claims 8 to 11 wherein the lysing solution is used both as a solubilising agent and as hybridization solution.
15. A method according to any one of claims 8 to 11 wherein 2X SSC is used to remove nonspecific hybrids.
16. A method according to any one of claims 8 to 11 wherein Triton-X-100 and SDS are used for the removal of the colouring material originating from the blood.
17. A method according to any one of claims 8 to 11 wherein the pathogen is P. falciparum.
18. A method according to any one of claims 8 to 11 wherein the pathogen is P.vivax.
19. A method according to any one of claims 8 to 11 wherein the pathogen is Shigella.
20. A method according to any one of claims 8 to 11 wherein the pathogen is Mycobacterium tuberculosis.
21. A diagnostic kit for the detection of a given nucleo-tide sequence in a target polynucleotide sequence on the basis of the methods according to any one of claims 8 to 11.
22. A diagnostic kit for detecting the presence of a pathogen in a body fluid which kit comprises:
(a) a labelled first DNA sequence capable of hybridizing with a nucleotide sequence of said pathogen with the proviso that the label is non-isotopic, (b) a second DNA sequence capable of hybridizing with same said nucleotide sequence of said pathogen.
(a) a labelled first DNA sequence capable of hybridizing with a nucleotide sequence of said pathogen with the proviso that the label is non-isotopic, (b) a second DNA sequence capable of hybridizing with same said nucleotide sequence of said pathogen.
23. A diagnostic kit according to claim 21 wherein said second DNA sequence is unlabelled.
24. A diagnostic kit according to claim 21 wherein said second DNA sequence is attached to a microtitre plate.
25. A diagnostic kit according to claim 22 wherein said first DNA sequence is labelled with biotin.
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN230MA1990 IN173164B (en) | 1990-03-30 | 1990-03-30 | |
| IN230/MAS/90 | 1990-03-30 | ||
| SE9002658-4 | 1990-08-15 | ||
| SE9002658A SE9002658D0 (en) | 1990-08-15 | 1990-08-15 | A NOVEL PROCEDURE FOR THE DETECTION OF PATHOGENS USING DNA PROBES |
| SE9100216A SE9100216D0 (en) | 1991-01-24 | 1991-01-24 | A NOVEL PROCEDURE FOR THE DETECTION OF PATHOGENS USING DNA PROBES |
| SE9100216-2 | 1991-01-24 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2038742A1 true CA2038742A1 (en) | 1991-07-25 |
Family
ID=27272424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002038742A Abandoned CA2038742A1 (en) | 1990-03-30 | 1991-03-21 | Procedure for the detection of pathogens using dna probes |
Country Status (4)
| Country | Link |
|---|---|
| AU (1) | AU640745B2 (en) |
| CA (1) | CA2038742A1 (en) |
| GB (1) | GB2242904B (en) |
| IE (1) | IE911010A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2049618B1 (en) * | 1991-11-13 | 1994-11-01 | Consejo Superior Investigacion | DIAGNOSTIC METHOD AND CLASSIFICATION OF TRYPANOSOMA CRUZI SPECIES. |
| JPH06261758A (en) * | 1993-03-12 | 1994-09-20 | Wakunaga Pharmaceut Co Ltd | Detection of malaria |
| DE19836559A1 (en) * | 1998-08-12 | 2000-03-23 | Antigen Gmbh | Blood collection vessel |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0135108A3 (en) * | 1983-08-12 | 1988-07-13 | Rockefeller University | Nucleotide hybridization assay for protozoan parasites |
| WO1990010716A1 (en) * | 1989-03-10 | 1990-09-20 | Gene-Trak Systems | Immobilized oligonucleotide probes and uses therefor |
| FR2648476B1 (en) * | 1989-06-16 | 1993-07-16 | Centre Nat Rech Scient | NUCLEIC ACID AND OLIGONUCLEOTIDE DERIVATIVE THEREOF, CONTAINING SPECIFIC NUCLEOTIDE PROBES OF PLASMODIUM FALCIPARUM, AND THEIR APPLICATION FOR THE DETECTION BY HYBRIDIZATION OF THE DNA OF PLASMODIUM FALCIPARUM |
-
1991
- 1991-03-01 AU AU72028/91A patent/AU640745B2/en not_active Ceased
- 1991-03-21 CA CA002038742A patent/CA2038742A1/en not_active Abandoned
- 1991-03-27 IE IE101091A patent/IE911010A1/en unknown
- 1991-03-27 GB GB9106504A patent/GB2242904B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| GB2242904B (en) | 1994-09-07 |
| GB2242904A (en) | 1991-10-16 |
| IE911010A1 (en) | 1991-10-09 |
| AU640745B2 (en) | 1993-09-02 |
| AU7202891A (en) | 1991-10-03 |
| GB9106504D0 (en) | 1991-05-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2332510C (en) | In situ hybridization method for detecting target nucleic acid | |
| Britto et al. | Polymerase chain reaction detection of Trypanosoma cruzi in human blood samples as a tool for diagnosis and treatment evaluation | |
| Waters et al. | Ribosomal RNA: nature's own polymerase-amplified target for diagnosis | |
| Uguen et al. | ParaSight-F rapid manual diagnostic test of Plasmodium falciparum infection. | |
| McCarthy et al. | Evaluation of a polymerase chain reaction-based assay for diagnosis of Wuchereria bancrofti infection | |
| JPH06510200A (en) | In situ hybridization method | |
| CA2011571A1 (en) | In-situ hybridization in suspension for detection or separation of cells | |
| EP0119209A1 (en) | Identification of microorganisms | |
| Rivera et al. | Differentiation of Entamoeba histolytica and E. dispar DNA from cysts present in stool specimens by polymerase chain reaction: its field application in the Philippines | |
| AU2007203531A1 (en) | Method of Evaluating the Function of Phagocyte and Utilization Thereof | |
| Spathas et al. | Prenatal detection of trisomy 21 in uncultured amniocytes by fluorescence in situ hybridization: a prospective study | |
| Morgan et al. | Molecular detection of parasitic protozoa | |
| CA2038742A1 (en) | Procedure for the detection of pathogens using dna probes | |
| WO1992003576A1 (en) | A novel procedure for the detection of pathogens using dna probes | |
| US5250411A (en) | Nucleic acid probes specific for Plasmodium vivax and methods of using the same | |
| JPH06261758A (en) | Detection of malaria | |
| Pammenter | Techniques for the diagnosis of malaria | |
| Van den Berg et al. | Detection of different developmental stages of malaria parasites by non-radioactive DNA in situ hybridization | |
| Smits et al. | PCR amplification reactions in parasitology | |
| WO2002031206A2 (en) | Methods and compositions using hybridization assays for detecting infectious agents | |
| UII4oranda | The use of DNA probes for malaria diagnosis: Memorandum from a WHO meeting | |
| GB2271850A (en) | Non-radioactive hybridisation assay for pathogens | |
| AU701316B2 (en) | Diagnostic and therapeutic system for Crohn's Disease and colitia ulcerosa | |
| Goselle et al. | Could the level in parasitaemia of Plasmodium determine sensitivity to various diagnostic tests? | |
| Donovan et al. | In situ detection of human immunodeficiency virus (HIV) nucleic acid in H9 cells using nonradioactive DNA probes and an image cytophotometry system. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |