BR112020022762A2 - polynucleotides for the amplification and detection of chlamydia trachomatis - Google Patents

Abstract

'' POLINUCLEOTIDS FOR THE AMPLIFICATION AND DETECTION OF CHLAMYDIA TRACHOMATIS ''. The invention provides methods and compositions for the detection of Chlamydia trachomatis in a test sample. Their presence or absence in the sample is determined by test methods based on nucleic acids using primers and / or probes and / or molecular beacons (hybridization probes) that bind to 23S ribosomal genes or gene transcripts.

Description

POLYNUCLEOTIDS FOR THE AMPLIFICATION AND DETECTION OF CHLAMYDIA TRACHOMATIS CROSS REFERENCE TO RELATED REQUESTS

[0001] This order claims the benefit of US Provisional Order No. 62 / 669,236, filed on May 9, 2018, and US Non-Provisional Order No. 15 / 976,733, filed on May 10, 2018, the disclosures of which are incorporated in full in this document. by reference.

SEQUENCE LISTING

[0002] The present application contains a Sequence Listing that was sent via EFS-Web and is incorporated in its entirety, by means of this, by reference. Said ASCII copy, created on May 8, 2019, is named TSM-045WO_CRF_sequencelisting.txt and is 29,937 bytes in size.

FIELD OF THE INVENTION

[0003] The present invention relates to the fields of molecular biology and nucleic acid chemistry. The invention provides methods and reagents for detecting pathogens, such as Chlamydia trachomatis and, consequently, also refers to the fields of medical diagnosis and prognosis. In particular, the invention relates to polynucleotides and methods for amplifying and detecting Chlamydia trachomatis.

BACKGROUND OF THE INVENTION

[0004] There is an urgent need for the development of a rapid, accessible, integrated, automated point of care (POC) diagnostic platform for sexually transmitted infections (STDs) . The World Health Organization (WHO) estimates that more than 499 million new cases of curable STDs, that is, those caused by Neisseria gonorrhoeae (NG), Chlamydia trachomatis (CT), Trichomonas vaginalis (TV) and Syphilis occur each year worldwide in men and women aged 15 - 49 years, causing significant morbidity and mortality. Untreated gonococcal and chlamydia infections in women in sub-Saharan Africa have been identified as the cause of up to 85% of infertility among women seeking infertility intervention.

[0005] C. trachomatis is responsible for the most common sexually transmitted infection in the United States. Chlamydia can cause urethritis in men and pelvic inflammatory disease, ectopic pregnancy and infertility in women. Asymptomatic infections are common in both men and women, which justifies screening to prevent the spread of the disease (as recommended by the CDC).

BRIEF DESCRIPTION OF THE DRAWINGS

[0006] Figure 1 identifies labeled polynucleotide sequences, or molecular beacons (hybridization probes), which are able to bind to the amplicon produced from each primer set.

SUMMARY

[0007] The present invention encompasses, in some embodiments, a composition comprising a set of polynucleotides selected from the group consisting of Set-1 to Set-81. In some embodiments, the composition further comprises a probe. In some embodiments, the probe comprises a marker. In some embodiments, the probe is a labeled polynucleotide. In a preferred implementation, the marker is a fluorophore, which is preferably covalently attached to a polynucleotide end. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide. In one embodiment, the fluorophore is FAM and the suppressor is BHQ1. In an alternative implementation, the fluorophore is ATTO 565 or Alexa 594 and the suppressor is BHQ1 or BHQ2.

[0008] In some implementations, the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4 -27 from SEQ ID NO: 104, nucleotides 7-30 from SEQ ID NO: 105, nucleotides 5-27 from SEQ ID NO: 106, nucleotides 6-29 from SEQ ID NO: 107, nucleotides 6-29 from SEQ ID NO : 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8- 31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO : 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. In other implementations, the labeled polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NOs: 97 to 131. In certain implementations, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NOs: 97 to 131. In other embodiments, the sequence of the labeled polynucleotide is selected from the group consisting of SEQ ID NOs: 97 to 131.

[0009] In some embodiments, the polynucleotide set is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set-66 and Sets 68-81, and the composition comprises a polynucleotide labeled comprising a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO : 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5- 29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 7-32 of SEQ ID NO: 128, and nucleotides 4-27 of SEQ ID NO: 129. In some implementations , the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128 and SEQ ID NO: 129. In some implementations, the sequence of the labeled polynucleotide is SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 108 , SEQ

ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO : 123, SEQ ID NO: 124, SEQ ID NO: 128 and SEQ ID NO: 129. In a preferred implementation, the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the set of polynucleotides is selected from the group consisting of the Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78. Even more preferably, the set of polynucleotides is Set-20 or Set-24.

[0010] In yet another embodiment, the set of polynucleotides is selected from the group consisting of Sets 12-27, Sets 39-54 and Sets 66-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5 -34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO : 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4- 33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122. More particularly, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO : 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122 In certain implementations, seq uence of the labeled polynucleotide is selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122.

[0011] In one implementation, the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47 , Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78 and Set-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126. In certain implementations, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. In some embodiments, the sequence of labeled polynucleotide is SEQ ID NO: 125 or SEQ ID NO: 126.

[0012] In another implementation, the set of polynucleotides is selected from the group consisting of Sets 14-27, Sets 41-54 and Sets 68-81, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8- 31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127. In some embodiments, the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 113 or SEQ ID NO: 127.

[0013] In yet another modality, the set of polynucleotides is selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74 and Sets 76-81, and the The composition comprises a labeled polynucleotide comprising nucleotides 6-27 of SEQ ID NO: 130. In some implementations, the labeled polynucleotide comprises SEQ ID NO: 130. In other embodiments, the sequence of the labeled polynucleotide is SEQ ID NO: 130.

[0014] In one implementation, the set of polynucleotides is selected from the group consisting of Set-13, Set-40 and Set-67, and the composition comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131. In such an embodiment, the labeled polynucleotide can comprise a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. In another embodiment, the sequence of the labeled polynucleotide is SEQ ID NO: 102 or SEQ ID NO: 131.

[0015] Another aspect of the invention provides molecular beacons comprising a fluorophore, a suppressor and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102,

nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119 and nucleotides 8-29 of SEQ ID NO: 120.

[0016] Yet another aspect of the invention provides methods of detecting Chlamydia trachomatis in a test sample, with the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 to Set- 81, and (c) detecting the presence or absence of an amplified product from step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. In one embodiment, the amplification in step (b) of the target sequence is performed between about 60 ° C and about 67 ° C for less than 30 minutes. Preferably, the amplification step is carried out for less than fifteen minutes, less than ten minutes or less than six minutes. In some implementations, the reaction mixture further comprises a reverse transcriptase. In some implementations, Chlamydia trachomatis is present in the test sample at a concentration of ≤ 100 UFI / mL, ≤50 UFI / mL, ≤5 UFI / mL, or even ≤2 UFI / mL. In one implementation, Chlamydia trachomatis is present in the test sample at a concentration of ≤ 5 UFI / ml and the amplification step is performed for less than 15 minutes. In another implementation, Chlamydia trachomatis is present in the test sample at a concentration of ≤ 10 UFI / ml and the amplification step is performed for less than six minutes.

[0017] In certain embodiments, the detection of the presence or absence of the amplification product comprises hybridization of the amplified product with a probe comprising a polynucleotide attached to a marker. In a preferred implementation, the marker is a fluorophore, which is preferably covalently attached to a polynucleotide end. In a particularly preferred embodiment, the probe or polynucleotide is a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide. In one embodiment, the fluorophore is FAM and the suppressor is BHQ1. In an alternative implementation, the fluorophore is ATTO 565 or Alexa 594 and the suppressor is BHQ1 or BHQ2. This method can be practiced using any combination of primer set and labeled polynucleotide, for example, molecular beacon, described in this document. Figure 1 identifies labeled polynucleotide sequences, or molecular beacons, which are able to bind to the amplicon resulting from each primer set and are therefore useful in detecting the presence of Chlamydia trachomatis in a test sample.

[0018] Yet another aspect of the invention provides kits comprising compositions comprising a set of polynucleotides selected from the group consisting of Set-1 to Set-81. In some embodiments, the kit further comprises a tape displacement polymerase and, optionally, a reverse transcriptase. In certain embodiments, the kit comprises a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5 -26 from SEQ ID NO: 103, nucleotides 4-27 from SEQ ID NO: 104, nucleotides 7-30 from SEQ ID NO: 105, nucleotides 5-27 from SEQ ID NO: 106, nucleotides 6-29 from SEQ ID NO : 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6- 29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8- 28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122,

nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. The molecular beacon polynucleotide sequence may comprise a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. In some embodiments, the molecular beacon polynucleotide sequence consists of a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. In one embodiment, the polynucleotide sequence of the molecular beacon consists of SEQ ID NO: 115 and the set of polynucleotides is Set-20 or Set-24.

[0019] Yet another aspect of the invention provides methods of detecting Chlamydia trachomatis in a test sample, with the method comprising (a) extracting nucleic acid from the test sample, (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific LAMP primer set, and (c) detecting the presence or absence of an amplified product from step (B); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. In some implementations, Chlamydia trachomatis is present in the test sample at a concentration of ≤ 100 UFI / mL, ≤50 UFI / mL, ≤5 UFI / mL, or even ≤2 UFI / mL. In certain implementations, the amplification step comprises reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific primer set, wherein said primer set of Specific sequence is selected from the group consisting of Set-1 to Set-81. In these implementations, the detection of the presence or absence of the amplification product may comprise the hybridization of the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. In some implementations, the Detecting the presence or absence of the amplification product comprises hybridizing the amplified product to a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 99 to SEQ ID NO:

120.

