AU9699198A - B7-2:CTL A4/CD 28 counter receptor - Google Patents

Description

1i m AUST LIA S *O *5'S Patents Act 1990 DANA-FARBER CANCER INSTITUTE, REPLIGEN

CORPORATION

ORIGINAL

COMPLETE SPECIFICATION STANDARD PATENT

S.

S S S S S. S *S

S

Invyentlion Title: B7-2: CTL A4iCD "28 counter receplor The following statement is a full description of this invention including thie best miethod of performing it known to uq:- RI

I

Icj Government Funding Work described hc.:-in was supported under CA-402 16-08 awarded by the National of Health. The U.S. government therefore may have certain rights iri this invention.

Backgrounid of the Invention To induce antigen-specific T cel activation and clonal expansion, two signals provided by antigen-presenting cells (APCs) must be delivered to the surf-ace of resting T *ID lymphocy tes (Jenkins, M. and Schwartz, R. (1987)1J ETD. Med. 1J., 3C-2-319; Mlueller, D.L..

*et ad. (1990) J Immunol. 144J, 3701-3709; Williams. and Unianue, E.R. (1990)].

mmunoL Ili, 85 The firsz signal which confers srecificity to the imune response. is mediated via the T ccl rectcror (TCR) following recognition of roreign arrigenic-peotide presented in the context or :e major nistocompiatibility complex The se-ond siunal.

:fi te-.med costimulation. 'induces T cells to nroliferare and become tanctional Schwartz, R.H.

(1990) Science 2-a8 13419-1356). Costimulation is neither antigen-specic. nor MI-iC restricted and is thought to be provided by one or more distinct cell surfiace molecules expressed bv'APCs (Jen-kins. et al. (1988)J immunot'. 110, 33124-3330: Linsley, P.S., **etal. (1991)j. EX-D Med J1.721-730: GirmnC.D etiai..(1991)Pr-oc. Aar!. A1ca. Sc.

USA. S S? 6 575-6 579 Youn:: LW.. e, )Q2) J. Cin_ fhvs. 0 ouiova, e,, al. (199 1)1) Mai. 121 7i9-762: Reiser, et al. (199) DProc. :Vcd. Acad. Sc!. "SA. 89, 71-75:van-Seventer. eta!. (1990)1 Immunci. 1 A579-4586: LaSalle.JM.. etaL.

(199 JImmunoL IA1 774-80; Dus-tin. M.I.1ta. E k 6,53 Anitage.

4 R.J. et al. (1!992) N'nrzire 2L, M0-E: Liu. e, al- Eryv.Me.I 4-45.

*Considerabl1e-~ildernct suucests that the B7 protein. expresse-d On APCs. is one, sucn cr-itical costirnulaor-; moriecule (Linsiey. et al., (1991) J V-ed. ,7-7 Gimrni. et al., (9 91) Proc- AarL Acad Sc. USA. 8.9 6 575-6557 9: KRoulova. et al..

(1991J)1 ExmV MVed. la., 7;59-7162: Rei;ser. et al. 1992) P0roc. Vac!i c_ c SC-. LEA. X 2'71-2?75: Linsiev.. P.S ei ai. 1990) PrOC. Narl Acad. Sc.FA .53-~5 reoman. C.J.

S0 er ai. (199,1)]I Ero. vied ,6 _75 -15 B-1 i s the c ou nter- receptDo r or tw Co'nd s excressed or. T 1v~ove.The irst iad trre CDIIS. is cos:ute xres 4 r, res::nt2 ceits aric. cessate citn After signaiing throucth T recetor.

liiauron ofCD-18 inducts cells to pmroire7ate and secree [Linsiey. e- al. (109 1 c-f~ -70C. D ai.( 99 1) Proc c:LY SS 657 6579: Thomasor.. C.B. a,.j (1 98O) jj. e C.j..

ema. (1990) irnmwunoi.TIoact 1-5 Hardinu. et'ai. ill .Vt:r c 609 The second licand. C7rne LA4' :shopoioious 0o CDS but is not =ex:rzse-; on ~i3 cisad aopears owirigz ac i aiiof (Brune,. L, al.. (PS I I I II I- Ia

I

h. J I I 1 .1 L 6 1 11 Dariavich. et al. 19S-" JimmunOl M-7)2, 1901-1905: Brni, et al. (1 9S7) supra: Brunet. J.F. ct al. (91Immunol. Rev 1 :2-36, an Feman. et al. (1992) J.

