BG106753A - Arylamine derivatives and their use as anti-telomerase agent - Google Patents

Abstract

The invention relates to arylamine derivatives for their use in the treatment of cancer as an anti-mimetic agent with a specific mechanism of action.

Description

ARYLAMINE DERIVATIVES AND THEIR USE AS AN ANTITOMERASE AGENT

The present invention relates to cancer therapy and relates to a new anticancer agent that has a very special mechanism of action. It also relates to novel compounds as well as their therapeutic application in humans.

The present invention relates to the use of non-nucleotide novel compounds that interact with specific deoxyribonucleic acid (ADN) structures. These new compounds are formed by a dispenser bonded to two groups of amino aromatic compounds. These novel compounds are useful in the treatment of cancer and act in particular as telomerase inhibitory agents. They are particularly useful as a stabilizing agent for AND as a G-quadruple structure (guanine notebooks). Therapeutic application to inhibit telomerase by stabilizing these G-quadruple structures has halted cellular mitosis and cell death during rapid division such as cancer cells and eventual induction of cancer cell senescence

The compounds of the present invention show a therapeutic advantage as a telomerase blocking agent. From a biological point of view, telomerase allows the introduction of repetitive AND sequences of the type T T A G G G, called telomerase sequences, at the telomere inlet during cell division. Through this action, telomerase produces

an immortal cell. Indeed, in the absence of this enzymatic activity, the cell loses 100 to 150 bases at each division, causing rapid aging. When rapid division of cancer cells occurs, these cells are selected to represent telomeres maintaining longer stability during cell division. In these cancer cells, telomerase is highly active, allowing it to add repetitive strands of telomeric sequences at the end of the telomere and thus allowing the longer telomere to be retained in the cancer cells. It has been achieved for some time that more than 85% of cancer cells are presented with positive tests in the presence of telomerase when somatic cells do not possess this characteristic.

Thus, telomerase is a highly desired target for the treatment of cancer cells. Obviously, the first approach to a telomerase blocking agent was the use of nucleotide structures (Chen et al., Proc. Natl. Acad. Sci. USA 93 (7), 2635-2639). Non-nucleotide compounds that have been used previously in the prior art may be cited by diaminoanthraquinones (Sun et al., J. Med. Chem. 40 (14), 2113-6) or diethyloxadicarbocyanins (Wheelhouse RT et al. J. Am. Chem. Soc 1998 (120) 3261-2).

Patent WO 99/40087 describes the use of compounds that interact with G-quadruple structures, which are perylene and carbocyanine compounds containing at least seven cycles of which two are heterocycles.

A method, quite surprisingly, has been selected that allows for simple structures to be obtained, at least equivalent to much less complex chemical structures. The compounds of the present invention that correspond to the target object, in other words, which have a particular G-quadruple structure and are therefore made with present telomerase inhibitory activity, conform to the following general formula:

nitrous aromatic ring - NR ₃ - dispenser - NR ' ₃ - aromatic ring in which the nitrided aromatic ring represents:

Ално optionally substituted quinoline with at least c

-one group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical or -a short-chain C1-C4 alkoxy group or a quinoline having a nitrogen atom below the quaternary form or □ benzamidine or □ pyridine • the aromatic ring represents но quinoline optionally substituted by at least one group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or one alkyl radical and / or short chain alkoxy with C1-C4 and / or quinoline having a quaternary nitrogen atom or benzamidine or pyridine or pyridine an enyl nucleus optionally substituted with a halogen group, alkoxy with C1-C4, cyano, carbonylamino optionally substituted with one or more alkyl groups with C1-C4, guanyl, alkylthio with C1-C4, amino, alkylamino

J with C1-C4, dialkylamino with C1-C4 for each alkyl group, nspro, alkyleneamino with C1-C4 or alkenyleneamino with C2-C4 or ете heterocyclic mono or bi or tricyclic ring containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more alkyl groups with C1-C4 or alkylene groups with C1-C4 or alkenylene with C2-C4 • R3 and R3, identical or different, represent independently of one another, hydrogen or C1-C4 alkyl radical • The dispenser is:

□ Triazine group optionally substituted by one alkyl radical. having 1 to 4 carbon atoms, a thio radical, oxy or amino are also optionally substituted by one or more short-chain alkyd chains containing 1 to 4 carbon atoms or a halogen atom or a ни carbonyl group or C group C (= NH) -NH- A C (= NH) or лки alkylenedyl group containing 3 to 7 carbon atoms or a зи diazine group optionally substituted by the same groups as triazines or their salts.

It is decided, within the meaning of the formula above, with a nitrogenated aromatic nucleus, that a heterocycle contains at least one nitrogen atom or an aromatic group containing no heteroatom in the nucleus but containing at least one nitrogen in the hydrocarbon chain attached to a ring such as guanidine or guaniline .

It is preferable to include among the combination of the above for use those containing a triazine or diazine group as a dispenser. Among the diazine groups it is preferable to use pyrimidines. Among the triazines, the compounds of formula (I) are preferred below:

RN ³ 1

Ah

NRL

I ³

Ag ₂ in which:

-A represents an amino group of formula NR 1 R 2 in which R 1 and R 2, identical or different, represent hydrogen or a straight or branched chain alkyl group containing 1 to 4 carbon atoms, or • an OR 1 or SR 1 group in which R 1 has the same meaning as before or • an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group; or • a hydrogen atom or • a halogen atom selected from fluorine, chlorine, bromine or iodine

-R3 and R3, the same or different, represent independently of one another hydrogen or alkyl of C1-C4.

- Ar _{1 and} Ar ₂ , the same or different represent

1. when Ar ₁ and Ar ₂ are the same:

• quinoline unit optionally substituted by at least

- the N (Ra) (Rb) group in which Ra and Rb, identical or different, represent hydrogen or an alkyl radical with a C1-C4 or -alkoxy group having a short chain containing 1 to 4 carbon atoms or • xuhoauh having a nitrogen atom of a quaternary form or • benzamidine or • pyridine attached to position 4 or combined with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group

2. when Ar ₃ and Ar ₂ are different • both the radicals Ar ₃ and Ar ₂ represent one of the possibilities mentioned above for Ar ₃ and Ar ₂ or • Ar _g represents one of the possibilities above and Ar ₂ represents • a phenyl ring optionally substituted with a halogen group, alkoxy with C1-C4, cyano, carbonylamino optionally substituted with one or more alkyl groups with Cl - C4, guanyl, alkylthio with Cl - C4, amino, alkylamino with Cl - C4, dialkylamino with Cl - C4 for each alkyl group, nitro, alkyleneamino with Cl - C4 or alkenyleneamino with C2 - C4 • heterocyclic mono or bi or tricyclic n ring containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more alkyl groups with Cl-C4 or alkylene groups with Cl-C4 or alkenylene C2-C4 or salts thereof .

Obviously, quinoline units may be substituted by any other non-administering group, such as acridine or isoquinoline or quinazoline or quinoxaline or phthalazine or benzothiazine or benzoxazine or phenoxazine or phenothiazine groups.

Preferred among the compounds of formula (I) above are those containing two heterocycles selected from the groups 4-aminoquinolyl, 4-aminoquinoline or quinoline, the quinoline nucleus of which is optionally substituted by a methyl group.

As for groups A, they preferably represent a methylthio radical, an amino, alkylamino or dialkylamino radical, in which the alkyl groups have 1 to 4 carbon atoms.

The title of compounds represented by formula (I) may be cited as the following compounds:

- 2-amino-bis-4,6 dichloride - [(1-methyl-4-amino-6'-quinaldino) amino] triazine

- 2-amino-bis-4,6 dichloride - [(1'-ethyl-4'-amino-6'-quinaldino) amino] triazine

2-dimethylamino-bis-4,6 - [(1-methyl-4-amino-6quinaldino) amino] -triazine dichloride

- 2-methylamino-bis-4,6 - [(4-amino-6 quinaldinyl) amino] -triazine trichlorohydrate

- 2-amino-bis-4,6 dichloride - [(1-methyl-6-quinolino) amino] -triazine-trichlorohydrate per 2-methylamino-bis-4,6 dichloride - [(4'-methylamino-

6-quinalidinyl) amino] -triazine

2-amino-bis-4,6 - [(9-amino-10-methyl-2-acridino) amino] -triazine dichloride dichloride

- 2-amino-bis-4,6 - [(4-amino-6-quinolinyl) amino] triazine trichlorohydrate

- 2-amino-bis-4,6- (p-amidinoanilino) -triazine trichlorohydrate

- 2-methylthio-bis-4,6 - [(1-methyl-4-amino-6-quinaldino) amino] · triazine dichloride

We do

- guxAOpxugpam guxugpam of 2-chloro-bis-4,6 - [(4 * -dimethylamino-6 quinalidinyl) amino] -triazine

- hardened with 2-methylthio-bis-4,6 - [(4'-dimethylamino-6-quinaldinyl) amino] triazine

- N, N- (4-Amino-6-quinalidinyl) urea dichlorhydrate

- N ¹ -bis (7-chloro-1-methyl-4-quinolino) pentane-1,5-diamine-trichlorohydrate bis-2,4 - [(4'-amino-6 quinalidinyl) amino diode ] pyrimidine

-guxugpam trichlorohydrate for 1,5- (4-amino-6'quinaldinyl) biguanide

- 6- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl [1,3,5} 1iriazin-2-ilamino1-2->^', etnl-h11nolin4-ol

- N6- [4- (4-dimethylamino-2-methyl-quinolin-6-ylamino) -6-methyl-sulfanyl- [1,3,5] triazin-2-yl] -2-methyl-quinolin-4, 6-diamine

- N- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methyl-sulfanyl- [1.3.5] triazin-2-yl] -2-methyl-quinolin-4,6- diamine

- N6- [4- (4-methoxy-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-yl] -4-methoxy-2-methyl-quinolin-6- amine

- N 6 - [(6- (4-amino-quinalidin-6-yl-amino) -4-methylthio-triazin-2-yl] quinaldine-4,6-diamine

- N 6 - [(6- (4-dimethylamino-quinaldin-6-yl-amino) -4-methylthio-triazin-2-yl] -quinaldine-4,6-diamine

- N 6 - [(6- (quinolyl-6-yl-amino) -4-diethylamino-triazin-2-yl] -quinaldine-4,6 diamine

Particularly preferred is any hydrate of 2-methylthio-bis-

4.6 - [(4'-Dimethylamino-6'-quinalidinyl) amino] triazine.

