GB2271850A

GB2271850A - Non-radioactive hybridisation assay for pathogens

Info

Publication number: GB2271850A
Application number: GB9324104A
Authority: GB
Inventors: Kasirajan Ayyanathan; Santanu Datta
Original assignee: Astra AB
Current assignee: AstraZeneca AB
Priority date: 1990-03-30
Filing date: 1993-11-23
Publication date: 1994-04-27
Anticipated expiration: 2011-03-27
Also published as: GB9324104D0; GB2271850B

Abstract

A non-radioactive assay for pathogens such as Plasmodium Falciparum and Shigella sp. is disclosed. Samples containing blood and body fluids are contacted with a lysing solution comprising guanidine hydrochloride, SLS and Triton-X-100 (RTM). The DNA is denatured and hybridised with a nucleotide probe (which may be label led) in solution before the hybrids are captured on a microtitre plate coated with a hybridisation probe. The plate is washed with a solution comprising SSC, Triton-X-100 (RTM) and SDS. The assay is sensitive because the DNA is substantially undegraded during the process and the rate of hybridisation in solution prior to capture on a solid substrate is high. Moreover, immobilisation on a microtitre plate permits the use of a colourmetric detection system since contaminating products from the sample can be effectively removed by a washing step. Specific nucleotide probes for P. falciparum are also disclosed.

Description

A NOVEL PROCEDURE FOR THE DETECTION OF PATHOGENS USING DNA PROBES Disclosed are novel methods by which a rapid, flultisanple, non-radioactive procedure to detect pathogen., such as Plasmodium falciparu: parasites, in biological fluid.

including human blood samples is achieved. The detection is based on the use of parasite specific DNA probes and sandwich hybridization technique employing nicrotitre plates. The high sensitivity and specificity of these assays and the ease with which they can be performed enables one to use them for routine analyses of a large number of blood and other coloured tissue samples of vertebrates and invertebrates.

Especially, these assay. can be used to detect the presence of P. falciparum. The procedure described is amenable for application in a wide variety of DNA detection analysis using non radioactive DNA probes. In regard to detection of P.falciParum, also disclosed are novel DNA fragments and hybridisation probes based on such fragments, which form the subject matter of GB patent application no. 9106504.5 from which the present application is a divisional. The invention also provides a diagnostic kit on the basis of the novel methods.

BACKGROUND op THE XMVZMTIOM Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The life cycle of the parasite occurs in two phases - the asexual phase in vertebrates and the sexual phase in mosquito (usually of the genus Anopheles). The four species of Plasmodium responsible for human malaria are P. falciparum, P.vivax, P.malariae and P.ovale. Among these, the first two are the most common. P. falciparum causes the most severe form of malaria which in some instances is fatal.

Furthermore, this parasite also develops resistance te the commonly used antimalarial drugs.

The current method of diagnosis of malaria is by blood smear examination. This method is laborious and also requires expertise. Further, a skilled microscopist is allowed to examine a maximum of sixty slides a day. Diagnosis by serology may also be done, but because of the persistence of antibodies current infections cannot be distinguished from past infections(l). Hence, the search for a new generation of diagnostic tests has included the possibility of detecting parasite nucleic acids as indicative of the presence of the parasite. Theoretically such a test should require very little blood (5-50 ul) that can be obtained from a finger prick, and should be sensitive and rapid. As few as 50 parasites in 10 ul of blood can be detected by nucleic acid hybridization (2). Hundreds of samples can be analyzed in a day with some initial training.The sensitivity of the assay enables the test to be used in blood banks for the screening of blood to be used for transfusion.

Nucleic acid hybridization could also be performed on insect tissue samples in order to identify the vector species as a carrier. Such information would help to intensify vector control measures in order to limit the geographic spread of malaria. Alternatively, chemoprophylaxis may be adopted in such areas and evaluation of thi 8 strategy may be accomp- lished using nucleic acid hybridization. The procedure described in this patent application provides an efficient means of accomplishing parasite detection using nucleic acid hybridization techniques.