ImmunoL ld!Q, 379-330,1. Although 137 has a higher affinit-y for CTLA4 than for CD-' (Linsley. et al.. (199 1) Exp. Med. 174. 561-569), the function or CTLA4 is still unknowvn.

Tne importance of the B7:CD28/CTLA4 costimulatory pathway has been demonstrated in vfrtro and in several in vivo model systems. Blockade of this costimulatorv pathway results in the development of antigen specific tolerance in murine and humans systems (Harding. elal. (1 992) Vature. 3j,607-609; Lenschow, et al- (1992) Science. 22789-792: Turka. et al. 1992) Proc. Mall. A4cad Sd. USA -89 11102- I I1105; Gimmi. et al. 1993) Proc. Nat. Acad Sci USA4 90t 6586-6590: Boussiotis, V..

:et al. (1993) J. EeMed 178, 1753-1763). Conversely, expression of B-1 bvW17 ncuativc murine tumor cells induces T-cell mediated specific immunity accompanied by cumor rejection and long lasting protection to tumor challenge (Chen. et al. (1992) Cell 7!, i~1093- 1102: Townsend. S.E. and Allison. i.P. 1993) Science 25.9, 368-37 0: Baskar. et al.

(1993) Proc. NaiL A cad Sci. 90. 5687-5690.). Therefore. manipulation of the B7-:CD28/CTLLA-! pathway offers urea: potential to stimulate or suppress immune responses in humans.

Summarv of the Invention This invention pertains to isolated nucleic acids encoding novel- molecules which costimulate T cell activation. Preferred costimulator' molecules include anti~ens on the :surface of B lvrmphocytes, Drofessional antigen pi-esenting cells monocytes. dendrItic cells. Langerhan cells) and other cells (eg.keratinocvtes. endotheili Cells. astrocvtes.

*2i Fibroblasts. oiilodndroc'.tesi which p~resenrt anticzen to imuecells, and which bind either CTLA4. CD28. bothl CTL-Al and CD2S or other known or as vet undefined receptors on imm une cells. Such coszimutalo--' molecules are referred to herei'n as CTLA-4/CD2S binding counter-receptors or B kvooct anens. and are capable of oroviding costimulation to activated T cells to thereby inducL T cell; proliferation andlor cytokine secretion. Preforred B lymphocyte antiac-ns include B7-2 and 137-3 and soluble fragmnents or dertyvatives there-of which bind CTLA-4 anidior CD72S and have the abilitY to inhibit or indLue coslimulation of immune celils. In on.-moire't an isolated nuc!et-c acie 'xhich cnL odes a petide hav i ng, the activity of the hum=an B- B lymnphocyte antigen is crovide- Pree'-b. the nucle'c acid iscDNA molecule haiea nicutide- seoucaice encodine human 3,7-2. as sonin Fi =rMe 8 (S EQ I D 1 nnter embodimrcnt. the- nuclei;c acidi !s 2 .:D\1A mnolecade having1 a nIUCleCotide seuen* ~odini- mur-in, 137-2. I's shoWn inllur S4 SE ID *NO: -12).

11

I

Lai AL] mi 9 1 aid 1k. A- I

L~

Fnhe invention also featuires nucleic acids which encode a peptide having 37-2 activ..ity and at least about 5001, iore preferably at least about 60%' and most preferably at least about homologous with an amino acid sequence shown in Figure 8 (SEQ ID NO:2) or an amino acid sequence shown in Figure 14 (SEQ ID NO:23). Nucleic acids which encode peptides having 137-2 acti vity and at least about 80%, more preferably at least about more preferably at least about 95% and most preferably at least about 98%/ or at least about 99% homolozous with an amino acid sequence shown in Figure 8 (SEQ ID NO:2) or an amino acid sequence shown in Figure 14 (SEQ ID NO:23) are also within the scope of the invention. In another embodiment, the peptide having 137-2 activity is encoded by a nucleic acid which hybridizes under high or low stringency conditions to a niucleic acid which encodes a peptide having an amino acid sequence of Figure 8 (SEQ ID NO:2) or a peptide having an amino acid sequence showNi in Figyure 14 (SEQ ID NO:23). The invention Further pertains to an isolated nucleic acid comcrising a niucleotide :.sequence enicoding a pentide having B7-2 activitv and having, a length of at least. 20 amino 15 acid residues. Pentides having B7-2 activity and consisting of at ieasl 40 amnino acid residues in length, at least 60 amino acid resi dues inlength, at least 80 amino acid residue:, in length.