Another object of the present invention includes compounds of formula (I) as novel chemical products. This therefore includes new substances corresponding to the following formula (I):

wherein:

-A represents an amino group of formula NR1R2 in which R1 and R2, the same or different, represent a straight- or branched-chain alkyl group containing 1 to 4 carbon atoms, or • a group OR1 or SR1 in which R1 represents hydrogen or has the same meaning as before this or • an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group or

• a hydrogen atom or • a halogen atom selected from fluorine, chlorine, bromine or iodine

-R ₃ and R ₃ , the same or different, represent independently of one another hydrogen or an alkyl group C 1 -C 4

-Ar _x uArj, identical or different represent

1. where Ar _x and Ar ₂ are the same:

• the quinoline moiety optionally substituted by at least the group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or an alkyl radical of Cl - C4 or

a short-chain alkoxy group containing 1 to 4 carbon atoms or • quinoline having a quaternary nitrogen atom or • benzamidine except where A represents diethylamine, hydrogen or an amine group • pyridine attached at position -4 or combined with aryl or heteroaryl a group optionally substituted by an alkyl group with C1-C4

2. when Aij and Ar ₂ are different • both the radicals Ar _t and Ar ₂ represent one of the possibilities mentioned above for both Ar ₂ or • AT} represents one of the possibilities of the above gs and Ar ₂ represents • a phenyl ring optionally substituted by halogen, alkoxy by C1-C4, cyano, carbonylamino optionally substituted by one or more alkyl groups with Cl - C4, guanyl, alkylthio with Cl - C4, amino, alkylamino with Cl - C4, dialkylamino with Cl - C4 for each alkyl group, nspro, alkyleneamino with Cl - C4 or alkenyleneamino with C2 - C4 • heterocyclic mono or bi or tricyclic soil en containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more alkyl groups with Cl-C4 or alkylene groups with Cl-C4 or alkenylene with C2-C4 or one of their salts with the exception of 2-aminobis-4,6 - [(4-amino-6-quinalidinyl) amino] -triazine dichlorohydrate and 2-amino-bis-4,6- (ramidino-anilino) -triazine.

Indeed, the first of these two compounds is described in one reference book, Indian Journal of Animal Sciences 43 (4), pages 226-229 as an antitrypanosomal agent for animals, and in no case as an antibody telomerase agent, and the second is also described as an antitrypanosomal agent in J. Chem. Soc., 1960, 4525

The compounds of formula (I) which are preferred are those for which Ar ₂ and Ar ₂ represent a group selected from the following units: 4-amino or 4-methylamino- or 4-dimethylaminoquinolyl or quinolyl, whose quinoline nucleus is optionally substituted by methyl group.

The compounds of general formula (1) _d are those for which A represents an amino or dimethylamino group or more preferably a methylthio group.

All, in particular, compounds of formula (I) are preferred, for which, when Afj and Ar ₂ are different:

1. Atj represents:

• quinoline unit substituted by at least

- the N (Ra) (Rb) group in which Ra and Rb, the same or different, represent hydrogen or an alkyl radical with a C1-C4 or -alkoxy short chain group containing 1 to 4 carbon atoms or • quinoline having a nitrogen atom in quaternary form or • benzamidine except where A represents diethylamine, hydrogen or an amine group, or • pyridine attached at position -4 or combined with an aryl or heteroaryl group

2. Ar ₂ represents a * nucleus as defined above, but different or * a phenyl nucleus optionally substituted by a halogen group, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, alkyleneamino with Cl - C4 or alkenyleneamino with C2-C4 * quinoline, benzimidazole, indole, benzothiophene, benzofuran, benzothiazole, benzooxazole, carbazole, quinazoline, quinoxaline nucleus, optionally substituted C4 groups or optionally substituted C4 groups or alkyl groups or alkenylene with C2-C4 or one of them the affinity thereof with the exception of the dihydrochloride of 2-aminobis-4,6 - [(4-amino-6-hinaldinil) amino] triazine and 2-aminobis-4,6- (ramidino-anilino) triazine.

Another object of the present invention involves the use of compounds of formula (I) as a pharmaceutical product for use in humans. _z

Methods of Preparing Compounds of Formula (I)

are described below.

General method 1

According to the first method for the preparation of compounds of general formula (I) in which Αη and Ar ₂ , on the one hand, and R ₃ and R _3, on the other hand, are the same and defined as before and R represents a halogen atom such as chlorine or fluorine, amino function, alkylamino or dialkylamino whose straight or branched chain alkyl moieties contain from 1 to 4 carbon atoms, alkyloxy or alkylthio whose straight or branched chain alkyl moieties contain from 1 to 4 carbon atoms can be obtained by amination of dihalogenotriazine, usually dyspnea o-striazin the general formula (B) wherein A is defined as above, with an aromatic or heteroaromatic amine of the general formula (C) wherein Are defined as above, by working according to Scheme 1:

Ar --- NH

I From (C)

(A)

Scheme 1

In the case where A represents a halogen atom, it is advantageous to make 2,4,6-trichalo-S-triazine corresponding to general formula (B) to react with an aromatic or heteroaromatic amine ArNHR ₃ of general formula (C).

It is usually worked into one mole of dichalo-in-triazine or trichalo-B-triazine condensed with 2 moles of aromatic or heteroaromatic amine. The reaction is carried out in an inert medium under the reaction conditions. Among the inert solvents, optionally an aqueous solution of acetone or optionally an aqueous solution of alcohol such as ethanol, or a halogenated solvent such as dichloromethane, or an ether such as diethyl oxide or dioxane, or an aprotic polar solvent such as DMF or NMP. It is preferable to operate at a temperature between 20 ° C and the reflux temperature, in the presence of an organic base, such as triethylamine or an inorganic base. such as soda or sodium or potassium carbonate. It is also possible not to use a base during the amination reaction and to isolate the hydrochloride of a substance of general formula (A), the base of which can then be separated

Dihalogeno or trichalo-in-triazines of the general formula (B) are either commercially available or known, and can be prepared under the conditions described in the literature.

Aromatic or heteroaromatic amines of general formula (C) are either known or can be readily prepared by methods known for the synthesis of aromatic or heteroaromatic amines.

In the case where Ar ₂ and Ar ₂ are different, the triazine of general formula (A) can be obtained by sequentially displacing the halogen atoms, usually chlorine atoms, of the substances of general formula (B) through the amines Ar _x NHR ₃ then Ar ₂ NHR ' ₃ of general formula (C) according to Scheme 2:

Yimmimaib)

Scheme 2 in

Typically, 1 mole of dichalo-in-triazine, or trichalo-in-triazine, and 1 mole of amine A 1 H 2 -NHR 2 are generally employed. Preferably, it is worked in an inert solvent such as optionally an aqueous solution of acetone or optionally an aqueous solution of alcohol, such as ethanol, or a halogenated solvent such as dichloromethane, or an ether such as diethyl oxide or dioxane, or an aprotic polar DM solvent such as or NMP. According to a better way of using the invention, it is operated at a temperature between 20 ° C and 50 ° C. Then, 1 mole of aMUHAr ₂ NHR ' ₃ is added to the product of general formula (D), which may optionally be isolated. It is operated precisely at a temperature between 50 ° C and the reflux temperature.

Affordably, it can be operated under the conditions described in

We do

J. Fluor. Chem., 1988, 39 (1), 117-123.

General method 2

According to the second method, the substances of general formula (A) in which Ar 1 NHR a and A _{2 2} N ₃ ' ₃ are defined as before and R represents a group NR 1 R 2 or OR 1 or SR 1 may also be obtained by nucleophilic displacement of the halogen atom, usually a chlorine atom, of the compound of general formula (A) in which R represents a halogen atom according to Scheme 3:

R ^ gNH oi F ^ Oou R-jS *

(A)

R = NR _X R ₂ ou OR _X ou SR _X

R = Cl (ou F ou Br oi I)

Scheme 3

It is generally employed in 1 mole of a substance of general formula (A) in which R represents a halogen atom, preferably a chlorine atom, condensed with 1 mole amine R1R2NH or an alcoholic R1O or a shioalcoholate R1S. The reaction is carried out in an inert medium under the reaction conditions. Among the inert solvents, optionally an aqueous solution of acetone or optionally an aqueous solution of alcohol, such as ethanol, or a halogenated solvent such as dichloromethane or an ether such as diethyl or dioxane oxide, or an aprotic polar solvent MS such as DM, or DM, such as DM . When the entry group represents the R1R2NH group, it is preferable to operate at a temperature comprised between 20 ° C and the reflux temperature, namely in the presence of an organic φ _ base such as triethylamine or inorganic such as soda or sodium or potassium carbonate. It is also possible not to use a base during the amination reaction, and to isolate the hydrochloride of a substance of general formula (A), the base of which can then be removed. When the entry group is an R 10 or R 10 group, it is preferable to treat an alcoholic or alkaline or alkaline earth shio alcohol such as sodium or potassium salt or lithium or ammonium or cesium or barium in an aprotic polar solvent such as DMF or DMSO or NMP at included between 50 ° C and reflux temperature.

© General method 3

According to a third method for the preparation of compounds for which R represents a straight or branched hydrogen atom or alkyl group having 1 to 4 carbon atoms may also be prepared by condensation of bisguanidine of the general formula (E) in which Atj and Ar ₂ on the one hand and R ₃ and R ₃ on the other hand are the same or different, with an acid derivative, preferably an acid chloride or methyl ester of the general formula (F) according to Scheme 4:

NH NH R ^ CI 11 II / Ar ₂ NR, N NR ' ^{+ 3} H ³ oi A R 0 (E) (F)

Scheme 4

The condensation between a bisguanidine of general formula (E) and an acid derivative of general formula (F) is typically carried out in an alcohol such as methanol or ethanol. It is preferably operated at a temperature between 0 ° C and the reflux temperature.

Bisguanidines of general formula (E), symmetric or asymmetrical, can be prepared by operating under the conditions described in the literature, and in particular according to the patent.

J.P. 94-4993.

General method 4

Substances of general formula (A) in which Atj and Ar ₂ are the same as previously defined and represented by Ar, and where R represents an straight or branched chain alkyl group containing from 1 to 4 carbon atoms, may also be obtained by condensation of cyanoguanidine of general formula (G) in which Ar is determined, as before, with nitrile of general formula (H) according to Scheme 4:

(θ) (Η) (A)

Figure 5

Condensation of cyanoguanidine of general formula (G) with

nitriles of the general formula (H) are precisely carried out by refluxing with a high boiling point polar solvent such as 2-methoxy-ethanol or 1,2-dimethoxyethane.

Cyanoguanidines of general formula (G) can be prepared under the conditions described in the literature.

It is decided that the s-triazines of the general formula can

be obtained in the form of libraries, applying the methods described in Schemes 1,2,3,4 or 5 chemically in parallel and / or combined in the liquid phase or in the solid phase, it being decided that when operating in the solid phase which and any of the reagents is pre-fixed on a solid carrier selected depending on the actual chemical formulation of the reaction, and the above chemical reaction is followed by an operation to cleave the product of the reaction of the solid carrier.

The present invention also encompasses therapeutic compositions comprising a compound of the invention in combination with an acceptable pharmaceutical carrier, depending on the

the chosen route of administration, the pharmaceutical composition may be presented in the form of a solid, liquid or liposome.

Powders, gels or tablets may be cited among the solid formulations. Oral forms may also be included for oral formulations recommended against the acidic environment in the stomach. The carriers used for the solid forms include, in particular, inorganic carriers such as phosphates, carbonates or organic carriers such as lactose, celluloses, amidone or polymers. Liquid forms include solutions of suspensions or dispersions. They contain a dispersible carrier or water or an organic solvent (ethanol, NMP or other) or mixtures of surfactants and solvents or complex substances and solvents. .