[0020] In some embodiments of the methods described in this document, the test sample comprises one or more other microorganisms in addition to Chlamydia trachomatis, and in which the target sequence of Chlamydia trachomatis is preferably amplified over a polynucleotide sequence of the one or plus other microorganisms.

[0021] In some embodiments, the invention provides a nucleic acid sequence of at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99 %%, at least 99 , 1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99, 8% or at least 99.9% identical to any of SEQ ID NOs 1-96 and methods of using these nucleic acid sequences to detect Chlamydia trachomatis in a test sample. In some embodiments, the invention provides a nucleic acid sequence of at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99 %%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least minus 99.9% identical to any of the group consisting of nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106 , nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO: 117 and methods of using these nucleic acid sequences to detect Chlamydia trachomatis in a test sample.

DETAILED DESCRIPTION

[0022] Detecting low concentrations of species (even a few molecules or microorganisms in a sample) is a challenge in medicine. The present invention relates to the selective detection of Chlamydia trachomatis. In particular, based on new detection strategies that use nucleic acid amplification, particularly RT-LAMP, and detection by molecular beacon, Chlamydia infections can be diagnosed using the methods and reagents described in this document. The use of RNA (ribosomal RNA (rRNA) or messenger RNA) as target regions provides multiple copies of the target per C. trachomatis genome. In this sense, this facilitates the detection of C. trachomatis in samples that use the approaches described in this document in relation to techniques that target genomic DNA, even when present in multiple copies per genome. In addition, the molecular beacon detection reagents described in this document provide additional specificity, in most cases failing to bind to the non-specific amplified DNA, thereby minimizing the occurrence, for example, of false positives. This specificity is illustrated, inter alia, in Example 4 provided below. Many other features of the invention are also described in this document.

[0023] As used herein, "nucleic acid" includes DNA and RNA, including DNA and RNA containing non-standard nucleotides. A "nucleic acid" contains at least one polynucleotide (a "nucleic acid strand"). A "nucleic acid" can be single-stranded or double-stranded. The term "nucleic acid" refers to nucleotides and nucleosides that comprise, for example, deoxyribonucleic acid (DNA) macromolecules and ribonucleic acid (RNA) macromolecules. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It should also be understood that the present invention can be used for biological sequences containing artificial nucleotides, such as peptide nucleic acid (PNA), morpholino, blocked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid ( TNA), among others. Preferably, the artificial nucleotides are blocked nucleic acid molecules, including [alpha] -L-LNAs. LNAs comprise analogs of ribonucleic acid, in which the ribose ring is "blocked" by a methylene bridge between 2′-oxygen and 4′-carbon — that is, oligonucleotides, containing at least one LNA monomer, or that is, a 2′-O, 4′-C-methylene-β-D-ribofuranosyl nucleotide. The LNA bases form standard Watson-Crick base pairs, but the blocked configuration increases the rate and stability of the base pairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)).

[0024] As used herein, a "polynucleotide" refers to a polymeric chain containing two or more nucleotides that contain deoxyribonucleotides, ribonucleotides and / or their analogs, such as those containing modified main structures (for example, peptide nucleic acids ( PNAs) or phosphorothioates) or modified bases. "Polynucleotides" include primers, oligonucleotides, nucleic acid strips, etc. A polynucleotide can contain standard or non-standard nucleotides. Thus, the term includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, probes, primers, etc. Typically, a polynucleotide contains a 5 ′ phosphorothioate at one end ("5 ′ end") and a 3 ′ hydroxyl group at the other end ("3 ′ end") of the chain. The most extreme nucleotide at 5 ′ of a polynucleotide can be referred to in this document as the "5 ′ terminal nucleotide" of the polynucleotide. The most extreme 3 ′ nucleotide of a polynucleotide can be referred to in this document as the "terminal 3 ′ nucleotide" of the polynucleotide. When the nucleic acid of the invention takes the form of RNA, it may or may not have a 5 'cap.

[0025] LAMP is a nucleic acid amplification method that is based on the synthesis of autocycle strand displacement DNA performed by a Bst DNA polymerase, or other strand displacement polymerases. The amplified products are rod-loop structures with multiple repeated sequences of the target and have multiple loops. The main merit of this method is that the denaturation of the DNA model is not necessary and, therefore, the LAMP reaction can be carried out under isothermal conditions (ranging from 60 to 67 ° C). LAMP requires only one enzyme and four types of primers that recognize six distinct hybridization sites in the target sequence. The reaction can be accelerated by adding two additional primers. The method produces a large amount of amplified product, resulting in easier detection, such as the detection by visual judgment of the turbidity or fluorescence of the reaction mixture.

[0026] In summary, the reaction is initiated by annealing and extending a pair of 'loop-forming' primers (internal forward and backward primers, FIP and BIP, respectively), followed by annealing and extending a pair of flanking primers ( F3 and B3). The extension of these primers results in the displacement of the tape from the loop forming elements, which bend to form terminal loop-hairpin structures. Once these key structures appear, the amplification process becomes self-sustaining and proceeds at a constant temperature in a continuous and exponential way (instead of a cyclic way, such as PCR) up to all nucleotides (dATP, dTTP, dCTP and dGTP ) in the reaction mixture have been incorporated into the amplified DNA. Optionally, an additional pair of primers can be included to accelerate the reaction. These primers, called loop primers, hybridize in terminal loops connected to the non-internal primer of the dumbbell-shaped products of the internal primer.

[0027] The term "primer", as used in this document, refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of the primer extension product is induced which is complementary to a nucleic acid strand (template), that is, in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at an appropriate temperature and pH.

[0028] LAMP allows amplification of target DNA sequences with greater sensitivity and specificity than PCR, usually with reaction times below 30 minutes, which is equivalent to faster real-time PCR tests. The target sequence that is amplified is normally 200-300 base pairs (bp) in length, and the reaction depends on the recognition between 120 bp and 160 bp of this sequence by several primers simultaneously during the amplification process. This high level of rigor makes amplification highly specific, so that the appearance of amplified DNA in a reaction occurs only if the entire target sequence was initially present.

[0029] The applications of LAMP were further extended to include the detection of RNA molecules by adding the enzyme Reverse Transcriptase (RT). By including RNA detection, the types of targets to which LAMP can be applied are also expanded and add the ability to additionally target RNA-based viruses, important regulatory non-coding RNAs (sRNA, miRNA) and RNA molecules that have been linked to certain diseases or physiological states. The ability to detect RNA also has the potential to increase assay sensitivity, for example, when choosing messenger RNA (mRNA) or ribosomal RNA (rRNA) targets

highly expressed, stable and / or abundant. This preliminary amplification phase involves the reverse transcription of RNA molecules into complementary DNA (cDNA). The cDNA then serves as a model for the strand-displacement DNA polymerase. The use of a thermostable RT enzyme (ie NEB RTx) allows the reaction to be completed in a single temperature and in a single step, a single reaction mix.

[0030] A "target sequence", as used in this document, means a nucleic acid sequence from Chlamydia trachomatis, or complement thereof, which is amplified, detected or amplified and detected, using one or more of the polynucleotides provided in this document. In addition, although the term target sequence sometimes refers to a double-stranded nucleic acid sequence, those skilled in the art will recognize that the target sequence can also be single-stranded, for example, RNA. A target sequence that is more or less specific for a particular organism can be selected. For example, the target sequence may be specific for an entire genus, for more than one genus, for a species or subspecies, serogroup, auxotype, serotype, strain, isolate or other subset of organisms.

[0031] The speed, specificity and sensitivity of the primer / probe compositions and the method described in this document result from several aspects. Examples of primers for use in the compositions and methods according to the present invention include: TABLE 1: Primer sequences Sequence ID Sequence (5 ′ to 3 ′) SEQ ID NO: 1 CGAAGGAATGACGGAGTA SEQ ID NO: 2 CGCCTTAGAATATTCATCTCG SEQ ID NO: 3 GCGACCTGATCTTATGTTAGCGCGATTGGAAGAGTCCGTA SEQ ID NO: 4 GAACCGATGGTGTGGAGCCCACCTGTGTCGGTT SEQ ID NO: 5 CTACTAACCGTTCTCATCGC SEQ ID NO: 6 CTGTTGATGGTGACCGTAC SEQ ID NO: 7 AAAACTATAGCGAAGGAATGACGGA SEQ ID NO: 8 TAATTTGCCGAGTTCCTTAACGAAAG SEQ ID NO: 9 CCCCGAAGATTCCCCTTGATCGCCGTAGAGCGATGAGAAC

GGTT SEQ ID NO: 10 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCC

CACCTGTG

Sequence ID Sequence (5 ′ to 3 ′) SEQ ID NO: 11 TGATCTTATGTTAGCGGATTTGCCTACT SEQ ID NO: 12 TTTCTAGCTGTTGATGGTGACCGT SEQ ID NO: 13 AACTATAGCGAAGGAATGACGGAG SEQ ID NO: 14 TAATTTGGGTA

GGTT SEQ ID NO: 16 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCC

CACCTGTG SEQ ID NO: 17 TGATCTTATGTTAGCGGATTTGCCTACT SEQ ID NO: 18 GTTGATGGTGACCGTACCAAAACC SEQ ID NO: 19 ATAGCGAAGGAATGACGGAGTAAG SEQ ID NO: 20 TAATTTGCCGAGTTGTGA

GGTT SEQ ID NO: 22 GGTGTGGAGCGAGGCTTTCAAGAAATAATATTCATCTCGCC

CACCTGTG SEQ ID NO: 23 GACCTGATCTTATGTTAGCGGATTTGC SEQ ID NO: 24 TTTCTAGCTGTTGATGGTGACCGT SEQ ID NO: 25 AGAAGCGAGTCCGGGAGAT SEQ ID NO: 26 CTGCTGAATACTACGCTCGA TACTAC

