BE1026457A1 - Method and device for the detection and differentiation of point mutations in microorganisms by oligochromatography - Google Patents

Abstract

The present invention relates to a method for the detection and differentiation of point mutations in microorganisms, in particular a bacterium, comprising a step of amplification of one or more DNA targets, whether or not preceded by a step of transcription reverse of one or more RNAs, and followed by a step of detection by oligochromatography of the amplified products and of differentiation (or discrimination) of point mutations (mutations by substitution, insertion or deletion of nucleic bases).

Description

BE2018 / 5469 Method and device for the detection and differentiation of point mutations in microorganisms by oligochromatography

The present invention relates to a method for the detection and differentiation of point mutations in microorganisms, in particular a bacterium, comprising a step of amplification of one or more DNA targets, whether or not preceded by a step of transcription inverse of one or more RNA, and followed by a step of detection by oligochromatography of the amplified products and of differentiation (or discrimination) of point mutations (mutations by substitution, insertion or deletion of nucleic bases).

Point mutations, or (mono) nucleotide polymorphisms, can be responsible for pathologies in living beings or even allow certain microorganisms to adapt to an unfavorable environment, as in the case of the appearance of resistance to agents anti-infectives.

The techniques currently available make it difficult to rapidly identify several nucleotide polymorphisms, that is to say to detect the insertion or deletion of a nucleotide base, as well as the substitution of a wild-type nucleotide base by another nucleotide base (mutated), capable, possibly, of conferring a new phenotype.

Several polymorphic variants or subpopulations can also coexist in a single individual. For example, some bacteria resistant to antibiotics coexist with sensitive bacteria. The detection of these different sub-populations can have consequences on the severity of the disease or on the choice of treatment to be administered to the patient.

In the case of nucleotide polymorphisms in a coding sequence, one of the major difficulties is being able not only to identify the region or the position in the genome of the mutated nucleic base, but also, in the case of coding regions, to determine specifically the amino acid modified by the point mutation. Indeed, one and the same position of the genome can present different nucleotide polymorphisms, generating where appropriate the synthesis of different amino acids.

In some cases, the response to the severity of the pathology or the sensitivity or resistance to the anti-infective agent is dependent on the amino acid synthesized. It is therefore

BE2018 / 5469 essential to be able to identify the modified nucleotide base compared to the wild-type coding sequence.

Currently, there are several technologies that can be used for the detection and characterization of a point mutation. For example, we can notably cite:

- PCR techniques “molecular beacons” or “Taqman” making it possible to identify the nucleotide polymorphisms by hybridization of “beacons” or “Taqman” probes specific to the region of interest after amplification of the target sequence by PCR. However, certain probes can cover several mutational positions, which does not make it possible to specifically identify the mutated nucleotide base and therefore the new amino acid formed (in the case of a coding gene). The other limitation of this technique is the use of different fluorophores for the labeling of specific probes. Real-time PCR devices allowing the quantification of fluorophores are limited to 4 or even 5 fluorescence channels, which limits the number of mutations detected by PCR reaction.

- PCR with intercalating agent followed by analysis by High Resolution Melting (HRM). Amplification of the target is carried out in the presence of a DNA intercalator, then a dissociation curve for the double strands of DNA is carried out under the effect of increasing temperatures. The links between the GC bases being stronger than for an A-T link, this technique can make it possible to discriminate from wild nucleic acids, from heterozygous nucleic acids (mutation on only one of the two strands of DNA), from nucleic acids homozygous (mutation on the two DNA strands), but only allows a single mutation to be detected per PCR reaction and should preferably be compared to the signal obtained for a wild-type sequence.

- Digital PCR techniques make it possible to significantly increase the sensitivity of detection of mutants in a large wild population. They thus make it possible to refine the diagnosis, or even to make a prognosis. As described for the PCR techniques, the fluorescence reading instruments are limited to the detection of 4 or 5 variants per sample, which requires either the multiplication of tests for the same sample or the limitation in terms of mutations detected.

BE2018 / 5469

- Sanger sequencing and high speed sequencing. However, these methods require expensive equipment as well as relatively long preparation and analysis times which can range from ten hours to ten days.

It therefore remains necessary to develop a technique for identifying point mutations which is sensitive, rapid and which makes it possible to identify a greater number of point mutations simultaneously; this is what the inventors have achieved by developing a method allowing rapid and efficient detection of specific nucleotide sequences, capable of carrying a point mutation and allowing a correlation of this detection with mutated forms of microorganisms, such as bacteria resistant to anti-infective agents such as antibiotics.