The administered dose of the compounds of the invention is adapted by the practitioner, depending on the mode of administration of the patient and the condition of the patient.

The compounds of the present invention may be administered alone or in admixture with other anticancer substances. Among the bonding possibilities, the alkylating agents, and in particular cyclophosphamide, melphalan, ifosfamide, chlorambucil, busulfan, thiotepa, prednimustine, carmustine, lomustin, semustin, steptozotocin, decarbazine, temozolomidine, carbosplatinum, carbosplatin, carbocarbazin, cytosolomidine, carbosplamatin or oxaliplatin • Antibiotic agents such as bleomycin, mitomycin, dactinomycin, < / RTI > others such as doxorubicin, daunorubicin, idarubicin, epirubicin, mitoxantrone, losoxantrone • topoisomerases of groups I and P, such as etoposite, teniposite, amsacrine, irinotecan, topotecan, and tomodex • fluoropyrimidines, such as 5-fluorodin, UF such as 5-azacytidine, ziparabine; ~ gemcitadine, 6-mercuric acid, 6-thioguanine • adenosine analogues such as pentostatin, cytarabine or fludarabine phosphate • methotrexate and folic acid • various enzymes and compounds such as L-enzymes and compounds , hydroxycarb id, trans-retinoic acid, suramin, dexrazoxane, amifostine, herceptin as well as oetrogenichni, androgenic hormones • antivascular agents such as combretastatin derivatives or colchicine and their prodrugs.

It is also possible to include the compounds of the present invention in radiation treatments. These treatments can be administered simultaneously, separately, sequentially. The treatment is adapted to the patient to be treated by the practitioner.

The effect of stabilizing the G-quadruple structure can be determined by the method using complex formation with fluorescein, the experimental protocol of which is described below.

Oligonucleotides

All oligonucleotides, whether modified or not, were synthesized by Eurogentec SA, Seraing, Belgique. The FAM + DABCYL oligonucleotide bears the catalog designation, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the telomeric human unit (G-rich filament). fluorescein is attached to the inlet 5 ', DABCYL to the inlet 3', through chemical consoles described by Eurogentec. The concentration of the samples was verified by spectrophotometry, recording the absorption spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the supplier.

Buffer solutions

All experiments were carried out in a 10 mM pH 7.6 sodium cacodylate buffer solution containing 0.1 M lithium chloride (or sodium chloride). The absence of fluorescence contamination in the buffer solution was checked previously. The fluorescent oligonucleotide was added at a final concentration of

0.2 μΜ.

Fluorescence study

All fluorescence measurements were performed on a Spex Fluorolog DM1B apparatus using an excitation bandwidth of 1.8 nm and a radiation bandwidth of 4.5 nm.

The samples were placed in a micro quartz cuvette 0.2 x 1 cm. The temperature of the sample was controlled by an Exterior marie bath. The sole oligonucleotide was analyzed at 20, 30, 40, 50, 60, 70 and 80 ° C. The emission spectra were recorded using an extinction wavelength of 470 nm. The extinction spectra were recorded using either 515 nm or 588 nm as the emission wavelength. The spectra are adjusted with the instrument characteristic for the standard curve. Significant extinction (80-90%) of fluorescence fluorescence at room temperature is observed, in accordance with the three-molecular curve of the oligonucleotide at 20 ° C in a G-quadrant form, which induces the adherence of its inputs 5 'and 3', respectively associated with fluorescein and DABCYL. This adherence entails a phenomenon already described as the extinction of fluorescence used for Molecular Beacons.

Voltage fluorescence

An available oligonucleotide solution with a concentration of 0.2 μΜ in a 0.1 M LiCl buffer, 10 mM cacodylate, pH 7.6, was heated briefly at 90 ° C and cooled slowly to 20 ° C, then aliquoted portions of 600 μΐ in fluorescence cells. Then 3 μΐ of water (for control) or 3 μΐ of test substance (200 μΜ in total, 1 μΜ final concentration) are added and mixed then the samples are allowed to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) does not affect the results obtained.

t24

Each experiment does not allow the measurement of a single sample. This sample was first incubated at an initial temperature of 20 ° C, reached 80 ° C for 38 minutes, remained for 5 minutes at 80 ° C, then cooled to 20 ° C for 62 minutes. During these times, fluorescence is measured by the emission simultaneously at two wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. One measurement takes only 30 seconds. The -marie bath temperature is recorded in parallel, and the temperature-dependent fluorescence profile is reproduced from these values. The profiled fluorescence is then normalized between 20 ° and 80 ° C, and the temperature for which the emission intensity at 515 pt, by these high and low temperatures, is called Tm. Under these conditions, the Tm of the reference sample without the addition of substance is 44 ° C in lithium chloride buffer. This temperature reaches up to over 55 ° C in sodium chloride buffer solution. The addition of a stabilizing compound with a G-four structure causes an increase in Tm. This increase is considered significant if it is above 3 °.

Antilomerase biological activity is determined according to the following experimental protocol:

Preparation of an enriched extract of active human telomerase

Offspring of HL60 leukemia are obtained from ATSC (Americam Type Culture Collection, Rockville USA). The cells were cultured in suspension in RPMI 1640 medium containing, L-glutamine mM, penicillin 200 U / ml, streptomycin 200 pg / ml, gentamicin 50 50gg / ml and addition of 10% fetal calf serum inactivated with heat.

An aliquot of 10 ^s cells was centrifuged at 3000 xG and the resultant was removed. The cell pellet was resuspended by sequentially pipetted into 200 μΐ lysis buffer containing CHAPS 0.5%, TrisHQ pH 7.5 10 mM, MgCl ₂ ImM, EGTA 1 mM, β-mercaptoethanol 5 mM, PMSF 0.1 mM and glycerol 10% and stored in a flask for 30 minutes. The lysate was centrifuged at 16 0000 x G for 20 minutes at 4 ° C and 160 μΐ of the flush was recovered. The dosing of proteins in the extract is carried out by the Bradford method. The extract was stored at -80 ° C.

Active telomerase dosage

Inhibition of active telomerase was determined by the oligonucleotide extension protocol TS ( ⁵ AATCGTTCGAGCAGAGTT ³ ) in the presence of a cell extract rich in active telomerase and compounds added at various concentrations (10, 1, 0.1 and 0.01 μΜ). The lengthening reaction is followed by an increase in PCR of the lengthening agents by the oligonucleotides TS and CXext ( ⁵ GTGCCCTTACCCITACCCTTACCCTAA ³ ).

The reaction medium is prepared according to the following composition:

Tris HQ pH 8.3 20 mM

MgC12 1.5 mM

Tween 20

EGTA dATP dGTP dCTP dTTP

Oligonucleotide TS Oligonucleotide CXext Bovine albumin Taq DNA polymerase alpha 32P and TCP (3000 Ci / mmole)

Telomerase extract

0.005% (P / V) tM μΜ μΜ μΜ μΜ gg / ml pg / ml

0.1 mg / ml lU / ml

0.5 μΐ

200 ng per volume of 10 μΐ in volume of 5 μΐ

Test substance or solvent Bi-distilled water QS 50 μΐ

The oligonucleotides were obtained from Eurogentec (Belgique) and stored at -20 ° C at a concentration of 1 mg / ml in distilled water.

The reaction samples were coupled in 0.2 ml PCR tubes and a drop of paraffin oil was placed on each of the reagents for the experiment before closing the tubes.

The reaction samples are then incubated in a Cetus 4800 PCR apparatus under the following temperature conditions:

minutes at 30 ° C, minutes at 90 ° C, followed by 30 cycles, seconds at 94 ° C, seconds at 50 ° C, and 1 minute and 30 seconds at 72 ° C, followed by one last cycle of 2 minutes at 72 ° S.

Pipette an aliquot of 10 μΐ from each of the samples from the layer under the oil and mix with 5 μΐ of the precipitate buffer solution containing:

TVE

glycerol bromophenol blue xylene cyanol

ZH

32% (W / W)

0.03%

0.03%

The samples were then analyzed by 12% acrylamide gel electrophoresis in TBE IX buffer solution for 1 hour at 200 volts using a Novex electrophoresis system.

The acrylamide gels were then dried on a Whatmann 3 mm paper sheet at 80 ° C for 1 hour.

The analysis and quantification of the substances of the reaction are performed with the help of the Instantimager (Pacard) apparatus.

For each concentration of test compound, the results are expressed as percent inhibition of the reaction and calculated from the untreated enzyme control and the enzyme-free sample (pure) according to the following formula:

(Compound Value - Pure Sample Value / Enzyme Control Value - Pure Sample Value) x 100.

The concentration of the compound inducing inhibition

50% of the reaction telomerase (IC50) was determined using a representative semi-logarithmic graph of the inhibition values obtained depending on each of the concentrations of the test compound.

The compound is considered to be active as

ampthalometer.he agent when the amount of inhibition of 50% of the telomerase response is exactly less than 5 μΜ »

Cytotoxic biological activity on a generation of human tumors is determined in accordance with the following experimental protocol:

Generations of human A549 cells originate from

ATCC (American Type Culture Collection, Rockville USA). A549 cells were cultured in the layer in the culture vial in RPMI 1640 medium containing L-glutamine 2 mM, penicillin 200 U / ml, streptomycin 200 pg / ml and addition of 10% fetal calf serum inactivated. KB cells were cultured in the layer in the culture vial in Dulbelco's medium containing, L · glutamine2 mM, penicillin 200 U / ml, streptomycin 200 pg / ml and addition of 10% fetal calf serum inactivated.

The cells in the exponential growth phases, trypsin, were washed in PBS IX and seeded on 4 x 10 ⁴ cells / ml for A549 and from Costar.

1.5 x 10 ⁴ cells / ml (0.2 ml / well) were then incubated for 96 hours in the presence of different concentrations of the test substance (10, 1, 0.1 and 0.01 μΜ, each point in quadruplicate). 16 hours before the end of incubation, 0.02% red neutral substance was finally added to each well. At the end of incubation, the cells were washed with FBS IX and lysed with 1% sodium lauryl sulfate. Intake into cells of a dye reflecting cell growth was evaluated by spectrophotometry at a wavelength of 540 nm for each sample using a Dynatech MR5000 reading apparatus.

For each concentration of test compound, the results are expressed as percent inhibition of cell growth and calculated from the untreated control and cell-free culture medium (pure) according to the following formula:

(compound-value of pure sample / value of control cells-value of pure sample) x 100.

The concentration of 50% growth inhibiting compound (IC50) was determined using a representative semi-logarithmic graph of the inhibition values obtained depending on each of the test compound concentrations.

A compound is considered to be active as a cytotoxic agent if the inhibition concentration of 50% of the growth of the tumor cells examined is exactly less than 10 μΜ.

The following non-limiting examples are given to illustrate the invention.