CGCCG SEQ ID NO: 28 GCGTAACAGCTCACCAATCGAGAATCATTGTCTTATCGACA

CACCCGC SEQ ID NO: 29 TTACCCACTTAGCATAAAATTAGGGACCTTAA SEQ ID NO: 30 ACGGGACTAAGCATAAAACCGACA SEQ ID NO: 31 AGAAGCGAGTCCGGGAGAT SEQ ID NO: 32 CCGGTACACCTTCTCTGAGCC SEGA IDTCATGAGGCA

GCCG SEQ ID NO: 34 GCGTAACAGCTCACCAATCGAGAATCATTGTCTTATCGACA

CACCCGC SEQ ID NO: 35 TTACCCACTTAGCATAAAATTAGGGACCTTAA SEQ ID NO: 36 ACGGGACTAAGCATAAAACCGACA SEQ ID NO: 37 CACAGGTGGGCGAGATGAATAT SEQ ID NO: 38 CTGACATATCCCTTTAACCTTTTGGTA

GATAACTTT

Sequence ID Sequence (5 ′ to 3 ′) SEQ ID NO: 40 AGAAATGGCCCAGGCGACTGTTTAGGCAGGCGTCACACCA

TATACT SEQ ID NO: 41 GGGATAATTTGCCGAGTTCCTTAACG SEQ ID NO: 42 AAAACACAGCACTATGCAAACCTCTAAG SEQ ID NO: 43 CACAGGTGGGCGAGATGAAT SEQ ID NO: 44 CTGACATATCCCTTTAACCTTTTGGCACAGTCCGCCTACT

GATAACTTT SEQ ID NO: 46 AGAAATGGCCCAGGCGACTGTTTAGGCAGGCGTCACACCA

TATACT SEQ ID NO: 47 GGGATAATTTGCCGAGTTCCTTAACG SEQ ID NO: 48 AAAACACAGCACTATGCAAACCTCTAAG SEQ ID NO: 49 ATTCGAAGACAGTTGGAATGT SEQ ID NO: 50 TATTATCGGCGCAATGATTCGGAGGCTTAGGAGAGCT

C SEQ ID NO: 51 GTGAGCTGTTACGCACTCT SEQ ID NO: 52 TCGTTACTTATGCCATGGATC SEQ ID NO: 53 TAAACGGGACTAAGCATAAAACCGACCTTCTCTGCTGAATA

CTACG SEQ ID NO: 54 GATAAGACACGCGGTAGGAG SEQ ID NO: 55 CTTACCAACGGAAATCAAACTC SEQ ID NO: 56 CACTTAGCATAAAATTAGGGACCTTAATCGGGGGGCTAAG

CTTCGT SEQ ID NO: 57 GCGGTCTGGGCTGTTC SEQ ID NO: 58 TATCGGCGCAATGATTCTC SEQ ID NO: 59 TGGGTAAGGAAGTGATGATTCGAAGGGTGAGCTGTTACGC

AC SEQ ID NO: 60 TGGCTTAGAGGCAGCAATC SEQ ID NO: 61 ATCGGCGCAATGATTCTCGATGGCTTAGAGGCAGCAATC SEQ ID NO: 62 CGTTACTTATGCCATGGATCT SEQ ID NO: 63 TAAGACACGCGGTAGGAGA SEQ ID NO: 64 GAAATCGAAGAGATTCCCTGTG SEQ ID NO: 65 GGTGTTGAGGTCGGTCTT SEQ ID NO: 66 TTATCCTCAATCCTACAACCCCGAGTAGCGGCGAGCGAAA

G SEQ ID NO: 67 GGATCAGGACTCCTAGTTGAACACACTCCTTTCGTCTACGG

GAC SEQ ID NO: 68 CCTTATCAGCTCGGTTTAGGC SEQ ID NO: 69 GGAAAGATGGATGATACAGGGTG

Sequence ID Sequence (5 ′ to 3 ′) SEQ ID NO: 70 GTTGTAGGATTGAGGATAAAGGATC SEQ ID NO: 71 TACTGGTTCACTATCGGTCATT SEQ ID NO: 72 TCGGTCTTTCTCTCCTTTCGTCTACTCCTAGTTGAACACATC

TGGAA SEQ ID NO: 73 CCTCAACACCTGAGTAGGACTAGACGCCTTGGAGAGTGGT

CTC SEQ ID NO: 74 GGACTATCACCCTGTATCATCCA SEQ ID NO: 75 CGTGAAACCTAGTCTGAATCTGG SEQ ID NO: 76 TATTCCCCTTTCGCTCGC SEQ ID NO: 77 GGCTATTCCCCTTTCGCTC SEQ ID NO: 78 TTAGGCTATTCCCCTTTCGC SEQ ID NO: 79 GCTATTCCCCTTTCGCTCGC SEQ ID NO: 80 GTTTAGGCTATTCCCCTTTC SEQ ID NO: 81 CTGAAACATCTTAGTAAGCAGAGG SEQ ID NO: 82 GTGTCTAGTCCTACTCAGGTG SEQ ID NO: 83 CCTACAACCCCGAGCCTTATCAAGAGATTCCCTGTGTAGC

G SEQ ID NO: 84 GGACTCCTAGTTGAACACATCTGGATTCTCTCCTTTCGTCT

ACGG SEQ ID NO: 85 GCTCGGTTTAGGCTATTCCC SEQ ID NO: 86 AAGATGGATGATACAGGGTGATAGT SEQ ID NO: 87 CGAACTGAAACATCTTAGTAAGCAG SEQ ID NO: 88 CTCCTTTCGTCTACGGGTATA SEQ ID NO: 89 ATCAGA

ATTCCCTG SEQ ID NO: 90 GCTCGGGGTTGTAGGATTGAGGATACCTGTATCATCCATCT

TTCCAGAT SEQ ID NO: 91 CTTTCGCTCGCCGCTAC SEQ ID NO: 92 GGATCAGGACTCCTAGTTGAACAC SEQ ID NO: 93 CCTACAACCCCGAGCCTTATCAGAAAAGAAATCGAAGAGAT

TCCCTG SEQ ID NO: 94 ATCAGCTCGGTTTAGGCTATTCCCAGAGATTCCCTGTGTAG

CG SEQ ID NO: 95 GCTCGGGGTTGTAGGATTGAGGATATTCTCTCCTTTCGTCT

ACGG SEQ ID NO: 96 GCTCGGGGTTGTAGGATTGAGGATACTGTATCATCCATCTT

TCCAGATGT

[0032] The detection of products amplified by LAMP can be carried out by means of a variety of methods. In a preferred embodiment, product detection is conducted by adding a fluorescence-labeled probe to the primer mix. The term used in this document "probe" refers to a single stranded nucleic acid molecule that comprises a portion or portions that are complementary, or substantially complementary, to a target sequence. In certain implementations, the fluorescence-labeled probe is a molecular beacon.

[0033] As used in this document, "molecular beacon" refers to a single-stranded hairpin oligonucleotide probe designed to report the presence of specific nucleic acids in a solution. A molecular beacon consists of four components; a rod, a hairpin handle, fluorophore marked at the end and suppressor marked at the opposite end (Tyagi et al., (1998) Nature Biotechnology 16: 49-53). When the hairpin beacon is not attached to a target, the fluorophore and the suppressor are close together and fluorescence is suppressed. In the presence of a complementary target nucleotide sequence, the beacon stem opens to hybridize to the target. This separates the fluorophore and the suppressor, allowing the fluorophore to become fluorescent. Alternatively, molecular beacons also include fluorophores that emit in the vicinity of an end-labeled donor. "Molecular Beacons with Wavelength Displacement" incorporate an absorption fluorophore ("harvester") that allows the fluorophore to emit more strongly. Current reviews of molecular beacons include Wang et al., 2009, Angew Chem Int Ed Engl, 48 (5): 856-870; Cissell et al., 2009, Anal Bioanal Chem 393 (1): 125-35; Li et al., 2008, Biochem Biophys Res Comm 373 (4): 457-61; and Cady, 2009, Methods Mol Biol 554: 367-79.

[0034] In one implementation, the molecular beacon comprises a fluorophore, a suppressor and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5- 34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5 -26 from SEQ ID NO: 103, nucleotides 4-27 from SEQ ID NO: 104, nucleotides 7-30 from SEQ ID NO:

105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114 , nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, and nucleotides 8-29 of SEQ ID NO: 120. In one embodiment, the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 99 through SEQ ID NO: 120. In another embodiment, the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 99 to SEQ ID NO:

120. Polynucleotides with the sequences described above can include one or more unnatural nucleosides or bonds, such as peptide nucleic acid (PNA), morpholino, blocked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA), among others. In some embodiments, the molecular beacon polynucleotide comprises from one to six blocked nucleic acids. In a preferred embodiment, the molecular beacon polynucleotide comprises three blocked nucleic acids. In another preferred embodiment, the molecular beacon polynucleotide comprises four blocked nucleic acids.

[0035] The molecular beacon is preferably used in a composition also comprising a set of LAMP primers of specific sequence. In one implementation, the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5 -30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO : 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6- 29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115,

nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. In this implementation, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 130. More preferably, the polynucleotide sequence of the molecular beacon consists of a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 130. In a particularly preferred implementation, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 115.

[0036] When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 12-27, Sets 39-54 and Sets 66-81, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101 , nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122. More particularly, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99 , SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121, and SEQ ID NO: 122. In certain implementations, the sequence The molecular beacon polynucleotide is selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO : 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO:

122.

[0037] When included in a composition comprising a set of polynucleotides selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set -47, Set-51, Set-54, Set-66, Sets 68-72, Set 74, Set-78, and Set-81, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126. In certain implementations, the molecular beacon may comprise a polynucleotide sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. In some embodiments, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 125 or SEQ ID NO: 126.

