BG113148A - Quantitative assessment method for quick prognosis and control of dysbiosis of the gastrointestinal tract in infants aged up to one year and for multifactorial diseases - Google Patents

Abstract

The invention relates to a method for in vitro assessment and prognosis for balancing the intestinal microbiota in newborns from one month to one year, based on an integrated approach with calculation of correlation coefficients between key indicators, divided into three main groups: 1. Correlation between the composition and amount of microorganisms in breast milk and in the faeces of the child; 2. Correlation between enzyme profile and activity of enzymes responsible for the absorption and metabolism of milk components (lactose, lipids, oligosaccharides, proteins) in samples of breast milk and faeces of the child; 3. Correlation between the amount of metabolites obtained from the metabolism of the main components of breast milk from the microbiota in breast milk and in the faeces of the child. The method, according to the invention, provides an opportunity for rapid prognosis of dysbiosis in infants up to the age of one year. In this way, it will find application in the algorithm for accurate diagnosis of the intestinal microbiota in newborns aged one month to one year, and the method assists to quickly determine the type of dysbiosis and the degree of disorder.

Description

QUANTITATIVE ASSESSMENT METHOD FOR RAPID PREDICTION AND CONTROL OF GASTROINTESTINAL TRACT DYSBIOSIS IN INFANTS OF

AGE UP TO ONE YEAR AND FOR MULTIFACTOR DISEASES

I. TECHNICAL FIELD

The present invention relates to the field of medical diagnostics, pharmacy, biotechnology.

II. PRIOR ART

There is mixed evidence that breastfeeding provides significant protection against infectious and inflammatory diseases, various disabilities and improves cognition (Bartick and Reinhold, 2010; Dieterich et al., 2013; Kramer et al, 2009). This is largely due to the properties of breast milk and its oligosaccharides to influence microbial colonization in newborns. Palmer et al. (2007) showed that infants are colonized with approximately 107 different types of microorganisms during the first week of life. These close relationships of the organism with the gastrointestinal microflora may underlie and be critical in relation to the health of the newborn, as well as the risk of developing various other non-infectious diseases. In fact, optimal breastfeeding remains a highly effective public health strategy for infant survival, especially for reducing mortality due to gastroenteritis and pneumonia in developing countries (Bhutta et al., 2013). Research on breastfeeding has shown the protective role of breast milk against many chronic and immune conditions, in particular, type 1 diabetes, necrotizing enterocolitis, asthma and leukemia (Bartick and Reinhold, 2010).

The development of the microbiota in the digestive system of the newborn is a gradual and dynamic process that is determined by several factors, such as mode of birth, prematurity, type of feeding, associated diseases and antibiotic therapy, as well as environmental influences, which necessitates a personalized approach (Wall et al. 2009). In addition, the colonization process is strongly influenced by the diet (breast milk and/or artificial milk). During the first month after birth, bifidobacteria and coliforms (especially E. coli) are predominant, followed by Lactobacillus spp. and Bacteroides and varies widely between individuals (Wall et al., 2009). Changes in the ratio of the dominant representatives of the intestinal microflora of newborns appear after about one year of life, mainly as a result of introducing new food into the baby's diet. The number of representatives of Lactobacillus spp., Bacteroides spp. and Clostridia increased while bifibroids and E. coli decreased. Finally, at about 2 years of age, gut microbial communities reach a composition similar to that found in the adult gut (Koenig et al. 2011). The species Bifidobacterium longum is the most common initial colonizer of the gastrointestinal tract of neonates (Palmer et al., 2007).

Human milk possesses multiple mechanisms to protect newborns: immune response cells, immunoglobulins, innate defense proteins, peptides, free fatty acids, cytokines and chemokines, glycans and oligosaccharides (Ballard and Morrow, 2013). Among the various bioactive components of human milk, oligosaccharides are the most abundant and include significantly more than 100 different bioactive carbohydrates built from 3 to 32 monosaccharides (Newburg et al., 2005). As a class, oligosaccharides are 6–12 g/L of breast milk and are largely synthesized from lactose (Bode, 2012). Human colostrum contains approximately 22-24 g/L milk oligosaccharides (Newburg et al., 1995; Urashima et al., 2012). In human milk, oligosaccharides are the third most concentrated component after lactose and lipids, and their amount is much higher than the amount of proteins (Newburg et al., 1995). The structure of more than 100 human oligosaccharides has been characterized to date (Urashima et al., 201 la,b; Kobata, 2010). Characterization of the physiology of bifidobacteria has focused largely on their ability to metabolize various dietary oligosaccharides. This genus of bacteria has a set of transmembrane permeases that ensure the metabolism of various carbohydrate polymers, such as dietary fiber, including human milk oligosaccharides, which pass undigested to the distal parts of the digestive tract (Moro et al, 2006; Macfarlane and Cummings, 1999). There are only a few species of bifidobacteria capable of metabolizing and using human milk oligosaccharides as a carbon source. Such species are typically isolated primarily from the microflora of the gastrointestinal tract of newborns. Neonatal-associated bifidobacteria have been found to be capable of predominantly digesting lacto-N-tetraoses (LNT; Gal β l-3GlcNAc β 1-3 Gal β l-4Glc) or lacto-N-neotetraoses (LNnT; Gal β l-4GlcNAc β 1-3 Gal β l-4Glc) (LoCascio et al., 2007).

B. bifidum secretes an extracellular 1,2-α-1-fucosidase (EC 3.2.1.63) that cleaves terminal 1,2-α-fucosyl bonds that protect the galactose residues in lacto-I-biose, thereby allowing continued of catabolite processes until their complete absorption (Katayama et al., 2004; Nagae et al., 2007). In addition, lacto-β-biosidase (EC3.2.1.140) releases lacto-biose from lacto-M-tetraose and from other milk oligosaccharides lacking fucosylation or sialylation (Wada et al., 2008). Once age is associated with later development of atopic wheezing. For example, dysbiosis was observed in Ecuadorian infants involving various bacterial taxa, including several taxa of microscopic fungi. Faecal short-chain fatty acid levels in three-month-old infants with atopic wheezing showed clear trends of increased acetate concentration and decreased caproic acid concentration.

Some of the protective mechanisms of human milk are due to oligosaccharides. Given the increasing rate of disease associated with dysregulated microbiota and host immunity, there is global interest in testing new nutritional approaches and functional foods matching those found in breast milk to optimize host health and restore the bacterial flora. The literature data described so far prove that the research models used both for diagnostic purposes and for microbiota control in children up to one year of age cannot provide an algorithm for a quick and reliable assessment of the state of the intestinal microbiota and its association with various diseases , because they are linear, referred to only one indicator.

The creation of a quantitative assessment method for the rapid prediction of dysbiosis in infants up to 1 year and for multifactorial diseases for the study of deviations in the human microbiota requires an interdisciplinary approach and in the final assessment may include the data from different research methods that are processed as databases with specific computational techniques.

SH. TECHNICAL ESSENCE OF THE INVENTION

The task of the invention is to create a method for in vitro quantitative assessment, which provides an opportunity for rapid prediction of dysbiosis in infants up to 1 year old, which can be used in creating a model (algorithm) for precise diagnosis of the intestinal microbiota in newborns age from one month to one year, as the method also helps to quickly establish the type of dysbiosis and the degree of violation. The method is based on an interdisciplinary approach in the analysis of the quantitative and qualitative composition of the microbiota, the type and quantity of key enzymes and metabolites and data analysis by means of an information system.

In the past few years, studies have revealed that both colostrum and breast milk from healthy women contain bacteria, including staphylococci, streptococci, corynebacteria, lactic acid bacteria, propionobacteria, and bifidobacteria (Fernandez et al., 2013). Recently, the application of various techniques, including metagenomic approaches, confirmed the presence of DNA from these and other bacterial genera in breast milk and colostrum (Hunt et al., 2011; Cabrera-Rubio et al., 2012; Fernandez et al., 2013; Jost et al., 2013, 2014; Ward et al., 2013; Jimenez et al., 2015). Therefore, these biological fluids are continuous sources of live bacteria to the gastrointestinal tract (McGuire and McGuire, 2015) Other studies have shown that there is a transfer of bacterial strains from mother to infant in the breastfeeding process (Albesharat et al, 2011; Martin et al al., 2012; Jost et al., 2014). Despite some established correlations of the amount and composition of the intestinal microbiota in the detection of certain diseases, the molecular biological methods used are lengthy and expensive for daily practice, which makes them unavailable for mass use. There are no correlations established with data on key enzymes and metabolites responsible for the absorption of specific components from colostrum and breast milk and their concentration dynamics when changing the diet and overcoming intestinal dysbiosis.