Example 1 Preparation of 2-amino-bis-4,6 - [(1-methyl-4'-amino-6 quinaldino) amino] -triazine dichloride

In a three-necked 2 dm ^3, were introduced 200 cm ³ of distilled water and saturated with stirring with 41,6 g (0,16 mol) of the hydrochloride chloride of 1-methyl-4,6-diaminohnnaloin, which may be prepared as described in J. Chem. Soc., 1953.50. A clear dark yellow solution which was poured 800 cm ³ of ethanol, causing copious precipitate. At 45 ° C, the precipitate was dissolved, then 13.2 g (0.08 mol) of 2-amino-4,6-dichloro-triazine, which can be obtained according to J. Amer. Chem. Soc., 1945, 67, 662. After a few minutes, a yellow precipitate appeared, and refluxed for 1 hour. Cool and refrigerate overnight. The resulting precipitate was filtered off and washed four times with 100 cm3 of 80% aqueous ethanol and then dried at 45 ° C. Thus, 47 g (100%) of 2-amino-bis-4,6 - [(1-methyl-4-amino-6-quinaldino) amino] -triazine dichloride dichloride are obtained.

Separation and purification of the formed base

In a 2-dm ^3- necked flask, add 1.2 dm ^{3 of} distilled water then 47 g of the monochlorohydrate obtained above, reach 55 ° C and pour 30 cm ^{3 of} concentrated ammonia (d = 0.925), then add heated to 85 ° C to facilitate dissolution. The undissolved residue is filtered hot

Wash 40 g of Supercel u three times with 50 cm ^{3 of} boiling water. After concentrating the filtrate to half, and re-filtration on 10 g of Supercel, 1.2 dm ^{3 of} ethanol was added and stirred for 5 minutes, then allowed to stand in the refrigerator overnight. In the morning, it was filtered, washed three times with 50 cm3 of ethanol 66% and twice with 50 cm ^{3 of} ethanol, dried in vacuo at 45 ° C, yielding 34.2 g (79%) of crude dichloride in 2- amino-bis-4,6 - [(1-methyl-

4-amino-6-quinaldino) amino] -triazine. In a 3-dm ^3- neck flask, enter 600 cm ^{3 of} distilled water and 34.2 g of crude base, reach 50 ° C with stirring until dissolution is almost complete, and the insoluble residue is filtered. The resulting filtrate was charged into a 3-dm ^3- necked flask and 1.4 dm ^{3 of} ethanol was rapidly poured with stirring. The resulting gelatinous precipitate was filtered off, washed three times with 100 ml of ethanol, dried in vacuo at 45 ° C to give 30.7 g (71%) of 2amino-bis-4,6 - [(1-methyl) dichloride. -4-amino-6-quinaldino) amino] -triazine, in the form of a white solid, having the following characteristics:

- melting point = 334 ° C.

- RMN spectrum Ή (300 Mhz, (CD ₃ ) ₂ SO d6, δ in ppm): 2.72 (s: 6H); 4.01 (s: 6H); 6.79 (s: 2H); 7.09 (mf: 2H); 8.11 (d, J = 10 Hz: 2H); 8.21 (dd, J = 10 at 2Hz: 2H); om 8.40 to 8.75 (mf stall: 4H); 9.01 (width: 2H); 9.83 (mf: 2H).

Example 2

Preparation of 2-amino-bis-4,6 - [(1-ethyl-4'-amino-6 '· quinaldino) amino] -triazine dichloride

J ί

Mr

Into a neck of ldm ³ , 75 cm ^{3 of} distilled water is introduced and saturated with stirring with 16.45 g (0.06 mol) of 1-ethyl-4,6-diamino-quinaldine chloride, which can be obtained according to US patent 2 585 905, then 300 cm3 of ethanol is poured. 55 ° C was reached, then 4.95 g (0.03 mol) of 2-amino-

4,6-dichloro-triazine, and refluxed for two and a half hours. Cool and refrigerate overnight. The resulting precipitate was filtered off, washed with 100 cm of ethanol 80% then dried at 45 ° C to give 16.47 g (91%) of 2-amino-bis-4,6 - [(1 'dichloride dichloride dichloride) -ethyl-4'-amino-6'-quinaldino) amino] triazine.

Separation and purification of the formed base

In a 250 cm ³ flask containing 200 cm ³ distilled water, with stirring, saturate with 16.47 g of the monochlorohydrate previously obtained and pour 8 cm ^{3 of} concentrated ammonia (d = 0.925), reflux to facilitate dissolution, filtered hot on Supercel a light undissolved product, which was washed twice with 10 cm ^{3 of} boiling water. After concentrating the filtrate, ethanol, stirring up to a half white solid, was added with stirring, stirring overnight, stirring overnight, refrigerated overnight. The precipitate was filtered off, washed five times with 10 cm ^{3 of} ethanol 80%, dried in vacuo at 55 ° C to give 12.87 g (76%) of 2-amino-bis-4,6 - [(1 D) -ethyl-4 ^, -amino-6'-quinaldino) amino] -triazine, in the form of a white hygroscopic powder, having the following characteristics:

- melting point = 302 ° C.

- RMN spectrum ^: H (300 MHz, (CD ₃ ) 2SO d6, δ B ppm): 1.42 (t, J = 7Hz: 6H); 2.74 (s: 6H); 4.57 (q, J = 7Hz: 4H); 6.80 (s: 2H); 7.09 (mf: 2H);

8.13 (d, J = 10 Hz: 2H); 8.21 (dd, J = 10 at 2 Hz: 2H); om 8.40 to 8.75 (mf stall: 4H); 9.01 (s width: 2H); 9.83 (mf: 2H).

Example 3

Preparation of 2-dimethylamino-bis-4,6 - [(1-methyl-4'-amino6'-quinaldino) amino] -triazine dichloride

In a 1 dm ³ neck, 60 cm ^{3 of} distilled water is introduced and saturated with stirring with 13.01 g (0.05 mol) chloride hydrate of 1-methyl-4,6-diamino-quinaldine, which can was obtained according to J. Chem Soc., 1953.50. A yellow solution was obtained where 240 cm ^{3 of} ethanol was poured, causing a large yellow precipitate. After dissolving under heating to 50 ° C, 4.83 g (0.025 mol) of 2-dimethylamino-4,6-dichloro-triazine, which can be obtained according to J. Amer., Is added. Chem. Soc., 1948, 70, 3726. After a few minutes, the residue precipitated and refluxed for 1 hour and a half. It is cooled for 1 hour in an ice bath, then the resulting precipitate is filtered off, washed four times with 30 cm ^{3 of} ethanol and dried. 12.92 g (86%) of 2-dimethylamino-bis-4,6 - [(1methyl-4'-amino-6'-quinaldino) amino] -triazine dichloride are obtained in the form of a hygroscopic cream powder, the characteristics of which are the following:

- melting point = 345 ° C.

- RMN spectrum ¹ H (300 MHz, (CD ₃ ) ₂ SO d6, δ in ppm): 2.72 (s: 6H);

3.18 (s: 6H); 4.00 (s: 6H); 6.75 (s: 2H); 8.12 (d, J = 9.5 Hz: 2H); 8.22 (mt: 2H); Om 8.40 to 8.65 (mf stall: 4H); 8.79 (width: 2H); 9.83 (mf: 2H).

Example 4 Preparation of Trichlorohydrate of 2-Methylamino-bis-4,6 - [(4'-amino-6 quinaldinyl) amino] -triazine

34 cm ^{3 of} distilled water and 126 cm ^{3 of} normal hydrochloric acid are introduced into a ³ dm ³ neck and saturated with stirring with 21.82 g (0.1 mol) of 4,6-diaminoquinaldine, which can be obtained according to J. Chem. Soc., 1953.50. To the resulting orange solution, pour 600 cm ^{3 of} ethanol, reach 65 ° C, then add 10.74 g (0.06 mol) of 2-methylamino-4,6-dichlorothiazine, which can be obtained according to the Chem. Berichte. 1899, 32, 700, and pour 40 _ cm ^{3 of} ethanol. A yellow precipitate appears, which rapidly thickens when refluxed for two hours. After cooling overnight in a refrigerator, the resulting precipitate was filtered off, washed three times with 120 cm ^{3 of} ethanol 80%, dried and yielded 27.3 g (81%) of 2-methylamino-bis-4,6 - [( 4'-amino-6'quinaldinyl) amino] -triazine as a hygroscopic white powder, having the following characteristics:

- melting point = 34 ° C.

- RMN spectrum ^] H (300 MHz, (CD ₃ ) ₂ SO d6, δ in ppm): 2.62 (s width: 6H); 2.94 (s width: 3H); 6.64 (s width: 2H); from 7.60 to 7.80 (mf stagnation: 1H); 7.89 (d width, J = 9.5 Hz: 2H); 8.10 (d width, J = 9.5 Hz: 2H); from 8.35 to 8.65 (mf stagnation: 4H); from 8.70 to 8.95 (mf stagnation: 2H); from 9.80 to 10.00 (mf stagnation: 2H); 13.76 (mf: 2H).

Example 5

Preparation of 2-amino-bis-4,6 - [(1-methyl-6quinoleino) amino] -triazine dichloride

Into a 2-dm ³ three-neck flask, introduce 225 cm ^{3 of} distilled water and saturate with stirring with 41.5 g (0.18 mol) of 1-methyl-6-aminoquinoline chloride chloride, which can be obtained according to Zh . Org. Khim .; 1993, 29 (10), 2018.

A yellow solution was obtained, where 900 cm3 of ethanol was poured, causing a large precipitate. After dissolving at 50 DEG C., 14.8 g (0.09 mol) of 2-amino-4,6-dichloro-triazine are added and refluxed for one hour, a yellow precipitate rapidly appears. The mixture was cooled overnight, then the resulting precipitate was filtered, which was washed twice with 50 cm ^{3 of} ethanol, dried and 36.6 g (79%) of 2-amino-bis-4 dichloride dichloride were obtained. 6 - [(N-methyl-6-quinoleino) amino] -triazine.

Separation and purification of the formed base

In a 1-dm ^3- necked flask, 200 cm ^{3 of} distilled water is added, then saturated with stirring with 36.6 g of the monochlorohydrate obtained previously, 80 ° C is poured, 10 cm ^{3 of} concentrated ammonia is poured (d = 0.925) , and the undissolved product is filtered on Supercel. In a 6-dm ^3- necked flask containing 3 dm ³ ethanol, stir with stirring for five minutes the previous filtrate, finally a bright yellow precipitate appears, which is left in the refrigerator for two days, then filtered, washed two times with 50 cm of ethanol, dried to give 19.1 g (44%) of 2-amino-bis-4,6 - [(1-methyl-6 quinoleino) amino] -triazine dichloride as a hygroscopic yellow powder , the characteristics of which are as follows:

- melting point = 296 ° C.

- RMN spectrum ^d H (300 MHz, (CD ₃ ) 2SO d6, δ in ppm): 4.64 (s: 6H); 7.11 (mf: 2H); 8.10 (dd, J = 8.5u 6Hz: 2H); 8.46 (d, J = 10 Hz: 2H);

8.56 (dd, J = 10 at 2 Hz: 2H); 9.17 (d width, J = 8.5 Hz: 2H); 9.30 (mt: 4H); 10.26 (mf: 2H).