This method allows both the multiplex amplification of targets and the specific detection of point mutations within at least nine mutational positions on each amplified target nucleotide sequence (also called amplicon) from a single sample of nucleic acids.

This method allows in particular:

- detecting the mutated position by the presence of nucleotide probes complementary to the mutated target nucleotide sequences (capture probes immobilized on an oligochromatography support);

- to identify specifically the mutated nucleotide base, and therefore the amino acid introduced by the mutated codon in the case of a mutation present in a coding sequence;

- to simultaneously detect at least nine mutational positions on a single DNA sequence;

- to present, for each mutational position, a capture probe corresponding to the wild type and capture probes corresponding to the possible mutations (up to at least 5 mutated probes per mutational position);

- to distinguish, in the same sample, wild and mutated microbial populations.

BE2018 / 5469

Another advantage of the method of the invention is its speed, because it can be executed quickly, in less than 90 minutes, preferably in less than 60 minutes, or even under preferred conditions in less than 30 minutes.

Thus, this method represents a diagnostic tool for (mono) nucleotide polymorphisms in the medical field and more particularly in that of infectious diseases and antibiotic resistance.

More specifically, the present invention relates to a method of detection and differentiation by oligochromatography of at least one point mutation in the genome of a microorganism, preferably a bacterium, present in a biological sample comprising the following steps:

a- amplification of at least one target nucleotide sequence, said target nucleotide sequence being capable of carrying a point mutation, that is to say of presenting, at a given position, the deletion of a nucleotide, the substitution of this nucleotide with another nucleotide or else the insertion of a nucleotide just before or just after said position;

b- the detection, among the amplified target nucleotide sequences obtained in step a) of wild-type nucleotide sequences or carriers of a point mutation by bringing said amplified target nucleotide sequences into contact with several capture probes immobilized on a support, the one of these capture probes being complementary and specific to a part of the wild-type nucleotide sequence, each of the others being complementary and specific to a part of nucleotide sequence comprising at least one point mutation, and the detection of the amplified target nucleotide sequences hybridized on the capture probes.

The biological sample consists of nucleic acids extracted from biological samples (humans, animals, plants, etc.); it may in particular consist of a sample extracted from an animal or from an individual such as a mammal, more particularly from a human, or from a food composition.

The biological sample is preferably lysed in a chemical lysis buffer or by thermal lysis or by mechanical lysis before being extracted by

BE2018 / 5469 manual or automated extraction methods generally combining two to three of the following stages such as retention or separation by affinity on a chromatographic column or magnetic beads, chemical precipitation, centrifugation ...

The target nucleotide sequences can be DNA sequences, in particular single-stranded or double-stranded or partially double-stranded DNA sequences, as well as cDNA sequences obtained by reverse transcription of RNA sequences. Thus, the method according to the invention can comprise an optional step, prior to step a), corresponding to the reverse transcription of the RNA contained in the sample.

In one embodiment, the amplified target sequences have a size of between 50 and 200 bases, in particular from 70 to 150 bases.

The amplification step a) can be carried out by any method known to those skilled in the art; more particularly, it can be carried out by PCR or by isothermal amplification, in particular by the LAMP method (Loop-Mediated Amplification) (Notomi et al., Nucleic acid Res., 2000, 28, e63) or RPA (Recombinase Polymerase Amplification) ( Piepenburg et al., PLOS Biol., 2006, 4 (7), e204) or NASBA (Nucleic Acid sequencebased amplification) (Guatelli et al., PNAS, 1990, 87 (5), 1874-1878). It is also possible to use the MLPA (Multiplex Ligation-dependent Probe Amplification) technique (Schouten et al., Nucleic Acid Res., 2002, 30, e57). MLPA is a variant of multiplex PCR and makes it possible to amplify multiple target nucleotide sequences with a pair of universal primers.

Preferably, the amplification step is carried out by PCR.

The reaction mixture for amplification may contain several reagents such as a buffer, enzymes, deoxynucleotide triphosphates (dNTPs), additives, and in particular several pairs of primers for the simultaneous amplification of multiple sequences in a single sample.

BE2018 / 5469

The two stages of reverse transcription and amplification by PCR can be carried out either in closed reaction tubes, inserted in a programmable instrument which heats and cools a stationary reaction chamber (such as a thermocycler), or in a microfluidic device with single use in which the reaction mixture circulates on static zones each having a defined temperature. In general, reverse transcription is performed at a single temperature before successive heating and cooling cycles allow targets to be multiplied (amplified) by PCR reaction. According to a preferred embodiment, these steps are carried out in continuous flow in a microfluidic system as described in European Patent EP 2 870 260 or in patent application EP 3 075 451.