a! least 100 amino acid residues in length or at least 200 or more amino acid residues in length are also within the scope of this invention. Particularly or.-rerret2 nucleic acids Lncode a ::apeptide having 137-2 activity, a lengrth of at least 20 amino acid residues or more and at least 50% or greater homology (pref-erably at least 70%) with a sentience_ showvn in Fizure 8 (SEQ ID NO:2) *,In one preaferred embodiment, the invention features an isola,ed DNA' encocing a e~ide having B7 -2 activity and an amino acid sequence: represenced by a n Inruh ~t: S Xn-Y-Zm In the formula. Y consists essential ly of amino acid residues 24-2415 of ,he s..-uonce shoewn in Figure 8 (SEQ ID NO:2'l. Xn and Zm are additional amino) acid residue: linked to Y by an aide bond. and Z. are amnino acid residues selected from amino acid restoues conri_!uous to Y in the amino acid sequence shown in Figure 8 (SFQ MD X_ camino acid residue(s) selected From amino acids contiguous to the amino -ernius ofY in -:he sequence snJowvn in FicTu r c S 'EQ ID NO:2), i-e- selected from arilno acid residue23: Zm is 37mino acid residuo(s) se!ected from, amino acids contiuu otecrbx emnso Y in 'the secuence snow-n in Figure 8 (SEQ ID N0:2). selected flrm amno aci reidue 46 !o 329. Accordina to the rormula. ni is a number fromi 0 to 23 n03a"L; i number from 0 to 84 A oarticularly prefer-red DNA encode-s a nertde ai af -4amino acid sequenct: representcd by the formula XnY'*Zm. where Y is amino acid residue3 24-245 of the sequence shown in Figuare 8 (SEQ ID NO:2) and niO and m=O.

Thc invention also features an isolate! DNA encoding a 137-2 fusion protein which includes a nucleotide sequence encoding a first peptide having 137-2 activitv a.nd a nucleotide sequence encoding a second peptide corresponding to a moiety that alters the solubility.

bindingz affinity, stability or valency of the first peptide. Pre 'erably. the first peptide having B7-2 activity includes an extracellular domain portion of the 137-2 protein about amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2)) and the second peptide is an immunoglobulin constant region, for example, a human Cyl or Cy4 domain, including the hinge, CH2 and CH3 region. to produce a B37-2 imrmunoglobulin fusion protein *::(B7-2lg)(see Capon et: al. (1989) NVature 33, 525-531 and Capon U.S. 5,116.964).

The nucleic acids obtained in accordance with the piresent invention can be inserted *:into various expression v.ectors, which in turn direct the synrthesis of the cortrl-sob'nding protein or peptides in a variety of hosts. particularly eucarrntic cells, such as mammalian and *~insect cell culture. and orocaryotic cells such as E. coli Expression, vectors within the scope ot the invention comprise a nucleic acid encoding at least one peptide having the activity of a novel B lymphocytie antligen as diescribed herein, and a promoter opcrably linked to the nucleic acid sequence. In one embodiment, the expression vector contains a DNA e-ncoding a peptide haviag the activity of the B'7-2 antigen and a DNA encoding a peptide havinsz the activity of another B lymp~hocyte antigen. such as the previously characterized B7 activation antigen. referred to herein as 137- Such expression vectors can be used to transfect host cells to thereby produce proteins and peptides. including fusion proteins. encoded by. nucleic acids as descriiL' d herein.