Some bacteria from the infant's oral cavity can contaminate milk during suckling due to backflow of milk into the milk ducts (Ramsey et al., 2004). Within 24 hours after birth, colostrum has been found to contain typical oral bacteria such as Veillonella, Leptotrichia and Prevotella (Cabrera-Rubio et al., 2012). Although the origin of the human salivary microbiome is still rather poorly understood (Zaura et al., 2014), Streptococcus spp. appears to be one of the dominant species in both adults (Nasidze et al., 2009; Yang et al., 2012) and infants (Bearfield et al., 2002; Cephas et al., 2011). Streptococci are also among the dominant species in human colostrum and breast milk (Jimenez et al., 2008a, b; Hunt et al., 2011; Martin et al., 2015). It has been proven that the oral health of the mother correlates closely with the likelihood of developing dental caries in the child (Zaura et al, 2014). Certain compounds in human milk (eg, human milk oligosaccharides, proteins) may affect the colonization of individual species indirectly. For example, milk proteins such as caseins and lactoferrin have been found to have the ability to inhibit the attachment of cariogenic streptococci to hydroxyapatite and promote the attachment of commensal bacteria in vitro (Johansson and Lif Holgerson, 2011). No sufficiently large-scale and long-term studies characterizing the development of the oral microflora during the neonatal period and childhood have been conducted. In initial studies, it was thought that oral colonization by dental caries-causing bacteria could occur after the first baby teeth erupted in the newborn, but it was later shown that the cariogenic Streptococcus mutans could be present in the infant's oral cavity before the appearance of hard tissues there (Law et al, 2007).

Epidemiological studies reveal a number of environmental exposures associated with asthma. This could explain the escalation of asthma over the past 30 years.

Infants at risk of asthma exhibit transient states of intestinal dysbiosis and changes in the metabolome (eg, urobilinogen) during the first 3 months of life. These metabolites or differences in the microbiome are used in the design of advance for the use of probiotics or to serve as prognostic biomarkers. A model was developed by combining estimates of ecosystem productivity and the generation of ecosystem services for the definition of dysbiosis in infants. According to him, the gut microbiome is characterized by (1) no perturbation in taxon composition and amounts upon dietary change or antibiotic intake; (2) high susceptibility to invasion by extraneous taxa; and (3) poor utilization of available resources (including breast milk oligosaccharides). A healthy/balanced microbiota state is characterized as a highly functioning ecosystem when the gut microbiome is: (1) stable over time in taxon composition and abundance, (2) resistant to invasion by allochthonous bacteria; and (3) demonstrate high conversion of breast milk oligosaccharides into end products and biomass beneficial to infants. This model is method and selection index agnostic and provides a quantitative indicator and an objective approach to microbiome assessment, but is mainly limited in data on the composition and quantity of microorganisms and is not based on correlations between composition and quantity of microorganisms, enzyme activity , responsible for the absorption of oligosaccharides from breast milk and the amount of metabolites secreted by the microbiota.

The present patent application relates to the development of a specific method for in vitro quantitative assessment for the rapid prediction of dysbiosis in infants up to 1 year of age, in which the possibility of controlling the human microbiome is achieved, and in the method, according to the description, general indicators are reported on the one hand such as age and gender, and on the other hand the specific indicators of a person's state of health. The proposed method is based on processing data from analyzes of the diversity and ratio of microorganisms in the intestinal tract and other body fluids (saliva, breast milk, feces), the amount of metabolites used as biomarkers and reporting the level of enzyme activity of enzymes used as biomarkers, allowing consideration of individual characteristics of people.

The method subject to the present patent application is based on an integrated approach for in vitro analysis of the intestinal microbiota balance in children from one to twelve months and prediction of its restoration in case of established dysbiosis by calculating correlation coefficients between key indicators divided into three main groups:

1. Correlation between composition and amount of microorganisms in mother's breast milk and in the child's feces;

2. Correlation between enzyme profile and activity of enzymes responsible for absorption and metabolization of breast milk components (lactose, lipids, oligosaccharides, proteins) in samples of breast milk and child's feces;

3. Correlation between the amount of metabolites obtained from the metabolization of the main components of breast milk by the microbiota in breast milk and in the child's feces.

The method of in vitro quantitative assessment for rapid prediction of dysbiosis in infants up to one year and for multifactorial diseases requires the following course of analysis:

1. Protocol for quantitative analysis of human microbiota by real-time qPCR. The presented protocol can be applied to establish deviations for analysis of dysbiosis in newborns from one to twelve months and be included in an algorithm for identifying condition, deviations and rules for restoring the balance of the microbiota. Through it, it will be possible to quantify different groups of microorganisms from the beneficial and pathogenic microflora, which can be used to calculate the ratios between individual species (table 1). Of essential importance for determining the degree of dysbiosis are the bifidobacteria/bacteroid ratios; lactobacilli/bacteroides; (bifidobacteria + lactobacilli)/bacteroids; (bifido-bacteria+lactobacilli)/yeasts; (bifidobacteria+lactobacilli)/E. coli. Another important indicator is the ratio between bifidobacteria and the main enzymes responsible for digesting the main components of breast milk (lactose, lipids, proteins, oligosaccharides).

The values of the individual ratios vary depending on age, health and diet. The range of ratios in healthy subjects is presented in Table 6.

Table 1. Model of comparison of the data from the 12 investigated indicators.

2. Analysis of enzymes in samples of breast milk and feces from children from one to twelve months, which are responsible for metabolizing the main components of breast milk (lactose, oligosaccharides, lipids, proteins - β-galactosidase, α-galactosidase, aglucosidase, β -glucosidase, α-fucosidase, lipase, protease. For the purpose of the method, the ratios between the individual enzymes are calculated, which gives information about the type of metabolic processes that take place, and on the other hand, they give information about the capacity of the beneficial microflora to maintain the balance of the intestinal microflora The α-fucosidase enzyme gives direct information about the adhesion potential of the beneficial microflora (bifidobacteria and lactobacilli) on the epithelial cells of the intestinal mucosa, while the other enzymes give information about the rate of reproduction of the beneficial microorganisms and their place is this specific ecological niche. The data on the amount of enzymes correlate with the data on the amount of metabolites established in the respective paragraphs slaves. The ratio range of enzyme activity values is described in Table 6.

3. Analysis of the amount of short-chain fatty acids in samples of breast milk and feces of babies from one to twelve months. The quantitative analysis of lactate, acetate propionate and butyrate in samples of breast milk and feces of babies up to one year of age provide objective information about the metabolic processes carried out with the participation of the accompanying microbiota. The presence of short-chain fatty acids is a direct confirmation of the functional activity of bifidobacteria and lactobacilli. The ratio between the individual groups of microorganisms described in the first point of the proposed method and the amount of short-chain fatty acids provides essential information about the balance of the microbiota and its functional state. Furthermore, for the purposes of the proposed method, the ratios between the enzyme activities of the enzymes from the second point (the second stage of the analysis) and the amount of short-chain fatty acids can be calculated. The ratio range of enzyme activity values is described in Table 6.

4. Calculation of the correlation dependences between the ratios of the individual components to define the status of the microbiome in children from one to twelve months. Our proposed in vitro model to determine intestinal dysbiosis in children from one to twelve months as a state of the specific ecological niche in the intestinal tract, correlating with a reduction in the risk of acute and chronic diseases. Furthermore, the model may provide a framework for evaluating the effectiveness of strategies for the prevention and treatment of intestinal dysbiosis.