Example 6

Preparation of Trichlorohydrate of 2-Methylamino-bis-4,6 - [(4'-Methylamino-6-quinaldinyl) amino] -triazine

Step A: Preparation of 4-methylamino-6-amino-quinaldine

Into a 2-dm ^3- necked flask, 240 cm ^{3 of} acetic acid was introduced and saturated with stirring with 57.4 g (0.25 mol) of 6-acetamido-4-methoxy-quinaldine prepared according to J. Amer. Chem. Soc., 1948, 70, 4065. Stirred with methylamine until dissolved, then refluxed for 2 hours. It was cooled and re-performed, cooled and poured with stirring, the solution obtained in a 2-dm ³ three-neck flask containing 300 cm ^{3 of} distilled water and 470 cm ^{3 of} normal hydrochloric acid. It is then heated to 100 ° C for 11 hours, then left in the refrigerator overnight. The crystallized product was filtered to give 25 g of hydrochloride, the main liquid structural elements were concentrated, left overnight in a refrigerator, then filtered to recover 150 g of hydrochloride. 175 g of hydrochloride are extracted with 300 cm ^{3 of} distilled water and dissolved under heating to 50 ° C, enriched with 1 g of black color and filtered on Supercel. Reaches to the filtrate at 90 ° C and basified by adding 54 cm @ ³ of concentrated soda. The resulting precipitate was refrigerated overnight and washed four times with 100 cm ^{3 of} distilled water, dried and yielded 33 g (70%) of 4-methylamino-6-amino-guinaldine.

Stage B

In a 2-dm ^3- necked flask, introduce 25 cm ^{3 of} distilled water and 101 cm ^{3 of} normal hydrochloric acid, and saturate with

18.9 g (0.101 mol) of 4-methylamino-6-amino guinaldine, the resulting orange solution was adjusted to 75 ° C, then poured over 2 minutes with 500 cm ^{3 of} ethanol, and 8.59 g (1 g added once) 0.048 mol) of 2-methylamino-4.6-dichloro-triazine prepared according to Example 4. After 5 minutes, a precipitate appeared and refluxed for 2 hours, allowed to stir for 3 hours and left to stand for 8 days in a refrigerator . The resulting precipitate was filtered off, washed twice with 100 cm ^{3 of} ethanol 80% and three times with 100 cm ^{3 of} ethanol, dried and yielded 21.7 g (77%) of 2-methylamino-bis-4,6- trichlorohydrate. [(4-methylamino-6quinalidinyl) amino] -triazine in the form of a hygroscopic cream powder, having the following characteristics:

- melting point = 355 ° C.

- RMN spectrum 300 (300 MHz, (CD ₃ ) ₂ SO d6, δ in ppm): 2.68 (s: 6H);

2.93 (s: 3H); 3.04 (mf: 6H); 6.59 (s: 2H); from 7.40 to 7.70 (mf stall: 1H); 7.88 (d, J = 9 Hz: 2H); 8.08 (d width, J = 9 Hz: 2H); om 8.50 to 8.95 (mf stagnation: 2H); om 8.75 to 8.95 (mf: 2H); om 9.70 to 10.10 (mf stagnation: 2H); 13.79 (mf: 2H).

Example 7

Preparation of 2-amino-bis-4,6 - [(9 amino-10-methyl-2-acridino) amino] -triazine dichloride dichloride

Eman A: Preparation of 2-acetamido-9-amino-acridine

Into a 250 cm ³ three-necked flask, 72 cm ^{3 of} acetic acid was introduced and saturated with stirring with 12 g (0.0575 mol) of 2.9 diaminoacridine prepared according to J.Chem. Soc., 1949, 1148, then poured 4.1 cm ³ (0.0575 mol) acetyl chloride. The temperature was raised to 50 ° C and the solution solidified. Maintained at 60 ° C for one hour, cooled and diluted with 200 cm 3 of diethyloxide. Filtration afforded 15.2 g of hydrochloride. In a 4 dm ³ flask, enter 2 dm ³ distilled water and stir with 15.2 g of hydrochloride. It is refluxed, filtered and basified with ammonia. The crystalline base was filtered and dried. 11.2 g (78%) of 2-acetamido-9-aminoacridine are obtained.

Step B: Preparation of 2-acetamido-9-amino-10-methylacridine sulfate

In a 1-dm ^3- necked flask, 300 cm ^{3 of} nitrobenzene was introduced, followed by 11.2 g (0.0446 mol) of 2-acetamido-9-amino acridine and 11 cm (0.116 mol) of dimethyl sulfate sequentially with stirring. Further, it reaches 140 ° C for 20 minutes. After cooling, the resulting precipitate was filtered off, washed with 20 cm < ³ > of nitrobenzene and six times with 20 cm < ^{3 > of} diethyl oxide, air-dried to give 14.35 g (85%) of 2-acetamido- sulfate.

9-amino-10-methyl-acridine.

Step C: Preparation of 2-acetamido-9amino-10-methyl-acridine chloride hydrochloride.

Into a flask of om 2 dm ² , introduce 600 cm ^{2 of} distilled water and saturate with stirring with 13 g of 2-acetamido-9-amino-10-methyl-acridine sulfate (0.0344 mol), reflux until complete dissolution. and the insoluble residue is filtered off. After cooling, pour a 900 cm3 aqueous solution of 35% sodium chloride, allow to precipitate and filter. In a 100 cm ³ flask, introduce 20 cm ³ concentrated hydrochloric acid (d = 1, 18) and saturate with the preceding compound by refluxing for 5 minutes, dilute with 67 cm ethanol and allow to crystallize in ice. . The crystals formed are filtered off, washed. twice with 5 cm of ethanol and three times with 10 cm of diethyl oxide, dried and obtained 5.1 g (50%) of chloride of 2acetamido-9-amino-10-methyl-acridine chloride.

Stage D

In a 100-cm ^3- neck flask, 5 cm ^{3 of} distilled water and 37 cm ^{3 of} ethanol are introduced and saturated with stirring with 1 g (0.00338 mol) of 2-acetamido-9-amino-10methyl-acridine chloride. 80 ° C was reached and 0.28 g (0.0017 mol) of 2-amino-4,6-dichloro-triazine were added. After 5 minutes, a precipitate formed and refluxed for 2 hours, then allowed to cool, filtered, washed three times with 3 cm ethanol and 5 cm ether, dried in vacuo to give 0. 8 g (73%) of 2-amino-bis-4,6 - ((9-amino-10-methyl-2-acridino) amino] triazine dichloride dichloride in the form of a hygroscopic yellow powder with an ocher tint characterized by the following:

-melting point = 310 ° C.

Example 8

Preparation of trichlorohydrate of 2-amino-bis-4,6 - ((4'-amino-6-quinolinyl) amino] -triazine (also referred to as SURFENE C)

In a 10-dm ^3- necked flask, introduce 5.25 dm ^{3 of} distilled water and saturate with stirring with 368.4 g (2,127 mol).

4,6-diaminoquinaldine prepared according to Example 4, then 117 g (0.709 mol) of 2-amino-4,6-dichloro-triazine are added. A yellow precipitate formed immediately, refluxed for 2 hours. After cooling and acidifying to pH = 3.4 by addition of 1.3 dm normal hydrochloric acid, reflux for 15 minutes, add 20 g of black color and maintain reflux for 10 minutes, then it filters. In a 10-dm three-necked flask, introduce the previous solution up to 80 ° C and then pour 852 cm ^{3 of} hydrochloric acid (d = 1.19) for 30 minutes. At the end of the pouring, a pale yellow precipitate appears which, after cooling in an ice bath, is filtered, washed four times with 250 cm ³ hydrochloric acid solution, 250 h hydrochloric acid (d = 1.19 combined) ) and 2 dm of distilled water, then dried in vacuo at 60 ° C to give 385.4 g (99%) of trichlorohydrate. Into a 4-dm ^3- necked flask, enter

1.9 dm ^{3 of} ethanol and saturated with 385.4 g of the previous substance and stirred for five hours at room temperature, protected from light, filtered, then washed twice with 250 cm of ethanol and dried; 346 g (89%) of 2-amino-bis-4,6 - ((4 amino-6-quinidinyl) amino] -triazine trichlorohydrate are obtained in the form of a hygroscopic cream powder, characterized by the following:

- melting point = 345 ° C

Example 9

2-Amino-bis-4,6- (p-amidinoanilino) -triazine trichlorhydrate

This substance can be prepared according to J.Chem Soc., 1960, 4525 in the form of a hygroscopic cream powder.

Example 10

Preparation of 2-methylthio-bis-4,6 - ((1-methyl-4 amino-6 '-quinaldino) amino] -triazine dichloride

Into a 1 dm ³ three-neck flask, introduce 60 cm ^{3 of} distilled water and saturate with stirring with 13.01 g (0.05 mol) of 1-methyl-4,6-diaminoquinaldine chloride, which can be obtained according to J.Chem Soc., 1953.50. A yellow solution was obtained where 240 cm ^{3 of} ethanol was poured, causing a large yellow precipitate. After dissolving under heating to 50 ° C, they are added

4.90 g (0.025 mol) of 2-methylthio-4,6-dichloro-triazine, which can be prepared according to Ang. Chem Int Ed., 1966, 5, 960. After a few minutes, a precipitate appeared and heated to reflux for one and a half hours. It was cooled overnight in a refrigerator, then the resulting precipitate was filtered, which was washed four times with 30 cm ^{3 of} ethanol and dried. 10.70 g (75%) of 2-methylthio-bis-4,6 - [(1-methyl-4-amino-6-quinaldino) amino] -triazine dichloride are obtained in the form of a hygroscopic cream powder, the characteristics of which are as follows :

- melting point = 320 ° C

Example 11

Preparation of dichlorohydrate 2-chloro-bis-4,6 - ((4-dimethylamino-6-quinalidinyl) amino] -triazine dihydrate

Step A: Preparation of 4-dimethylamino-6-amino-quinaldine

It was done as in step A of Example 6, but proceeded from 57.4 g (0.25 mol) of 6-acetamido-4-methoxy-quinaldine prepared according to J. Amer. Chem. Soc., 1948, 70, 4065, and 100 cm < ^{3 > of an} aqueous solution of 40% dimethylamine in 250 cm < ^{3 > of} acetic acid were heated to 100 < 0 > C for 2 hours in a 1 dm autoclave. Then, acidic base purification was obtained by working as in step A of Example 6, 38.71 g (77%) of 4-dimethylamino-6-amino-quinaldine.