[0038] When used in combination with a set of polynucleotides selected from the group consisting of Sets 14-27, Sets 41-54 and Sets 68-81, the molecular beacon preferably comprises a polynucleotide sequence selected from the group consisting of nucleotides 8- 31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127. In some embodiments, the labeled polynucleotide of the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO:

127. In other embodiments, the molecular beacon polynucleotide sequence is SEQ ID NO: 113 or SEQ ID NO: 127.

[0039] When included in a composition comprising a set of polynucleotides selected from the group consisting of Sets 12-20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74 and Sets 76-81, the molecular beacon preferably comprises nucleotides 6-27 of SEQ ID NO: 130. In some implementations, the molecular beacon comprises SEQ ID NO: 130. In other embodiments, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 130.

[0040] When used in combination with a set of polynucleotides selected from the group consisting of Set-13, Set-40 and Set-67, the molecular beacon preferably comprises a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131. In this embodiment, the molecular beacon can comprise a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. In another embodiment, the polynucleotide sequence of the molecular beacon is SEQ ID NO: 102 or SEQ ID NO: 131.

[0041] The term "marker", as used in this document, means a molecule or fraction with a property or characteristic that is capable of detection and, optionally, of quantification. A marker can be directly detectable, such as, for example (and without limitation), with radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microparticles and the like; or a marker can be detectable indirectly, as, for example, with specific binding members. It will be understood that the directly detectable markers may require additional components, such as, for example, substrates, activation reagents, suppression fractions, light and the like to allow the detection and / or quantification of the marker. When indirectly detectable markers are used, they are usually used in combination with a "conjugate". A conjugate is usually a specific binding member that has been attached or coupled to a directly detectable marker. Coupling chemistries for synthesizing a conjugate are well known in the art and can include, for example, any chemical and / or physical medium that does not destroy the specific binding property of the specific binding member or the detectable property of the marker. As used herein, "specific binding member" means a member of a binding pair, that is, two different molecules in which one of the molecules through, for example, chemical or physical means specifically binds to another molecule. In addition to specific binding pairs between antigen and antibody, other specific binding pairs include, but are not limited to, avidin and biotin; haptens and antibodies specific for haptens; complementary nucleotide sequences; enzymatic cofactors or substrates and enzymes; and the like.

[0042] The molecular beacon can be composed of nucleic acid only, such as DNA or RNA, or it can be composed of a peptide nucleic acid (PNA) conjugate. The fluorophore can be any organic fluorescent dye or a single quantum dot. The suppressor fraction desirably suppresses the luminescence of the fluorophore. Any suitable suppressor fraction that suppresses the fluorophore's luminescence can be used. A fluorophore can be any fluorescent marker / dye known in the art. Examples of suitable fluorescent labels include, without limitation, Fam, Hex, Tet, Joe,

Rox, Tamra, Max, Edans, Cy, such as Cy5, Fluorescein, Coumarin, Eosin, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow, Texas Red, and the ATTO dye family. A suppressor can be any suppressor in the art. Examples of suppressors include, without limitation, Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all are registered trademarks). Those skilled in the art would know which dye / suppressor combinations would be suitable when designing a probe. In an exemplary embodiment, fluorescein (FAM) is used in conjunction with Blackhole Quencher ™ (BHQ ™) (Novice, Calif.). The binding of the molecular beacon to the amplified product can then be assessed visually, directly. Alternatively, the level of fluorescence can be measured by spectroscopy to improve sensitivity.

[0043] A variety of commercial suppliers produce standard and custom molecular beacons, including Abingdon Health (UK; www.abingdonhealth.com), Attostar (US, MN; www.attostar.com), Biolegio (NLD; www.biolegio. com), Biomers.net (DEU; www.biomers.net), Biosearch Technologies (US, CA; www.biosearchtech.com), Eurogentec (BEL; www.eurogentec.com), Gene Link (US, NY; www. genelink.com) Integrated DNA Technologies (US, IA; www.idtdna.com), Isogen Life Science (NLD; www.isogen-lifescience.com), Midland Certified Reagent (US, TX; www.oligos.com), Eurofins (DEU; www.eurofinsgenomics.eu), Sigma-Aldrich (US, TX; www.sigmaaldrich.com), Thermo Scientific (US, MA; www.thermoscientific.com), TIB MOLBIOL (DEU; www.tib-molbiol. de), TriLink Bio Technologies (US, CA; www.trilinkbiotech.com). A variety of kits, which use molecular beacons, are also commercially available, such as SentinelTM Molecular Beacon Allelic Discrimination Kits from Stratagene (La Jolla, Calif.) And various kits from Eurogentec SA (Belgium, eurogentec.com) and Isogen Bioscience BV ( The Netherlands, isogen.com).

[0044] The oligonucleotide probes and primers of the invention are optionally prepared using essentially any practice known in the art. In certain embodiments, for example, the oligonucleotide probes and primers described in this document are chemically synthesized using essentially any method of nucleic acid synthesis, including, for example, according to the solid phase triester phosphoramidite method described by Beaucage and Caruthers (1981), Tetrahedron Letts. 22 (20): 1859-1862, which is incorporated by reference, or another synthesis practice known in the art, for example, using an automated synthesizer, as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res. 12: 6159-6168, which is incorporated by reference. A wide variety of equipment is commercially available for automated oligonucleotide synthesis. Multinucleotide synthesis approaches (for example, trinucleotide synthesis, etc.) are also optionally used. In addition, the nucleic acids of the primers described in this document optionally include various modifications. For further illustration, primers are also optionally modified to improve the specificity of amplification reactions, as described, for example, in US Patent No. 6,001,611, issued on December 14, 1999, which is incorporated by reference. Primers and probes can also be synthesized with a number of other modifications, as described in this document or as otherwise known in the art.

[0045] In addition, essentially any nucleic acid (and virtually any labeled nucleic acid, whether standard or not) can be ordered as standard or tailored from any variety of commercial sources, such as Integrated DNA Technologies, the Midland Certified Reagent Company , Eurofins, Biosearch Technologies, Sigma Aldrich and many others.

[0046] The test samples are generally derived from or isolated from subjects, usually mammals, more usually humans, suspected of having a Chlamydia infection. Examples of specimens or specimens include blood, plasma, serum, urine, synovial fluid, seminal fluid, seminal plasma, prostatic fluid, vaginal fluid, cervical fluid, uterine fluid, cervical scrapes, amniotic fluid, anal scrapes, mucus, sputum, tissue and similar. Essentially, any technique for acquiring these samples is optionally used, including, for example, scraping, venipuncture, swab, biopsy or other techniques known in the art.

[0047] The term "test sample", as used in this document, means a sample taken from an organism or biological fluid that is suspected of containing or potentially containing a target sequence. The test sample can be taken from any biological source, such as, for example, tissue, blood, saliva,

sputum, mucus, sweat, urine, urethral swabs, cervical swabs, vaginal swabs, urogenital or anal swabs, conjunctival swabs, ocular lens fluid, cerebrospinal fluid, milk, ascites fluid, synovial fluid, peritoneal fluid, amniotic fluid, broths fermentation, cell cultures, chemical reaction mixtures and the like. The test sample can be used (i) directly as obtained from the source or (ii) after pre-treatment to modify the character of the sample. Thus, the test sample can be pre-treated before use, for example, preparing plasma or blood serum, breaking up viral cells or particles, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids , inactivating interfering components, adding reagents, purifying nucleic acids and the like.

[0048] Advantageously, the invention allows rapid and reliable detection of Chlamydia trachomatis in a clinical sample, such as a urine sample.

[0049] To further illustrate, before analyzing the target nucleic acids described in this document, these nucleic acids can be purified or isolated from samples that normally include complex mixtures of different components. The cells in the collected samples are normally lysed to release cell content. For example, C. trachomatis and other cells in the specific sample can be lysed by contact with various enzymes, chemicals and / or lysed by other approaches known in the art, which degrade, for example, bacterial cell walls. In some embodiments, nucleic acids are analyzed directly in the cell lysate. In other embodiments, nucleic acids are further purified or extracted from cell lysates prior to detection. Essentially, any nucleic acid extraction methods can be used to purify nucleic acids in the samples used in the methods of the present invention. Examples of techniques that can be used to purify nucleic acids include, for example, affinity chromatography, hybridization in probes immobilized on solid supports, liquid-liquid extraction, (for example, phenol-chloroform extraction, etc.), precipitation (by example, using ethanol, etc.), filter paper extraction, extraction with micelle-forming reagents (for example, cetyl-trimethyl-ammonium-bromide, etc.), binding to immobilized intercalating dyes (for example, ethidium bromide, acridine, etc.), adsorption on silica gel or diatomic soil, adsorption on glass particles or organosilane particles under chaotropic conditions, and / or the like. Sample processing is also described, for example, in US Patent No. 5,155,018, 6,383,393 and 5,234,809, which are incorporated by reference.

[0050] A test sample may optionally have been treated and / or purified according to any practice known to those skilled in the art, to improve the efficiency of amplification and / or qualitative precision and / or quantitative precision. The sample can thus exclusively or essentially consist of nucleic acids, whether obtained by purification, isolation or by chemical synthesis. Means for isolating or purifying nucleic acids from a test sample are available to those skilled in the art, such as DNA, for example, to isolate or purify DNA from cervical scrapes (eg, QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany). EXAMPLES: Example 1: Target selection and primer probe design

[0051] Considering the constitutive and high level of expression of ribosomal genes in bacterial cells, these genes were chosen as targets for the amplification assay, specifically the 16S and 23S genes.

