BRPI0610396A2 - multivalent hpv vaccine, methods to protect a patient against infection, to prevent or reduce the frequency of cytological abnormalities in a patient, to prevent the formation of histologically confirmed lesions and to manufacture the vaccine, and, uses of a composition, to a vaccine and a vaccine composition - Google Patents

Abstract

MULTIVALENT HPV VACCINE, METHODS TO PROTECT A PATIENT AGAINST INFECTION, TO PREVENT OR REDUCE THE FREQUENCY OF CYTOLOGICAL ABNORMALITIES IN PATIENTS, TO PREVENT THE FORMATION OF CINHISTOLOGICALLY CONFIRMED LABELS, AND TO MANUFACTURE, AND MANUFACTURE, AND MANUFACTURE, , A VACCINE AND A VACCINE COMPOSITION. This invention relates to methods and vaccines for treating infections caused by human papillomaviruses. Immunization with particles equivalent to HPV16 and HPV18 viruses has been found to provide cross-protection against other types of HPV

Description

"MULTIVALENT HPV VACCINE, METHODS TO PROTECT A PATIENT AGAINST INFECTION, TO PREVENT OR REDUCE THE FREQUENCY OF CYTOLOGICAL ANORMALITIES IN A PATIENT, TO PREVENT THE FORMATION OF CIN HISTOLOGICALLY CONFIRMED, AND TO FACIL, INJURY A VACCINE AND A VACCINE COMPOSITION "

Field of the Invention

The present invention relates to human papillomavirus (HPV) vaccines.

Background of the Invention

Papillomaviruses are small DNA tumor viruses that are highly species specific. To date, more than 100 individual human papillomavirus (HPV) genotypes have been described. HPVs are generally skin-specific (eg HPV-I and -2) or mucosal surfaces (eg HPV-6 and -11) and usually cause benign tumors (warts) that persist for several months or years. Such benign tumors may be agonizing for the individuals involved but tend to be non-life threatening, with a few exceptions.

Some HPVs are also associated with cancers, known as oncogenic HPV types. The strongest positive association between HPV and human cancer is between HPV-16 and HPV-18 and cervical carcinoma. Cervical cancer is the most common malignancy in developing countries, with about 500,000 new cases occurring worldwide each year.

Other types of HPV that can cause cancer are types 31,33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68 (alluded to as "oncogenic HPV types"). Types 16 and 18 are those that have the highest association with cervical cancer. Types 31 and 45 are the types with the highest contiguous association with a cancer risk (Munoz N, Bosch FXj of Sanjose S et al. International Agency for Research on Cancer Multicenter Cervical Cancer Study Group. N Engl J Med 2003; 348: 518-27).

HPV virus equivalent particles (VLPs) have been suggested as potential vaccines for the treatment of HPV. Animal studies have shown that VLPs do not produce any cross-protection against infection with other HPV types - see, for example, Suzich, JA, et al., Proc Natl Acad Sci, 92: 11553-11557, 1995 and Breitburd, Seminars. in Cancer Biologys vol 9, 1999, pp 431-445.

WO 2004/056389 discloses that an HPV .16,18 VLP vaccine can provide cross-protection against infection by HPV types other than 16 and 18. Statistically significant protection has been observed against certain HPV type groups. However, the level of cross-protection against individual types within groups was not disclosed. There is still a need for a vaccine that delays multiple HPV types.

Summary of the Invention

The present invention relates to a multivalent HPV vaccine, the vaccine comprising an L1 protein or immunogenic fragment thereof of at least 3 different oncogenic HPV types, these types including HPV 16 and HPV 18, wherein the vaccine does not comprise a protein. Ll or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV 45, HPV 52 or any combination thereof.

The present invention further relates to the use of a composition comprising a protein II or immunogenic fragment thereof of HPV 16 and HPV 18 in the manufacture of a medicament for preventing infection and / or disease by one or more of the group consisting of HPV 31, HPV 45 and HPV 52. The present invention further relates to the use of a composition comprising a protein L1 or immunogenic fragment thereof of HPV 16 and HPV 18 in the manufacture of a medicament for the prevention of cytological and / or abnormalities. reduction in the frequency of cytological abnormalities and / or prevention of CIN lesions (ASCUS, CIN 1, CIN 2, CIN, cervical cancer) in an individual, abnormalities or lesions caused by at least one HPV type other than HPV 16 or HPV 18, suitably caused by the HPV type 31 or 45 or 52 or a combination thereof.

The invention further relates to a method for preventing and / or treating HPV5 infection and / or disease, the method comprising releasing to an individual in need thereof an effective amount of a composition comprising an L1 protein or immunogenic fragment thereof. At least 3 different types of oncogenic HPV, these types including HPV 16 and HPV 18, wherein the vaccine does not comprise an ll protein or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV 45, HPV 52 or any combination thereof.

The invention further relates to the use of a multivalent composition in the manufacture of a medicament for the prevention and / or treatment of HPV infection and / or disease, the multivalent composition comprising an L1 protein or immunogenic fragment thereof of at least 3 different types. HPV, these types including HPV .16 and HPV 18, wherein the vaccine does not comprise an ll protein or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV 45, HPV 52 or any combination thereof. and where the medicine provides protection against infection and / or disease caused by the omitted HPV type.

The invention also relates to a method for the manufacture of a vaccine, the method comprising combining an ll protein or immunogenic fragment thereof of at least 3 different oncogenic HPV types, these types including HPV 16 and HPV 18 types, wherein the The vaccine does not comprise an ll protein or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV .45, HPV 52 or any combination thereof.

Detailed Description

The general existence of cross-protection produced by HPV 16 and HPV 18 against both incident and persistent infection as assessed for certain HPV type groups has been disclosed in WO2004 / 056389.

We have surprisingly found that cross-protection against certain HPV types (not HPV16, HPV 18) (as judged by the effectiveness of an HPV 16 and HPV 18 vaccine against these types) is higher than against certain other HPV types ( non-HPV 16, HPV 18). Cross-protection can be considered as protection produced by a vaccine containing one HPV type against infection (incident or persistent) and / or disease caused by a different HPV type. Cross-protection can be assessed by considering the efficacy of the vaccine (V.E.), where V.E. is the% improvement in protection against vaccine infection or disease compared to a placebo group for a given type.

The infection can be incident or persistent infection. The disease may be abnormal cytology, ASCUS, CIN1, CIN2, CIN3 or cervical cancer related to HPV infection. Infection can be assessed by PCR, for example. The disease can be assessed, for example, by histological examination or analysis of biomarkers such as ρ 16.

Such a finding has potential implications for vaccine planning. For example, the level of cross-protection afforded by HPV 16 and HPV 18 LI-containing vaccines against certain other HPV types, such as HPV 31, HPV 45, and HPV 52, allows the components of these HPV L1 components to be omitted from a vaccine comprising HPV 16 and HPV 18 while still providing a vaccine that provides some protection against incident and / or persistent infection and / or disease related to these omitted types.

After HPV types 16 (found in 53.5% of cervical cancers) and 18 (found in 17.2% of cervical cancers), types .45 (6.7%) and 31 (2.9%) are the most significant in terms of their frequency in cervical cancers (Munoz et al. supra). HPV 33 (2.6%) is as follows, followed by HPV 52 (2.3%). Thus, when planning a multivalent cervical cancer HPV vaccine containing at least .3 HPV types then types 31 and 45 would generally be included by the skilled person after types 16 and 18 from a statistical perspective.

The ability to omit antigens from certain HPV types potentially allows the inclusion of Ll protein from other HPV types or indeed antigens from other viruses or pathogens in a vaccine in a scenario where the total amount of antigen in a vaccine may be limited, for example by physical, chemical, regulatory or other restrictions.

In particular other HPV types include oncogenic HPV types such as HPV 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68.

The present invention relates to a multivalent HPV vaccine, the vaccine comprising an L1 protein or immunogenic fragment thereof of at least 3 different oncogenic HPV types, these types including HPV 16 and HPV 18, wherein the vaccine does not comprise a protein. Ll or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV 45, HPV 52 or any combination thereof.

In one aspect of the invention the vaccine does not contain a protein II or immunogenic fragment thereof of HPV 31.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by HPV 31.

In one aspect of the invention the vaccine of the invention does not contain a protein II or immunogenic fragment thereof of HPV 45.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by HPV 45.

In one aspect of the invention the vaccine does not contain a protein II or immunogenic fragment thereof of HPV 52.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by HPV 52.

In one aspect of the invention the vaccine of the invention does not contain a protein II or immunogenic fragment thereof of HPV 31 and 45.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by both HPV .31 and 45.

In one aspect of the invention the vaccine does not contain a protein II or immunogenic fragment thereof of HPV 31 and 52.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by both HPV .31 and 52.

In one aspect of the invention the vaccine of the invention does not contain a protein II or immunogenic fragment thereof of HPV 45 and 52.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by both HPV .52 and 45.

In one aspect of the invention the vaccine is capable of providing protection against incident and / or persistent HPV infection by HPV 31 and HPV 45 and HPV52. Suitably the vaccine is able to protect against persistent infection. Suitably the vaccine is able to protect against incident infection. Incident and persistent cervical infections are defined in Example 1.