IV. EXAMPLES OF IMPLEMENTATION OF THE INVENTION

Example 1. In vitro study of 12 indicators for assessing the balance of the microbiota in babies from one to twelve months:

1. Protocol for quantitative analysis of human microbiota by real-time qPCR

The presented protocol can be applied to establish deviations for analysis of dysbiosis in newborns from one to twelve months and be included in an algorithm for identifying condition, deviations and rules for restoring the balance of the microbiota.

A. Primers and fluorescently labeled probes for real-time real-time PCR detection of bacterial groups and species in samples from the target groups

Primer pairs and fluorescently labeled probes for performing real-time qPCR detection of bacterial species and communities in samples from different target groups are presented in Table 2.

Table 2. Primers and fluorescently labeled probes for real-time qPCR detection of bacterial groups and species used in the presented study.

Targeted. bacterial group j or species Primers and probes Sequence __ - ² . I: ¹ **“: - Source Bifidobacterium sp. Bif-F Bif-R TCCGGTCYGGTGTGAAAG CCACATCCAGCRTCCCAC Rinttila et al., 2004 Bacteroides, Prevotella, Porphyromonas BPP-F BPP-R GGTGTCGGCTTAAGTGCCAT CGGAYGTAAGGGCCGTGC Rinttila et al., 2004 Lactobacillus Lacb-F Lacb-R AGCAGTAGGGAATCTTCCA CACCGCTACACACATGGAG Walter et al., 2001 Heilig et al., 2001 Bifidobacteria um F_Bifid 09c RBifid 06 CGGGTGAGTAATGCGTGACC TGATAGGACGCGACCCCA Furet et al., 2009 Bacteroides, Prevotella FBacter 11 RBacter 08 CCTWCGATGGATAGGGGTT CACGCTACTTGGCTGGTTCAG Furet et al., 2009

Lactobacillus, Leuconostoc, Pediococcus F_Lacto 05 R Lacto 04 AGCAGTAGGGAATCTTCCA CGCCACTGGTGTTCYTCCATATA Furet et al., 2009 Total intestinal bacterial microflora FBact 1369 R_Prokl492 CGGTGAATACGTTCCCGG TACGGCTACCTTGTTACGACTT Suzuki et al., 2000 Clostridium leptum FClept 09 RClept 08 CCTTCCGTGCCGSAGTTA GAATTAAACCACATACTCCACTGCTT Furet et al., 2009 Clostridium coccoides F_Ccoc 07 R_Ccoc 14 GACGCCGCGTGAAGGA AGCCCCAGCCTTTCCACATC Furet et al., 2009 Bifidobacterium probe PBifid 6FAM-CTCCTGGAAACGGGTG-BHQ-1 Furet et al., 2009 Bacteroides, Prevotella РВасЗОЗ probe HEX-AAGGTCCCCCACATTG- BHQ-1 Manz et al., 1996 Total intestinal bacterial microflora Probe PTM1389F 6FAM-CTTGTACACACCCGCCGTC- BHQ-1 Suzuki et al., 2000 Clostridium leptum Probe Pclep 01 6FAM- CACAATAAGTAATCCACC- BHQ-1 Furet et al., 2009 Clostridium coccoides Probe P_Erec482 HEX- CGGTACCTGACTAAGAAGBHQ-1 Franks et al., 1998

2. Control bacterial strains

Bacterial strains used to control the specificity of the primers and labeled probes used, as well as for the quantitative evaluation of individual bacterial species and communities are presented in Table 3. The strains used were purchased from the National Bank for Industrial Microorganisms and Cell Cultures (NBPMK) and German Collection of Microorganisms and Cell Cultures (DSMZ). The strains are cultivated aerobically or anaerobically in selective nutrient media, according to the recommendations of DSMZ and NBPMK. A series of dilutions is made from the developed cultures for each strain and plated on the corresponding agar medium in a petri dish to determine the total number of bacteria - colony-forming units (CFU). Additionally, samples of 1.0 ml are taken from the preparation dilutions, which are centrifuged under the following conditions: 12000rpm/3min. The resulting bacterial cell pellets were stored at -80°C until used for analysis.

Table 3. Control bacterial strains used in the study.

Source Application of genomic DNA in real-time PCR Lactobacillus delbrueckii subsp. Bulgaricus 1132 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Lactobacillus acidophilus 8896 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Lactobacillus rhamnosus 1010 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Bifidobacterium longum subsp. longum DSM-20219 DSMZ detection of Bifidobacterium without the use of fluorescent probes Bacteroides fragilis DSM-2151 DSMZ detection of Bacteroides, without polishing fluorescent probes Bifidobacterium adolescentis DSM-20083 DSMZ detection of Bifidobacterium, with fluorescently labeled probes Bifidobacterium longum subsp. infantis DSM-20088 DSMZ detection of Bifidobacterium, with fluorescently labeled probes Bifidobacterium breve DSM-20213 DSMZ detection of Bifidobacterium, with fluorescently labeled probes Clostridium leptum DSM-753 DSMZ detection of Clostridium with fluorescently labeled probes Clostridium coccoides (Blautia coccoides) DSM-935 DSMZ detection of Clostridium with fluorescently labeled probes

3. Isolation of DNA from bacterial cultures and samples from the target groups

Bacterial genomic DNA from the control strains and isolates from samples of the target groups was extracted using the Blood and Tissue kit DNeasy (Qiagen, Hilden, Germany).

Microbial DNA from faecal samples and from breast milk was isolated using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany). Initially, 200 mg of faecal sample/milk was diluted in 1.8 ml of sterile PBS buffer. 20 μΐ lysozyme (150 mg/ml) and 130 μΐ lysis buffer (2.0 mM Na2EDTA; 20 mM Tris-HCl; 1.2% Triton X-100) were added to 200 μΐ of diluted fecal sample. The mixture was incubated at 37°C for 30 min, after which DNA was isolated.

4. Quantification of DNA

The quantity and purity of the bacterial genomic DNA extracted from the standard strains and from the tested samples were determined spectrophotometrically. For this purpose, the absorbance of the suitably diluted DNA samples is determined at wavelengths of 260 nm and 280 nm. Measurements were performed on a Shimadzu UV-2600 spectrophotometer at a light path of 8.5 mm, after zeroing the apparatus against a cuvette with elution buffer. Homogeneity of genomic DNA was determined by visualizing the isolated DNA in a 1% (w/v) agarose gel by electrophoresis and staining with ethidium bromide. Samples with isolated DNA were stored at -20°C.

5. Conduct Real-time qPCR

In real-time qPCR reactions for the detection and quantification of bacteria without the use of fluorescent probes, SYBR Green PCR Master Mix (Applied Biosystems) was used. Reactions were plated in 96-well plates with a final volume of each reaction of 25 pL. Reactions were run on a Real-time PCR CFX96 Touch (BIO-RAD) with software version 3.0.1224 under conditions for each of the target groups of bacteria listed in Table 4.

Table 4. Primers and reaction conditions for conducting Real-time qPCR for the quantification of bacteria in faecal samples.

5? Target audience Bif-F and Bif-R Bifidobacteria et al Primers - 0.5 μΜ each; Predenaturation - 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of primers — 20 sec/58 °C; Elongation - 30 sec/72 °C; Detection — 30 sec/80 °C; Number of cycles —35. BPP-F and BPP-R Bacteroides, Prevotella, Porphyromonas Primers — 0.5 μΜ each; Predenaturation - 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of primers — 20 sec/68 °C; Elongation - 30 sec/72 °C; Detection - 30 sec/80 °C; Number of cycles-35. Lacb-F and Lacb-R Lactobacillus Primers - 0.5 μΜ each; Predenaturation — 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of primers — 20 sec/58 °C; Elongation - 30 sec/72 °C; Detection - 30 sec/80 °C; Number of cycles - 35.

F_Lacto 05 and R_Lacto 04 Lactobacillus, Leuconostoc, Pediococcus Primers - 0.2 μΜ each; Predenaturation - 10 min/95 °C; Denaturation — 30 sec/95 °C; Binding of the primers - 30 sec/60 °C; Elongation - 1 min/72 °C; Detection - 30 sec/80 °C; Number of cycles — 40.