The detection method described by the present invention can be used generally to detect the presence of pathogens in blood, tissues, samples and body fluids of humans as well as of vertebrates and invertebrates in general such as cattles and insects.

The said pathogens may be e.g. bacteria, virus and parasites sucY as of the Plasmodium gents especially P.falciparum and P.vivax.

As further examples of pathogens can be mentioned Shigella, e.g.

Shigella flexneri, Shigella dysenteriae, Shigella sonnei, and Mycobacterium tuberculosis.

Although the specific examples in the present application relate to P.falciparum, it will be understood that the detection method is generally applicable as outlined above.

PRIOR ART Nucleic acid (DNA and RNA) based hybridisation is now being used in a number of clinical diagnosis. Initially this technology utilised radioactively labelled probes. Though the sensitivity of the diagnosis in the radioactive format is satisfactory this method is not popular in the clinical laboratories owing to the precautions and regulations necessary in radioactive material handling. Hence there is an urgent need for non radioactive detection in this field of pathogen detection by nucleic acid hybridisation. One of the most popular method of non isotopic detection is based on the incorporation of biotin enzymatically (3) or photochemically into the nucleic acid probes (4).The hybrids that bind the biotin labelled probes can then be easily detected with complexes of avidin or streptavidin and suitable enzymes like phosphatase or pcroxidase. Though the above mentioned non isotopic method looks attractive it has not been yet popular. A few important problems remain to be solved. The major problems relate to the coloured background and the state of purity of the target DNA. Most DNA based diagnostics are done on membrane filters (either nitrocellulose or nylon). Body fluids like blood which are to be tested for the presence of pathogens when spotted directly on the membrane filter to immobilise the DNA leave an indelible coloured mark which makes the subsequent colour development after hybridisation almost impossible.Thus the only alternative left is spotting pure DNA obtained from the pathogens that are present in the tissue or body fluid.

Since isolation of DNA involves a procedure which includes centrifugation and precipitation, it severely curtails the feasibility of a rapid multisample diagnosis. For a preferable diagnostic procedure based on nucleic acid hybridisation the following conditions are essential.

ESSENTIALS OF A GOOD DNA BASED MULTISAMPLE DIAGNOSTIC PROCEDURE.

1. It should be based on non radioactive detection 2. It should use small amount of blood (a drop from a finger prick).

3. Most of the components used in the diagnostic kit should be stable at room temperature.

4. Exact micropipeting of individual components should bs avoided.

5. Centrifugation and precipitation steps should be avoided.

6. It should require minimum training for successful operation.

By the present invention a detection method is provided which fulfills all these criteria The present invention is summarised in the following clauses: 1. A single stranded DNA fragment (f 63) having the sequence or including the sequence given below: AGCTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTACTTTAACTAAACT or its complementary strand or variants thereof hybridisable to f63 or its complementary strand; or the corresponding double stranded sequence.

2. A fragment of the DNA as defined by clause 1 having a contiguous segment of fe3 which is at least greater than 20 bases or base pairs in length, and more particularly AGGTCTTAACATGACTAACTA.

3. A DNA according according to clauses 1 or 2 in single stranded form.

4. A hybridization probe comprising a DNA according to any one of clause 1 to 3.

5. A hybridization probe according to clause 4 which is labelled by a group capable of colourimetric detection.

6. A hybridization probe according to clause 5 wherein the labelled group for colourimetric detection is biotin.

7. A hybridization probe according to clause 5 wherein the labelled group for colourimetric detection is a chromophoric reporter group.

8. A hybridization probe according to any one of clauses 4 to 7 substantially as hereinbefore described with reference to any one of the Examples.

9. A method for detecting a pathogen present in blood or other body fluid comprising the following steps: a) Lysing a blood sample in a solution containing GuHCl, SIS and Triton-X-100.

b) Denaturing the DNA present in the said blood sample and performing solution hybridization in the presence of a hybridization probe which hybridizes with DNA of the said pathogen.

c) Capturing the hybrids formed in step (b) in the said microtitre plate coated with a hybridization probe which has a nucleotide sequence capable of hybridizing to the same strand of gnomic DNA that the hybridization probe used in step (b) binds.

d) Washing the microtitre plate with a solution comprising SSC, SDS and Triton-X-100.

e) Detection of the presence of the-hybrids by colourimet-:ic methods.