Stage B

In a 25-cm ^3- neck flask, dissolve 402 mg (2 mmoles) of 4-dimethylamino-6-amino-quinalidine in 7 cm ³ acetic acid, then 184 mg (1 mmole) of cyanide chloride are added over two minutes. then heated to 90 ° C for three hours. After cooling, the crystals formed were removed, washed with 2.5 cm ^{3 of} acetic acid and dried in vacuo at 100 ° C. 588 mg (94%) of dichlorohydrate dihydrate of 2-chloro-bis-4,6 - [(4'-dimethylamino-6quinalidinyl) amino] -triazine are obtained in the form of pale yellow crystals having the following characteristics:

melting point = 350 ° C

elemental analysis:% C = 51.75 (calculated = 52.06); % H = 5.67 (calculated = 5.50); % N = 19.98 (calculated = 20.23)

Example 12

Preparation of hydrate of 2-methylthio-bis-4,6 - [(4'-dimethylamino-6quinaldynyl) amino] -thiazine

In a 250 cm ³ three-necked flask, introduce 100 cm ³ of 90% ethanol aqueous solution and saturate with stirring with 4.02 g ¢ 0.02 mol) of 4-dimethylamino-6-amino-quinaldine obtained in step A of example 11 and 1.96 g (0.01 mol) of 2-methylthio-4,6-dichloro-triazine, which can be prepared according to Ang. Chem. Int Ed., 1966.5, 960. After a few minutes, a precipitate formed and refluxed for 1 hour and a half. It was cooled overnight in a refrigerator and then the resulting precipitate was filtered, which was washed four times with 30 cm ^{3 of} ethanol and dried. 5.26 g (88%) of crude hydrochloride are obtained.

In a 250 cm three-necked flask, add 75 cm 90% aqueous ethanol and then saturate with stirring.

5.26 g of the hydrochloride obtained previously, reached 80 ° C and poured 5 cm ^{3 of} concentrated ammonia (d = 0.925) and allowed to crystallize for 2 days in a refrigerator, filtered, washed twice with 5 cm ³ aqueous ethanol solution 90%, dried to give 3.20 g (59.5%) of 2-methylthio-bis-4,6 - [(4-dimethylamino-6quinaldinyl) amino] -triazine hydrate, in the form of a pale yellow solid having the following characteristics:

-melting point = 280-3 ° C

elemental analysis:% C = 62.06 (calculated = 62.48); % H =

5.81 (calculated = 62.48); % N = 23.80 (calculated = 23.42). Example 13 Preparation of dichlorohydrate of Ν, Ν - (4-amino-6-quinalidinyl) urea (the base, also called SURFENE can be obtained according to Ang. Chem. 1939, 891)

Into a 500 cm ³ three-necked flask, introduce 400 cm ^{3 of} distilled water and saturate with stirring with 30 g (0.2 mol) of 4,6 diaminoquinaldine, which can be obtained according to J. Chem.

Soc., 1953, 50, followed by the addition of 8.4 g (0.06 mol) of sodium trihydrate acetate and heated to 95-96 ° C. Then flow of phosgene while saturated (5 to 10 minutes) then maintain at 95-96 ° C for 1 hour. After cooling and acidifying by the addition of 200 cm3 hydrochloric acid, the precipitate formed was removed, washed with 200 cm3 hydrochloric acid and dried in vacuo at 60 ° C to give 30 g of crude hydrochloride which was recrystallized in 300 cm3 distilled water and 30 cm ^{3 of} concentrated hydrochloric acid in the presence of a black colorant. After cooling, the crystals formed were removed, washed with hydrochloric acid N, then with acetone and dried in vacuo at 40 ° C. 27 g (60.5%) of dichlorohydrate of N, N '- (4-amino-6-quinalidinyl) urea are thus obtained, in the form of hygroscopic cream powder, characterized by the following:

-melting point = 329-40 ° C

Example 14

Preparation nadiyodid of K ^1, K ⁵ -bis (7-chloro-1-methyl-4hinoleino) pentane-1,5-diamine

Dissolve, when heated to about 50 ° C, 3 g (7 mmoles) of N, ¹ -bis (7-chloroquinolein-4-yl) pentane-1,5-diamine, which can be obtained according to J. Med. Chem. 1992, 35, 2129, in 60 cm ³ butane-2-one. 3 g (21 mmoles) of methyl iodide are added and refluxed for 5 hours. The crystals formed were removed, washed with butan-2-one, then with diethyl oxide and dried in vacuo. Thus, 3 g (60%) of the diode of N ¹ , N ⁵ -6uc (7-xAopo-1-MemuA-4-xuHOAeuHo) neHmaH-1,5-guaMUH are obtained, in the form of beige crystals, characterized by the following:

-melting point = 277-78 ° C

Example 15

Preparation of the hydrochloride pentahydrate of bis-2,4 - [(4-amino-

In a 250 cm three-necked flask, reheat

refrigerator 1.73 g (10 mmoles) of 4,6-diamino-1-methyl-quinoline which can be prepared according to! Chem. Soc., 1953, 50, and 0.74 g of 2,4-dichloropyrimidine in 75 cm < ^{3 > of} ethanol and 5 cm < ³ & gt ^{; of} water for 5 hours. The reaction medium was concentrated in half, then allowed to crystallize in a refrigerator overnight. The precipitate formed was removed, washed with ethanol, then with diethyl oxide and dried in vacuo. The resulting precipitate was stirred for 6 hours in 10 cm @ ^{3 of} hydrochloric acid 0.2 N, then removed in rinsed ses water and dried under vacuum at 80 ° C. Thus 0.98 g (46.5%) of the bis-2,4 - [(4'-amino-6quinalidinyl) amino] pyrimidine trichlorhydrate pyrimidine are obtained as a yellow solid having the following characteristics:

-melting point = 310-20 ° C

elemental analysis:% C = 47.37 (calculated = 47.46); % H = 5.51 (calculated = 5.67); % N = 18.41 (calculated = 18.45); Ό = 15.84 (calculated = 15.76)

Example 16

Preparation of the trichlorohydrate dihydrate of 1,5- (4-amino-6-quinolinyl) biguanide n In a 25 cm ^3- necked flask, add 5 cm ³ water, 3 cm ³ hydrochloric acid 5N, 1.3 g (7.5 mmoles) 4,6-diamino-quinaldine, which can be prepared according to J. Chem. Soc., 1953, 50, and 0.34 g (3.75 mmoles) of sodium dicyanamide and reached 50-55 ° C overnight. After cooling, the resulting precipitate was removed, washed with ice water and dried in vacuo at 70 ° C. Thus, 0.47 g (22.5%) of trichlorohydrate dihydrate of 1,5- (4-amino-6quinalidinyl) biguanide are obtained, in the form of yellow crystals having the following characteristics:

-melting point = 262-66 ° C

elemental analysis:% C = 47.85 (calculated = 47.56); % H = 5.67 (calculated = 5.38); % N = 22.96 (calculated = 22.69); O = 18.79 (calculated = 19.14).

Example 17: Parallel Synthesis of Symmetrically Substituted 2,4-Diamino-6-Methylthio-Triazine Derivatives

Parallel Synthesis of N 6 - [(6- (4-Amino-quinaldin-6-yl-amino) -4-methylthio-triazin-2-yl] -quinaldine-4,6-diamine (Example 17-1)

A 50 mg (0.25 mmole) 2,6-dichloro-6-methylthio-triazine 50 mg (0.25 mmole) was introduced into a magnetic reactor heated with a Zymark capacitor of the STEM RS2050 type containing 25 wells, each provided with a 50 ml glass tube in parallel. obtainable according to J. Amer. Chem. Soc., 1945, 67, 662. In the first tube (Example 17-1), 5 ml of toluene, 0.5 ml of aqueous soda solution N and 88 mg (0.5 mmole) of 4,6-diamino- quinaldine. The reaction medium was refluxed under argon for 24 hours. After cooling, dilute the contents of the tube with 5 ml of water and 5 ml of dichloromethane. The organic phase was decanted, dried and concentrated under reduced pressure. The crude product obtained is then purified by LC / MS using a C18 Waters Xterra 3.5 μΜ column, 3 m in diameter and 50 m in length, eluting with a linear elution gradient including start times (to = 0 m) for water. containing 0.05% trifluoroacetic acid and end times (tf = 4 mp) for acetonitrile containing 0.05% trifluoroacetic acid. Thus, after purification, 28 mg of H6 - [(6- (4-amino-quinalidin-6-yl-amino) -4-methylthio-triazin-2-yl] quinaldine-4,6-diamine are obtained, having the characteristics of the following:

mass spectrum (DAD-TIC) = 459 (M ⁺ )

- retention time = 2.95 mp (under the conditions described above for purification).

Examples 17-1 to 17-3 were obtained by working as above in a Zymark STEM RS2050 reactor. Example 17-1 was the isolation in the form of a base and in the form of chlorhydrate

Examples 17-2 and 17-3 were the only isolates in the form of hydrochloride after purification by LC / MS for extraction in 1M hydrochloric acid solution in diethyl oxide. The structures used under different operating conditions and the characteristics of Examples 17-1 to 17-3 are summarized in the results table.

Example 18: Parallel Synthesis of Asymmetrically Substituted Derivatives of M6- (6-Amino-4-methylthio-triazin-2-yl) -quinalidine-4,6-diamine

Ατχ different om Ar ₂ Preparation of N - (6-amino-4-methylthio-triazin-2-yl) -quinaldine-4,6 diamine

In a 1 liter three-necked flask, to a solution of 5 g (25 mmoles) of 2,6-dichloro-6-methylthio-triazine, which can be obtained according to! Amer. Chem. Soc., 1945, 67, 662, In 400 ml of tetrahydrofuran, 4.4 g (25 mmoles) of 4.6 diamino-quinaldine and 2.8 g (25 mmoles) of sodium carbonate are added sequentially. The reaction mixture was refluxed for 16 hours. After evaporation of the tetrahydrofuran, the residue is recovered with 400 ml of a mixture of water and dichloromethane (50-50 in volumes). The organic phase was decanted, dried over sodium sulfate and concentrated to dryness under reduced pressure. 7.5 g (88%) of N6- (6-amino-4-methylthio-triazin-2-yl) -quinalidin-4,6-diamine are then obtained as a pale yellow solid, having the following characteristics:

- melting point = 294 ° C.

- RMN 1 H spectrum (300 MHz, (CD ₃ ) ₂ SO d6, δ in ppm): 2.43 (s: 3H); D5 & (sH 3H); 6.47 (s: 1H); 6.61 (mf: 2H); 7.62 (d width, 1 ^ 9 Hz: 1H); 7.69 (d, J = 9 Hz: 1H); 8.32 (mf: 1H); 10.80 (mf: 1H).