The choice of nucleotide sequences used as primers for amplification, preferably by PCR, is made according to the target nucleotide sequence (s) to be amplified and detected. The selection of these primers is within the reach of those skilled in the art, as well as their possible labeling with elements such as metallic particles, preferably gold particles, colloids, polystyrene particles, colored particles. , (para) -magnetic particles or fluorescent elements or any other marker allowing detection.

The amplified target nucleotide sequence (amplicon) can be labeled, directly or indirectly, with different detection markers, preferably fluorophores (or fluorescent elements) or nanoparticles such as colloidal gold. The amplicon can be labeled (i) either from the amplification step by the use of an amplification primer labeled with a fluorophore (Figure 1A), (ii) or after resuspension of a probe fluorescent or a probe coupled to a conjugate with colloidal gold (Figure 1B) deposited at the level of the region of application of the oligochromatography support, the sequence of which is different from the sequence of the immobilized and complementary capture probe of a part of the amplified target nucleotide sequence, (iii) either by the incorporation of a primer labeled with a hapten (for example DIG, DNP or FAM) and the resuspension of the receptor for this hapten, the receptor itself coupled to a detection marker (Figure 1C).

BE2018 / 5469

Preferably, the marker is a fluorescent marker, preferably consisting of cyanine (Cy5) or a marker having similar fluorescent properties.

Markers having different types of staining or different wavelengths of fluorescence can be used for the labeling of the amplified target nucleotide sequences so as to facilitate their simultaneous or consecutive detection on the support, each color being specific for a sequence or a group of amplified target nucleotide sequences initially present in the test sample, their colorimetric detection can thus be obtained by means known to those skilled in the art.

The number of different nucleotide sequences which can be detected by the method according to the invention can be adapted according to the needs of the application. The method of the invention is modular and makes it possible to adapt the number of capture probes present on the oligochromatographic support according to the number of target nucleotide sequences to be detected.

In a preferred embodiment, between about 2 sequences and about 50 target nucleotide sequences, preferably between about 4 sequences and about 40 target nucleotide sequences are amplified and detected in the same sample.

In particular, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or 50 target sequences are amplified and detected in the same sample.

For the implementation of step b) of detection, the capture probes, used to detect by hybridization the target nucleotide sequences amplified in step a), preferably have a length of between 18 and 35 bases. Their sequence is defined according to the region in which the point mutation is sought.

In particular, the capture probes according to the invention have a size of 18, 19, 20, 21,

22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 bases.

BE2018 / 5469

The capture probes can be formed from purine, pyrimidine, degenerate, universal, or LNA (lock nucleic acid), ANA (altritol nucleic acid), HNA (hexitol nucleic acid), etc. nucleotide bases. nucleic acid type PNA (peptide nucleic acid) but which can be paired with nucleotide sequences or combinations of these different types of bases.

The capture probes may be entirely specific for a target sequence or may contain, in addition to the sequence defined according to the region in which the point mutation is sought (for example in addition to their 18 to 35 bases), spacers (“ spacers ") of a nucleotide or chemical nature. According to a particular embodiment, the spacer of nucleotide type is a sequence of at least 2 T (thymine), preferably between 5T and 8T, and the spacer of chemical type is a carbon type chain of at least 3 carbons and a maximum of 12 carbons.

The capture probes, with or without a spacer, are immobilized on a support, preferably on an oligochromatography membrane, allowing the capture or the hybridization of the amplified target nucleotide sequences.

In the invention, the term oligochromatography designates a method of detection by flow of nucleic acids on a support to allow their hybridization to specific capture probes.

The capture probes specific to each point mutation, whether or not starting with a spacer, are immobilized on the support, preferably on an oligochromatography membrane in the form of points (spotted) (Figure 2), in particular via covalent bonds or via a carrier molecule to facilitate attachment to the support and accessibility of the probe. The carrier molecule is added to the nucleotide sequence of the probe, regardless of the presence of the spacer. This fixation can be direct or indirect; in the latter case, the capture probe is coupled to a first molecule, such as biotin, itself fixed on the membrane by a second complementary protein molecule, such as avidin, streptavidin or derived molecules.

BE2018 / 5469

The support can be of different natures; it can act on a membrane, for example a membrane of nitrocellulose, cellulose, cellulose acetate, nylon, acrylic and nylon copolymer, etc.

In particular, the support can be in the form of a strip. A strip according to the invention can be dipped in a reaction tube or placed in a microfluidic system.