We have also determined that a vaccine comprising HPV 16 Ll and HPV 18 Ll proteins (for example, as described in example 1) provides protection against cytological abnormalities caused by certain other oncogenic HPV types such as HPV 52 and is significantly protective. with respect to such abnormalities caused by a group of high risk HPV types (defined as 31, 33, 35, 39, 45, .51, 52, 56, 58, 59, 66 and 68). Cytological abnormalities are adequately detected by the well-known Pap smear technique.

Thus the invention further relates to the use of a combination of a protein II or immunogenic fragment thereof of HPV 16 and HPV 18 in the preparation of a composition for preventing cytological abnormalities or reducing the frequency of cytological abnormalities in an individual caused by others. HPV types (non-HPV 16, HPV 18), adequately oncogenic HPV types and prevention of histologically confirmed CIN lesions (CIN 1, CIN 2, CIN 3) and cervical cancer associated with infection by non-HPV types 16 or 18. Said use is beyond the prevention or reduction of such events caused by HPV vaccine types, HPV 16 and 18.

Properly preventing cytological abnormalities, reducing the frequency of cytological abnormalities, or preventing histologically confirmed CIN lesions is prevention against those abnormalities or lesions caused by types not included in the combination, properly selected from the HPV 31, HPV 45, and HPV 52 list. or is prevention against those abnormalities or injuries caused by the group of 31, 33, 35, 39, 45, .51, 52, 56, 58, 59, 66 and 68. Said use is beyond the prevention or reduction of such events. caused by HPV types in the vaccine, HPV 16 and 18.

Suitably the composition comprising HPV 16 and HPV 18 for use as above is the multivalent HPV vaccine of the invention, the vaccine comprising an L1 protein or immunogenic fragment thereof of at least 3 different oncogenic HPV types, these types including HPV 16 and HPV 18, wherein the vaccine does not comprise an ll protein or immunogenic fragment thereof of an HPV type selected from the list consisting of HPV 31, HPV 45, HPV 52 or any combination thereof.

The vaccine of the invention comprises L1 or immunogenic fragment of HPV 16, HPV 18 and at least one other type of oncogenic HPV. Oncogenic HPV types are these types associated with a risk of cervical cancer and those oncogenic types that could be included in the vaccine of the invention in addition to HPV 16 and HPV 18 include, but are not limited to, HPV 31, 33, 35, 39. , 45, 51, 52, 56, 58, 59, 66 and 68, provided that the vaccine does not comprise all HPV 31, 45 and 52.

The vaccine of the invention suitably comprises an HPV 33 L1 protein or immunogenic fragment thereof.

The vaccine of the invention suitably comprises an HPV 58 L1 protein or immunogenic fragment thereof.

The vaccine of the invention suitably comprises an HPV 59 L1 protein or immunogenic fragment thereof.

The vaccine of the invention suitably comprises an HPV 16 Ll protein or immunogenic fragment thereof, HPV 18 Ll protein or immunogenic fragment thereof, HPV 33 ll protein or immunogenic fragment thereof and HPV 58 ll protein or immunogenic fragment thereof. .

Proteins L1 or protein fragments of additional HPV types may be included in the vaccine of the invention, such as skin types (in particular HPV 5 and 8) and genital wart-associated types, such as HPV 6 and 11. Types 6 and 11 are not considered here as oncogenic types.

In one aspect of the invention the vaccine may include an initial HPV antigen, for example an antigen selected from the list consisting of HPV E1, E2, E3, E4, E5, E6, E7 or E8. Alternatively, the vaccine may lack an initial HPV antigen, for example an antigen selected from the list consisting of HPV E1, E2, E3, E4, E5, E6, E7 or E8.

In one aspect the vaccine of the invention is trivalent (contains one HPV L1 or fragment thereof of 3 different types of oncogenic HPV). In another aspect the vaccine is tetravalent. In another aspect the vaccine is pentavalent. In another aspect the vaccine is heptavalent. In another aspect the vaccine is septavalent. In another aspect the vaccine is octavalent. Higher order valences are also considered here. In other respects the vaccine is at least tetravalent, pentavalent, heptavalent, septavalent or octavalent with respect to oncogenic HPV types.

Preferably the combination of HPV components within the vaccine does not significantly influence the immunogenicity of any HPV component. In particular it is preferred that there is no biologically relevant interference between HPV antigens in the combination of the invention, such that the combined vaccine of the invention is capable of providing effective protection against infection or disease caused by each HPV genotype represented in the vaccine. Suitably the immune response against a given HPV type in combination is at least 50% of the immune response of those same HPV types when measured individually, preferably 100% or substantially 100%. For responses to HPV 16 and HPV 18, the combined vaccine of the invention preferably stimulates an immune response that is at least 50% of that provided by a combined HPV 16 / HPV 18 vaccine. Suitably the immune response generated by the vaccine of the invention is at a level where the protective effect of each HPV type is still observed. The immune response may be suitably measured, for example, by antibody responses in preclinical or human experiments. Measurement of antibody responses is well known in the art and disclosed (for example) in WO 03/077942.

We have determined that a vaccine comprising HPV 16 Ll and HPV 18 Ll proteins (for example see example 1) provides cross-protection against infection or disease caused by certain types of HPV. Just as we provide new compositions, this information allows new uses to be developed.

In particular, the invention relates to the use of a composition comprising HPV 16 and HPV 18 ll protein or immunogenic fragment thereof in the manufacture of a medicament for preventing HPV infection 31.

The invention further relates to the use of a composition comprising the HPV 16 and HPV 18 ll protein or immunogenic fragment thereof in the manufacture of a medicament for preventing HPV infection 45.

The invention further relates to the use of a composition comprising the HPV 16 and HPV 18 ll protein or immunogenic fragment thereof in the manufacture of a medicament for preventing HPV infection 52.

In one aspect the invention relates to the use of a vaccine comprising the HPV 16 ll protein or immunogenic fragment thereof in the preparation of a medicament for preventing infection and / or disease caused by HPV 31 or HPV 52 or any combination thereof. of the same.

In one aspect the invention relates to the use of a vaccine comprising the HPV 18 L1 protein or immunogenic fragment thereof in the preparation of a medicament for preventing HPV infection and / or disease.

The composition for such use may lack an antigenic component of the HPV type for which cross protection is provided.

Alternatively the composition for said use may comprise such an antigenic component, for example the L1 protein or fragment thereof of said cross-protected type. In the latter case the use of the composition comprising the HPV 16 and HPV 18 ll protein or immunogenic fragment thereof provides both cross protection (eg against HPV 31, 45 and 52) and homologous protection (eg against HPV 16 and HPV 18).

The composition in one aspect is a multivalent composition comprising the ll proteins or immunogenic fragments thereof of HPV 16, HPV 18 and at least one other type of oncogenic HPV, wherein a ll protein or immunogenic fragment thereof of one or more types HPV selected from the group consisting of HPV 31, HPV 45, and HPV 52 is omitted from the vaccine and the vaccine provides protection against infection caused by the omitted HPV type.

Where the vaccine or composition of the invention comprises an immunogenic L1 fragment, then suitable HPV ll immunogenic fragments include LL truncation, deletion, substitution or insertion mutants. Such immunogenic fragments are suitably capable of eliciting an immune response (if necessary when adjuvant), said immune response being capable of recognizing a L1 protein such as a virus equivalent particle, of the HPV type from which the L1 protein was derived.

A suitable immunogenic fragment of HPV 16 is capable of cross-protecting against at least one of HPV 31 and HPV 52 and in one aspect of the invention capable of cross-protecting against both.

A suitable HPV 18 immunogenic fragment is capable of cross-protecting against HPV 45. The cross-protection obtainable by HPV 16 and / or HPV 18 immunogenic fragments can be assessed by testing in humans,

for example as outlined in Example 1.

Similarly, different vaccines according to the present invention may be tested using standard techniques, for example as in Example 1 or standard preclinical models, to confirm that the vaccine is immunogenic.

Suitable immunogenic L1 fragments include truncated L1 proteins. In one aspect the truncation removes a nuclear localization signal. In another aspect the truncation is a C-terminal truncation. In another aspect the C-terminal truncation removes less than 50 amino acids, such as less than 40 amino acids. Where the L1 is from HPV 16 then in another aspect the C-terminal truncation removes 34 amino acids from the HPV 16. Where the L1 is from HPV 16 then in another aspect the C-terminal truncation removes 35 amino acids from the HPV 16. 18. Truncated L1 proteins are described in US 6,060,324, US 6,361,778 and US 6,599,508 incorporated herein by reference.

In one aspect the HPV 16 amino acid sequence is the

following sequence: (SEQID NO: 1)

In another aspect the invention relates to virus equivalent particles consisting only of HPV 16 L1 having the above amino acid sequence and compositions containing such VLPs.

The HPV 16 sequence may also be that disclosed in WO 9405792 or US 6649167, for example, suitably truncated. Suitable truncates are truncated at a position equivalent to that shown above as assessed by sequence comparison.

In one aspect the HPV 18 amino acid sequence is as follows: (SEQ ID NO: 2)

In another aspect the invention relates to virus equivalent particles consisting only of HPV 18 L1 having the above amino acid sequence and compositions containing such VLPs.

An alternative HPV 18 sequence is disclosed in WO 9629413, which may be suitably truncated. Suitable truncates are truncated at a position equivalent to that shown above as assessed by sequence comparison.

Other HPV 16 and HPV 18 sequences are well known in the art and may be suitable for use in the present invention.

Proper truncations of HPV 31, HPV 45, and HPV 52 may also be fabricated by suitably removing C-terminal portions of protein L1 equivalent to those described above as assessed by sequence alignment.