10. A method according to clause 9 wherein the denaturing step (b) is carried out by heating.

11. A method according to clauses 9 or 10 wherein the hybridization probe used in coating the microtitre plate has the same nucleotide sequence as the hybridization probe used in step (b).

12. A method according to any one of clauses 9 to 11 wherein the final concentration-of the reagents in step (a) are as follows: a) Guanidine hydrochloride : Between 1.OM - 3.OM b) Sodium lauryl sarcosine : Between 0.2% - 0.5% W/V c) Triton-X-100 : Between 0.28 - 0.5% V/V.

13. A method according to any one of clauses 9 to 12 wherein the final concentration in step (e) are as follows: a) Standard Saline Citrate - 0.5 X - 2.5 X SSC b) Triton-X-100 - 0.2% - 0.5% V/V c) Sodium dodecyl Sulphate - 0.2% - 0.58 W/V.

14. A method according to any one of clauses 9 to 13 wherein the lysing solution is used both as a solubilising agent and as hybridization solution.

15. A method according to any one of clauses 9 to 14 wherein nX SSC is used to remove non-specific hybrids.

16. A method according to any one of clauses 9 to 15 wherein Triton-X-100 and SDS are used for the removal of the colouring material originating from the blood.

17. A method according to any one of clauses 9 to 16 wherein the pathogen is P. falciarum.

18. A method according to clause 17 wherein the hybridization probe is as defined in any one of clauses 4 to 7.

19. A method according to any one of clauses 9 to 16 wherein the pathogen is P. vivax.

PRIMCIPLE Or DNA BASED SANDWICH KYBRIDISATIOM Background: In the non radioactive format the final mode of detection is the development of a colour either soluble or insoluble depending on the nature of the substrate used in the reaction catalysed by either alkaline phosphatase or horse radish peroxidase.Therefore it is essential to remove the residual coloured material from the target DNA as well as inactivating the endogenous enzyme. This makes spotting blood directly cnto membrane filters (as is done in the radioactive hybridisation format useless since the removal of residual blood stains from the filter is almost impossible.To circumvent this problem we have used the microtitre plate format coupled with sandwich hybridisation, the basic principle of which is described below.

It has bee shown earlier that one of the characteristics of F.falcipaxu genome is that it contains a 21 base pair repeat that is present in tandem in a large region of the genome (5-6). The fraction of the genome represented by this repeated sequence is about 1. Comparisons of several clones containing this repeat sequence have indicated a consensus 21 base pair repeat sequence. Based on this consensus sequence we have designed and constructed a 63 ner oligonucleotide probe (designated f63 hereafter).It consists of three 21 mers in tandem which are maximally represented in the repeated sequences of the P. falciparum DNA (Fig. 1). The preferred use of single stranded DNA as a probe and its said length is based on the following reasoning. Single stranded DNA is superior to double stranded as a probe because it hybridises only to the target DNA. In case of double stranded DNA there is a greater probability of self hybridisation thus reducing the effective concentration of the probe that is required to bind the target DNA. This clearly establIshes the superiority of the single stranded probe in its cost effectiveness as it is required in a much lower amount for hybridisation. Of the several methods that are available to make single stranded DNA, oligonucleotide synthesis is most convenient.

For detection of pathogens other than P.falciparum, one has to design an optimal DNA probe which is repeated in the pathogen DNA. This hybridization probe can then be used in z similar detection protocol of sandwich hybridization which. is given below specifically for P.falciparum.