Real-time qPCR reactions for detection and quantification of bacteria using fluorescently labeled probes used TaqMan Universal PCR Master Mix (Applied Biosystems). Reactions were plated in 96-well plates with a final volume of each reaction of 25 pL. Conditions for conducting each of the analyzes to determine the target groups of bacteria are indicated in Table 5.

Table 5. Primers, fluorescent probes and reaction conditions for conducting Real-time qPCR for the quantification of bacteria in faecal samples.

Primer pair and fluorescently labeled probe ' π —:5, Target audience Reaction conditions and .7 detection FBifid 09c, RBifid 06, PBifid probe Bifidobacterium Primers - 0.2 μΜ each; Probe - 0.2 μΜ: Predenaturation - 10 min/95 °C; Denaturation - 30 sec/95 °C; Primer extension and detection - 1 min/60 °C; Number of cycles - 40. F_Bacter 11, R Bacter 08, P_BasZOZ probe Bacteroides, Prevotella F_Bact 1369, R_1492, probe PTM1389F Determination of total amount of bacteria F Clept 09, R Clept 08, Probe P-Clep01 Clostridium leptum F Ccoc 07, R Ccoc 14, probe P_Erec482 Clostridium coccoides

All Real-time qPCR assays for bacterial quantification in faecal samples and breast milk were performed with a minimum of two replicates from different assays.

6. Electrophoretic analysis of DNA fragments obtained after performing real-time qPCR

Agarose gel electrophoresis of the reaction products was performed to verify the size and integrity of the amplimers obtained after performing real-time qPCR. The separation of the DNA fragments was performed in a 2% agarose gel, at a voltage of 35V and a current of 25 mA. The separated fragments are visualized fluorescently - by treating the gel with ethidium bromide and illuminating with UV light. The approximate sizes of the DNA fragments are determined by comparison with a standard containing small DNA fragments of known sizes - SmartLadder SF (Eurogentec, Belgium).

7. Statistical data processing

Statistical processing of the data and their graphical presentation were performed with SYSTAT version 13.2 and SigmaPlot version 12.0 software (Systat Software Inc., USA).

IL Analysis of enzymes in breast milk and newborn faeces samples

1. Determination of β-galactosidase enzyme activity (EU 3.2.1.23)

The enzyme reaction was carried out under conditions: 100 mM sodium acetate buffer, pH 6.0, containing 2 mM solution of o-nitrophenyl-B-O-galactopyranoside (ONP-Gal) and appropriately diluted cells or supernatant after disintegration of cells at 37oC. The reaction was quenched with 1 M sodium carbonate. One unit of enzyme activity catalyzes the production of 1.0 gmol of o-nitrophenol in one minute at pH 4.0 and 37°C. The o-nitrophenol content was determined spectrophotometrically at 410 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

2. Determination of α-galactosidase activity (EC 3.2.1.22)

The enzyme reaction was carried out under conditions: 400 mM citrate buffer, pH 4.0, containing 9.9 mM solution of p-nitrophenyl α-D-galactopyranoside (PNP-Gal) (prepared in distilled water by dissolving p-nitrophenyl α-D-galactopyranoside, Sigma cat. No. N-0877) and appropriately diluted cells or superfluid after disintegration of the cells at 37°C. The reaction was stopped with 200 mM borate buffer, pH 9.8. One unit of activity converts 1.0 gmole of p-nitrophenyl α-D-galactopyranoside to o-nitrophenol and D-galactose in one minute at pH 4.0 and 37°C.

The p-nitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

3. Determination of the activity of α-L - fucosidase (EU 3.2.1.51)

The enzyme reaction was carried out under conditions: 100 mM citrate buffer, pH 6.5, containing 10 mM solution of p-nitrophenyl α-L-fucopyranoside (PNP-FUC) (prepared by diluting p-nitrophenyl α-L-fucopyranoside (Sigma cat. no. N3628) with distilled water and appropriately diluted cells at 37°C. The reaction was stopped with 200 mM borate buffer, pH 9.8. One unit of activity converted 1.0 pmole of p-nitrophenyl α-L-fucopyranoside to r-nitrophenol and L-fucopyranoside in one minute at pH 4.0 and 37° C. Nitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

4. Determination of α-glucosidase activity (EC 3.2.1.20)

The enzyme reaction was carried out under conditions: 100 mM acetate buffer, pH 6.0, containing 1.25 mM solution of p-nitrophenyl α-D-glucopyranoside (prepared by diluting p-nitrophenyl α-D-glucopyranoside (Sigma cat. no. N3628) with distilled water , and suitably diluted cells at 37°C. The reaction was stopped with 0.5 M sodium carbonate. One unit of activity converted 1.0 pmole of p-nitrophenol α-D-glucopyranoside to rnitrophenol and D-glucopyranoside in one minute at pH 6.0 and 37°C. The rnitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

5. Determination of β-glucosidase activity (EC 3.2.1.28)

The enzyme reaction was carried out under conditions: 0.1 M acetate buffer, pH 5.0, containing a 20 mM solution of p-nitrophenyl-B-O-glucopyranoside (ONP-Glu) and appropriately diluted cells at 37°C. The reaction was stopped with 0.2 M sodium carbonate. One unit of activity converts 1.0 pmole of p-nitrophenyl α-D-glucopyranoside to p-nitrophenol and D-glucopyranoside in one minute at pH 5.0 and 37°C. The p-nitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

6. Determination of protease activity

Protease activity of cells and CSF was assayed in the presence of casein (Fluka) as a substrate. One unit (U) of protease activity is defined as the amount of enzyme that hydrolyzes casein to Ipmol tyrosine in 1 minute, at pH 7.5 and 37°C.

The enzyme reaction was carried out under the following conditions: in 50 mM phosphate buffer, pH 7.5, 0.65% (w/v) casein and 1.0 ml of an appropriately diluted sample (cells or HUT) were dissolved. The reaction takes place for 10 min at 37°C in a water bath. The reaction was stopped by the addition of 110 mM trichloroacetic acid (THO) (Merck) at 37°C. Samples were incubated with THO for 30 min at the same temperature. To separate the undegraded casein, the samples are centrifuged at 9000 rpm/15 min., 4°C. The supernatant was analyzed for the amount of tyrosine released from the degradation of casein in the presence of 500 mM #2 CO 3 and 0.5 M Folin's reagent solution (Merck) at 37°C for 30 minutes. The absorbance at λ=660 nm (AbbOpt) was measured on a Beckman Coulter DU 800 spectrophotometer, relative to a control containing distilled water instead of the sample. The concentration of tyrosine (pmol) was determined from the measured AbbOpt by a standard curve. L-tyrosine (Sigma-Aldrich) was used as a standard for the construction of a standard curve.

All experiments for the determination of protease activity were performed with a minimum of three-fold repeatability.

7. Determination of lipase activity (EU 3.1.1.3)

The enzyme reaction was carried out under the following conditions: 0.1 M acetate buffer, pH 7.6, containing 0.8 mM p-nitrophenyl palmitate solution and appropriately diluted cells at 37°C. The reaction was stopped with 0.2 M lead acetate (II). One unit of activity converts 1.0 pmole of p-nitrophenyl palmitate to p-nitrophenol and palmitate in one minute at pH 7.6 and 37°C. The p-nitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

III. Analysis of short-chain fatty acids in breast milk and faecal samples of one- to twelve-month-old infants.

The following protocol has been developed for the detection of short-chain fatty acids in excrement samples:

1. Isolation of short-chain fatty acids from excreta.

To 100 mg of fresh fecal sample or mother's breast milk, 2% H3POd or 0.05% H2SO4 is added in a ratio of 1:10. The samples are homogenized very well on a vortex 2 times for 2 min each. The resulting homogenate was centrifuged for 10 min, 13,000 rpm, after which the supernatant was separated. 200 pL were taken from the supernatant and extracted with 200 pL organic solvent (CH 2 Cl 2 , AcCN, EtOH, EtOAc). Samples were homogenized, then centrifuged for 5 min, 13,000 rpm. The resulting organic layer was separated and subjected to HPLC analysis.