Truncated L1 proteins are disclosed, for example, in WO 9611272 and US6066324, incorporated herein by reference.

The L1 protein or fragment of the invention may optionally be in the form of a fusion protein, such as the fusion of L1 protein with L2 or an initial protein.

The HPV L1 protein is suitably in the form of a virus equivalent capsomer or particle (VLP). In one aspect HPV VLPs may be used in the present invention. HPV VLPs and methods for producing VLPs are well known in the art. VLPs are typically constructed of the L1 and optionally L2 structural proteins of viruses, see for example WO 9420137, US5985610, WO 9611272, US6599508B1, US6361778B1, EP 595935. Any suitable HPV VLP can be used in the present invention by providing cross-protection such as as a VLP Ll or Ll + L2.

Suitably the VLP is an LL only VLP

In one aspect of the invention the vaccine comprises HPV 16 ll-only and HPV 18 VLPs, suitably in combination with a selected HPV 31 VLPs 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68, provided that the vaccine does not comprise VLPs of all HPV 31, 45 and 52.

VLP formation can be assessed by standard techniques such as, for example, electron microscopy and dynamic laser light scattering.

The VLP may comprise the life-size L1 protein. In one aspect the L1 protein used to form the VLP is a truncated L1 protein as described above.

VLPs can be made on any suitable cell substrate such as yeast cells or insect cells for example baculovirus cells and techniques for preparing VLPs are well known in the art such as WO 9913056, US 6416945B1, US 6261765B1 and US6245568 and references therein, the entire contents of which are hereby incorporated by reference.

VLPs are suitably manufactured by disassembly and reassembly techniques, which can provide more stable and / or homogeneous papillomavirus VLPs. For example, McCarthy et al, 1998 "Quantitative Disassembly and Reassembly of Human Papillomavirus Type 11 Lyke Particles In Vitro Virus" J. Virology 72 (1): 33-41, describe disassembly and reassembly of purified recombinant HPV 11 L1 VLPs from insect cells to obtain a homogeneous preparation of VLPs. WO 9913056 and US6245568 also describe disassembly / reassembly processes for manufacturing HPV VLPs.

In one aspect the HPV VLPs are manufactured as described in WO 9913056 or US6245568.

The HPV L1 of the invention may be combined with an adjuvant or immunostimulant such as, but not limited to, detoxified lipid A from any source and non-toxic lipid derivatives Aj saponins and other reagents capable of stimulating a TH1-like response.

It is well known that enterobacterial lipopolysaccharide (LPS) is a potent immune system booster, although its use in adjuvants has been restricted by its toxic effects. A non-toxic LPS derivative, monophosphoryl lipid A (MPL) produced by removal of the nucleus carbohydrate group and reducing end glycosamine phosphate, has been described by Ribi et al (1986, Immunology and Immunopharmacology of bacterial endotoxins, Plenum Publ Corp., NY, p407-419) and has the following structure:

<formula> formula see original document page 16 </formula> Another detoxified version of MPL results from the removal of the acyl chain from position 3 of the disaccharide backbone and is called 3-O-Deacylated monophosphoryl lipid A (3D-MPL) ). It can be purified and prepared by the methods disclosed in GB 2122204B, which reference also discloses the preparation of diphosphoryl lipid A and 3 O-deacylated variants thereof.

A suitable form of 3D-MPL is in the form of an emulsion having a small particle size of less than 0.2 μπα in diameter and its manufacturing method is disclosed in WO 94/21292. Aqueous formulations comprising monophosphoryl lipid A and a surfactant have been described in WO 9843670A2.

Bacterial lipopolysaccharide derived adjuvants to be formulated in the compositions of the present invention may be purified and processed from bacterial sources or alternatively they may be synthetic. For example, purified monophosphoryl lipid A is described in Ribi et al 1986 (supra) and 3-O-Deacylated monophosphoryl or diphosphoryl lipid A derived from Salmonella sp. are described in GB 2220211 and US 4912094. Other purified and synthetic lipopolysaccharides have been described (Hilgers et al, 1986, Int. Arch. Allergy. Immunol., 79 (4): 392-6; Hilgers et al, 1987, Immunology, 60 (1): 141-6; and EP 0 549 074 B1). In one aspect the bacterial lipopolysaccharide adjuvant is 3D-MPL.

Accordingly, the LPS derivatives that may be used in the present invention are those immunostimulants which are similar in structure to that of LPS or MPL or 3D-MPL. In another aspect of the present invention the LPS derivatives may be an acylated monosaccharide, which is a sub-portion of the above MPL structure.

Saponins are disclosed in: Lacaille-Dubois, M and Wagner H. (1996. A review of the biological and pharmacological activities of saponins. Phytomedicine vol 2 pp 363386). Saponins are steroid or triterpene glycosides widely distributed in the plant and marine animal kingdoms. Saponins are mentioned for forming colloidal water solutions that foam on agitation and to precipitate cholesterol. When saponins are close to cell membranes they create pore-like structures in the membrane which causes the membrane to rupture. Red blood cell hemolysis is an example of this phenomenon, which is a property of certain but not all saponins.

Saponins are known as adjuvants in vaccines for systemic administration. The adjuvant and hemolytic activity of individual saponins has been extensively studied in the technique (Lacaille-Dubois and Wagner, supra). For example, Quil A (derived from the bark of the South American Quillaja Saponaria Molina tree) and fractions thereof are described in US 5,057,540 and "Saponins as vaccine adjuvants", Kensil, CR, Crit Rev Ther Drug Carrier Syst, 1996, 12. (1-2): 1-55; and EP 0 362 279 BL Particulate structures, called Immune Stimulating Complexes (ISCOMS), comprising Quil A fractions are hemolytic and have been used in the manufacture of vaccines (Morein, B., EP 0 109 942 BI; WO 96/11711 WO 96/33739). Hemolytic saponins QS21 and QS17 (Quil A HPLC purified fractions) have been described as potent systemic adjuvants and the method of their production is disclosed in US Patent No. 5,057,540 and EP 0 362 279 BL Other saponins which have been used in studies Systemic vaccination include those derived from other plant species such as Gypsophila and Saponaria (Bomford et al., Vaccine, 10 (9): 572-577, 1992).

An enhanced system involves the combination of a non-toxic lipid A derivative and a saponin derivative particularly the combination of QS21 and 3D-MPL as disclosed in WO 94/00153 or a less reacogenic composition where QS21 is quenched with cholesterol as disclosed in WO 96/33739.

A particularly potent adjuvant formulation involving QS21 and 3D-MPL in an oil-in-water emulsion is described in WO 95/17210 and the use of these adjuvant forms is an aspect of the invention.

Accordingly in one embodiment of the present invention there is provided a detoxified lipid A adjuvanted vaccine or a non-toxic lipid A derivative, more suitably with adjuvant with a monophosphoryl lipid A or derivative thereof.

In one aspect the vaccine further comprises a saponin, for example QS21.

In one aspect the vaccine formulation comprises an oil in water emulsion. The present invention also provides a method for producing a vaccine formulation comprising mixing a peptide L1 of the present invention together with a pharmaceutically acceptable excipient such as 3D-MPL.

Additional components that may be included in a vaccine formulation according to the invention include nonionic detergents such as octoxynols and polyoxyethylene esters as described herein, particularly t-octylphenoxy polyethoxyethanol (Triton X-100) and polyoxyethylene sorbitan monooleate (Tween 80); and bile salts or cholic acid derivatives as described herein, in particular sodium deoxycholate or sodium taurodeoxycholate. Thus, in one aspect of the invention a formulation comprises 3D-MPL, Triton X-100, Tween 80 and sodium deoxycholate, which may be combined with an L2 antigen preparation to provide a suitable vaccine.

In one embodiment of the present invention, the vaccine comprises a vesicular adjuvant formulation comprising cholesterol, a saponin and an LPS derivative. In this regard the adjuvant formulation suitably comprises a unilamellar vesicle comprising cholesterol having a lipid bilayer suitably comprising dioleoyl phosphatidyl choline wherein the saponin and LPS derivative are associated with or embedded within the lipid bilayer. In one aspect these adjuvant formulations comprise QS21 as saponin and 3D-MPL as the derivative of LPSs wherein the ratio of QS2 lxolesterol is from 1: 1 to 1: 100 weight / weight and in one aspect a ratio of 1: 5 weight / weight. Such adjuvant formulations are described in EP 0 822 831 B, the disclosure of which is incorporated herein by reference.

Suitably the vaccines of the invention are used in combination with aluminum and are suitably adsorbed or partially adsorbed on aluminum adjuvants. Suitably the adjuvant is an aluminum salt, which may be in combination with MPL 3D, such as aluminum phosphate and MPL 3D. Aluminum hydroxide, optionally in combination with MPL 3D is also suitable.

In another aspect of the present invention the vaccine comprises combining HPV VLPs with an aluminum salt or an aluminum + MPL 3D salt. Aluminum hydroxide is suitable as aluminum salt.

The vaccine may also comprise aluminum or an aluminum compound as a stabilizer.

In another aspect the adjuvant may be a combination of an oil-in-water emulsion adjuvant and 3D MPL. In one aspect the oil-in-water emulsion comprises a metabolizable oil, a sterol and an emulsifying agent.

The vaccines of the invention may be provided by any of a variety of routes such as oral (e.g. see WO 9961052 A2), topical, subcutaneous, mucosal (typically intravaginal), intravenous, intramuscular, intranasal, sublingual, intradermal and through suppository.