The basic protocol for the sandwich hybridisation is given below.( Also explained pictorially in Fig.2) FLOW CHART FOR MON RADIOACTIVE DIAGNOSIS OF P.FALCIPARU@ INFEOTION IN HUMAN BLOOD BY @ANDWICH HYBRIDISATION Add one drop of blood sample (50 ul) from a finger prick in a small plastic tube containing Lysing solution and bio-f63 probe Phase 1

(i) nix well (ii) Heat in Boiling water bath for two minutes (iii) Leave at room temperature for a minimum of four hours Parasite DNAbio-f63 probe hybrid See Fig.1. Plate A Phase 2

(i) Transfer the mixture from the tube in Phase 1 to wells in microtitre plates precoated with unlabelled f-63 probe (See Fig.l. Plate B) (ii) Allow to stand at room temperature for overnight.

CAPTURED HYBRID See Fig.l. Plate C Phase 3

(i) Wash wicrotitre plate wells from phase 2 with 2 x SSC containing 0.2% SDS and 0.2t Triton x 103 (ii) Repeat wash procedure four times each time let stand wash buffer for 5 minutes.

(iii) Let stand in each well APB-1 solution for 30 minutes at room temperature.

(iv) Add one drop of APB-1 containing streptavidin Alkaline phosphatase conjugate.

(v) Let stand for 30 minutes at room temperature.

Ph@@@ 4 Captured hybrid ready for detection by colorimetry Fig.l Plate D

(vi) Discard solution in the wells.

(vii) Let stand Affl-1 solution (without BSA) in each well for 5 minutes and discard solution.

(viii) Repeat above operation four times.

(ix) Rinse each well with APB-2 solution.

(x) Add enzyme substrate in APB-2 solution.

(xi) Let stand at room temperature for atleact 120 minutes.

(xii) Read absorbancy at 410 nm @ microtitre plate reader.

Phase 5 Analysis of Text Results

Colour with absorbancy values higher than 0.2 denotes presence of parasite DNA Absence of parasite DNA should give an absorbancy value of lesa than 0.1 The success of this method depends on the fact that P. faloiparum DNA remains nearly undegraded during the process.In the solution hybridisation step biotinylated f3 binds to P.falciparum DNA and would proceed to near completion, the rate of solution hybridisation being much faster when compared to immobilized target DNA. The efficiency of capture hybridisation is directly proportional to the length of the P.falciparum DNA.In the extreme limit it can be seen that if the P. falciparum DNA is totally undegraded then even a meagre 0.03% of capture hybridisatlcn can bring down all the hybrid complex.

In the case of other pathogens, the efficiency of capture hybridization will depend on the number of times the probe is repeated in the pathogen genome.

PROTOCOL FOR MON-ISOTOPIC DETECTION OF P.TALCIPARUM DNA IN BLOOD SANPLES 1. Preparation of the probe: The probe for coating the microlitre plates: The 63 mer oligonucleotide( f63 ) was synthesised using the automated DNA synthesizer(Applied Biosystems 340A).

Labeled probe for detecting the the hybrids: Biotinylation of f63 was done by photobictinylation using photobiotin acetate according to published procedures.

2.Coating of microtitre plates: All the wells in the microtitre plate (Dynatech, Polyvinyl chloride) are coated with varyir.g amounts(lug to 10ng of f63 in 50 ul volume containing 0.1 H MgC12. The coating is done overnight following which the microtitre plate is exposed under germicidal W lamp (40 watts) at a distance of 10 cms, for 5 minutes to immobilise DNA. The contents of the wells are discarded subsequently and the wells are washed with 2X SSC buffer. Unoccupied sites sites in each of the wells are blocked by carrying out prebybridisation in a buffer (200 ul/well) containing 2X SSC, 5X Denhardts, 0.5% Triton-X-100, 0.5% SDS and 50 ug/ml salmon sperm DNA. The prehybridisation is carried out for 4-6 hours at room temperature.The coated plates can be stored at this stage in room temperature 3. Collection of blood samples and solution hybridisation: Blood samples (50 ul aliquots) are collected fron a finger prick, directly into 5C ul of a solution containing 4X guanidine hydrochloride (Gu HCl), 0.5S sodium iauryl sarcosine (SLS) and 0,5S Triton-X-100. This solution also contains 5 ng of oligonucleotide probe (biotinylated f-63).