[0052] The 16S and 23S gene sequences for multiple serovars of C. trachomatis, closely related species, such as Chlamydophila pneumoniae and Chlamydia psittaci, and for other species commonly found in urine or vaginal fluid, have been retrieved from the NCBI database. The sequences were aligned using Clustal omega (Sievers, et al. 2011. Molecular Systems Biology 7: 539) and regions with specific bases unique to the species C. trachomatis were identified. The loop-mediated amplification primers were designed using LAMP designer (Premier Biosoft). For greater specificity, molecular beacons or probes aimed at amplified products were designed manually or using the Beacon designer (Premier Biosoft). Sets of designed primers and beacons were further analyzed for specificity using BLAST against the human genome and the NCBI nucleotide database. Several sets of primers and probes were designed and screened for reaction speed.

[0053] The primer sets of the invention are summarized in Table 2, which include, at a minimum, an internal forward primer (FIP) and an internal backward primer (BIP). In addition, primer sets typically also include at least two additional primers selected from the external forward primer (F3), external backward primer (B3), loop forward primer (LF) and loop backward primer (LB). TABLE 2: LAMP Primer Sets Set F3 B3 FIP BIP LF LB Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 1 NO: 1 NO: 2 NO: 3 4 NO: 5 NO: 6 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 2 NO: 7 NO: 8 NO: 9 10 NO: 11 NO: 12 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 3 NO: 13 NO: 14 NO: 15 16 NO: 17 NO: 18 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 4 NO: 20 NO: 20 NO: 21 22 NO: 23 NO: 24 Set- SEQ SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 5 NO: 25 NO: 26 NO: 27 28 NO: 29 NO: 30 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 6 NO: 31 NO: 32 NO: 33 34 NO: 35 NO: 36 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 7 NO: 37 NO: 38 NO: 39 40 NO: 41 NO: 42 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 8 NO: 43 NO: 44 NO: 45 46 NO: 47 NO: 48 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 9 NO: 49 NO : 52 NO: 50 53 NO: 51 NO: 54 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 10 NO: 55 NO: 58 NO: 5 6 59 NO: 57 NO: 60 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 11 NO: 49 NO: 62 NO: 61 53 NO: 51 NO: 63 Set- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID ID NO: SEQ ID SEQ ID 12 NO: 64 NO: 65 NO: 66 67 NO: 68 NO: 69 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 13 NO: 70 NO: 71 NO: 72 73 NO: 74 NO: 75 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 14 NO: 81 NO: 82 NO: 83 84 NO: 76 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 15 NO: 81 NO: 82 NO: 83 84 NO: 77 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 16 NO: 81 NO: 82 NO: 83 84 NO: 78 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 17 NO: 81 NO: 82 NO: 83 84 NO: 79 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO : SEQ ID SEQ ID 18 NO: 81 NO: 82 NO: 83 84 NO: 80 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 19 NO: 87 NO: 82 NO: 89 84 NO : 91 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 20 NO: 81 NO: 82 NO: 83 84 NO: 85 NO: 86 Set- S EQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 21 NO: 87 NO: 88 NO: 89 90 NO: 91 NO: 92 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 22 NO: 87 NO: 82 NO: 89 84 NO: 76 NO: 86

Set F3 B3 FIP BIP LF LB Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 23 NO: 87 NO: 82 NO: 93 84 NO: 76 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 24 NO: 87 NO: 82 NO: 94 84 NO: 76 NO: 86 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 25 NO: 87 NO: 82 NO: 89 95 NO: 91 NO: 92 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: SEQ ID SEQ ID 26 NO: 87 NO: 82 NO: 93 95 NO: 76 NO: 92 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO : SEQ ID SEQ ID 27 NO: 87 NO: 82 NO: 94 95 NO: 76 NO: 92 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 28 NO: 1 NO: 2 NO: 3 4 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 29 NO: 7 NO: 8 NO: 9 10 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 30 NO : 13 NO: 14 NO: 15 16 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 31 NO: 19 NO: 20 NO: 21 22 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 32 NO: 25 NO: 26 NO: 27 28 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 33 NO: 31 NO: 32 NO: 33 34 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 34 NO: 37 NO: 38 NO: 39 40 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 35 NO: 43 NO: 44 NO: 45 46 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 36 NO: 49 NO: 52 NO: 50 53 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 37 NO: 55 NO: 58 NO: 56 59 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 38 NO: 49 NO: 62 NO: 61 53 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: - - --- 39 NO: 64 NO: 65 NO: 66 67 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 40 NO: 70 NO: 71 NO: 72 73 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 41 NO: 81 NO: 82 NO: 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 42 NO: 81 NO: 82 NO : 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 43 NO: 81 NO: 82 NO: 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 44 NO: 81 NO: 82 NO: 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 45 NO: 81 NO: 82 NO: 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 46 NO: 87 NO: 82 NO: 89 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 47 NO: 81 NO: 82 NO: 83 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 48 NO: 87 NO: 88 NO: 89 90

Set F3 B3 FIP BIP LF LB Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 49 NO: 87 NO: 82 NO: 89 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: - - --- 50 NO: 87 NO: 82 NO: 93 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 51 NO: 87 NO: 82 NO: 94 84 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 52 NO: 87 NO: 82 NO: 89 95 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 53 NO: 87 NO: 82 NO: 93 95 Set- SEQ ID SEQ ID SEQ ID SEQ ID NO: --- --- 54 NO: 87 NO: 82 NO: 94 95 Set- --- --- SEQ ID SEQ ID NO: --- - - 55 NO: 3 4 Set- --- --- SEQ ID SEQ ID NO: --- --- 56 NO: 9 10 Set- --- --- SEQ ID SEQ ID NO: --- - - 57 NO: 15 16 Set- --- --- SEQ ID SEQ ID NO: --- --- 58 NO: 21 22 Set- --- --- SEQ ID SEQ ID NO: --- - - 59 NO: 27 28 Set- --- --- SEQ ID SEQ ID NO: --- --- 60 NO: 33 34 Set- --- --- SEQ ID SEQ ID NO: --- - - 61 NO: 39 40 Set- --- --- SEQ ID SEQ ID NO: --- --- 62 NO: 45 46 Set- --- --- SEQ ID SEQ ID NO: --- - - 63 NO: 50 53 Set- --- --- SEQ ID SEQ ID NO: --- --- 64 NO: 56 59 Set- --- --- SEQ ID SEQ ID NO: --- --- 65 NO: 61 53 Set- --- --- SEQ ID SEQ ID NO: --- --- 66 NO: 66 67 Set- --- --- SEQ ID SEQ ID NO: --- --- 67 NO: 72 73 Set- --- --- SEQ ID SEQ ID NO: --- --- 68 NO: 83 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 69 NO: 83 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 70 NO: 83 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 71 NO: 83 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 72 NO: 83 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 73 NO: 89 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 74 NO: 83 84

Set F3 B3 FIP BIP LF LB Set- --- --- SEQ ID SEQ ID NO: --- --- 75 NO: 89 90 Set- --- --- SEQ ID SEQ ID NO: --- - - 76 NO: 89 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 77 NO: 93 84 Set- --- --- SEQ ID SEQ ID NO: --- - - 78 NO: 94 84 Set- --- --- SEQ ID SEQ ID NO: --- --- 79 NO: 89 95 Set- --- --- SEQ ID SEQ ID NO: --- - - 80 NO: 93 95 Set- --- --- SEQ ID SEQ ID NO: --- --- 81 NO: 94 95 Example 2: Kinetics of the amplification reaction

[0054] A negative urine matrix was contaminated with titrated C. trachomatis (strain Z054, D-UW3 (Zeptometrix) or ATCC serovar D strain VR-885) in two different concentrations (103 UFI / mL and 10 UFI / mL). Nucleic acids were extracted using standard extraction methods and the sample was amplified using LAMP primer sets as described in Table 2. The YoProTM dye (Life Technologies; fluorescent green carbocyanine nucleic acid staining) was used for product detection amplified. In this example, a 25 µl reaction contained 1X Isothermal Amplification Buffer (New England Biolabs) supplemented with 4.8 mM or 6 mM MgCl2, 1.4 mM or 1.6 mM dNTP, 200nM YO-PRO-1 dye (Life Technologies), primers (0.2 µM of F3 and B3, when present; 1.6 µM of FIP and BIP; 0.4-0.8 µM of LF and LB, when present), 8 or 12 units of Bst2 polymerase (New England Biolabs), 7.5 units of RTx Warmstart (reverse transcriptase; New England Biolabs), and the extracted nucleic acid (as a model) or water (as no model control). The reactions were incubated at 63 ° or 65 ° C and the kinetics were monitored using a Roche real-time Lightcycler96 (Roche).

[0055] This example shows that using this set of primers and the loop-mediated amplification method, rapid amplification kinetics is achieved. The results are summarized in Table 3, in which the Time to Positive (Tp) was calculated by the instrument. NT indicates untested concentrations. The results are classified by the time to positive (NT means “not tested” and “without classification” indicates that no amplification was detected).