In particular, a strip according to the invention has a length of 40 to 60 mm and a width of 4 to 10 mm. More particularly, a strip according to the invention has a length of 57 mm and a width of 5 mm.

In a particular embodiment, the support can also be a microfluidic detection chip made of a cycloolefin polymer.

Capture of the amplified target nucleotide sequences is carried out by hybridization between the amplified target nucleotide sequences and the nucleotide capture probes immobilized on said support, preferably on an oligochromatography membrane. For this, a migration buffer is used; this buffer can consist of a buffered solution, preferably it is a phosphate-Tris base buffer supplemented with salts (KCl and MgCl ₂ ) and saturants (casein hydrolyzate and threealose).

The hybridization temperature is adapted to the sequence of capture probes, it is generally between 45 ° C and 80 ° C, preferably between 50 ° C and 75 ° C.

As indicated earlier, the different steps of the method according to the invention, that is to say, the optional reverse transcription, the amplification and the detection, can be carried out either in a single microfluidic device, or in closed reaction tubes. then requiring a detection step, separate from the amplification, preferably on the oligochromatographic support.

BE2018 / 5469

According to one embodiment, the method is implemented in a microfluidic device, as described in European Patent EP 2 870 260 and shown in Figure 3; this microfluidic device is inserted into dedicated equipment allowing the temperatures of reverse transcription, PCR and detection to be managed. The flow of the reaction mixture is conditioned by a peristaltic pump and the detection zone is read using a camera. Software for analyzing the signals observed makes it possible to differentiate the (mono) nucleotide polymorphisms.

According to another embodiment of the method according to the invention, it is carried out using reaction tubes which are inserted into a thermocycler allowing the possible RT-PCR and PCR to be carried out. The amplified target nucleotide sequences (amplicons) are then detected after migration on the oligochromatographic support, on which the capture probes are immobilized. Reading of the optical zone and analysis of the signals are then carried out using a reader and analysis software.

After the step of capturing the amplified target nucleic sequences, the oligochromatographic support is washed with a buffered solution aimed at eliminating the primers marked in excess and the aspecific hybridizations. The buffered solution can be introduced either at the level of the buffer reservoir in the microfluidic device as described in (Figure 3, reference 12), or at the bottom of a tube in the case of vertical oligochromatography. The buffered wash solution may consist of a buffered solution. Preferably, it is a phosphate-Tris base buffer supplemented with salts (KCl and MgCl ₂ ) and saturants (casein hydrolyzate and threalose) ... In the case where the buffered solution is introduced at the level of buffer reservoir of the microfluidic device (FIG. 3, reference 12), the buffered solution is subjected to the temperatures first of the reverse transcription, of the PCR, then of the hybridization at the level of the oligochromatographic device. In the case where the migration is carried out in a vertical tube, the tube containing the buffered washing solution is heated to the temperature allowing hybridization between the nucleotide probes immobilized on the oligochromatography device and the amplified nucleotide sequences.

BE2018 / 5469

After washing the support with the buffered solution, for example for 5, 10, 15, 20 or 30 minutes, or when the dedicated equipment establishes the best signal / background noise ratio at each spot of nucleotide probes, the area of detection is exposed to the light source of dedicated equipment or a microscope in order to detect and quantify the signal either of a fluorescent marker or of a detectable element in the visible light spectra such as beads colloidal gold. The exposure time is adapted to the method used, for example, it can be between 1 and 5000 ms, in particular between 50 ms and 1500 ms.

The signal intensities are measured at each position (“spot”) where a nucleotide capture probe is immobilized on the oligochromatographic device; this is the specific signal, and around each position it is the background noise.

In the case of the use of equipment specific to the aforementioned microfluidic device, this equipment positions an analysis grid allowing the automatic quantification of the light signal for each spot and for the background noise signal around each spot.

The signal strength is higher when the probe recognizes its homologous sequence in the amplicon. If the amplicon is wild type, the wild probe will be brighter. For example, if in the wild sequence the nucleotide in position X is G then it is the spot with the probe carrying a C complementary to the G in position X which will be brighter. If the amplicon is of the mutated type, the mutated probe will be brighter. For example, if in the mutated sequence the nucleotide in position X is replaced by a T (G> T) then it is the spot with the probe carrying an A at position X which will be brighter. Preferably, an analysis algorithm facilitates the interpretation of the results.

Preferably, the point mutation to be detected is likely to be present in the genome of a microorganism, in particular of a bacterium.

According to a preferred embodiment, the method is intended to detect a point mutation in the bacterial genome of Mycobacterium tuberculosis.