2. HPLC method for the analysis of short-chain fatty acids.

A Konik-Tech (Spain) HPLC system was used, equipped with an Aminex НХ-87Н Ion Exclusion Column (7.8 mm i.d. x 30 cm, Biorad, Richmond, CA) and a Micro-Guard Cation-H pre-column (4.6 mm i.d. x 30 mm, Biorad). The determination of the samples was carried out with a UV detector at a wavelength of 210 nm, with a mobile phase of 0.005M H2SO4, a flow rate of 0.6 ml/min and a column temperature of Т=40°C.

Peaks were identified by retention times against standards of short-chain fatty acids: lactic acid, acetic acid, propionic acid, and butenoic acid. For the quantitative determination of short-chain fatty acids, standard lines were prepared in concentrations of 25 - 1.56 mmol/L. Correlation equations describing the peak area (y) and the concentration of short-chain fatty acids (x, mmol/L) were derived. The standard lines are with linear sections between 25 - 1.65 mmol/L and with a correlation coefficient r2 > 0.9999.

Parameters Breast milk Feces Types of microorganisms 1. Bifidobacteria 103-105 10M0 ⁸ 2. Lactobacilli 10 ⁴ -10 ⁶ 10M0 ⁸ 3. Clostridia - 104-106 4. Bacteroidetes - 105-10 ⁷ 5. Enterococci 1Q5-10 ⁷ 104-106 6. E.coli — typical - 104-106 Ί. Yeast-like fungi of the genus Candida - SW-10 ⁵ Enzymes

1. Alpha-galactosidase (U/mg protein) 0.1-0.3 0.1-0.2 2. Beta-galactosidase (U/mg protein) 0.4-2.0 0.2-1.0 3. Alpha-glucosidase (U/mg protein) 0.2-1.2 0.1-0.5 4. Beta-glucosidase (U/mg protein) 0.3-0.8 0.3-0.8 5. A+alpha-fucosidase (U/mg protein) 0.1-0.8 0.05-0.3 6. Lipase (U/mg protein) 7. Protease (U/mg protein) 0.5-3.0 0.2-1.5 Metabolites 1. Lactic acid (mmol/g) 0.5-1.2 0.2-0.8 2. Acetic acid (mmol/g) 0.2-0.6 0.3-0.7 3. Propionic acid (mmol/g) 0.1-0.3 0.05-0.3 4. Butyric acid (mmol/g) 0.05-02 0.02-0.13

Table 6. Range of values of measured indicators in healthy children aged one to twelve months.

As a result of the analyzes of the tested mother's breast milk and feces from a newborn between the ages of one and twelve months, the following coefficients are calculated:

1. Ratio of the quantity of Bifidobacteria/Bacteroides

2. The ratio of the amount of Bifidobacteria/Lactobacilli

3. The ratio of the quantity (Bifidobacteria+Lactobacilli)/Bacteroides

4. The ratio of the quantity (Bifidobacteria+Lactobacilli)/Yeast

5. The ratio of the amount of Bacteroids / Yeast

6. The ratio of the quantity (Bifidobacteria+Lactobacilli)/E. cars

7. The ratio of the quantity (Bifidobacteria+Lactobacilli)/betagalactosidase activity

8. The ratio of the amount of (Bifidobacteria+Lactobacilli)/alphafucosidase activity

9. The ratio of beta-galactosidase/alpha-galactosidase enzyme activities

10. The ratio of beta-galactosidase/alpha-fucosidase enzyme activities

11. The ratio of beta-galactosidase/lipase enzyme activities

12. The ratio of beta-galactosidase/protease enzyme activities

13. The ratio of enzyme activities (beta-galactosidase+alpha-galactosidase)/alpha-fucosidase

14. Ratio of metabolites lactic acid/acetic acid/butyric acid It is calculated as a ratio between the numbers of the corresponding bacteria (enzymes, metabolites), where as a measure of the number of bacteria (enzymes, metabolites) the relative value of the number is used compared to the middle of the interval of the normal and values.

' W .ShsG

Where:

1. C — ratio between the number of bacteria (enzymes, metabolites) A and B;

2. A - number of bacteria (enzymes, metabolites) A;

3. A nom. min. - the lower limit of the norm for the number of bacteria (enzymes, metabolites) A;

A nom.max. - upper limit of the norm for the number of bacteria (enzymes, metabolites) A;

B - number of bacteria (enzymes, metabolites) B;

In nom.min. - the lower limit of the norm for the number of bacteria (enzymes, metabolites) B;

In nom.max. - upper limit of the norm for the number of bacteria (enzymes, metabolites) B.

The trends in reporting the ratio are expressed in Table 7, which are obtained at the corresponding ratio of the indicator from the column of the table to the indicator from the row of the table.

Table 7. Trends of the ratios between the individual indicators, a red arrow indicates a positive effect on the microbiota, and a blue arrow indicates a negative effect on the microbiota.

1-Bifido

1-Bifido _____

.....................♦fSKS

3-Bacteroides _______

B-edide« MK6

6- E. coll

7- A-galactosidase φ (7/1)φ

8-8-galactosldase φ (8/1)4

9-A-fucosidase φ (9/1)Φ

Shaft φ (10/1)4

U-Protease φ (11/1)4

2-LAB 3-Bacteroid

4-Rains t (1/6) f (2/6)

12-Metabolites ♦ σ/a»4 t ¢/2)4 t (9/2)4 t (10/2)4 * (11/2)4

f (5/6) ♦ (6/5)4 ♦ ¢/5)4 + (8/S)4 + (9/S)4 t (10/5)4 t (11/5)4

7-A-placto$ldase 8-B*galactosidase 9-A-fuco$idase 10-LipaseT 11-Protease 12-Metabolites + (3/10) 4 + ¢/11)4 ______________________________________«ΛΦ 4 T (4/11 )4 t (7/12)4 t (8/12)4 f (9/12)4 t (10/12) 4

........ ......... * (11/12) 4

Example 2. In vitro study of 6 indicators for assessing the balance of the microbiota in babies from one to twelve months:

1. Protocol for quantitative analysis of human microbiota by real-time qPCR

The presented protocol can be applied to establish deviations for analysis of dysbiosis in newborns from one to twelve months and be included in an algorithm for identifying condition, deviations and rules for restoring the balance of the microbiota.

A. Primers and fluorescently labeled probes for real-time real-time PCR detection of bacterial groups and species in samples from the target groups

Primer pairs and fluorescently labeled probes for performing real-time qPCR detection of bacterial species and communities in samples from different target groups are presented in Table 8.

Table 8. Primers and fluorescently labeled probes for real-time qPCR detection of bacterial groups and species used in the presented study.

- ............. ^,J V ¹ I rune or species Primers and probes Sequence 5-3 Source Bifidobacterium sp. Bif-F Bif-R TCCGGTCYGGTGTGAAAG CCACATCCAGCRTCCCAC Rinttila et al., 2004 Bacteroides, Prevotella, Porphyromonas BPP-F BPP-R GGTGTCGGCTTAAGTGCCAT CGGAYGTAAGGGCCGTGC Rinttila et al., 2004 Lactobacillus Lacb-F Lacb-R AGCAGTAGGGAATCTTCCA CACCGCTACACACATGGAG Walter et al., 2001 Heilig et al., 2001 Bifidobacterium F_Bifid 09c R_Bifid 06 CGGGTGAGTAATGCGTGACC TGATAGGACGCGACCCCA Furet et al., 2009 Bacteroides, Prevotella FBacter 11 R_Bacter 08 CCTWCGATGGATAGGGGTT CACGCTACTTGGCTGGTTCAG Furet et al., 2009 Lactobacillus, L is u c ο η o s t o c, Pediococcus F Lacto 05 RLacto 04 AGCAGTAGGGAATCTTCCA CGCCACTGGTGTTCYTCCATATA Furet et al., 2009

2. Control bacterial strains

Bacterial strains used to control the specificity of the primers and labeled probes used, as well as for the quantitative assessment of individual bacterial species and communities are presented in Table 2. The strains used were purchased from the National Bank for Industrial Microorganisms and Cell Cultures (NBPMK) and German Collection of Microorganisms and Cell Cultures (DSMZ). The strains are cultivated aerobically or anaerobically in selective nutrient media, according to the recommendations of DSMZ and NBPMK. A series of dilutions is made from the developed cultures for each strain and plated on the corresponding agar medium in a petri dish to determine the total number of bacteria - colony-forming units (CFU). Additionally, samples of 1.0 ml are taken from the preparation dilutions, which are centrifuged under the following conditions: 12000rpm/3min. The resulting bacterial cell pellets were stored at -80°C until used for analysis.