Parallel synthesis of K6 - [(6- (methyl-quinolin-6-yl-amino) -4-methylthiotriazin-2-yl] -quinalidine-4,6-diamine (example 18-1)

50 mg (0.15 mmole) of M6- (6-amino-4-methylthio-triazine) were introduced into a magnetic reactor heated with a Zymark condenser of the STEM RS2050 type containing 25 wells, each provided with a 50 ml glass tube in parallel. -2-yl) -quinalidin-4,6-diamine. In the first tube (Example 18-1), 5 ml of dioxane, 16 mg (0.15 mmole) of sodium carbonate, 23 mg (0.15 mmole) of sodium iodide and 49 mg (0.3 mmole) of methyl-quinoline-6- are added sequentially. ylamine. The reaction medium was refluxed under argon for 24 hours. After cooling, the contents of the tube were evaporated under reduced pressure, extracted with 5 ml of water and 5 ml of ethyl acetate and filtered. The organic phase was decanted, dried and concentrated under reduced pressure. The crude product obtained is then purified by LC / MS using a C18 Waters Xterra 3.5 μΜ column, 3 m in diameter and 50 m in length, eluting with a linear elution gradient including start times (to = 0 m) for water. containing 0.05% trifluoroacetic acid and end times (tf = 4 mp) for acetonitrile containing 0.05% trifluoroacetic acid. Thus, after purification, 58 mg of N6 - [(6- (methylaminoquinolin-6-yl-amino) -4-methylthio-triazin-2-yl] -quinaldine-4,6-diamine are obtained, having the following characteristics:

- mass spectrum (DAD-TIC) = 454 (M ⁺ )

- retention times = 2.51 mp (under the conditions described above for purification)

Examples 18-1 to 18-13 were obtained by doing the above in a Zymark STEM RS2050 reactor. Example 17-1 can also be obtained by working as above. Examples 182 to 18-13 were base isolation. The structures used under different operating conditions and the characteristics of Examples 18-1 to 18-13 are summarized in the results table.

Example 19: Parallel Synthesis of Asymmetrically Substituted Derivatives of 2-MemuA-N6- (6-Amino-4-Diethylamino-triazin-2-yl) -quinoline-4,6-diamine

Ar _T other than Ar ₂

Preparation of N6- (6-amino-4-diethylamino-triazin-2-yl) quinaldine-4,6-diamine

In a 1 liter three-necked flask, to the solution of 5 g (22.5 mmoles) of commercially available 2,6-dichloro-4-diethylamino-triazine, in 300 ml of THF, was added successively 3.91 g (22.5 mmoles) 4,6-diamino-quinaldine and 2.4 g (22.5 mmoles) of sodium carbonate. The reaction mixture was refluxed for 20 hours. After evaporation of the tetrahydrofuran, the residue is recovered with 400 ml of a mixture of water and dichloromethane (50-50 in volumes). The organic phase was decanted, dried over sodium sulfate and concentrated to dryness under reduced pressure. 7.4 g (92%) were then obtained.

N6- (6-amino-4-diethylamino-triazin-2-yl) -quinaldine-4,6-diamine, a yellow solid having the following characteristics:

- melting point = 120 ° C.

- RMN spectrum ^X H (300 MHz, (CD ₃ ) ₂ SO d6, δ in ppm): 1.14 (mt: 6H);

2.42 (s: 3H); om 3.50 to 3.70 (mt: 4H); 6.47 (s and mf: 3H completely); 7.54 (d width, J = 9Hz: 1H); 7.67 (dd, J = 9 in 2 Hz: 1H); 8.27 (mf: 1H); 10.09 (mf: 1H).

Parallel synthesis of H6 - [(6- (pyrid-4-yl-amino) -4-diethylaminotriazin-2-yl] -quinaldine-4 6-opamine (Example 19-2)

50 mg (0.13 mmole) of M6- (6-amino-4-diethylamino-triazine) are introduced into a magnetic reactor heated with a Zymark capacitor of the STEM RS2050 type containing 25 wells, each provided with a 50 ml glass tube in parallel. -2-yl) -quinalidin-4,6-diamine. In the first tube (Example 19-2), 5 ml DMF, 19 mg (0.14 mmole) potassium carbonate, 21 mg (0.14 mmole) sodium iodide and 13 mg (0.14 mmole) pyridin-4-yl- amine. The reaction medium was refluxed at 120 ° C under argon for 16 hours. After cooling, the contents of. The tube was evaporated under reduced pressure, extracted with 5 ml of water, filtered and washed with diethyl oxide. The crude product obtained was then purified by LC / MS using a C18 Waters Xterra 3.5 μΜ column, 3 mm in diameter and 50 m in length, eluting with a linear elution gradient including starting times (to = 0 mp) for water. containing 0.05% trifluoroacetic acid and end times (tf = 4 mp) for acetonitrile containing 0.05% trifluoroacetic acid. This gives you, after purification, 44 mg of M6 - [(6- (pyridin-4-yl-amino) -4-diethylamino-triazin-2-yl] -quinalidine-4,6-diamine, the characteristics of which are as follows:

- mass spectrum (DAD-TIC) = 415 (M ⁺ )

- retention times = 0.82 mt (under the conditions described above for purification).

Examples 19-1 to 19-2 were prepared by working as above in a Zymark STEM RS2050 reactor. Example 19-1 was the isolation in the form of hydrochloride after purification by LC / MS by extraction in 1 M hydrochloric acid solution in diethyl oxide. The structures used under different operating conditions and the characteristics of Examples 19-1 to 19-2 are summarized in the results table.

Example 20

The activities of the G-quartet, the anti-telomerase and the cytotoxicity of the various exemplary compounds were determined according to the working protocols described previously.

an example fluorescence telomerase cytotoxes. A549 Tm (° C) 1C50 (μM) 1C50 (μM) 1 - 0.25 0.59 / 1.9 * 2 48 ° 0.56 4.7 3 52 ° 0.22 - 4 48 ° 0.51 3.1

5 57 ° 0.13 0.56 / 1.8 * 6 44 ° 0.3 1.9 7 55 ° 0.89 4.9 8 - 0,051 9,1 9 - 0.74 0.53 10 - 0.24 3.6 11 57 ° 3 5.14 12 70 ° 0.041 0.44 / 1.1 * 13 - 0.72 - 14 - 1.4 / 4.9 * 6.5 15 53 ° 0.49 8.7 16 52 ° 2 / 4.5 * 5.8 17-1 57 0.049 1.6 17-2 - 0.95 6,1 17-3 6 3.9 3.2 18-1 47 3.5 - 18-2 49 2.3 - 18-3 57 0.34 10 18-5 47 3.4 - 18-6 50 2.6 10 18-7 51 3.3 8 18-8 49 3.4 - 18-9 51 3.4 9.5 18-10 49 3.3 10 18-11 48 3.3 1.3 18-12 - 2.8 - 18-13 - 3.4 - 19-1 58 1.0 1.5 19-2 53 2.5 -

*: results from two independent experiments

1 P ⁸ with its E 8 C Ε V " CM 3.02 mn c E Jo CM 3 * | s os co • Μ · si co OS os s hg conditions 6 p.mmoles per amine and ο and b · o and o co o Reaction Heating. 24h./110° 0 o £ CO 'M · 0 o o £ CM 24h./100® Dissolve Φ c Ό 3 Ο Ф c * ф 3 2 Г c gf 3 o CoC co X o b d » CE χ X X Ф Z < \ ΛΑ ΛΟ ζ - σ ζ \ LA I / X ζ = ς z— x Oh a. \ LA \ LA Vv and - X X X X Ci Ar, \ ΛΑ iQjz \ ΛΑ z = / Z— X o t a. \ o ^x ° -v> \ LA Z — P z < φ ζ ω φ with ω Φ with ω Φ s ω An example b * CM 1 b * V CO b. CO., LTD

toluen = toluene dioxan = dioxane

c c c c E E E E N CM o 0) Oh o CM CM CO., LTD co ' co h * co o co σ> CD M · co co CO., LTD co o o o o 0 o 0 O o o 4 o o o o · * · » JS XI x: x: co 'T hg co CM CM F. Φ Φ Φ c c c c that co CO., LTD co X X X o o o o * D Ό Ό X5 X X X X \ \ \ \ FOR ΛΑ ^X O-Hz -H // K \ == / / \ = / \ = / \ ^z . ^{x x} X X X X \ \ \ \ LA FOR ^ A / A ^and “Cy i- £ A and z — e z iQ4 H F. Φ Φ Φ s 2 Σ 2 co co co co CM CO., LTD 4f Yu CO., LTD CQ co co 1 ·

i

I

I (

p c c c c Well E E E E w o and xf co co o> o co see co CM co CM * o o 429 'r co co CO., LTD and and Fr. o Oh o o 0 o 0_ 0 Fr. o o o o T · £ -C x: SW CO., LTD co co CM CM 03 xt D *. r * f Φ F. Φ f X s Φ X co X CO., LTD Fr. Q o o o TK Ό Ό Ό X X X X X Mr A \ ( 3 / A / o A \ o \ = -J / \ 7 5 = A # A l % z A A ] \ ^Ζ Λ, xz, z X / X X X X X \ A \ ΛΑ \ Λ A \ / A \ / A cm X Z- In A Cl X z— M CM X z— A CM X z- _ # 4 44 f Φ Φ F. c >. 2 > s ω ω ω ω ω CO., LTD h> CO., LTD 03 o ώ CO., LTD CO., LTD co co

(ianwwiHw yvmiYyi

4.06 mn 2,85 mn with ε about cm ' 1,03 mn 0,82 mn CO., LTD CP • m · and Yu ο Yu co Yu Μ- 'C · and Yu CM ο o ' o ' o ' o ο ο ο Fr. o o ο ο Fr. CM CM £ si SW si si co see CD CD CM m · >. 4— φ φ f hap p € 0 X with C0 Li. S LL ο Fr. Fr. Q Q Ό * δ Ό X X X X X <ΓΛ \ ΛΆ \ LA \ \ W / ^z / H / Z V (/ b ^z A \ \ = / \ ^z \ = Z \ \ \ * -— ~ / V / X X X X X \ \ \ \ \ LA ΛΑ ΛΑ LA LA \ _ / \ __ / Wjz iQjz ^x ~ # A Ζ— / Ζ χ ~ ΛΑ ζ - σ z \ \ Φ f f ^ S! 2 2 2 W LU And co co z z see co CM co 00 T » co co σ> D ·

Patent Claims

Claims (21)