TABLE 3: Time to Positive with Dye Detection Tp Tp 10 primers 3 NTC 10 UFI / mL UFI / mL Set-1 6.1 7.8 25.12 Set-2 8.6 10.8 36.81 Set-3 6.6 9.1 28.59 Set-4 8.2 19.8 36.77 Set-5 7.9 11.1 31.42 Set-6 8.8 12.2 38.28 Set-7 11, 0 14.4 21.05 Set-8 10.9 14.2 19.86 Set-9 NT 7.0 42.89 Set-10 NT 6.8 32.68 Set-11 NT 11.0 27.34 Set -12 4.1 6.54 48.03 Set-13 7.3 10.13 46.55 Set-14 4.4 5.18 29.24 Set-15 4.6 5.21 20.34 Set-16 4.6 5.40 43.24 Set-17 4.5 5.36 23.37 Set-18 3.9 6.00 23.78 Example 3: Effect of the location of the beacon design on the test kinetics

[0056] Amplification reactions containing some of the above primer sets and the intercalating dye resulted in the detection of an amplification product when using water or negative urine extraction or the DNA of closely related species, such as C. pneumoniae or C. psittaci as models at frequencies varying between 0% and 75% of the time (Table 4), within varying intervals of our cut window for the test time. The results are sorted by time to positive ("unclassified" indicates that no amplification has been detected). TABLE 4: Cross Reactivity - Detection by Dye Set of NTC (water) C. DNA C. C. Primer pneumoniae psittaci 1 of 1 of Set-9 42.9 15.2 NT - 2 1 1 of 1 of Set- 10 32.7 9.4 NT - 2 1 1 of 1 from Set-11 27.3 18.0 NT - 2 1

[0057] For greater specificity, molecular beacons were designed throughout these primer sets to ensure that only the signal from the C. trachomatis target was detected (sequences listed in table 5). Each molecular beacon was designed with modifications of 5 ′ fluorophore / 3 ′ suppressor (6- Carboxyfluorescein (FAM) and Black Hole Quencher 1 (BHQ1)) included to provide specific fluorescent detection of the target. TABLE 5: Probe Sequences Sequence ID Fluorophore Suppressor Sequence (5 'to 3')

CGCGCACATCTGGAAAGATGGATG ID SEQ ID NO: MB1 FAM BHQ1 ATACAGGGTGCGCG 97 CGTCCAGGACTCCTAGTTGAACACA SEQ ID NO: MB2 FAM BHQ1 TCTGGACG 98 CCGGATCAGGACTCCTAGTTGAACA SEQ ID NO: MB3 FAM BHQ1 CATCTGATCCGG 99 CGGCCAGGACTCCTAGTTGAACAC SEQ ID NO: MB4 FAM BHQ1 ATCTGGCCG 100 CGTCCGGATCAGGACTCCTAGTTGA SEQ ID NO: MB5 FAM BHQ1 ACACCGGACG 101 CTCGCCACGTGAAACCTAGTCTGAA SEQ ID NO: MB6 FAM BHQ1 TCTGGCGAG 102 CCGTGGATGATACAGGGTGATAGT SEQ ID NO: MB7 FAM BHQ1 CCACGG 103 CGTGGGATGATACAGGGTGATAGT SEQ ID NO: MB8 FAM BHQ1 CCCACG 104 CGGCTCGAGATTCCCTGTGTAGCG SEQ ID NO: MB9 FAM BHQ1 GCGAGCCG 105 MB1 CGCCAGGATCAGGACTCCTAGTTG SEQ ID NO: FAM BHQ1 0 AACCTGGCG 106 MB1 CACCGGGATGATACAGGGTGATAG SEQ ID NO: FAM BHQ1 1 TCCCGGTC 107 MB1 CACCGGGATGATACAGGGTGATAG SEQ ID NO: FAM BHQ1 2 TCCCGGTG 108 MB1 TCGCGGGATGATACAGGGTGATAG SEQ ID NO: FAM BHQ1 3 TCCCGCGG 109 MB1 CAGCGGGATCAGGACTCCTAGTTG SEQ ID NO: FAM BHQ1 4 AACCCGCTG 110 MB1 CACGCTCGAGATTCCCTGTGTAGCG SEQ ID NO: FAM BHQ1 5 GCGAGCGTG 111 MB1 CAGGCGGATCAGGACTCCTAGTTG SEQ ID NO: FAM BHQ1 6 AACACCGCCTG 112 MB1 CAGCGACAGAAATCGAAGAGATTC SEQ ID NO: FAM BHQ1 7 CCTGTGTCGCTG 113 MB1 CACGGGATGATACAGGGTGATAGT SEQ ID NO: FAM BHQ1 8 CCCGTC 114 MB1

Sequence ID Fluorophore Suppressor Sequence (5 'to 3')

ID 0 GTCCATCGTG 116 MB2 CACCGATGGATGATACAGGGTGAT SEQ ID NO: FAM BHQ1 1 AGTCCCATCGGTG 117 MB2 CGCGATCGAGGATAAAGGATCAGG SEQ ID NO: FAM BHQ1 2 ACTCGATCGCG 118 MB2 CGCGATCATTGAGGATAAAGGATCA SEQ ID NO: FAM BHQ1 3 GGACTGATCGCG 119 MB2 CGCGATCCTCCTAGTTGAACACATC SEQ ID NO: FAM BHQ1 4 TGGAGATCGCG 120 MB2 CGCGATCAGGACTCCTAGTTGAACA SEQ ID NO: FAM BHQ1 5 CATCTGGATCGCG 121 MB2 CGCGACTCAGGACTCCTAGTTGAAC SEQ ID NO: FAM BHQ1 6 ACATCTGGAGTCGCG 122 MB2 CGCGATCCGGATAAAGGATCAGGA SEQ ID NO: FAM BHQ1 7 CTCCTAGTTGGGATCGCG 123 MB2 CGCGAGTAGGATTGAGGATAAAGG SEQ ID NO: FAM BHQ1 8 ATCAGGACTCGCG 124 MB2 CGCGATCCCTGTGTAGCGGCGAGC SEQ ID NO: FAM BHQ1 9 GAGATCGCG 125 MB3 CGCGATCCTGTGTAGCGGCGAGCG SEQ ID NO: FAM BHQ1 0 AAAGATCGCG 126 MB3 CGGCTCGGGGTTGTAGGATTGAGG SEQ ID NO: FAM BHQ1 1 ATACGAGCCG 127 MB3 CCGGAGCCTACAACCCCGAGCCTT SEQ ID NO: FAM BHQ1 2 ATCAGCTCCGG 128 MB3 GCGCAGCTCGGTTTAGGCTATTCCC SEQ ID NO: FAM BHQ1 3 CTGCGCG 129 MB3 CGCGGTCTCTCCTTTCGTCTACGGG SEQ ID NO: FAM BHQ1 4 ACCGCG 130 MB3 CGCAGTGAGAGAAAGACCGACCTC SE Q ID NO: FAM BHQ1 5 AACACTGCG 131

[0058] A negative urine matrix was contaminated with titrated C. trachomatis (strain Z054, D-UW3 (Zeptometrix) or ATCC serovar D strain VR-885) in two different concentrations (103 UFI / mL and 10 UFI / mL). The nucleic acids were extracted using standard extraction methods and the sample was amplified using a set of LAMP primers (as shown in Table 2) and one of the molecular beacons (as shown in Table 4) was used to detect the amplified product. In this example, a 25 µl reaction contained 1X Isothermal Amplification Buffer (New England Biolabs) supplemented with 4.8 mM or 6 mM MgCl 2, 1.4 mM or 1.6 mM dNTP, 200nM molecular beacon (Sigma-Aldrich) , primers (0.2 µM of F3 and B3, if present; 1.6 µM or 2 µM of FIP and BIP; 0.4-0.8 µM of LF and LB, if present), 8 or 12 units of Bst2 polymerase (New England Biolabs), 7.5 units of RTx Warmstart (reverse transcriptase; New England Biolabs), and the extracted nucleic acid (as a model) or water (as no model control). The reactions were incubated at 63 ° C and the kinetics were monitored using a Roche real-time Lightcycler96 (Roche). The time to positivate for each primer-probe combination is reported in Table 6. The results are classified by the time to positivate (Tp) from the start of the reaction as follows: "NT" indicates that this combination has not been tested and " unclassified "indicates that no amplification was detected.

TABLE 6: Time to Positive with Detection by Probe 10 NTC Primers Beacon 103 UFI / mL UFI / mL without Kit-12 MB1 5.6 7.6 rating without Kit-12 MB2 4.8 6.7 rating without Kit-12 MB3 5.2 7.2 classification without Set-12 MB4 6.3 8.4 classification without Set-12 MB5 5.6 7.4 classification without Set-13 MB2 14.6 20.9 classification without Set-13 MB6 8, 9 11.2 classification without Set-14 MB11 4.8 6.7 classification without Set-14 MB12 5.2 6.7 classification without Set-14 MB13 5.1 6.9 classification without Set-14 MB15 5.5 7.0 classification without Set-14 MB18 4.8 6.5 classification without Set-14 MB19 5.8 7.3 classification without Set-14 MB2 4.9 6.5 classification without Set-14 MB7 4.8 6.3 classification without Set-14 MB8 4.9 6.7 rating without Set-14 MB9 5.2 7.0 rating

10 NTC Primers Beacon 103 UFI / mL UFI / mL without Set-15 MB2 4.4 6.4 classification without Set-16 MB2 4.2 7.4 classification without Set-17 MB2 4.3 6.0 classification without Set- 18 MB2 4.8 6.6 classification without Set-19 MB11 6.0 8.0 classification without Set-19 MB12 5.9 7.9 classification without Set-19 MB13 5.9 8.0 classification without Set-19 MB18 5.6 7.4 classification without Set-19 MB19 6.6 8.7 classification without Set-19 MB2 4.7 6.6 classification without Set-19 MB20 5.7 7.7 classification without Set-19 MB21 5, 7 7.6 rating Set-20 without MB11 5.2 7.3 rating Set-20 without MB12 5.2 6.7 rating Set-20 without MB13 4.9 6.7 rating Set-20 without MB15 5.1 7 , 2 rating Set-20 without MB18 4.7 6.7 rating Set-20 without MB19 5.5 7.3 rating Set-20 without MB20 5.6 7.2 rating Set-20 without MB21 5.1 7.2 Classification Set-20 without MB3 5.8 7.7 Classification Set-20 without MB3 5.0 6.7 32.7 Set-20 without MB7 5.0 6.8 Classi fication Conjunto-20 without MB8 5.0 6.9 classification Conjunto-20 without MB9 4.9 7.1 classification Conjunto-21 without MB8 6.8 8.5 without