Table 9. Control bacterial strains used in the study.

Strain Source · ..· - assM··.· ..... Application of genomic DNA in real-1 time PCR Lactobacillus delbrueckii subsp. Bulgaricus 1132 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Lactobacillus acidophilus 8896 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Lactobacillus rhamnosus 1010 T NBPMKK detection of Lactobacillus without the use of fluorescent probes Bifidobacterium longum subsp. longum DSM-20219 DSMZ detection of Bifidobacterium without the use of fluorescent probes Bacteroides fragilis DSM-2151 DSMZ detection of Bacteroides, without polishing fluorescent probes Bifidobacterium adolescentis DSM-20083 DSMZ detection of Bifidob acterium, with fluorescently labeled probes Bifidobacterium longum subsp. infantis DSM-20088 DSMZ detection of Bifidobacterium, with fluorescently labeled probes Bifidobacterium breve DSM-20213 DSMZ detection of Bifidobacterium, with fluorescently labeled probes Clostridium leptum DSM-753 DSMZ detection of Clostridium with fluorescently labeled probes Clostridium coccoides (Blautia coccoides) DSM-935 DSMZ detection of Clostridium with fluorescently labeled probes

3. Isolation of DNA from bacterial cultures and samples from the target groups

Bacterial genomic DNA from control strains and isolates from target group samples was extracted using the Blood and Tissue kit DNeasy (Qiagen, Hilden, Germany). Microbial DNA from faecal samples and from breast milk was isolated using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany). Initially, 200 mg of faecal sample/milk was diluted in 1.8 ml of sterile PBS buffer. 20 μΐ lysozyme (150 mg/ml) and 130 μΐ lysis buffer (2.0 mM NazEDTA; 20 mM Tris-HCl; 1.2% Triton X-100) were added to 200 μΐ diluted fecal sample. The mixture was incubated at 37°C for 30 min, after which DNA was isolated.

4. Quantification of DNA

The quantity and purity of the bacterial genomic DNA extracted from the standard strains and from the tested samples were determined spectrophotometrically. For this purpose, the absorbance of the suitably diluted DNA samples is determined at wavelengths of 260 nm and 280 nm. Measurements were performed on a Shimadzu UV-2600 spectrophotometer at a light path of 8.5 mm, after zeroing the apparatus against a cuvette with elution buffer. Homogeneity of genomic DNA was determined by visualizing the isolated DNA in a 1% (w/v) agarose gel by electrophoresis and staining with ethidium bromide. Samples with isolated DNA were stored at -20°C.

5. Conduct Real-time qPCR

In real-time qPCR reactions for the detection and quantification of bacteria without the use of fluorescent probes, SYBR Green PCR Master Mix (Applied Biosystems) was used. Reactions were plated in 96-well plates with a final volume of each reaction of 25 μΕ. Reactions were run on a Real-Time PCR CFX96 Touch (BIO-RAD) with software version 3.0.1224 under conditions for each of the target groups of bacteria listed in Table 10.

Table 10. Primers and reaction conditions for conducting Real-time qPCR for the quantification of bacteria in fecal samples.

Prime pair Target audience _s Reaction conditions and detection Bif-F and Bif-R Bifidobacterium Primers - 0.5 μΜ each; Predenaturation - 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of primers — 20 sec/58 °C; Elongation - 30 sec/72 °C; Detection - 30 sec/80 °C; Number of cycles - 35. BPP-F and BPP-R Bacteroides, Prevotella, Porphyromonas Primers - 0.5 μΜ each; Predenaturation - 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of the primers - 20 sec/68 °C; Elongation - 30 sec/72 °C; Detection - 30 sec/80 °C; Number of cycles-35.

Lacb-F and Lacb-R Lactobacillus Primers — 0.5 μΜ each; Predenaturation - 5 min/95 °C; Denaturation - 15 sec/95 °C; Binding of the primers - 20 sec/58 °C; Elongation - 30 sec/72 °C; Detection - 30 sec/80 °C; Number of cycles — 35. F Lacto 05 and RLacto 04 Lactobacillus, Leuconostoc, Pediococcus Primers - 0.2 μΜ each; Predenaturation — 10 min/95 °C; Denaturation - 30 sec/95 °C; Binding of the primers - 30 sec/60 °C; Elongation - 1 min/72 °C; Detection - 30 sec/80 °C; Number of cycles - 40.

Real-time qPCR reactions for detection and quantification of bacteria using fluorescently labeled probes used TaqMan Universal PCR Master Mix (Applied Biosystems). Reactions were plated in 96-well plates with a final volume of each reaction of 25 pL. Conditions for conducting each of the analyzes to determine the target groups of bacteria are indicated in Table 11.

Table 11. Primers, fluorescent probes and reaction conditions for conducting Real-time qPCR for the quantification of bacteria in faecal samples.

Primer pair and fluorescently labeled probe Target audience Reaction conditions and detection F_Bifid 09c, R Bifid 06, probe P_Bifid Bifidobacterium Primers - 0.2 μΜ each; Probe - 0.2 μΜ: Predenaturation - 10 min/95 °C; Denaturation - 30 sec/95 °C; Primer extension and detection - 1 min/60 °C; F Bacter 11, R Bacter 08, probe РВасЗОЗ Bacteroides, Prevotella F Bact 1369, R 1492, probe PTM1389F Determination of total amount of bacteria

All Real-time qPCR assays for bacterial quantification in faecal samples and breast milk were performed with a minimum of two replicates from different assays.

6. Electrophoretic analysis of DNA fragments obtained after performing real-time qPCR

Agarose gel electrophoresis of the reaction products was performed to verify the size and integrity of the amplimers obtained after performing real-time qPCR. The separation of the DNA fragments was performed in a 2% agarose gel, at a voltage of 35V and a current of 25 mA. The separated fragments are visualized fluorescently - by treating the gel with ethidium bromide and illuminating with VB light. The approximate sizes of the DNA fragments are determined by comparison with a standard containing small DNA fragments of known sizes - SmartLadder SF (Eurogentec, Belgium).

7. Statistical data processing

Statistical processing of the data and their graphical presentation were performed with SYSTAT version 13.2 and SigmaPlot version 12.0 software (Systat Software Inc., USA).

II. Analysis of enzymes in breast milk and newborn fecal samples

1. Determination of β-galactosidase enzyme activity (EU 3.2.1.23)

The enzyme reaction was carried out under conditions: 100 mM sodium acetate buffer, pH 6.0, containing 2 mM solution of o-nitrophenyl-B-O-galactopyranoside (ONP-Gal) and appropriately diluted cells or supernatant after disintegration of cells at 37oC. The reaction was quenched with 1 M sodium carbonate. One unit of enzyme activity catalyzes the production of 1.0 pmol of o-nitrophenol in one minute at pH 4.0 and 37°C. The o-nitrophenol content was determined spectrophotometrically at 410 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

2. Determination of α-L-fucosidase activity (EU 3.2.1.51)

The enzyme reaction was carried out under conditions: 100 mM citrate buffer, pH 6.5, containing 10 mM solution of p-nitrophenyl α-L-fucopyranoside (PNP-FUC) (prepared by diluting p-nitrophenyl α-L-fucopyranoside (Sigma cat. no. N3628) with distilled water and appropriately diluted cells at 37°C. The reaction was stopped with 200 mM borate buffer, pH 9.8. One unit of activity converted 1.0 pmole of p-nitrophenyl α-L-fucopyranoside to r-nitrophenol and L-fucopyranoside in one minute at pH 4.0 and 37° C. Nitrophenol content was determined spectrophotometrically at 405 nm wavelength on a Beckman Coulter DU 800 spectrophotometer.

All experiments for the determination of enzyme activity were performed in triplicate.