Optionally the vaccine may also be formulated or co-administered with HPV antigens or non-HPV antigens. Suitably these non-HPV antigens may provide protection against other diseases such as sexually transmitted diseases such as herpes simplex virus, EBV, chlamydia and HIV. We particularly prefer that the vaccine comprises gD or one truncated thereof from HSV. Thus the vaccine provides protection against both HPV and HSV.

The dosage of vaccine components will vary with the individual's condition, gender, age and weight, route of administration and HPV of the vaccine. The amount can also be varied with the number of VLP types. Suitably the release is of an adequate amount of vaccine to generate an immunologically protective response. Suitably each vaccine dose comprises from 1 to 100 μg of each VLP, in an aspect of 5 to 80 μg, in another aspect of 5 to 30 μg of each VLP, in another aspect of 5 to 20 μg of each VLP, in yet another aspect 5 μ ^ 6 μg, 10 μg, 15 μg or 20 μg.

In one aspect the vaccine may comprise HPV L1 protein components, preferably as virus equivalent particles, in different amounts. In one aspect, HPV 16 and HPV 18 VLPs may be delivered at a higher dose than those of other oncogenic types, such as HPV 33 or 58. In one aspect only HPV 16 and HPV 18 ll VLPs are provided. at 20 μg per dose for human use. Other HPV VLPs may be used at a lower dose, such as 15 or 10 μg per dose for human use.

For all vaccines of the invention, in one aspect the vaccine is used for vaccination of adolescent girls aged 10 to 15, such as 10 to 13 years. However, older girls over 15 years old and adult women can also be vaccinated. The vaccine can also be given to women following an abnormal pap smear or after surgery following the removal of an HPV lesion or which are seronegative and DNA negative for HPV cancers. The vaccine of the invention may be used in men.

In one aspect the vaccine is released on a 2 or 3 dose regimen, for example on a 0, 1 month or 0.1 and 6 month regimen respectively. Suitably the vaccination regimen incorporates a booster injection after 5 to 10 years, such as 10 years.

In one aspect the vaccine is a liquid vaccine formulation, although the vaccine may be lyophilized and reconstituted prior to administration.

The disclosure of all references in this application, including patent applications and granted patents, are hereby incorporated by reference in their entirety.

The vaccines of the invention comprise certain HPV components as set forth above. In another aspect of the invention the vaccine essentially consists of or consists of said components.

The term 'vaccine' as used herein refers to a composition comprising an immunogenic component capable of eliciting an immune response in an individual, such as a human, optionally when properly formulated or with adjuvant. A vaccine suitably evokes a protective immune response against incident infection or persistent infection or cytological abnormality such as ASCUS, CIN1, CIN2, CIN3 or cervical cancer caused by one or more HPV types.

The present invention is now described with respect to the following examples which serve to illustrate the invention.

Example 1

Exact details of the experiment are provided in Harper et al, the Lancet. Nov 13, 2004; 364 (9447): 1757-65, incorporated herein by reference.

In summary, healthy women between the ages of 15 and 25 were immunized with a mixture of HPV 16 and HPV ll VLPs.

18. The women enrolled were: 1) seronegative for HPV-16 and HPV-18; 2) negative for high-risk cervical HPV infection (detected by HPV PCR); 3) had 6 or fewer partners in their sex life and 4) had normal PAP smears.

The mixture comprised, per 0.5 ml dose, 20 μg HPV-16 Ll VLP, 20 μg HPV-18 Ll VLP and was adjuvanted with 500 μg aluminum hydroxide and 50 μg 3D MPL . The placebo group was injected with 500 µg aluminum hydroxide alone.

The efficacy of the vaccine (V.E.) against certain types of HPV cancer was evaluated, in which the V.E. is the% improvement in protection against vaccine infection or disease compared to a placebo group.

Cross protection was assessed by detecting the presence of specific nucleic acid for various oncogenic types in the vaccines and control group. Detection was performed using techniques as described in WO 03014402 and references therein, particularly for non-specific HPV DNA amplification and subsequent detection of DNA types using a LiPA system as described in WO 99/14377 and Kleter et al. [ Journal of Clinical Microbiology (1999), 37 (8): 2508-2517], the entire contents of which are specifically incorporated herein by reference.

Any suitable method, however, can be used to detect HPV DNA in a sample, such as type-specific PCR using primers specific for each HPV of interest. Suitable primers are known to the skilled person or can be readily constructed as oncogenic HPV type sequences are known.

In detail, the methods section of the Lancet document is reproduced here below for full coverage (continues to section entitled "Initial analysis and results")

The primary objective of this study was to evaluate the efficacy of the vaccine in preventing infection with HPV-16, HPV-18 or both (HPV-16/18) between months 6 and 18 in participants who were initially shown to be HPV seronegative. -16/18 by ELISA and HPV-16/18 DNA negative by PCR. Included secondary objectives: evaluation of vaccine efficacy in the prevention of persistent HPV-16/18 infection and evaluation of vaccine efficacy in the prevention of cytologically confirmed low-grade squamous intraepithelial lesions (LSIL), high-grade squamous intraepithelial lesions (HSIL) ) and histologically confirmed LSIL (CIN 1), HSIL (CIN 2 or 3) of squamous cell cancer or adenocarcinoma associated with HPV-16/18 infection between months 6 and 18 and months 6 and 27. Cell prevention Atypical squamous cells of undetermined significance cytology (ASCUS) associated with HPV-16/18 infection were added post-hoc to the outcome analyzes.

We also performed an exploratory analysis of the CIN 1 and 2 histopathological endpoints associated with HPV-16/18 DNA detected by PCR in lesional tissue. Other objectives included the evaluation of vaccine immunogenicity, safety and tolerability. Researchers in North America (Canada and the USA) and Brazil recruited women for this efficacy study through advertisements or previous participation in an HPV epidemiology study from a representative sample that took place between July and December 2000. For each Of the 32 study sites, an institutional review board approved the protocol, consent forms and amendments. The women signed separate written consent for study participation and colposcopy. For those under 18, the consent and approval of the participant's parents was required.

There were two phases of the study: an initial phase for vaccination and follow-up that was completed in 18 months; and a blind follow-up extension phase that was completed in 27 months.

Women eligible for the early stage (months 0-18) included healthy women aged 15-25 who had no more than six sexual partners, no history of an abnormal Pap test or ablative or excisional cervical treatment. uterus and no ongoing treatment for external condyloma; and were cytologically negative, seronegative for HOPV-16 and HPV-18 antibodies by ELISA, and negative for HOPV DNA by PCR for the 14 high-risk HPV types (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68) no more than 90 days prior to study entry.

Women who completed the initial phase of the study earlier and who did not have ablative or excisional cervical therapy or hysterectomy after enrollment were eligible to participate in the extension phase of the study (18 to 27 months).

Procedures

Each dose of the divalent HPV-16/18 virus equivalent particle vaccine (GlaxoSmithKline Biologicals, Rixensart, Belgium) contained 20 μg of HPV-16 ll virus equivalent particle and 20 μg of HPV ll virus equivalent particle. -18. Each virus equivalent particle type was produced on a Spodoptera frupperda Sf-9 and Trichoplusia ni Hi-5 cell substrate with AS04 adjuvant containing 500 μg aluminum hydroxide and 50 μg 3-deacylated lipid A monophosphoryl (MPL, Corixa, Montana, USA) supplied in a single dose vial. The placebo contained 500 μg aluminum hydroxide per dose and was identical in appearance to the HPV-16/18 vaccine. Each study participant received a 0.5 ml dose of vaccine or placebo at 0 months, 1 month and 6 months. Health care providers obtained cervical specimens with a cervical brush and spatula (washed at PreservCyt, Cytyc Corporation, Boxborough, MA, USA) for screening cytology and HPV DNA testing at months 6, 12, and 18. At months 0 and 6 and thereafter every 3 months, women self-obtained cervicovaginal specimens with two sequential swabs (placed on PreservCyt) for HPV DNA testing. [DM Harper, WW Nolls DR Belloni and BF. Cole, Randomized clinical trial of PCR-determined human papillomavirus detection methods: self-sampling versus clinician-directed-biological agreement and women's preferences. Am J Obstet Gynecol 186 (2002), p. 365-373] A central laboratory (Quest Diagnosticsi Teterboro, NJ, USA) reported cytology results (ThinPrep, Cytyc Corporation) using the Bethesda 1991 grading system. Protocol guidelines recommended colposcopy after two reports of ASCUS or a report of atypical glandular cells of undetermined significance, LSIL or HSIL, squamous cell carcinoma, in situ adenocarcinoma or adenocarcinoma. These guidelines also recommended biopsy for any suspected injury.

The central histology laboratory made an initial diagnosis of formalin-fixed tissue specimens for clinical control. A panel of three pathologists made a subsequent consensus diagnosis for lesions associated with HPV-16 and HPV-18 with the CIN system. This consensus diagnosis also included a review of the sections collected at the time of microdissection for PCR detection of lesional HPV DNA.