10 NTC Primers Beacon 103 UFI / mL UFI / mL classification without Set-21 MB14 6.7 8.9 classification without Set-21 MB16 6.4 8.4 classification without Set-21 MB17 2.7 3.5 classification without Set -21 MB3 8.2 10.3 classification without Set-21 MB4 6.9 8.9 classification without Set-22 MB19 7.3 9.3 classification without Set-23 MB19 11.8 14.8 classification without Set-24 MB19 6.5 8.4 classification without Set-24 MB20 6.3 8.3 classification without Set-24 MB21 5.9 8.1 classification without Set-25 MB19 7.3 9.7 classification without Set-25 MB20 7 , 6 10.0 classification without Set-25 MB21 7.2 8.4 classification Set-26 MB19 19.0 25.5 41.4 without Set-27 MB19 7.9 10.0 classification without Set-76 MB19 17, 3 NT classification without Set-78 MB19 12.2 NT classification without Set-79 MB19 28.6 NT classification without Set-81 MB19 22.1 NT classification

[0059] The use of Molecular Beacons for detection resulted in a slight increase in the Tp of the reaction, however, the significant increase in the specificity of the assay generated a reasonable dilemma, no amplification was observed in the sample of water or DNA from a species closely related within the 45 min test period (see Example 4, Table 7). Example 4: Specificity Test

[0060] A negative urine matrix has been contaminated with titrated C. trachomatis or with organisms commonly associated with sexually transmitted infections (eg Neisseria gonorrhoeae) or species closely related to C. trachomatis (C. pneumonia or C. psittaci). The bacterial strains were serially diluted in PBS before addition to the urine matrix at the desired concentration. The extracted nucleic acids or corresponding DNAs from the test species were used as models in the RT-LAMP reactions containing the LAMP primers and the beacon molecular probe, according to the methods described in Example 3, above. NT indicates untested reactions. TABLE 7: Cross Reactivity - Probe Detection 103 10 CN Primers Beacon C. psittaci NTC UFI / mL UFI / mL pneumoniae gonorrhoeae Set- MB2 4.4 6.2 13.5 13.2 20.2 19.6 14 Set- MB11 NT 6.7 18.6 14.4 32.1 23.3 14 Set- MB2 4.7 7.0 22.5 23.5 21.8 21.1 20 Set- MB11 NT 6.7 26.4 27.1 27.8 20.4 20 Set- MB2 without without without 6.6 6.6 21 classification classification classification classification Set- without without without MB19 NT 8.1 19 classification classification classification classification Set- without without MB19 NT 7.8 33.4 28.6 20 classification classification Set- without without MB19 NT 7.3 20.1 14.9 14 classification classification

[0061] This example shows that the CT23S assay and its reaction formulation can be designed to be highly specific, limiting cross-reactivity with sequences of closely related organisms and those commonly associated with sexually transmitted infections. Example 5: Sensitivity Test

[0062] A molecular standard of RNA was diluted in various concentrations to assess the sensitivity of the indicated primer / molecular beacon set combinations (Table 8). The standards were serially diluted with 0.1mg / mL Poly A carrier RNA in PBS (Sigma) and used as a model for amplification in RTLAMP reactions. The final concentrations in the reactions were 40, 8 or 4 copies / uL. The reaction conditions were equivalent to those described above in Example 3. The amplification signal was obtained with concentrations as low as 4 copies / µL (see Table 8). TABLE 8: Sensitivity with LAMP and Molecular Beacon

Primer Beacon set 40 copies / uL 8 copies / uL 4 copies / uL Set-14 MB2 6.5 7.6 12.3 Set-20 MB2 6.5 7.8 9.9

Claims (104)