BE2018 / 5469

In the context of the present invention, the term “bacterial genome” means the bacterial chromosome and the natural bacterial plasmids.

A point mutation represents a deletion, insertion or substitution of a nucleotide in a codon of the bacterial genome which can lead to the expression of a protein having an amino acid modified compared to the wild-type sequence of this protein. The wild sequence of a gene or a protein is that present mainly in nature.

More specifically, the method according to the invention allows the detection of a point mutation associated with resistance to an antibiotic. The antibiotic can be chosen from the following families: beta-lactams, glycopeptides, aminoglycosides, macrolides, phenicolics, cyclins, fusidic acids, oxazolidinones, quinolones, sulfonamides and trimethoprim, nitrated products ( nitrofurans and nitroimidazoles), anti-tuberculosis drugs in particular, it may be a point mutation associated with resistance in Mycobacterium tuberculosis to rifampicin, isoniazid, pyrazinamide, ethanbutol and fluoroquinolones ...

Resistance to first-line antibiotics can result from a point mutation localized in the gene: for example in the rpoB gene for resistance to rifampicin, or in the katG, inhA or kasA gene for resistance to isoniazid. .

In the case of resistance to rifampicin, the point mutation is localized in the rpoB gene (gene for the β subunit of RNA polymerase). In a nonlimiting manner, table 1 presents a list of capture probes targeting different mutational positions within the rpoB gene in M. tuberculosis.

BE2018 / 5469

Mutational position (E. coli / M. tuberculosis' numbering) Genotype Amino acid corresponding to the mutational position Probe sequence (5'-3 '') base substituted in bold SEQ ID NO. Amplicon 1 Position 511/430 wild leucine GCACCAGCCAGCTGAGCC AATTCATGG 1 mutated proline GGCACCAGCCAGCCGAGC CAATTCATGG 2 Position 512/431 wild serine GCACCAGCCAGCTGAGCCA ATTCATGG 1 mutated cysteine GCACCAGCCAGCTGTGCCA ATTCATGG 3 Position 513/432 wild glutamine GCACCAGCCAGCTGAGCCA ATTCATGG 1 mutated leucine ACCAGCCAGCTGAGCCTAT TCATGGACCA 4 Position 516/435 wild aspartate AGCCAATTCATGGACCAGA ACAACCCGCT 5 mutated tyrosine CTGAGCCAATTCATGTACC AGAACAACCCGCT 6 mutated valine AGCCAATTCATGGTCCAGA ACAACCCGCT 7 mutated alanine CCAATTCATGGCCCAGAAC AACCCGCTG 8 Position 522/441 wild serine CCAGAACAACCCGCTGTCG GGGTTGACC 9 mutated leucine CCAGAACAACCCGCTGTTG GGGTTGACC 10 Position 526/445 wild histidine GCTGTCGGGGTTGACCCAC AAGCGCC 11 mutated aspartate GCTGTCGGGGTTGACCGAC AAGCGCC 12 mutated asparagine CGCTGTCGGGGTTGACCAA CAAGCGCC 13 mutated tyrosine CGCTGTCGGGGTTGACCTA CAAGCGCC 14 mutated leucine CGCTGTCGGGGTTGACCCT CAAGCGCC 15 mutated arginine GCTGTCGGGGTTGACCCGC AAGCGCC 16 Position 529/448 wild arginine GGGGTTGACCCACAAGCGC CGACTGT 17 arginine GGGTTGACCCACAAGCGCC GACTGTCGGC 18 mutated glutamine GGGGTTGACCCACAAGCGC CAACTGT 19 glutamine GGGTTGACCCACAAGCGCC AACTGTCGGC 20 Position 531/450 wild serine GCCGACTGTCGGCGCTGG GGCC 21 mutated leucine CGCCGACTGTTGGCGCTGG 22

BE2018 / 5469

GGC mutated tryptophan CGCCGACTGTGGGCGCTGG GGC 23 mutated glutamine CGCCGACTGCAGGCGCTGG GGC 24 mutated phenylalanine CGCCGACTGTTCGCGCTGG GGCC 25 Position 533/452 wild leucine ACTGTCGGCGCTGGGGCCC GG 26 mutated proline ACTGTCGGCGCCGGGGCCC G 27 Amplicon 2 Position 572/491 wild isoleucine GGCCCAACATCGGTCTGAT CGGCTCG 28 mutated phenylalanine GGCCCAACATCGGTCTGTT CGGCTCG 29

Table 1: Sequences of the probes targeting the wild and mutated genotypes detected at the level of the rpoB gene. The numbering in italics is linked to the first numbering of the codons according to the genome of Escherichia coli. The bold numbering is linked to the new codon nomenclature, based on the genome of Mycobacterium tuberculosis.