HPV DNA isolated from the cytology specimen (MagNaPure Total Nucleic Acid system, Roche Diagnostics, Almere, The Netherlands) and cervical biopsy specimen (proteinase K extraction) was amplified from an aliquot of purified total DNA with the spectrum primers. broad SPFlO amplifying a 65 base pair region of the LL gene [B Kleter, LJ van Doom, Jter Schegget et al., Novel short-fragment PCR assay for highly sensitive broad-spectrum detection of anogenital human papillomaviruses. Am J Pathol 153 (1998), p. 1731-1739: LJ van Doom, W. Quint, B. Kleter et al. Genotyping of human papillomavirus in cervical cytology specimens by the PGMY Iine blot assay and the SPF (IO) Iine probe assay. J Clin Microbiol 40 (2002), p. 979-983 and WG Quint, G Scholte, LJ van Dooms B Kleter, PH Smits and J. Lindemano, Comparative analysis of human papillomavirus infections in cervical scrapes and biopsy specimens by general SPF (IO) PCR and HPV genotyping. J Pathol 194 (2001), p. 51-58] Amplification products were detected by a DNA enzyme immunoassay. An in-line probe assay (LiPA INNO HPV Kit LiPA HPV genotyping assay, SPF-10 version 1 system, Innogenetics5 Gent, Belgium, manufactured by Labo Biomedical Products, Rijswijk, The Netherlands) detected 25 HPV genotypes (6, 11, 16 , 18, 31, 33, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70 and 74). [B Kleter, L. van Doom, L. Schrauwen et al., Development and clinical evaluation of a highly sensitive PCR-reverse hybridization Iine probe assay for detection and identification of anogenital human papillomavirus. J Clin Microbiol 37 (1999), p. 2508-2517] Any specimen that was positive by DNA enzyme immunoassay was tested by HPV-16 and HPV-18 type-specific PCR. HPV-16 type-specific PCR primers amplified a 92 base pair segment of the E6 / E7 gene and HPV-18 type-specific OCR primers amplified a 126 base pair segment of the LL gene [MF Baay , WG Quint, J Koudstaal et al., Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas. J Clin Microbiol 34 (1996), p. 745-747]

We defined incident HPV-16/18 cervical infection as at least one HPV-16 or HPV-18 positive PCR result during the test and persistent HPV-16/18 infection as at least two positive PCR assays. HPV DNA for the same viral genotype at least 6 months apart. [H. Richardson, G. Kelsall, P. Tellier et al., The Natural History of Type-Specific Human Papillomavirus Infections in Female University Students. Cancer Epidemiol Biomarkers Prev 12 (2003), p. 485-490 and AB Moscickij JH Ellenberg, S Farhat and J. Xui Persistence of human papillomavirus infection in HIV-infected and -infected adolescent girls: risk factors and differences, by philogenetie type. J Infect Dis 190 (2004), p. 37-45] HPV DNA test results were concealed from investigators during the study and cytological and histological diagnoses were only revealed for clinical control purposes. Analyzes included HPV-16/18 DNA results for cervical specimens and combined self-obtained cervical and cervicovaginal specimens.

We collected serum from study participants at months 0, 1, 6, 7, 12, and 18 for immunogenicity assessment. Serological testing for antibodies to HPV-16 and HPV18 virus equivalent particles was by ELISA. Recombinant HPV-16 or HPV-18 virus equivalent particles were used as coating antigens for antibody detection (see appendix http://image.thelancet.com/extras/ 04art 10103webappendix.pdf). Seropositivity was defined as a titer greater than or equal to the cut-off titer titre set at 8 ELISA units / mL for HPV-16 and 7 ELISA units / mL for HPV-18. Typical natural titers were determined by the use of blood samples obtained from women in the previous epidemiology study that were found to be HPV-16 or HPV-18 seropositive by ELISA.

Women recorded the symptoms experienced during the first 7 days after vaccination on the daily cards with a three-degree scale of symptom intensity. In addition, they reported to study staff by interview all adverse effects within the first 30 days after vaccination. Information on serious adverse events and pregnancy was collected throughout the study.

Statistical methods

Assuming a cumulative 6% incidence rate of both HPV-16 and HPV-18 infection at 12 months, we estimate that 500 women per treatment group would provide 80% mastery to assess a lower limit of 95% IC. of vaccine efficacy above zero. We assume an 80% retention rate in 18 months. Intermediate analyzes for efficacy, safety and immunogenicity were performed for future study planning purposes only; The 0'Brien and Fleming method was used to adjust the value for the final analysis after the intermediate analyzes occurred (total α = 0.05; bilateral assay). [PC O'Brien and TR. Fleming, A multiple testing procedure for clinical trials. Biometrics 35 (1979), p. 549556]

Stratified block randomization according to validated algorithms was centralized with an internet randomization system. Stratification was according to age (15 to 17, 18 to 21 and 22 to 25 years) and region (North America and Brazil). Each vaccine dose was assigned a randomly chosen number based on the specific participant information entered into the computerized randomization system by the study staff. The distribution of treatment remains hidden from researchers and women participating in a long-term follow-up study.

The intention-to-treat and protocol-based groups are shown in the figure, in which the reasons for exclusion from analysis are listed in the classification; Women who met more than one exclusion criterion were counted only once according to the highest classification criterion. We refer to the sets of participants introduced in the intent-to-treat analyzes and according to protocol as groups, although the information used to restrict patient inclusion in the according to protocol was only known after follow-up. We performed the analyzes according to protocol and intention to treat as well as efficacy. Calculation of vaccine efficacy in the 18-month analysis according to the protocol was based on the proportion of participants with HPV-16/18 infection in the vaccinated versus placebo groups. Vaccine efficacy was defined as 1 minus the ratio between these two proportions; 95% of CIs measured the accuracy of efficacy estimates. The ρ values were calculated with the bilateral Fisher exact test. Corresponding ratios were expressed as case numbers with the result divided by the numbers of participants at risk. The 18-month group according to the protocol included enlisted women who received three scheduled doses of vaccine and complied with the protocol as described in the figure.

Calculation of vaccine efficacy in the 27 month intention-to-treat and protocol-based analyzes was based on the Cox proportional hazard model using the time to occurrence of HPV-16/18 infection cases in the vaccinated versus placebo groups. . This allowed us to control for the accumulated Tempo-persona data in each group. Vaccine efficacy was calculated using 1 minus the risk ratio and ρ values calculated using the log classification test. Corresponding rates were expressed as the number of cases divided by the total Tempo-persona. All women enrolled who received at least one dose of vaccine or placebo were negative for high-risk HPV DNA at month 0 and no data available for outcome measurement were included in the intention-to-treat group.

The 27-month protocol group included results from the 18-month protocol group and results that occurred during the extension phase (from 18 months to 27 months).

Calculation of ρ values for safety analysis was performed using Fisher's exact test comparisons. The safety analysis group included all enlisted women who received at least one dose of vaccine or placebo and met the specified minimum protocol requirements (see protocol below :) <figure> figure see orginal document page </figure>

Immunogenicity was evaluated in a subset of the safety group according to the protocol, which included women with serology results at months 0, 7, and 18 who received all three doses of study vaccine or placebo according to the program, complied with the blood sampling program and did not become HPV-16/18-DNA positive during the test. Seropositivity rates between the vaccine and placebo groups were compared with Fisher's exact tests (p <0.001 judged The mean geometric titles were compared with the ANOVA and Kruskal-Wallis tests.

Block randomization and statistical analyzes were performed with SAS version 8.2 (SAS Institute5 Cary, North Carolina).

Initial analysis and results

The results of the initial cross protection analysis are presented in patent application WO 2004/056389, the entire contents of which are incorporated herein by reference.

An initial analysis was performed on an "ITT" (Intention for Treatars group representing all subjects who received at least one vaccine dose). These data are shown in Table A.

The results presented in the BeC Tables refer to the "ATP" group (According to Protocol) for those patients who met all the test criteria. Table B is an intermediate point analysis with data taken from all patients at the time point at least 50% of the group was 18 months after their first vaccination. Table C gives the final results, all data being from patients 18 months after the first vaccination (month 0). In the ATP group all patients received 3 doses of vaccine at 0, 1 and 6 months and were seronegative at 6 months.

As shown by the data presented in Table A, immunization with a mixture of HPV 16 and HPV18 VLPs provided apparent cross protection against other HPV types. At this point sample sizes are too small to provide accurate statistical analysis, however the data show a positive trend and suggests that immunization with HDPV 16 and HPV 18 VLPs will be effective against infection with other HPV types.

This was confirmed as the study progressed.

Table B shows that HPV 16 and HPV 18 provide statistically significant cross-protection against the high-risk cancer group 31, 33, 35, 39,45, 51, 52, 56, 58, 59, 66 and 68.

Table C shows that, except for HPV-18-related types (which show a very strong tendency), there is statistically significant cross-protection against the groups of: HPV types 31, 35, 58; HPV 31, 33, 35, 52, 58; and the 12 high-risk (non-HPV-16/18) assessed.

Another analysis was performed on specific cross-protection against specific types.

Vaccine efficacy was evaluated against infections and diseases related to the 12 high-risk cancer types 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68, HPV phylogenetic related types -16 (the groups of; 31, 35 and 58; 31, 33, 35, 52 and 58) and HPV-18 phylogenetic related types (45 and 59).

An analysis was performed on an "ATP" group (According to Protocol) for those patients who met all the test criteria. In the ATP group all patients received 3 doses of vaccine at 0, 1 and 6 months and were seronegative at 6 months.

As shown by the data presented in Table D, immunization with a mixture of HPV16 and HPV18 VLPs provided statistically significant cross-protection against incident HPV 31, 52, and 45 infection compared with the control.