III. Analysis of short-chain fatty acids in breast milk and faecal samples of one- to twelve-month-old infants.

The following protocol has been developed for the detection of short-chain fatty acids in excrement samples:

3. Isolation of short-chain fatty acids from excrement.

2% HPO4 or 0.05% H2SO4 in a ratio of 1:10 is added to 100 mg of fresh fecal sample or breast milk. The samples are homogenized very well on a vortex 2 times for 2 min each. The resulting homogenate was centrifuged for 10 min, 13,000 rpm, after which the supernatant was separated. 200 pL were taken from the supernatant and extracted with 200 pL organic solvent (CH 2 Cl 2 , AcCN, EtOH, EtOAc). Samples were homogenized, then centrifuged for 5 min, 13,000 rpm. The resulting organic layer was separated and subjected to HPLC analysis.

4. HPLC method for the analysis of short-chain fatty acids.

A Konik-Tech (Spain) HPLC system equipped with an Aminex НХ-87Н Ion Exclusion Column (7.8 mm i.d. x 30 cm, Biorad, Richmond, CA) and a Micro-Guard Cation-H pre-column (4.6 mm i.d. x 30 mm, Biorad). The determination of the samples was carried out with a UV detector at a wavelength of 210 nm, with a mobile phase of 0.005M H2SO4, a flow rate of 0.6 ml/min and a column temperature of Т=40°С.

Peaks were identified by retention times against standards of short-chain fatty acids: lactic acid, acetic acid, propionic acid, and butenoic acid. For the quantitative determination of short-chain fatty acids, standard lines were prepared in concentrations of 25 - 1.56 mmol/L. Correlation equations describing the peak area (y) and the concentration of short-chain fatty acids (x, mmol/L) were derived. The standard lines are with linear sections between 25 - 1.65 mmol/L and with a correlation coefficient r2 > 0.9999.

Table 12. Range of parameters studied in children from one to twelve months.

Parameters Breast milk Feces Types of microorganisms 1. Bifidobacteria 10M0 ⁵ 10*-10« 2. Lactobacilli 10 ⁴ -10 ⁶ 10 ^b -10« 3. Bacteroidetes - 105-10' Enzymes 4. Beta-galactosidase (U/mg protein) 0.4-2.0 0.2-1.0 5. Alpha-fucosidase (U/mg protein) 0.1-0.8 0.05-0.3 Metabolites 6. Lactic acid (mmol/g) 0.5-1.2 0.2-0.8 7. Acetic acid (mmol/g) 0.2-0.6 0.3-0.7

8. Propionic acid (mmol/g) 0.1-0.3 0.05-0.3 9. Butyric acid (mmol/g) 0.05-02 0.02-0.13

As a result of the analyzes of the tested mother's breast milk and feces from a newborn between the ages of one and twelve months, the following coefficients are calculated:

1. Ratio of the quantity of Bifidobacteria/Bacteroides

2. The ratio of the amount of Bifidobacteria/Lactobacilli

3. The ratio of the quantity (Bifidobacteria+Lactobacilli)/Bacteroides

4. The ratio of the quantity (Bifidobacteria+Lactobacilli)/beta-galactosidase activity

5. The ratio of the amount of (Bifidobacteria+Lactobacilli)/alpha-fucosidase activity

6. The ratio of beta-galactosidase/alpha-fucosidase enzyme activities

7. The ratio of beta-galactosidase/protease enzyme activities

8. Lactic acid/acetic acid/butyric acid metabolite ratio

Calculations are made according to the specified formula.

Table 13. Trends of the ratios between the individual indicators, a red arrow indicates a positive effect on the microbiota, and a blue arrow indicates a negative effect on the microbiota.

................ _ 1-Bifido 2-LAB H-Bacterotdes 4-Bifido+MKB

1-Bifido

2-LAB .......... ___________________

[3-Bacteroides 1IIIVNI

4-Bifido+MKB

5-B-galactosidase(5/1) f f (5/2) f f (5/4) f b-A-fucosidase f (6/1) f f (5/1) f f (6/4) f

7- Metabolites

5-B-galactosidase b-A-fucosidase 7-Metabolites

(5/7) Ψ (6/7) f

Literature:

1. Albesharat, R., Ehrmann, M.A., Korakli, M., Yazaji, S., Vogel, R.F., 2011. Phenotypic and genotypic analyzes of lactic acid bacteria in local fermented food, breast milk and faeces of mothers and their babies. Systematic and Applied Microbiology 34, 148-155.

2. Ballard, O., Morrow, A.L., 2013. Human milk composition: nutrients and bioactive factors. Pediatric Clinics of North America 60(1), 49-74.

3. Bartick, M., Reinhold, A., 2010. The burden of suboptimal breastfeeding in the United States: a pediatric cost analysis. Pediatrics 125 (5), el048-el056.

4. Bhutta, Z.A., Das, J.K., Walker, N., et al., 2013. Interventions to address deaths from childhood pneumonia and diarrhea equitably: what works and at what cost? Lancet 381 (9875), 1417-1429.

5. Bode, L., Jantscher-Krenn, E., 2012. Structure-function relationships of human milk oligosaccharides. Advances in Nutrition 3 (3), 383S-391S.

6. Cabrera-Rubio, R., Collado, M.C., Laitinen, K., Salminen, S., Isolauri, E., Mira, A., 2012. The human milk microbiome changes over lactation and is shaped by maternal weight and mode of delivery. American Journal of Clinical Nutrition 96(3), 544-551.

7. Cephas, K.D., Kim, J., Mathai, R.A., Barry, K.A., Dowd, S.E., Meline, B.S., Swanson, K.S., 2011. Comparative analysis of salivary bacterial microbiome diversity in edentulous infants and their mothers or primary care givers. using pyrosequencing. PLoS ONE 6, e23503.

8. Dieterich, C.M., Felice, J.P., O'Sullivan, E., Rasmussen, K.M., 2013. Breastfeeding and health outcomes for the mother-infant dyad. Pediatric Clinics of North America 60 (1), 3148.

9. Jimenez, E., de Andres, J., Manrique, M., Pareja-Tobes, P, Tobes, R., Martinez-Blanch, J.F., Codoner, F.M., Ramon, D., Fernandez, L., Rodriguez , J.M., 2015. Metagenomic analysis of milk of healthy and mastitis-suffering women. Journal of Human Lactation 31, 406-415.

10. Jimenez, E., de Andres, J., Manrique, M., Pareja-Tobes, P., Tobes, R., Martinez-Blanch, J.F., Codoner, F.M., Ramon, D., Fernandez, L., Rodriguez, J.M., 2015. Metagenomic analysis of milk of healthy and mastitis-suffering women. Journal of Human Lactation 31, 406-415.

11. Johnson, P., Watkins, W., 1982. Separation of an alpha-3-L-fucosyltransferase from the blood-group-Legene-specified alpha-3/4-L-fucosyltransferase in human milk. Biochemical Society Transactions., 10:445—446.

12. Katayama, T., et al., 2004. Molecular cloning and characterization of Bifidobacterium bifidum 1,2-alpha-L-fucosidase (AfcA), a novel inverting glycosidase (glycoside hydrolase family 95). Journal of Bacteriology 186 (15), 4885-4893.

13. Kobata, A., 2010. Structures and application of oligosaccharides in human milk. Proceedings of the Japanese Academy, Series B, Physical and Biological Sciences 86, 1-17.

14. Koenig, J.E., et al., 2011. Succession of microbial consortia in the developing infant gut microbiome. Proceedings of the National Academy of Sciences of the United States of America 108 (Suppl. 1), 4578^1585.

15. Kramer, M.S., Matush, L., Bogdanovich, N., et al., 2009. Health and development outcomes in 6.5-y-old children breastfed exclusively for 3 or 6 mo. The American Journal of Clinical Nutrition 90 (4), 1070-1074.

16. Law, V., Scow, W.K., Townsend, G., 2007. Factors influencing oral colonization of mutans streptococci in young children. Australian Dental Journal 52, 93-100.

17. LoCascio, R.G., et aL, 2009. A versatile and scalable strategy for glycoprofiling bifidobacterial consumption of human milk oligosaccharides. Microbial Biotechnology 2 (3), 333-342.

18. Macfarlane, G.T., Cummings, J.H., 1999. Probiotics and prebiotics: can regulating the activities of intestinal bacteria benefit health? BMJ 318(7189), 999-1003.