1. Compounds with a defined G-quadruple telomere structure, characterized in that they conform to the following general formula: aromatic aromatic ring - NR ₃ - dispenser - NR ₃ - aromatic ring, in which • the nitrogenated aromatic ring represents: Ално optionally substituted quinoline with at least c -one zpyna ^ N (Ra) iRb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical or -a C1-C4 short chain alkoxy group or a quinoline having a nitrogen atom below the quaternary form or □ benzamidine or □ pyridine • the aromatic ring represents □ quinoline optionally substituted by at least - one group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical or a C1-C4 short chain alkoxy group or a quinoline having a nitrogen atom in the quaternary form or □ benzamidine or □ pyridine or ени phenyl nucleus optionally substituted with a halogen group, alkoxy with C 1 -C 4, cyano, carbonylamino optionally substituted with one or more alkyl groups with C 1 -C 4, guanyl, alkylthio with C 1 -C 4, amino, alkyl, alkyl C1-C4, dialkylamino with C1-C4 for each alkyl group, nitro, alkyleneamino with C1-C4 or alkenyleneamino with C2-C4 or □ heter a cyclic mono or bi or tricyclic ring containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or C1-C4 alkylene groups or alkenylene with C2 -C4 • R3 and R3, the same or different, independently represent one another, hydrogen or an alkyl radical having a C1-C4 • the dispenser represents: □ a triazine group optionally substituted by one alkyl radical having 1 to 4 carbon atoms, a thio radical, oxy or amino optionally also substituted by one or more short chain alkali chains containing 1 to 4 carbon atoms or a halogen atom or a ни carbonyl group or ни carbonyl group the C (= NH) -NH-C (= NH) group or the ле alkylenedyl group containing 3 to 7 carbon atoms or the зи diazine group optionally substituted by the same groups as triazine or their salts. Compounds according to claim 1, characterized in that the dispenser is selected from triazine or diazine groups. Compounds according to claim 2, characterized in that the diazine groups are pyrimidines. Compounds according to claim 1, characterized in that they comply with formula (I) below: wherein: A represents an amino group of formula NR 1 R 2 in which R 1 and R 2, the same or different, represent hydrogen or a straight or branched chain alkyl group containing 1 to 4 carbon atoms, or • a group OR 1 or SR 1 in which R 1 has the same meaning as before or • an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group; or • a hydrogen atom or • a halogen atom selected from fluorine, chlorine, bromine or iodine -R3 and R3, the same or different, independently represent hydrogen or an alkyl radical of C1-C4 -Arj EFA _2, identical or different, represent 1. where Ατχ and Ar ₂ are the same: • quinoline unit optionally substituted by at least - the N (Ra) (Rb) group in which Ra and Rb, the same or different, represent hydrogen or an alkyl radical with a C1-C4 or -alkoxy short chain group containing 1 to 4 carbon atoms or • quinoline having a nitrogen atom in quaternary form or • benzamidine or • pyridine attached at position -4 or combined with an aryl or heteroaryl group optionally substituted by an alkyl group with C1-C4 2. when Ar _x and Ar ₂ are different • both the radicals Arj and Ar ₂ represent one of the possibilities mentioned above for Arj and Ar ₂ or • Ar _g represents one of the above options and Ar ₂ represents a • phenyl ring optionally substituted with a halogen group, alkoxy with C1-C4, cyano, carbonylamino optionally substituted with one or more alkyl groups with Cl - C4, guanyl, alkylthio with Cl - C4, amino, alkylamino with C1 - C4, dialkylamino with Cl - C4 for any alkyl group nitro, alkyleneamino with Cl - C4 or alkenyleneamino with C2 - C4 • heterocyclic mono or bi or tricyclic e. octene containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more alkyl groups with Cl-C4 or alkylene groups with Cl-C4 or alkenylene C2-C4 or salts thereof. Compounds according to claim 3, characterized in that Ar _x and Ar ₂ represent a group selected from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinoline, whose quinoline ring is optionally substituted by methyl group. Compounds according to claim 1, characterized in that group A represents a thiomethyl radical, amino, alkylamino or dialkylamino radicals in which the alkyl groups have 1 to 4 carbon atoms. Compounds according to claim 2, characterized in that A represents a methylthio group. Compounds according to claim 1, characterized in that they have telomerase inhibitory activity. Compounds according to any one of the preceding claims, characterized in that they have anticarcinogenic activity. 10. New compounds according to the following formula (I): FLN N NR ' Ί I ³ Ag ₁ Ag ₂ in which: -A represents an amino group of formula NR1R2 in which R1 and R2, the same or different, represent hydrogen or a straight or branched chain alkyl group containing 1 to 4 carbon atoms, or • a group OR1 or SR1 in which R1 represents hydrogen or has the same meaning as before or • an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group or • a hydrogen atom or • a halogen atom selected from fluorine, chlorine, bromine or iodine -R3 and R3, the same or different, independently represent hydrogen or an alkyl group C1-C4 -Ar _x uAr ₂ , identical or different represent 1. where Ag _x and Ag ₂ are the same: • the quinolein unit optionally substituted by at least - the N (Ra) (Rb) group in which Ra and Rb, the same or different, represent hydrogen or an alkyl radical with a C1-C4 or -alkoxy short chain group containing 1 to 4 carbon atoms or • quinoline having a nitrogen atom in quaternary form or • benzamidine except where A represents diethylamine, hydrogen or an amine group • pyridine attached at position -4 or combined with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group 2. when Ar ₂ and Ar ₂ are different • both the radicals Arj and Ar ₂ represent one of the possibilities mentioned above for Ar ₂ and Ar ₂ or • Atj represents one of the above and Ar ₂ represents • a phenyl ring optionally substituted with a halogen group, alkoxy with C1-C4, cyano, carbonylamino optionally substituted with one or more alkyl groups with Cl - C4, guanyl, alkylthio with Cl - C4, amino, alkylamino with Cl - C4, dialkylamino with Cl - C4 for any alkyl group, nitro, alkyleneamino with Cl - C4 or alkenyleneamino with C2 - C4 • heterocyclic mono or bi or tricyclic a ring containing 0 to 2 ring heteroatoms provided that at least one heteroatom is present in at least one ring optionally substituted by one or more alkyl groups with Cl-C4 or alkylene groups with Cl-C4 or alkenylene with C2-C4 or one their salts with the exception of 2-aminobis-4,6 - [(4-amino-6 '-quinalidin) amino] -triazine dichlorohydrate and 2-amino-bis-4,6- (ramidino-anilino) -triazine. Compounds according to claim 10, characterized in that when Ar ₂ and Ar ₂ are the same, Ar ₂ and Ar ₂ represent a group selected from the groups 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinoline having a quinoline ring is optionally substituted by a methyl group. Compounds according to claim 10, characterized in that R1 and R2 represent hydrogen. Compounds according to claim 10, characterized in that A represents a methylthio group. Compounds according to claim 10, characterized in that when Ar _x and Ar ₂ are different 1. Ar _x represents: • the quinolein unit optionally substituted by at least - the N (Ra) (Rb) group in which Ra and Rb, the same or different, represent hydrogen or an alkyl radical with a C1-C4 or -alkoxy short chain group containing 1 to 4 carbon atoms or • quinoline having a nitrogen atom in quaternary form or • benzamidine except where A represents diethylamine, hydrogen or an amine group, or • pyridine attached at position -4 or combined with an aryl or heteroaryl group 2. Ar ₂ represents a * nucleus as defined above, but different, or * a phenyl nucleus optionally substituted by a halogen group, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, alkyleneamino with Cl - C4 or alkenyleneamino with C2-C4 * quinoline, benzimidazole, indole, benzothiophene, benzofuran, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline nucleus, optionally substituted by one or more C 1-4 alkyl groups or alkenylene with C2-C4 or one of them These salts, with the exception of 2-aminobis-4,6 - [(4-amino-6-quinalidinyl) amino] -triazine dichlorohydrate and 2-amino-bis-4,6- (ramidino-anilino) -triazine. 15. Compounds according to claim 10 selected from: - 2-amino-bis-4,6 - [(1-methyl-4-amino-6-quinaldino) amino] triazine dichloride - 2-amino-bis-4,6 - [(1-ethyl-4-amino-6-quinaldino) amino] triazine dichloride 2-dimethylamino-bis-4,6 - [(1-methyl-4-amino-6 quinaldino) amino] -triazine dichloride - 2-methylamino-bis-4,6 - [(4-amino-6quinaldynyl) amino] -triazine trichlorohydrate - 2-amino-bis-4,6 - [(1-methyl-6-quinoleino) amino] -triazine dichloride - trichlorohydrate per dichloride on 2-methylamino-bis-4,6 - [(4'-methylamino6'-quinalidinyl) amino] -triazine - 2-amino-bis-4,6 - [(9-amino-10-methyl-2-acridino) amino] -triazine dichloride dichloride - 2-methylthio-bis-4,6 - [(1-methyl-4-amino-6-quinaldino) amino] triazine dichloride - Dichlorohydrate dihydrate of 2-chloro-bis-4,6 - [(4'-dimethylamino-6 quinalidinyl) amino] - hydrate of 2-methylthio-bis-4,6 - [(4'-dimethylamino-6-quinolinyl) amino] triazine -dichlorohydrate of N, N- (4-amino-6-quinalidinyl) urea - N ¹ -bis (7-chloro-1-methyl-4-quinoleino) pentane-1,5-diamine-trichlorohydrate bis-2,4 - [(4-amino-6 quinalidinyl) amino diode pyrimidine - trichlorohydrate dihydrate of 1,5- (4-amino-6 'quinalidinyl) biguanide - 6- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-ylamino] -2-methyl-quinolin-4-ol - N- [4- (4-dimethylamino-2-methyl-quinolin-6-ylamino) -6-methyl-sulfanyl- [1.3.5] pphiazin-2-yl] -2-methyl-quinolin-4,6- diamine - N6- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methyl-sulfanyl- [1.3.5] triazin-2-yl] -2-methyl-quinolin-4,6- diamine - N6- [4- (4-methoxy-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-yl] -4-methoxy-2-methyl-quinolin-6- amine - N 6 - [(6- (4-amino-quinalidin-6-yl-amino) -4-methylthio-triazin-2-yl] quinaldine-4,6-diamine - N 6 - [(6- (4-dimethylamino-quinaldin-6-yl-amino) -4-methylthio-triazin-2-yl] -quinaldine-4,6-diamine - N 6 - [(6- (quinolyl-6-yl-amino) -4-diethylamino-triazin-2-yl] -quinaldine-4,6 diamine 16. Compounds according to claim 15 selected from: h -hydrate of 2-methylthio-bis-4,6 - [(4'-dimethylamino-6-quinalidinyl) amino] triazine -guxAopxugpam guxugpam for 2-chloro-bis-4,6 - [(4′-dimethylamino-6quinalidin) amino] -triazine. 6- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-ylamino] -2-methyl-quinolin-4-ol - N- [4- (4-dimethylamino-2-methyl-quinolin-6-ylamino) -6-methyl-sulfanyl [1.3.5] triazin-2-yl] -2-methyl-quinolin-4,6-diamine - N6- [4- (4-amino-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-yl] -2-methyl-quinolin-4,6-diamine - N6- [4- (4-methoxy-2-methyl-quinolin-6-ylamino) -6-methylsulfanyl- [1.3.5] triazin-2-yl] -4-methoxy-2-methyl-quinolin-6- amine - N6- [6- (4-amino-quinalidin-6-yl-amino) -4-methylthio-triazin-2-yl] quinaldine-4,6-diamine - N 6 - [(6- (4-dimethylamino-quinalidin-6-yl-amino) -4-methylthio-triazin-2-yl] -quinaldine-4,6-diamine - N 6 - [(6- (quinolyl-6-yl-amino) -4-diethylamino-triazin-2-yl] -quinaldine-4,6 diamine. The use of the compounds of claim 10 as a pharmaceutical substance for human use. 18. Therapeutic compounds formed by one compound according to claim 1 and another anticancer compound. 19. Compounds according to claim 18, characterized in that the anticancer compound is selected from alkylating agents, platinum derivatives, antibiotic substances, antimicrobial substances, anthracyclines, topisomerases of groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs and various compounds such as L-asparaginase, hydroxycarbamide, trans-retuic acid, suramin, irinotecan, topotecan, dextrazoxane, amifostine, herceptin as well as heterogeneous hormones, androgens, anti-vascular agents creation. A therapeutic compound formed by a compound according to claim 1 and radiation. 21. Compounds according to any one of claims 18 to 20, characterized in that each of the compounds or treatments is administered simultaneously, separately or sequentially.