Statistically significant cross-protection against incident infection was also observed against the HPV 16-related group of all types (HPV-31, 33, 35, 52, and 58) and the all-risk group excluding 16 and 18 (HPV 31,33,35,39,45,51,52,56,58,59,66 and 68). Statistically significant cross-protection against persistent infection was also observed against types 31 and 52 and was also observed against the group of all HPV-related types .16 (see Table E).

Statistically significant cross-protection was observed against cytological abnormalities associated with HPV 52 and was also observed against cytological abnormalities associated with the HPV 16-related group of all types (HPV-31, 33, 35, 52, and 58). group of all high risk types, excluding 16 and 18 (31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68) (Table F).

Table A

<table> table see original document page 34 </column> </row> <table>

Samples were collected at 9, 12, 15, and 18 months from the patients and tested for HPV infection by the types specified above.

Table B - Vaccine efficacy after three doses in preventing incident heterologous infections.

Vaccine efficacy against infection with HPV-16 phylogenetically related types, HPV-18 phylogenetically related types, HPV-16 and / or HPV-18 phylogenetically related types, and all HPV-16 and HPV exclusive high-risk types -18 - ATP group (6 to 18 months)

<table> table see original document page 35 </column> </row> <table>

N = number of patients in specific group η = number of patients with incident HPV infection AR = Attack ratio = n / N

95% CI = 95% confidence interval lower limit = 1 - exp (Yog (arv / arp) + 1.96 * root q. (1 / nv - 1 / Nv + 1 / np - l / Np)) limit higher = 1 - exp (Yog (arv / arp) - 1.96 * root q. (1 / nv-1 / Nv + 1 / np-1 / Np)) when the number of cases in the vaccine = O :. lower bound * = 1 - exp (Yog (arv * / arp *) + 1.96 * root q (l / (nv + 0.5) - l / (Nv + 0.5) + l / (np + 0 , 5) - l / (Np + 0,5))) upper bound * = 1 - exp (Yog (arv * / arp *) - 1,96 * root q. (L / (nv + 0,5) - l / (Nv + 0.5) + l / (np + 0.5) - l / (Np + 0.5))) with: arv = attack rate of vaccine recipients arp = attack rate of vaccine recipients placebo nv = number of cases at vaccine recipients Nv = number of cases at vaccine recipients np = number of cases at placebo recipients Np = number of cases at placebo recipients

Related HPV-16: Phylogenetically related types HPV-16 35, 31, 58 without regard to other HPV-related types HPV-16 *: Phylogenetically related HPV-16 types 35, 31, 58, 33, 52 without considering other types of HPV

Related HPV-18: Phylogenetically related types

HPV-18 45, 59 without considering other HPV types

HPV-16 and / or related HPV-18: phylogenetically types

related to the HPV-16 and / or HPV-18 35, 31, 58, 45, 59

without considering other HPV types

HPV-16 and / or related HPV-18 *: phylogenetically types

related to HPV-16 and / or HPV-18 35, 31, 58, 33,

52, 45, 59 without considering other HPV types

* * = HPV-16 and HPV-18 exclusive high-risk types Table C

<table> table see original document page 36 </column> </row> <table>

Samples were collected from 18 months of patients and tested for HPV infection by the types specified above.

Table D

Effectiveness against incident infections with 16/18 * related types

<table> table see original document page 36 </column> </row> <table> * Cervical samples: ATP group Table E

Efficacy against persistent infections with 16/18-related types *

<table> table see original document page 37 </column> </row> <table>

* All Samples: ATP group

Table F

Effectiveness against cytological abnormalities ass. with related types 16/18 *

<table> table see original document page 37 </column> </row> <table>

* ATP Group In tables D5 E and F,

N = number of patients in specific group AR = Attack Ratio = η (number of patients with incident infection, persistent infection or HPV cytological abnormality as appropriate to the table) / N

% vaccine efficacy is 1 - (A / B) χ 100, adjusted for relative vaccine group and placebo size, where

A =% of women in the vaccine group with incident infection, persistent infection or cytological abnormality, as appropriate for the table.

B =% of women in the placebo group with incident infection, persistent infection or cytological abnormality, as appropriate for the table. LIST OF SEQUENCES

<110> Glaxosmithfclins biologicals <120> VACCINE

<130> b45331-l

<150> 11/114301 <151> 2005-04-26

<150> 11/367601 <151> 2005-12-16

<150:> PCT / EP2005 / 006461 <151> 2005-06-14

<160> 6

<170> FastSEQ for Windows Version 4.0

<210> 1 <211> 471 <212> PRT

<213> HUMAN PAPILOMA VIRUS PARTIAL SEQUENCE hpv 16

<400> 1

Met Seru Leu Trp Leu Pro Be Glu Wing Thr Val Tyr Leu Pro Pto Val

1 5 10 15

Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Wing Arg Thr Asn

20 25 30

Ile Tyr Tyr His Wing Gly Thr Be Arg Read Leu Wing Val Gly His Pro

35 40 45

Tyr Phe Pro Ile Lys Pro Lys Pro Asn Asn Pro Lys Xle Read Val Pro Lys

50 55 60

Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro 65 70 75 80

Asn Lys Phe Gly Phe Pro Asp Thr Be Phe Tyr Asn Pro Asp Thr Gln

B5 90 95

Arg Leu Val Trp Cys Wing Val Gly Val Glu Val Gly Arg Gly Gln Pro 100 105 on Leu Gly Val Gly Ile Ser Gly His Pro Leu Asu Lys Leu Asp Asp

115 120 125

Thr Glu Asn Wing Be Wing Tyr Wing Wing Asn Wing Gly Val Asp Wing. Arg

130 135 140

Qlu Cys Xle Be Met Asp Tyr Lys Gln Thr Gln Read Cys Read Ile Gly 145 150 155 160

Cys Lys Pro Pro lie Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr

155 170 175

Asn Val Val Wing Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn

180 185 190

Thr Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Met Wing

195 200 205

Asp Phe Thr Thr Read Gln Wing Asn Lys Ser Glu Val Pro Read Asp Ile

210 215 220

Cys Thr Be Ile Cys Lys Tyr Pro Asp Tyr Ile Lye Met Val Ser Glu 225 230 235 240

Pro Tyr Gly Asp Being Read Phe Phe Tyr Read Arg Arg Glu Gln Met Phe

245 250 255

Val Arg His Leu Phe Asn Arg Wing Gly Wing Val Gly Glu Asn Val Pro

260 265 270

Asp Asp Leu Tyr Ile Lys Gly Ser Gly Be Thr Wing Asn Leu Wing Ser

275 280 285

Be Asn Tyr Phe Pro Thr Be Gly Be Met Val Thr Be Asp Wing

290 295 300

Gln Ile Phe Asn Lys Pro Tyr Trp Read Gln Arg Wing Gln Gly His Asn 305 310 315 320

Asn Gly Ile Cys Trp Gly Aen Gln Read Phe Val Val Val Val Asp Thr

325 330 335

Thr Arg Be Thr Asn Met Be Read Cys Wing Wing Ile Be Thr Be Glu

340 345 350

Thr Thr Tyr Lys Asn Thr Thr Asn Phe Lys Glu

355 360 365

Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr

370 375 380

Wing Asp Val Met Thr Tyr Ile His Be Met Asn Be Thr Ile Leu Glu 385 390 395 400

Asp Trp Asn Phe Gly Leu Gln Pro Pro Gly Gly Thr Leu Glu Asp

405 410 415

Thr Tyr Arg Phe Val Thr Be Gln Wing Ile Wing Cys Gln Lys His Thr

420 425 _ 430

Pro Pro Wing Pro Lys Glu Asp Pro Read Lys Lys Tyr Thr Phe Trp Glu

435 440 445

Val Asn Leu Lys Glu Lys Phe Ser Wing Asp Leu Asp Gln Phe Pro Leu 450 455 460 Gly Arg Lys Phe Lbu Leu Gln 455 470

<210> 2 <2I1> 472 <212> PRT

* 213> HUMAN PAPILOMA VIRUS PARTIAL SEQUENCE hpv 18

<400> 2

Met Wing Leu Trp Arg Pro Be Asp Asn Thr Val Tyr Leu Pro Pro

15 ID

Ser goes Ala Arg Val goes Asn Thr Asp Asp Tyr Val Thr Arg Thr

20 25 30

IlG Phe Tyr His Wing Gly Be Ser Arg Read Leu Thr Val Gly Asn Pro

35 40 45

Tyr Phe Arg Val Pro Gly Wing Gly Gly Asly Lys Gln Asp Ile Pro Lys

50.55 SO

Val Ser Wing Tyr Gln Tyr Arg VaX Phe Arg Val Gln Lea Pro Asp Pro 65 70 75 80

Asn Lys Phe Gly Leu Pro Asp Asn Ser Ile Tyr Asn Pxo Glu Thr Gln

85 90 95 '

Arg Leu Val Trp Cys Wing Val Gly Val Glu Ile Gly Arg Gly GIti Pro

100 105 HO

Read Gly Val Gly Read Be Gly His Pro Phe Tyr Asn Lys Read Asp Asp

115 120 125

Thr Glu Be Be His Wing Ward Thr Be Asn Val Be Glu Asp Val Arg

130 135 140

Asp Asn Val Ser Val Asp Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly 145 150 155 160