In the case of isoniazid resistance, the point mutation is localized in the katG gene (heme-containing enzyme catalase-peroxidase), in the kasA gene (3-oxoacylACP synthase) or in the promoter region of the inhA gene (gene enoyl-acyl carrier protein reductase). In a nonlimiting manner, table 2 presents a list of capture probes targeting different mutational positions within the katG and inhA genes in M. tuberculosis.

Mutational position (Numbering M. tuberculosis) Genotype Amino acid corresponding to the mutational position Probe sequence (5'-3 '') base substituted in bold Seq ID NO Amplicon KatG Position 315 wild serine GTAAGGACGCGATCACCAGCGG CATCGAGG 30 mutated threonine GTAAGGACGCGATCACCACCGGC ATCGAGG 31 mutated threonine GTAAGGACGCGATCACCACAGG CATCGAGGT 32 mutated asparagine GTAAGGACGCGATCACCAACGG CATCGAGGT 33 mutated isoleucine GTAAGGACGCGATCACCATCGGC 34

BE2018 / 5469

ATCGAGGT Amplicon inhA Position -15 wild GCGGCGAGACGATAGGTTGTCG GGGTG 35 mutated GCCGCGGCGAGATGATAGGTTG TCGGG 36 Position -16 wild GCGGCGAGACGATAGGTTGTCG GGGTG 35 mutated CCGCGGCGAGGCGATAGGTTGT CG 37 Position -8 wild GCGGCGAGACGATAGGTTGTCG GGGTG 35 mutated CGGCGAGACGATAGGCTGTCGG GGTG 38 mutated GCGGCGAGACGATAGGATGTCG GGGTG 39

Table 2: Sequences of the probes targeting the wild and mutated genotypes detected at the level of the katG and inhA genes.

The present invention also relates to an oligochromatographic support on which specific capture probes are immobilized. The oligochromatographic support and the capture probes are as defined above.

According to one embodiment, said support comprises a capture probe complementary and specific to the wild sequence of the target region and at least one capture probe complementary and specific to the mutated sequence of the target region.

The present invention also relates to a microfluidic device comprising the oligochromatographic support according to the invention. Preferably, the microfluidic device is as described in European Patent EP 2 870 260.

The present invention finally relates to a reagent kit comprising at least primers for amplification of a target region and the oligochromatographic support according to the invention.

The following examples describe some embodiments of the present invention. However, the examples are presented only by way of illustration and in no way limit the scope of the invention.

BE2018 / 5469 LEGEND OF FIGURES

Figure 1: Schematic representation of amplicon hybridization and amplicon labeling systems.

Figure 2: Schematic representation of capture probes immobilized on the oligochromatographic support: checkerboard of 40 spots and example of 4 capture probes including the one with the wild genotype; probe 1 has a mutation in position 5 (G> C), probe 2 has a mutation in position 5 (G> T) and probe 3 has a mutation in position 4 (A> G).

Figure 3: Microfluidic device described in European Patent EP 2 870 260.

1. amplification chamber, 2. detection chamber, 3. channel, 4. oligochromatographic support (rod), 5. proximal part of the rod, 6. distal part of the rod, 7. region of application, 8. detection region, 9. absorbing region, 10. fluid communication, 11. reaction mixture tank, 12. buffer tank, 13. contact pipe with the pumping system, 14. connecting pipe.

Figure 4: Histogram illustrating the detection of a strain of Mycobacterium tuberculosis mutated in position 526 and wild for positions 511-512-513; 516; 522;

529; 531; 533 at the level of the rpoB gene.

Figure 5: Histogram illustrating the detection of a strain of Mycobacterium tuberculosis mutated in position 315 at the level of the katG gene.

BE2018 / 5469 EXAMPLES

Example 1 Detection of Wild or Rifampicin Resistant Mycobacterium Tuberculosis Strains

It is known that resistance to rifampicin is due to one or more (mono) nucleotide polymorphisms in the rpoB gene (gene for the β subunit of RNA polymerase, target of rifampicin in Mycobacterium tuberculosis).

Two target sequences, of 113 and 119 nucleotides respectively, were therefore selected at the level of the rpoB gene (Table 3).

Nucleotide sequence (5'-3 ') Seq ID NO amplicon 1 AGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGACCA GAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGG CGCTGGGGCCCGGCGGTCTGTCACG 40 amplicon 2 GCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCT GAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGC GCGGGTCAACCCGTTCGGGTTCATCGAAACGC 41

Table 3. Target sequences of the rpoB gene amplified by PCR. The primer sequences are indicated in bold.