19. Martin, R., Langa, S., Reviriego, C., Jiminez, E., Marin, M.L., Xaus, J., Fernandez, L., Rodriguez, J.M., 2012. Human milk is a source of lactic acid bacteria for the infant gut. Journal of Pediatrics 143, 754-758.

20. McGuire, M.K., McGuire, M.A., 2015. Human milk: mother nature’s prototypical probiotic food? Advances in Nutrition 6, 112-123.

21. Moro, G., et al., 2006. A mixture of prebiotic oligosaccharides reduces the incidence of atopic dermatitis during the first six months of age. Archives of Disease in Childhood 91 (10), 814-819.

22. Nagae, M., et al., 2007. Structural basis of the catalytic reaction mechanism of novel 1,2alpha-L-fucosidase from Bifidobacterium bifidum. Journal of Biological Chemistry 282 (25), 18497-18509.

23. Nasidze, 1., Li, J., Quinque, D., Tang, K., Stoneking, M., 2009. Global diversity in the human salivary microbiome. Genome Research 19, 636-643.

24. Newburg, D.S., Naubauer, S.H., 1995. Carbohydrates in milks: analysis, quantities and significance. In: Jensen, R.G. (Ed.), Handbook of Milk Composition. Academic Press, San Diego, pp. 273-349.

25. Palmer, C., et al., 2007. Development of the human infant intestinal microbiota. PLoS Biology 5 (7), el77.

26. Urashima, T., Fujita, S., Fukuda, K., Nakamura, T., Saito, T., Cowan, P., Messer, M., 2012. Chemical characterization of milk oligosaccharides of the common brushtail possum ( Trichosurus vulpecula). Glycoconjugate Journal 31, 387-399.

27. Urashima, T., Messer, M., Oftedal, O.T., 2011. Comparative biochemistry and evolution of milk oligosaccharides of monotremes, marsupials, and eutherians. In: Pontarotti, P. (Ed.), Evolutionary Biology: Genome Evolution, Speciation, Coevolution and Origin of Life. Springer, Switzerland, pp. 1-33.

28. Wada, J., et al., 2007. Purification, crystallization and preliminary X-ray analysis of the galacto-N-biose-/lacto-N-biose I-binding protein (GL-BP) of the ABC transporter from Bifidobacterium longum JCM1217. Acta Crystallographica Section F Structural Biology and Crystallization 63 (Pt 9), 751-753.

29. Wall, R., Ross, R. P., Shanahan, F., O' Mahony, L., O' Mahony, C., Coakley, M., et al., 2009. Metabolic activity of the enteric microbiota in influenza the fatty acid composition of murine and porcine liver and adipose tissues. The American Journal of Clinical Nutrition, 89, 1393-1401.

30. Ward, T.L., Hosid, S., loshikhes, 1., Altosaar, I., 2013. Human milk metagenome: a functional capacity analysis. BMC Microbiology 13, 116.

31. Yang, F., Zeng, X., Ning, K., Liu, K.L., Lo, C.C., Wang, W., Chen, J., Wang, D., Huang, R., Chang, X., Chain, P.S., Xie, G., Ling, J., Xu, J., 2012. Saliva microbiomes distinguish caries-active from healthy human populations. ISME Journal 6, 1-10.

32. Zaura, E., Nicu, E.A., Krom, B.P., Keijser, B.J., 2014. Acquiring and maintaining a normal oral microbiome: current perspective. Frontiers in Cell Infection and Microbiology 24, 85.

33. Newburg, D.S., Naubauer, S.H., 2005. Carbohydrates in milks: analysis, quantities and significance. In: Jensen, R.G. (Ed.), Handbook of Milk Composition. Academic Press, San Diego, pp. 273-349.

34. Wada, J., et al., 2008. Bifidobacterium bifidum lacto-N-biosidase, a critical enzyme for the degradation of human milk oligosaccharides with a type 1 structure. Applied and Environmental Microbiology 74 (13), 3996^1004.

35. Suzuki, R., et al., 2008. Structural and thermodynamic analyzes of solute-binding protein from Bifidobacterium longum specific for core 1 disaccharide and lacto-N-biose I. Journal of Biological Chemistry 283 (19), 13165-13173 .

36. Fujita, K., et al., 2005. Identification and molecular cloning of a novel glycoside hydrolase family of core 1 type O-glycan-specific endo-alpha-N-acetylgalactosaminidase from Bifidobacterium longum. Journal of Biological Chemistry 280 (45), 37415-37422.

37. Ruas-Madiedo, P., et al., 2008. Mucin degradation by Bifidobacterium strains isolated from the human intestinal microbiota. Applied and Environmental Microbiology 74 (6), 1936-1940.

38. Cabrera-Rubio, R., Collado, M.C., Laitinen, K., Salminen, S., Isolauri, E., Mira, A., 2012. The human milk microbiome changes over lactation and is shaped by maternal weight and mode of delivery. American Journal of Clinical Nutrition 96(3), 544-551.

39. Fernandez, L., Langa, S., Martin, V., Maldonado, A., Jimenez, E., Martin, R., Rodriguez, J.M., 2013. The human milk microbiota: origin and potential roles in health and disease. Pharmacological Research 69, 1-10.

40. Jost, T., Lacroix, C., Braegger, C., Rochat, F., Chassard, C., 2014. Vertical mother-neonate transfer of maternal gut bacteria via breastfeeding. Environmental Microbiology 16 (9), 2891-2904.

41. Ward, T.L., Hosid, S., loshikhes, I., Altosaar, I., 2013. Human milk metagenome: a functional capacity analysis. BMC Microbiology 13, 116.

Claims (6)

1. Quantitative assessment method for rapid prediction of dysbiosis in infants up to 1 year and for multifactorial diseases by assessing quantitative and qualitative composition of microbiota, type and amount of enzymes and metabolites, characterized by the fact that it includes the stages of: a) carrying out in vitro analyzes of the diversity and ratio of microorganisms in the intestinal tract and body fluids of mother and child, amount of metabolites used as biomarkers and reporting the level of enzyme activity of enzymes used as biomarkers. b) processing according to a mathematical model of the data from the previous stage, which as a result outputs: c) correlation between composition and amount of microorganisms in the body fluids of the mother and the child; d) correlation between enzyme profile and activity of enzymes responsible for the absorption and metabolism of body fluid components in the body fluid samples of the macaque and the child; f) correlation between the amount of metabolites derived from the metabolization of the main body fluid components by the microbiota in the body fluids of the mother and the child. 2. Method according to claim 1, characterized in that the other body fluids are selected from the group of saliva, breast milk, feces. 3. Method according to claims 1 or 2, characterized in that the microorganisms are selected from the group of bifidobacteria, lactobacilli, bacteroidetes, clostridia, enterococci, e.coli 4. Method according to claims 1 to 3, characterized in that the enzymes are selected from the group of alpha-galactosidase, beta-galactosidase, alpha-glucosidase, betaglucosidase, beta-glucosidase, alpha-fucosidase, lipase, protease. 5. Method according to claims 1 to 4, characterized in that the metabolites are selected from the group of lactic acid, acetic acid, propionic acid, butyric acid. 6. A method according to any one of claims 1 to 5, characterized in that the correlation is one or more of: correlation is amount of bifidobacteria/bacteroids correlation of amount of (bifidobacteria+lactobacilli)/bacteroids correlation of amount of (bifidobacteria+lactobacilli)/yeast correlation of amount of bacteroides/yeast correlation of amount of (bifidobacteria+lactobacilli)/e. coli correlation of quantity (bifidobacteria+lactobacilli)/betagalactosidase activity correlation of quantity (bifidobacteria+lactobacilli)/alphafucosidase activity correlation of enzyme activities beta-galactosidase/alpha-galactosidase correlation of enzyme activities beta-galactosidase/alpha-fucosidase correlation of enzyme activities beta-galactosidase/lipase correlation of enzyme activities beta-galactosidase/protease correlation of enzyme activities (beta-galactosidase+alpha-galactosidase)/alphafucosidase correlation of metabolites lactic acid/acetic acid/butyric acid.