Cys Wing Pro Ile Wing Gly Glu His Trp Wing Lys Gly Thr Wing Cys I.ys

165 Í70 175

Be Arg Pro Read Be Gln Gly Asp Cys Pro Be Read Glu Leu Lys Asn

180 185 190

Thr Val Leu Glu Asp Gly Asp Met Val Asp Thr Gly Tyr Gly Met Wing

195 200 205

Asp Phe Ser Thr Thr Read Gln Aep Thr Lys Cys Glu Val Pro Read Asp Ile

210 215 220

Cys Gln Ser Ile Cys Lys Tyr Pro Asp Tyr Read Gln Met Ser Wing Asp 225 230 235 240

Pro Tyr Gly Asp Being Met Phe Phe Cys Leu Arg Arg Glu Gln Leu Phe

245 250 255

Arg Wing His Phe Trp Asn Arg Wing Gly Thr Met Gly Asp Val Thr 260 265 270 Pro Be Read Tyr Ile Lys Qly Thr Gly Met Arg Wing Be Pro Gly Ser

275 2β0 285

Cys Val Tyr Be Pro Be Pro Be Gly Be Ile Val Thr Be Asp Ser

290 295 300

Gln Read Phe Asn Lys Pro Tyr Trp Iieu His Lys Wing Gln Gly His Asn 305 310 315 320

Asn Gly Val Cye Trp Ris Asn Gln Read Phe Val Val Val Asp Thr

325 330 335

Thr Arg Be Thr Aen Leu Thr Ile Cys Wing Be Thr Gln Be Pro Val

340 345 350

Pro Gly Gln Tyr Asp Wing Thr Lys Phe Lys Gln Tyr Be Arg His

355 360 365

Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Thr Ile Thr Leu

370 375 3BO

Thr Wing Asp Val Met Ser Tyr Ile His Ser Met Asn Ser Ser Ile Leu 385 390 395 400

Glu Asp Trp Asn Phe Gly Val Pro Pro Pro Pro Thr Thr Be Leu Val

405 410 415

Asp Thr Tyr Arg Phe Val Gln Ser Val Wing Ile Thr Cys Gln Lys Aap

420 425 430

Wing Wing Wing Wing Glu Asn Lys Asp Pro Tyr Asp Lys Leu Lye Phe Trp

435 440 445

Asn Val Asp Leu Lys Glu Lys Phe Ser Leu Asp Leu Asp Gln Tyr Pro

450 455 460

Read Gly Arg Lys Phe Read Val Gln 465 470

<210> 3 <211> 1416 <212> DNA

<213> HUMAN PAPILOMA VIRUS PARTIAL SEQUENCE hpv 16

<400> 3 atgCctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaag € 0 gttgeaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120 agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180 ttagttccta aagtatcagg attacaatac agggtattta gaatacattt acctgacccc 240 aataagtttg gttttcctga cacctcattt tataatccag atacacagcg gctggtttgg 300 gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtgggcat taStggccat 360 cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420 gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg cttaattggt 4 & 0 tgcaaaccac ctatagggga acactggggc aaaggatccc catgtaccaa tgttgcagta 540 aatccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatacg 600 gttgatactg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660 ccactggata tttgtacatc tatttgcaaa tatccagatt atattaaaat ggtgccagaa 720 ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tagacattta 780 tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840 g ggtctactg caaatttagc cagttcaaat tattttccta caectagtgg ttctatggtt SOO acctctgatg cccaaatatt caataaacct tattggttac aacgagcaca gggccacaat 960 aatggcattt gttggggtaa ccaactattt gttactgttg ttgatactac acgcagtaca 1020 aatatgtcat tatgtgctgc catatctact tcagaaacta catataaaaa tactaactet 1080 aaggagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140 ataaccttaa ctgcagacgt tatgacatac atacattcta tgaattccac tattttggag 1200 gactggaatt ttggtctaca acctccccca ggaggcacac tagaagatac ttataggttt 1260 gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320 cttaaaaaat acactttttg ggaagfcaaat ttaaaggaaa agttttctgc agacctagat 1380 cagtttcctt taggacgcaa atttttact ca 14

<210> 4 <211> 1419 <212> DNA

<213> HUMAN PAP1L0MA PARTIAL VIRUS PART SEQUENCE hpv 18

<400> 4

atggctttgt ggcggcctag tgacaatacc gtatatcttc cacctccttc tgtggcaaga 60 gttgtaaata ccgatgatta tgtgactcgc acaagcatat tttatcatgc tggcagctct 120 agattattaa ctgttggtaa tccatatttt agggttcctg caggtggtgg caataagcag 180 gafcattccta aggtttctgc ataccaatat agagtattta gggtgcagtc acctgaccca 240 aataaacttg gtttacctga taatagtatt tataatcctg aaacacaacg tttagtgtgg 300 gagtggaaat tggccgtggt cagcctttag gcctgtgttg gtgttggcct tagtgggcat 360 ccattttata ataaattaga tgacactgaa agttcceatg ccgccacgtc taatgtttct 420 gaggacgtta gggacaatgt gtctgtagat tataagcaga cacagttatg tatttfegggc 480 tgtgcccctg ctattgggga acactgggct aaaggcactg cttgtaaatc gcgtccttta 540 tcacagggcg attgcccccc tttagaactt aaaaacacag ttttggaaga tggtgatatg 600 gtagatactg gatatggtgc catggacttt agtacattgc aagatactaa atgtgaggta 660 ccattggata tttgtcagtc tatttgtaaa tatcctgatfc atttacaaat gtctgcagat 720 ccttatgggg attccatgtt tttttgctta cggcgtgagc agctttttgc taggcatttt 780 tggaataggg caggtactat gggtgacact gtgcctccat ccttatatat taaaggcaca 640 ggtatgcgtg cttcacc TGG cagctgtgtg tattctccct ctccaagtgg ctctattgtt 900 acctctgact cccagttgtt taataaacca tattggttac ataaggcaca gggtcataac 960 aatggtgttt gctggcataa tcaattattt gttactgtgg tagataccac tcgcagtacc 1020 aatttaacaa tatgtgcttc tacacagtct cctgtacctg ggcaatatga tgctaccaaa 1080 tttaagcagt atagcagaca tgttgaggaa tatgatttgc agtttatttt tcagttgtgt 1140 actattactt taactgcaga tgttatgtcc tatattcata gtatgaatag cagtatttta 1200 gaggattgga actttggtgt tccccccccg ccaactacta gtttggtgga fcacatatcgt 1250 tttgtacaat ctgttgctat tacctgtcaa aaggatgctg caccggctga aaataaggat 1320 ccctatgata agttaaagtt ttggaatgtg gatttaaagg aaaagttttc tttagactta 1380 gatcaatatc cccttggacg taaatttttg gttcagtaa

1419

<210> 5 <211> 1419 <212> DNA

<213> HUMAN PAPILOMA VIRUS PARTIAL SEQUENCE hpv 31

<400> 5 atgtctctgt ggcggcctag cgaggctact gtctacttac cacctgtccc agtgtctaaa 60 gttgtaagca cggatgaata tgtaacacga accaacatat attatcacgc aggcagtgct 120 aggctgctta cagtaggcca tccatattat tccatadcta aatctgacaa tcctaaaaaa 180 atagttgtac caaaggtgtc aggattacaa tatagggtat ttagggttcg tttaccagat 240 ccaaacaaat ttggattccc tgatacatct ttttataatc ctgaaactca acgcttagtt 300 tgggcctgtg ttggtttaga ggtaggtcgc gggcagccat taggtgtagg tattagtggt 360 catccattat taaataaatt tgatgacact gaaaactcta atagatatgc cggtggtcct 420 ggcactgata atagggaatg tatatcaatg gattataaac aaacacaact gtgtttactt 430 ggttgcaaac cacctattgg agagcattgg ggtaaaggta gtccttgtag taacaatgct 540 attacccctg gtgattgtcc tccattagaa ttaaaaaatt cagttataca agatggggat 600 atggttgata caggctttgg agctatggat ttfcacfcgctt tacaagacac taaaagtaat 660 gttcctttgg acatttgtaa ttctatttgt aaatatccag attatcttaa aatggttgct gcgatacatt atttttttat gagccatatg 720 ttacgtaggg aacaaatgtt tgtaaggcat 780 ttttttaata gatcaggcac ggttggtgaa toggfccccta ctgacttata tatfcaaaggc 840 tcc ggttcaa cagctactct agctaacagt acatactttc ctacacctag cggctccatg 900 gttacttcag atgeacaaat ttttaataaa ccatattgga tgcaacgtgc tcagggacac 960 aataatggta tfctgttgggg caatcagtta tttgttactg bggtagatac cacacgtagt 1020 accaatatgt ctgtttgtgc tgcaattgca aacagtgata ctacatttaa aagtagtaat 1080 tttaaagagt atttaagaca tggtgaggaa tttgatttac aatttatatt tcagttatgc 1140 aaaataacat tatctgcaga cataatgaca tatattcaca gtatgaatcc tgctatcttg 1200 gaagattgga attttggatt gaccacacct ccctcaggfcfc ctttggagga tacctatagg 1260 tttgtcacct cacaggccat tacatgtcaa aaaactgccc cccaaaagcc caaggaagat 1320 ccatttaaag attatgtatt Ctgggaggtt aatttaaaag aaaagttttc tgcagattta 1380 gateagtttc cactgggtcg caaattttta ttacagtaa 1419