This mixture is heated for 5 minutes at 95 deg C and then kept at room temperature for 4-6 hours for the solution hybridisation to occur.

4. Capture hybridisation: After solution hybridisation is over, the contents of the eppendorf tubes are transferred into the wells of the microtitre plate that are precoated with unlabelled f-63.

This sandwich hybridisation(capture) is allowed to go for 24 hours. During this phase, hybridisation occurs between the f-63 coated ofo the plate and the rest of the complementary sites available in the hybrid. The hybrid is a long piece of target DNA carrying the biotinylated f-63 in certain locations leaving behind other complementary sites. (See Fig: 2).

5. Colour development: After the sandwich hybridisation is over, the contents of the wells of the microtitre plate are discarded and wells are washed with z solution containing 2X SSC, 0.2% SDS and 0.2% Triton X-100, four times, five minutes each at room temperature. During this post hybridisation each, all the coloured materials are removed leaving behind the sandwich hybrid. The wells are then blocked with A.P 7.5 which is a solution containing IN NaCl, 100 mM Tris-cl pH 7.5, 2 mM MgCl2, 0.05% Triton-X-100 and 3% BSA, for 30 minutes at room temperature.

The sandwich hybrids are then detected by using for example, Streptavidln- alkaline phosphatase conjugate. The Streptavidin alkaline phosphatase conjugate(1 ug/ml) is added to A.P 7,5 buffer. 50 ul of this solution (AP 7.5 buffer containing streptavidin alkaline phosphatase) is added to each well and incubation continued for another 30 minutes at room temperature. The excess unbound conjugate is removed by washing four times, five minutes each, at room temperature with A.P 7.5 buffer without BSA.

Finally the wells are rinsed with A.P 9.5(substrate incubation buffer containing 100mM Tris-Cl pH 9.5, 100 mM NaCl and 50 mM MgCl2). 50 ul of the substrate p-nitrophenyl phosphate is added to A.P 9.5 at a concentration of lmg/ml and 50 ul of this solution is added to each well. The color development is allowed to take place for 6-12 hours. The absorbance (at 410 n.m.) are recorded, using a - suitable plate reader( e.g. Dynatech plate reader).

The Test results are given in the following table.

RESULTS: Table 1 f63 BENBITIVITY DATA (Absorbance at 410 mm) Amount of parasite DNA Amount of f63 coated on microbacteria plate (T9/106* DNA) l ug 500 ng 100 ng 10 ng 500 ng over over over over 250 ng 125 ng " " " " 63 ng " " " " 31 ng " " " " 16 ng " " " 1.524 7.5 ng 1.511 1.242 1.373 0.929 1 ug 0.291 0.295 0.263 0.214 Human DNA * T9/106 represent a chloroquine resistant P. falciparum clone.

Note : In human samples 50 ul of blood has about 50ng of parasite (P.falciparum) DNA if the infection is about 1%.

The term "over" indicates an optical density above 2.0.

FIGURE LEGENDS Fig.l shows the oligo f63 that was designed frow the consensus repeated sequence (21 base repeat) of P.falciparum.

legend to Fig. 2 A: Solution hybridization.

B: Depicts Microtitre well coated with the. probe f63.

C: Capture hybridization.

D: Capture hybrids after washing and ready for colour development.

Fig. 3 depticts: biotinylated f63 DNA B: genomic P.falciparum DNA C: f63 DNA References 1. Seroepidimiology of Human Malaria : A multicentric study. Malaria Research Centre (ICMR) (1987) 2. Barker, R.H.Jr., Suebsaens, L., Rooney, W., Alecrin,G.C., Dourado, H.V., and Wirth, D.F. (1986) Science 231, 1434.

3. Langer P.R., Waldrop A.A. and Ward,D.C. (1981).

Proc.Natl. Acad. Sci. USA 78, 6633.