1. Composition characterized by the fact that it comprises a set of polynucleotides selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78. 2. Composition according to claim 1, characterized by the fact that it also comprises a probe. 3. Composition according to claim 2, characterized by the fact that the probe is a labeled polynucleotide. 4. Composition according to claim 3, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6 -29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO : 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8- 28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of S EQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 5. Composition according to claim 2, characterized by the fact that the probe is a molecular beacon (hybridization probe) comprising a fluorophore, a suppressor and a polynucleotide. 6. Composition according to claim 5, characterized by the fact that the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8 -31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO : 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7- 34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 7. Composition according to claim 6, characterized by the fact that the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130. 8. Composition according to claim 7, characterized by the fact that the polynucleotide sequence consists of SEQ ID NO: 115. 9. Molecular beacon characterized by the fact that it comprises a fluorophore, a suppressor and a polynucleotide, in which the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5- 34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO : 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4- 27 from SEQ ID NO: 104, nucleotides 7-30 from SEQ ID NO: 105, nucleotides 5-27 from SEQ ID NO: 106, nucleotides 6-29 from SEQ ID NO: 107, nucleotides 6-29 from SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 10. Molecular beacon according to claim 9, characterized in that the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130. 11. Composition according to claim 10, characterized by the fact that the polynucleotide sequence consists of SEQ ID NO: 115. 12. Molecular beacon, according to claim 9, characterized by the fact that the fluorophore is FAM and the suppressor is BHQ1. 13. Chlamydia trachomatis detection method in a test sample, the method being characterized by the fact that it comprises: (a) extracting the nucleic acid from the test sample; (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78; and (c) detecting the presence or absence of an amplified product from step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. 14. Method according to claim 13, characterized in that the amplification in step (b) of the target sequence is carried out between about 60 ° C and about 67 ° C for less than fifteen minutes. 15. Method, according to claim 14, characterized by the fact that the amplification step is performed for less than ten minutes. 16. Method according to claim 13, characterized in that the reaction mixture further comprises a reverse transcriptase. 17. Method according to claim 13, characterized in that the detection of the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a marker. 18. Method according to claim 17, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6 -29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO : 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8- 28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 19. Method according to claim 18, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97-101 and 103-130. 20. Method according to claim 19, characterized in that the sequence of the labeled polynucleotide is SEQ ID NO: 115. 21. Method according to claim 13, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 100 UFI / mL. 22. Method according to claim 21, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 5 UFI / ml and the amplification step is performed for less than 15 minutes. 23. Method according to claim 21, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 10 UFI / ml and the amplification step is performed for less than six minutes. 24. Kit characterized by the fact that it comprises a composition according to claim 1. 25. Kit according to claim 24, characterized in that it further comprises a tape displacement polymerase. 26. Kit according to claim 24, characterized by the fact that it further comprises a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide, in which the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NOs: 97- 101 and 103-130. 27. Kit according to claim 26, characterized by the fact that the polynucleotide consists of SEQ ID NO: 115. 28. Chlamydia trachomatis detection method in a test sample, the method being characterized by the fact that it comprises: (a) extracting the nucleic acid from the test sample; (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific LAMP primer set selected from the group consisting of at Conjunto-20 and Conjunto-24; and (c) detecting the presence or absence of an amplified product from step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. 29. Method according to claim 28, characterized in that the detection of the presence or absence of the amplification product comprises hybridization of the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of nucleotides 5-34 of the SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8 -29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO : 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, n ucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 30. Method according to claim 28, characterized in that the detection of the presence or absence of the amplification product comprises the hybridization of the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 97 -101 and 103-130. 31. Composition characterized by the fact that it comprises a set of polynucleotides selected from the group consisting of Set-1 to Set-81. 32. Composition according to claim 31, characterized by the fact that it further comprises a probe. 33. Composition according to claim 32, characterized by the fact that the probe comprises a marker. 34. Composition according to claim 33, characterized by the fact that the probe is a labeled polynucleotide. 35. Composition according to claim 34, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5 -29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, and nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9 -34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. 36. Composition according to claim 34, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97 to 131. 37. Composition according to claim 34, characterized by the fact that the marker is a fluorophore. 38. Composition according to claim 37, characterized by the fact that the fluorophore is covalently attached to a polynucleotide terminal. 39. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104 , nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 7-32 of SEQ ID NO: 128, and nucleotides 4-27 of SEQ ID NO: 129, and where the set of polynucleotides is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set-66 and Sets 68-81. 40. Composition according to claim 39, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107 , SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128 and SEQ ID NO: 129. 41. Composition according to claim 40, characterized by the fact that the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the set of polynucleotides is selected from the group consisting of Set-20, Set-24, Set-47 , Set-51, Set-74 and Set-78. 42. Composition according to claim 41, characterized by the fact that the set of polynucleotides is Set-20 or Set-24. 43. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98 , nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122 , and in which the polynucleotide set is selected from the group consisting of Sets 12-27, Sets 39-54 and Sets 66-81. 44. Composition according to claim 43, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100 , SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122. 45. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126 , and where the polynucleotide set is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set- 51, Set-54, Set-66, Sets 68-72, Set 74, Set-78 and Set-81. 46. Composition according to claim 45, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. 47. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127 , and in which the polynucleotide set is selected from the group consisting of Sets 14-27, Sets 41-54 and Sets 68-81. 48. Composition according to claim 47, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127. 49. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising nucleotides 6-27 of SEQ ID NO: 130, and in which the set of polynucleotides is selected from the group consisting of Sets 12- 20, Sets 22-27, Sets 39-47, Sets 49-54, Sets 66-74 and Sets 76-81. 50. Composition according to claim 49, characterized in that the labeled polynucleotide comprises SEQ ID NO: 130. 51. Composition according to claim 31, characterized in that it further comprises a labeled polynucleotide comprising a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131 , and in which the set of polynucleotides is selected from the group consisting of Set-13, Set-40 and Set-67. 52. Composition according to claim 51, characterized in that the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. 53. Composition according to claim 52, characterized in that the probe is a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide. 54. Composition according to claim 53, characterized in that the molecular beacon comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6 -29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO : 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5- 30 from SEQ ID NO: 117, nucleotides 8-28 from SEQ ID NO: 118, nucleotides 8-30 from SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8 -34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO : 128, nucleotides 4-27 of SEQ ID NO: 129, and nucleotides 6-27 of SEQ ID NO: 130. 55. Composition according to claim 54, characterized in that the molecular beacon comprises a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 130. 56. Composition according to claim 55, characterized by the fact that the polynucleotide sequence consists of SEQ ID NO: 115. 57. Molecular beacon characterized by the fact that it comprises a fluorophore, a suppressor and a polynucleotide, in which the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5- 34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO : 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, and nucleotides 8-29 of SEQ ID NO: 120. 58. Molecular beacon according to claim 57, characterized in that the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 99 to SEQ ID NO: 120. 59. Molecular beacon according to claim 58, characterized in that the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 99 to SEQ ID NO: 120. 60. Molecular beacon according to claim 57, characterized by the fact that the fluorophore is FAM and the suppressor is BHQ1. 61. Molecular beacon according to claim 57, characterized by the fact that the fluorophore is ATTO 565 or Alexa 594 and the suppressor is BHQ1 or BHQ2. 62. Method of detecting Chlamydia trachomatis in a test sample, the method being characterized by the fact that it comprises: (a) extracting the nucleic acid from the test sample; (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific primer set, wherein said sequence-specific primer set is selected from the group consisting of Set-1 to Set-81; and (c) detecting the presence or absence of an amplified product from step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. 63. Method according to claim 62, characterized in that the amplification in step (b) of the target sequence is carried out between about 60 ° C and about 67 ° C for less than 30 minutes. 64. Method, according to claim 63, characterized by the fact that the amplification step is performed for less than fifteen minutes. 65. Method according to claim 64, characterized by the fact that the amplification step is performed for less than ten minutes. 66. Method according to claim 65, characterized by the fact that the amplification step is performed for less than six minutes. 67. Method according to claim 62, characterized in that the reaction mixture further comprises a reverse transcriptase. 68. Method according to claim 62, characterized in that the detection of the presence or absence of the amplification product comprises hybridizing the amplified product with a probe comprising a polynucleotide attached to a marker. 69. Method according to claim 68, characterized by the fact that the marker is a fluorophore. 70. Method according to claim 69, characterized in that the fluorophore is covalently attached to a polynucleotide terminus. 71. Method according to claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6-30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6 -29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO : 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5- 30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. 72. Method according to claim 71, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 97 to 130. 73. The method of claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 8-31 of SEQ ID NO: 111, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, nucleotides 5-30 of SEQ ID NO: 117, nucleotides 8 -28 from SEQ ID NO: 118, nucleotides 8-30 from SEQ ID NO: 119, nucleotides 9-34 from SEQ ID NO: 123, nucleotides 8-34 from SEQ ID NO: 124, nucleotides 7-32 from SEQ ID NO : 128, and nucleotides 4-27 of SEQ ID NO: 129, and where the specific sequence primer set is selected from the group consisting of Set-12, Sets 14-27, Set-39, Sets 41-54, Set -66 and Sets 68-81. 74. Method according to claim 73, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 107 , SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 128 and SEQ ID NO: 129 75. Method according to claim 74, characterized by the fact that the sequence of the labeled polynucleotide is SEQ ID NO: 115, and the specific sequence primer set is selected from the group consisting of Set-20, Set-24, Set-47, Set-51, Set-74 and Set-78. 76. Method according to claim 75, characterized by the fact that the specific sequence primer set is Set-20 or Set- 24. 77. Method according to claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 5-27 of SEQ ID NO: 106, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, and nucleotides 7-34 of SEQ ID NO: 122, and wherein the sequence specific primer set is selected from the group consisting of Sets 12-27, Sets 39-54 and Sets 66-81. 78. Method according to claim 77, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100 , SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122 79. Method according to claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-28 of SEQ ID NO: 125 and nucleotides 7-28 of SEQ ID NO: 126, and where the specific sequence primer set is selected from the group consisting of Set-12, Sets 14-18, Set-20, Set-24, Set-27, Set-39, Sets 41-45, Set-47, Set - 51, Set-54, Set-66, Sets 68-72, Set 74, Set-78 and Set-81. 80. The method of claim 79, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126. 81. Method according to claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 8-31 of SEQ ID NO: 113 and nucleotides 3-27 of SEQ ID NO: 127, and where the specific sequence primer set is selected from the group consisting of Sets 14-27, Sets 41-54 and Sets 68-81. 82. The method of claim 81, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 113 and SEQ ID NO: 127. 83. The method of claim 68, characterized in that the labeled polynucleotide comprises nucleotides 6-27 of SEQ ID NO: 130, and in which the sequence-specific primer set is selected from the group consisting of Sets 12 -20, Sets 22-27, Sets 39- 47, Sets 49-54, Sets 66-74 and Sets 76-81. 84. Method according to claim 83, characterized in that the labeled polynucleotide comprises SEQ ID NO: 130. 85. Method according to claim 68, characterized in that the labeled polynucleotide comprises a sequence selected from the group consisting of nucleotides 6-30 of SEQ ID NO: 102 and nucleotides 8-29 of SEQ ID NO: 131, and where the specific sequence primer set is selected from the group consisting of Set-13, Set-40 and Set-67. 86. Method according to claim 85, characterized in that the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 102 and SEQ ID NO: 131. 87. Method according to claim 62, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 100 UFI / mL. 88. Method according to claim 87, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 50 UFI / mL. 89. Method according to claim 88, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 5 UFI / mL. 90. Method according to claim 89, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 2 UFI / mL. 91. Method according to claim 87, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 5 UFI / ml and the amplification step is performed for less than 15 minutes. 92. Method according to claim 87, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 10 UFI / ml and the amplification step is performed for less than six minutes. 93. Kit characterized by the fact that it comprises a composition according to claim 31. 94. Kit according to claim 93, characterized in that it further comprises a tape displacement polymerase. 95. Kit according to claim 94, characterized in that it further comprises a molecular beacon comprising a fluorophore, a suppressor and a polynucleotide, wherein the polynucleotide comprises a sequence selected from the group consisting of nucleotides 5-34 of SEQ ID NO: 97, nucleotides 5-31 of SEQ ID NO: 98, nucleotides 3-31 of SEQ ID NO: 99, nucleotides 5-30 of SEQ ID NO: 100, nucleotides 6-29 of SEQ ID NO: 101, nucleotides 6 -30 of SEQ ID NO: 102, nucleotides 5-26 of SEQ ID NO: 103, nucleotides 4-27 of SEQ ID NO: 104, nucleotides 7-30 of SEQ ID NO: 105, nucleotides 5-27 of SEQ ID NO : 106, nucleotides 6-29 of SEQ ID NO: 107, nucleotides 6-29 of SEQ ID NO: 108, nucleotides 6-29 of SEQ ID NO: 109, nucleotides 6-30 of SEQ ID NO: 110, nucleotides 8- 31 of SEQ ID NO: 111, nucleotides 6-29 of SEQ ID NO: 112, nucleotides 8-31 of SEQ ID NO: 113, nucleotides 5-29 of SEQ ID NO: 114, nucleotides 5-29 of SEQ ID NO: 115, nucleotides 4-28 of SEQ ID NO: 116, n ucleotides 5-30 of SEQ ID NO: 117, nucleotides 8-28 of SEQ ID NO: 118, nucleotides 8-30 of SEQ ID NO: 119, nucleotides 8-29 of SEQ ID NO: 120, nucleotides 4-33 of SEQ ID NO: 121, nucleotides 7-34 of SEQ ID NO: 122, nucleotides 9-34 of SEQ ID NO: 123, nucleotides 8-34 of SEQ ID NO: 124, nucleotides 6-28 of SEQ ID NO: 125, nucleotides 7-28 of SEQ ID NO: 126, nucleotides 3-27 of SEQ ID NO: 127, nucleotides 7-32 of SEQ ID NO: 128, nucleotides 4-27 of SEQ ID NO: 129, nucleotides 6-27 of SEQ ID NO: 130, and nucleotides 8-29 of SEQ ID NO: 131. 96. Kit according to claim 95, characterized by the fact that the polynucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. 97. Kit according to claim 96, characterized by the fact that the polynucleotide consists of a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. 98. Kit according to claim 97, characterized by the fact that the polynucleotide consists of SEQ ID NO: 115 and the set of polynucleotides is Set-20 or Set-24. 99. Method of detecting Chlamydia trachomatis in a test sample, the method being characterized by the fact that it comprises: (a) extracting the nucleic acid from the test sample; (b) amplifying a target sequence by reacting the nucleic acid extracted in step (a) for less than ten minutes with a reaction mixture comprising a strand-displacement DNA polymerase and a sequence-specific LAMP primer set; and (c) detecting the presence or absence of an amplified product from step (b); wherein the presence of said amplification product is indicative of the presence of Chlamydia trachomatis in the test sample. 100. Method according to claim 99, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 100 UFI / mL. 101. Method according to claim 100, characterized by the fact that Chlamydia trachomatis is present in the test sample at a concentration of ≤ 10 UFI / mL. 102. Method according to claim 99, characterized in that the amplification step comprises the reaction of the nucleic acid extracted in step (a) with a reaction mixture comprising a strand-displacing DNA polymerase and a primer set specific sequence, wherein said specific sequence primer set is selected from the group consisting of Set-1 to Set-81. 103. Method according to claim 102, characterized in that the detection of the presence or absence of the amplification product comprises the hybridization of the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 131. 104. Method according to claim 102, characterized in that the detection of the presence or absence of the amplification product comprises the hybridization of the amplified product with a molecular beacon comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 99 to SEQ ID NO: 120.