<2I> s <211> 1428 <212> DNA

<213> HUMAN PAPILOMA VIRUS PARTIAL SEQUENCE hpv 45

<400> 6

atggctttgt ggcggcctag fcgacagtacg gtatatcttc caccaccttc tgtggccaga 60 gttgtcaaca ctgatgatta tgtgtctcgc acaagcatat tttaccatgc aggcagttcc 120 cgattattaa ctgtaggcaa tccatatfctt agggttgtac ctagtggtgc aggtaataaa 180 caggctgttc ctaaggtatc cgcatatcag tatagggtgt ttagagtagc 240 tttacccgat

cctaataaat ttggattacc tgaccctact atatataatc ctgaaacaca acgtttggtt 300 tgggcatgtg taggtatgga aattggtcgt catccatttt ataataaatt ggatgataca acgcaggatg ttagggataa tgtgtcagtt ggttgtgtac ctgctattgg tgagcactgg ttgcagcctg gtgactgtcc fccctttggaa atggtggata caggttatgg ggcaatggat gttccattag acatttgtca atccatctgt gatccctatg gggattctat gtbtttttgc ttttggaata gggcaggtgt tatgggtgac actagcgcta atatgcgtga aacccctggc cctattatta cttctgattc tcaattattt ggccataaca atggtatttg ttggcataat cgcagtacta atttaacatt atgtgcctct cctactaagt fcfcaagcaota tagtagacat cagttgtgca ctattacttt aactgcagag agtatattgg aaaattggaa ttttggtgta acatatcgtt ttgtgcaatc agttgctgtt aagcaggatc catatgataa attaaagttt tccgatttgg atcaatatcc ccttggtcga

gggcagcctt taggtattgg cctaagtggc 360 gaaagtgctc atgcggctac ggctgttgtt 420 gattataagc aaacacagct gtgtatttta 480 gccaagggca cactttgtaa acetgcacaa 540 cttaaaaaca ccattattga ggatgstgafc 600 tttagtacat tgcaggatac aaagtgcgag 660 aaacatccag attatttgca aatgtctgct 720 ctacgccgtg aacaactgtt tgcaagacat 780 acagtaccta cagacctata tattaaaggc 840 agttgtgtgt attccccttc tcccagtggc 900 aataagccat attggttaca taaggcccag 960 cagttgtttg ttactgtagt ggacactacc 1020 acacaaaatc ctgtgccagg tacatatgat 1080 gtggaggaat atgafcttaca gtttatfcttt 1X40 gttatgtcat atatccatag Catgaatagt 1200 cctccaccac ctactacaag tttagtggat 1260 acctgtcaaa aggatactac acctccagaa 1320 tggactgtta 14tagttatatagtaaagtagtagagtagta

Claims (45)

Multivalent HPV vaccine, characterized in that it comprises L1 proteins or immunogenic fragments thereof of HPV .16, HPV 18 and at least one other type of oncogenic HPV, wherein a L1 protein or immunogenic fragment thereof of one or more More HPV types selected from the group consisting of HPV 31, HPV 45, and HPV 52 are omitted from the vaccine and the vaccine provides protection against infection caused by the omitted HPV type. Vaccine according to claim 1, characterized in that an L1 protein or immunogenic fragment thereof of HPV .31 is omitted from the vaccine. Vaccine according to claim 1, characterized in that an L1 protein or immunogenic fragment thereof of HPV.45 is omitted from the vaccine. Vaccine according to claim 1, characterized in that a protein L1 or immunogenic fragment thereof of HPV.52 is omitted from the vaccine. Vaccine according to claim 1, characterized in that an L1 protein or immunogenic fragment thereof from HPV. 31 and HPV 45 is omitted from the vaccine. Vaccine according to claim 1, characterized in that a protein L1 or immunogenic fragment thereof of HPV .31 and HPV 52 is omitted from the vaccine. Vaccine according to claim 1, characterized in that an L1 protein or immunogenic fragment thereof of HPV.45 and HPV 52 is omitted from the vaccine. Vaccine according to claim 1, characterized in that an L1 protein or immunogenic fragment thereof of HPV .31 and HPV 45 and HPV 52 is omitted from the vaccine. Vaccine according to claim 1, characterized in that the vaccine protects against incident infection. Vaccine according to claim 1, characterized in that the vaccine protects against persistent infection. Vaccine according to claim 1, characterized in that the other type of oncogenic HPV is HPV 33. Vaccine according to claim 1, characterized in that the other type of oncogenic HPV is HPV 58. Vaccine according to claim 1, characterized in that the other type of oncogenic HPV is HPV 59. Vaccine according to claim 1, characterized in that it comprises the HPV 16 ll protein or immunogenic fragment thereof, the HPV 18 ll protein or immunogenic fragment thereof, the HPV 33 ll protein or immunogenic fragment thereof. and HPV 58 L1 protein or immunogenic fragment thereof. Vaccine according to claim 1, characterized in that at least one of the L1 proteins or fragments thereof is in the form of a virus equivalent particle. Vaccine according to claim 1, characterized in that at least one of the L1 proteins is a truncated L1 protein. Vaccine according to claim 16, characterized in that the at least one L1 protein is a C-terminal truncated L1 protein. Vaccine according to claim 1, characterized in that it further comprises an adjuvant. Vaccine according to claim 18, characterized in that the adjuvant is an aluminum salt. Vaccine according to claim 19, characterized in that the adjuvant is aluminum hydroxide. Vaccine according to claim 18, characterized in that the adjuvant is MPL 3D. Vaccine according to claim 18, characterized in that the adjuvant is 3D MPL and aluminum hydroxide. Vaccine according to claim 18, characterized in that the adjuvant is an oil-in-water emulsion. Vaccine according to claim 23, characterized in that the adjuvant additionally comprises an aluminum salt. 25. A method of protecting a patient against infection caused by HPV 16, HPV 18 and at least one other type of HPV selected from the group consisting of HPV 31, HPV 45 and HPV 52, which comprises administering the vaccine as a defined in claim 1 wherein the vaccine provides protection against infection caused by the omitted HPV type. The method of claim 25, wherein the omitted HPV type is HPV 31. Method according to claim 25, characterized in that the omitted HPV type is HPV 45. The method of claim 25, wherein the omitted HPV type is HPV 52. A method for preventing or reducing the frequency of cytological abnormalities in a patient caused by HPV 16, HPV 18 and at least one other type of HPV selected from the group consisting of HPV-31, HPV 45 and HPV 52, characterized by which comprises administering the vaccine as defined in claim 1 wherein the vaccine prevents or reduces the frequency of cytological abnormalities caused by the omitted HPV type. Method according to claim 29, characterized in that the omitted HPV type is HPV 52. Method according to claim 29, characterized in that the omitted HPV type is HPV 45. Method according to claim 29, characterized in that the omitted HPV type is HPV 31. 33. Method for preventing the formation of histologically confirmed CIN lesions caused by HPV 16, HPV 18 and at least one other type of HPV selected from the group consisting of HPV 315 HPV 45 and HPV 52, characterized in that it comprises administering the vaccine. as defined in claim 1 wherein the vaccine prevents the formation of histologically confirmed CIN lesions caused by the omitted HPV type. The method of claim 33, wherein the omitted HPV type is HPV 52. A method according to claim 33, characterized in that the omitted HPV type is HPV 45. A method according to claim 33, characterized in that the omitted HPV type is HPV 31. A method for preventing or reducing the frequency of cytological abnormalities in a patient caused by oncogenic HPV types, which comprises administering the vaccine as defined in claim 1. A method for preventing the formation of histologically confirmed CIN lesions in a patient caused by oncogenic HPV types, which comprises administering the vaccine as defined in claim 1. A method for manufacturing the vaccine as defined in claim 1, comprising combining L1 proteins or immunogenic fragments thereof of HPV 16, HPV 18 and at least one other type of oncogenic HPV, wherein the vaccine does not comprise a L1 protein or immunogenic fragment thereof from one or more HPV types selected from the group consisting of HPV 31, HPV 45 and HPV 52. 40. Use of a composition comprising HPV 16 ll and HPV 18 ll proteins, or immunogenic fragment thereof, in the preparation of a medicament for the prevention of infection and / or disease caused by one or more of : HPV 31, HPV 45, or HPV 52. 41. Use of a vaccine comprising an HPV 16 ll protein or immunogenic fragment thereof, which is in the preparation of a medicament for the prevention of infection and / or disease caused by HPV 31, or HPV 52, or a combination of them. 42. Use of a vaccine composition comprising an HPV 18 L1 protein, or an immunogenic fragment thereof, which is in the preparation of a medicament for the prevention of HPV infection and / or disease. Use of a vaccine according to claim 40, characterized in that it is in the manufacture of a medicament for preventing cytological abnormalities or reducing the frequency of cytological abnormalities in an individual caused by a type other than HPV 16 and HPV. 18 Use of a vaccine or combination according to claim 40, characterized in that it is in the manufacture of a medicament for the prevention of histologically confirmed CIN lesions (CIN 1, CIN 2, CIN 3) caused by a type other than HPV 16 and HPV 18. Use according to any one of claims 40 to 44, characterized in that the composition comprising proteins L1 or immunogenic fragments thereof of HPV 16, HPV 18 and at least one other type of oncogenic HPV, wherein a ll protein or immunogenic fragment thereof from one or more HPV types selected from the group consisting of HPV 31, HPV 45 and HPV 52 is omitted from the vaccine and where the vaccine provides protection against infection and / or disease caused by HPV type omitted.