4. Forster A.C., McInncs,J.L., Skingle, D.C. and Symons, R.F. (1985) Nucleic Acids Res, 13, 745.

5. Aslund, L., Franzen.L., Westin, G., Persson.T., Wignzell.H., and Pettersson.U. (1985) J.Mol.Diol. 185, 509.

6. Francis. V.S., Ayyanathan, K., Bhat.P., Srinivasa.H. and Padmanaban.G. (1988). Indian J. Biochem. Biophys 23, 537.

Claims

1. A method for detecting a pathogen present in blood or other body fluid comprising the following steps: (a) contacting said sample with a lysing solution containing GuHCl, SLS and Triton-X-100, (b) denaturing the DNA present in the said sample and performing solution hybridisation in the presence of a hybridisation probe which hybridises with DNA of the said pathogen, (c) capturing the hybrids formed in step (b) on a microtitre plate coated with a hybridisation probe which has a nucleotide sequence capable of hybridising to the same strand of genomic DNA that the hybridisation probe used in step (b) binds, (d) washing the microtitre plate with a solution comprising SSC, SDS and Triton-X-100, and (e) detecting the presence of the hybrids by a colourimetric method.

2. A method according to claim 1 wherein the denaturing step (b) is carried out by heating.

3. A method according to claim 1 or claim 2 wherein the hybridisation probe used in coating the microtitre plate has the same nucleotide sequence as the hybridisation probe used in step (b).

4. A method according to any one of claims 1 to 3 wherein the final concentration of the reagents in step (a) are as follows: a) Guanidine hydrochloride : Between 1.OM - 3.OM b) Sodium lauryl sarcosine : Between 0.2% - 0.5% W/V c) Triton-X-100 : Between 0.2% - 0.5% V/V.

5. A method according to any one of claims 1 to 4 wherein the final concentration of the reagents in step (d) are as follows: a) Standard Saline Citrate - 0.5 X - 2.5 X SSC b) Triton-X-100 - 0.2% - 0.5% V/V c) Sodium dodecyl Sulphate - 0.2t - 0.5% W/V.

6. A method according to any one of claims 1 to 5 wherein the lysing solution is used both as a solubilising agent and as the hybridisation solution in step (b).

7. A method according to any one of claims 1 to 6 wherein 2X SSC is used to remove non-specific hybrids.

8. A method according to any one of claims 1 to 7 wherein Triton-X-100 and SDS are used for the removal of the colouring material originating from starting blood.

9. A method as claimed in any one of claims 1 to 8 wherein the hybridisation probe employed for solution hybridisation in step (b) is labelled by a group capable of colourimetric detection.

10. A method as claimed in claim 9 wherein the label group for colourimetric detection is biotin.

11. A method as claimed in claim 9 wherein the label group for colourimetric detection is a chromophotic reporter group.

12. A method according to any one of claims 1 to 11 wherein the pathogen is P.falciparum.

13. A method according to claim 12 wherein the hybridisation probe employed in step (b) comprises a DNA selected from single stranded DNAs having or including the sequence f63 given below: AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTACTTTAACTAAACT complementary strands and corresponding double-stranded sequences.

14. A method as claimed in claim 13 wherein a single-stranded hybridisation probe is employed.

15. A method according to any one of claims 1 to 11 wherein the pathogen is P. vivax.

16. A method according to any one of claims 1 to 11 wherein the pathogen is Shipella.

17. A method according to any one of claims 1 to 11 wherein the pathogen is Mvcobacterium tuberculosis.

18. A method according to claim 1 substantially as hereinbefore described with reference to the Example.

19. A method of detecting P. falcinaruni infection which comprises contacting a sample of blood or other body fluid taken from a patient suspected of having P. falciparum infection with a hybridisation probe as defined in claim 13 or claim 14 and determining whether or not hybridisation occurs between the DNA of the probe and the DNA of the sample.

20. A method according to claim 19 substantially as hereinbefore described with reference to the Example.

21. A diagnostic kit for the detection of a given nucleotide sequence in a target polynucleotide sequence on the basis of a method according to any one of claims 1 to 20.

22. A diagnostic test kit as claimed in claim 21 comprising a hybridisation probe as defined in claim 13 or claim 14.