On these sequences, 10 mutational positions showing (mono) nucleotide polymorphisms involved in rifampicin resistance were targeted. Amplicon_1 has 9 mutational positions and amplicon_2 has only one mutational position. From 2 to 6 sequence variants are detected for each of the positions (Table 1).

In this application, the target regions of the rpoB gene of Mycobacterium tuberculosis are amplified by PCR, followed by detection on an oligochromatographic support, in the microfluidic device as described in patent application EP 3075451.

BE2018 / 5469

Filling the device: the buffer tank (12) is filled with a volume of buffered washing solution which can range from 50 to 80 μL. The reaction mixture tank (11) is filled with a volume of 10 to 20 μL of reaction mixture containing the sample and the amplification reagents, and, if necessary, reverse transcription.

Closing of the device: the microfluidic device is hermetically closed by a pump head (Patent application EP 3075451).

Amplification and detection: the device is inserted into appropriate dedicated equipment allowing the steps of reverse transcription, PCR amplification, hybridization of the amplification products to the probes immobilized on the oligochromatography device and washing of the reading area with buffered washing solution.

The device is managed by dedicated equipment allowing the management of the flow of liquid in the channel of the microfluidic device via an active pumping system and the management of the temperature of at least two, and up to 5, heating zones under the reaction mixture tank, amplification chamber and PCR channel and a heating zone under the detection rod.

The results are interpreted by the dedicated equipment analysis software. The identification of the wild or mutated character of each position of interest is carried out by the analysis of the fluorescence values between probes hybridizing at the same positions.

For example, for position 526/445 of the rpoB gene, 6 amino acids have been identified in natural variants: histidine (H) in the wild sequence, aspartate (D), asparagine (N), tyrosine (Y), leucine (L) or arginine (R) in mutated variants.

Each of these amino acid changes is due to a mutation in the corresponding codon.

BE2018 / 5469

Six probes covering this codon were immobilized on the checkerboard of the oligochromatographic strip, each probe being specific to one of the codons (wild or mutated, Table 1).

The amplification product hybridizes to each of these 6 probes and the signal intensity is measured. For each probe, the signal is related to the average of the signals of the 5 other probes. The signal ratios thus calculated make it possible to identify the genotype at the position considered: the probe for which a signal ratio greater than the predetermined cut-off value (for example the value 2) is obtained corresponds to the sequence present in the sample.

In the case of positions 511-512-513, the use of a common “wild type” probe for these 3 positions makes it possible to alleviate the problem of proximity of the sequences, while the probes corresponding to the mutated genotypes are specific for each position, respectively in position 577/430, 572/431, 575/432.

Example of a Mycobacterium tuberculosis strain, carrying the H526Y mutation:

In this example, the genotype is wild for positions 511-512-513-522-529531 and 533 (identified by a ratio greater than 2, dark gray histogram bars) and the genotype is mutated H526Y (black bar) for the position 526 (nomenclature of E. coli) (Figure 4).

The light gray bars represent the ratio obtained for each of the probes which correspond to the wild-type H526 and to the mutants not detected. (Figure 4). The amino acid change is identified. The histidine at position 526 is replaced by a tyrosine; amino acids at other positions are wild type.

This method also makes it possible to detect mixtures of strains or variants.

BE2018 / 5469 Example 2 - Detection of strains of wild or iscazide-resistant Mycobacterium tuberculosis

In Mycobacterium tuberculosis, it is known that isoniazid resistance is mainly due to one or more (mono) nucleotide polymorphisms in the katG gene or in the promoter region of the inhA gene.

A target sequence of 85 nucleotides was therefore selected at the level of the katG gene and a sequence of 123 nucleotides was selected at the level of the inhA gene (Table 4).

Nucleotide sequence (5'-3 ') Seq ID NO amplicon katG GGCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGG ACGCGATCACCAGCGGCATCGAGGTCGTATGGACGAACACCC 42 Amplicon inhA GTTACGCTCGTGGACATACCGATTTCGGCCCGGCCGCGGCGAG ACGATAGGTTGTCGGGGTGACTGCCACAGCCACTGAAGGGGCCA AACCCCCATTCGTATCCCGTTCAGTCCTGGTTACCG 43

Table 4. Target sequences of the katG and inhA genes amplified by PCR. The primer sequences are indicated in bold.

One position showing (mono) nucleotide polymorphisms involved in isoniazid resistance was targeted in the target sequence of the katG gene, while 3 positions were targeted in the promoter sequence of the inhA gene. Between 2 to 5 sequence variants are detected for each of the positions (Table 2).

In the case of the inhA gene, the different mutational positions are found at the promoter region of the gene. A mutation at this level therefore does not induce the formation of a new amino acid but the overexpression of the gene which will lead to resistance to isoniazid.

As in the previous example, the target regions of the katG gene and of the promoter region of the inhA gene of Mycobacterium tuberculosis are amplified separately by

BE2018 / 5469 PCR, followed by detection on an oligochromatographic support in the microfluidic device, as described in the previous example.

The results are interpreted by the dedicated equipment analysis software. The identification of the wild or mutated character of each position of interest is carried out by the analysis of the fluorescence values between probes hybridizing at the same positions.

Example of a Mycobacterium tuberculosis strain, carrying the mutation S315N:

For example, in the case of the katG gene, the mutational position 315 can have 4 different amino acids: the serine (S) which corresponds to the wild sequence, threonine (T), found in two of the mutated sequences, asparagine ( N) and isoleucine (I). Each of these amino acid changes is due to a mutation in the corresponding codon. The synthesis of threonine can be induced by two different nucleotide polymorphisms.

Five probes covering this codon were immobilized on the checkerboard of the oligochromatographic strip, each probe being specific to one of the codons (wild or mutated, Table 2).

The amplification product hybridizes to each of these 5 probes and the signal intensity is measured. For each probe, the signal is related to the average of the signals of the other 4 probes. The signal ratios thus calculated make it possible to identify the genotype at the position considered: the probe for which a signal ratio greater than a predetermined cut-off is obtained corresponds to the sequence present in the sample.

In this example, the genotype for position 315 is mutated S315N (nomenclature of E. coli). The light gray bars represent the ratio obtained for each of the probes which correspond to the undetected wild and mutant genotypes. (Figure 5). The amino acid change is identified. The serine is replaced by an asparagine.

Claims (14)

BE2018 / 5469 CLAIMS 1. Method for the detection and differentiation by oligochromatography of at least one point mutation in the genome of a microorganism, preferably a bacterium, present in a biological sample comprising the following steps: a- amplification of at least one target nucleotide sequence; said target nucleotide sequence being capable of carrying a point mutation, that is to say of presenting, at a given position, the deletion of a nucleotide, the substitution of this nucleotide by another nucleotide or even the insertion of a nucleotide just before or just after said position; b- the detection among the amplified target nucleotide sequences obtained in step a) of nucleotide sequences carrying a point mutation by bringing said amplified target nucleotide sequences into contact with several capture probes immobilized on a support, one of these capture probes being complementary and specific to part of the wild-type nucleotide sequence, each of the others being complementary and specific to a part of nucleotide sequence comprising at least one point mutation, and the detection of the amplified target nucleotide sequences hybridized on the capture probes. 2. Method according to claim 1, characterized in that it comprises a prior step of reverse transcription of the RNA contained in the sample. 3. Method according to claim 1 or claim 2, characterized in that the amplification is carried out by PCR or by isothermal amplification. 4. Method according to any one of the preceding claims, characterized in that the amplified target nucleotide sequence is marked, directly or indirectly, with a marker. 5. Method according to any one of the preceding claims, characterized in that the capture sequences contain from 18 to 35 bases. BE2018 / 5469 6. Method according to any one of the preceding claims, characterized in that the capture sequences contain a spacer. 7. Method according to any one of the preceding claims, characterized in that the contacting of the amplified target nucleotide sequences with the capture probes immobilized on the oligochromatographic support is carried out by hybridization of said amplified target nucleotide probes followed by washing with using a migration buffer. 8. Method according to claim 7, characterized in that the hybridization is carried out at a temperature between 45 ° C and 80 ° C, preferably between 50 ° C and 75 ° C. 9. Method according to any one of the preceding claims, characterized in that the point mutation to be detected is present in the bacterial genome of Mycobacterium tuberculosis. 10. Method according to any one of the preceding claims, characterized in that said point mutation is associated with: - resistance to rifampicin and is localized in the rpoB gene, or - resistance to isoniazid respectively located in the katG gene and the promoter of the inhA gene. 11. Method according to claim 10, characterized in that the capture probes are chosen from the sequences SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 and 39. 12. Oligochromatographic support on which are immobilized capture probes chosen from the sequences SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 and 39. BE2018 / 5469 13. Microfluidic device comprising the oligochromatographic support according to claim 12. 14. Reagent kit comprising at least primers for amplification of a 5 target region of a bacterial genome and the oligochromatographic support according to claim 12.