Nucleic acid probes useffil I-or assaying a biological sample for t1he presence of B cells.

eXpressinP_ the B lvrnDhocywi antigens 137-2 and B7-3 are also within theL scoe or the invention.

The invention further per-ains to isolated peptides having, the activity of a niovelC B lvm[phocyte antinen. inciudinu, the 137-2 and B-3- protein anigens. A orceree oertide riavina 137-2 activity is pronuced by recombinant expression and comprises an amino acid sequence shown in Figure S (SEQ 1D NO: Anrother preferred rep)tie hav ig B7-' activitY comprises an amino acid secuence sliomn in Figure 14' (SEQ ID NO:23). A particularly preerred Depi'de 'rvrt -he ci~v c -the 5B7-2 antigecnicludes att least aprtir~on or tne mature form of the protcin. suchas~ an ex-tracellular domain pardon e..about amino acid residues 24 -245 of SEQ ID 'ohch can be used to enhance or suppress T -ccli mediated i mmun~e responses tnr. su2 reer ptiehavina 13-i jicit::it~ pep~tides nav.ing an amino rcoresenteu uv a formula: In the formula, Y is amino acid residues selected from tht itrouo consisting of: amino acid residues 55-68 of the sequence shown in Figure 8 (SEQ ID NO:2): amino acid residues 8!-89 of the sequence shown in Figure 8 (SEQ ED 140:2); amino acid residues 128-14"1 of the sequence shown in Figure 8 (SEQ ED amnino acid residues 160- 169 of the sequence shown in Figure 8 (SEQ ID N0:2), amiuno acid residues 188-200 of the sequence shown in Figue 8(SEQID 409); and amino acid residues 269-282 of the sequence shown inFigr 8 (SEQ ED 40:2). In the formiula Xn and Zm are additional amino acid residue(s) linked to Y by an amide bond and are selected from amino acid residues contiquous to Y in the amnino e:.:acid seauence shown in Figu~re 8 (SEQ ED 140:2). Xr is amino, acid residuefs) selected from amino acids contigzuous to the amino terminus of Y in the sequence shown In Fig::re S (SEQ E: D 140:2). Zm is amninoi acid residue(s) seiected from amino acid's corIl2uo1US 70 thc carboxv ::.terminus olfY in the secouenc shown -in Figure,9 (SFQ ID \0 Aczjrcimni- io tle tornuia, .4j n is a number from 00 to_30 (F=0-30) and rn Is a numnber- from 0 to 30 (m-O Fusion proteins or hvbrid fuision proteins includina a Peotide having the activillv of novel B lymphocyte antigen (e g. B7-2, B 7-3) are also featured. For examole. a fusion protein comprising a first peptide which includes an extraceilular domain portton ot a novel B :~lymphocyte antigen fused to second peptide. such as an, immaunoglobulini constant rcin. that alters the solubility. binding affinity, stabii'tv and/or valenicv of the First eti are provided.

In one embodiment, a fusion protein is produced cornp-Isinz a first pet wihicludes 5 amino acid residues of an extracellular domain portion of the E37-2 orotein Joined to a second peide which includes amino aci residues ofa scauence corresponding to the hinge. CH2 and CH3 re,,ions of Cyl or C-/4 to fiorm a B37-2ia Fusion protein. In anotiher toFoet a *23 hybrid fusion protein is produced comprising a first peptide which inldsan e-xir ce!lhllar domain piortLion of the 137-1 anti2en and an extracellular domain portion Of the anig2en and a second peptide which includes amino acid residues conresnonding to) the hine2e. C H-1 and CR3 of C-1 (see ee.. Linslev et al. (199 E:,.tfeC. 17S3:7-30:aconai (1989) _Vatur 2. 525-53 1: -arid Capon U.S. 5.116.964)i.

I0 solated peptides and fusion prtsOff the invenilon can ne adomlnis!7s 7e o a smc to either upreguiate or fIhibit t~he exp~ression of one or more B lvmn'noc%-te antteN or the lination of one or more B lymphocyte- antlees to the!, natural lcn n~nnu c~ such as T cells, to thereby provide enanFmn or uprssion r. lneiae mnn responses in viro.

embodin7..: t-he- invenion provid;es rn~o~s re erihly moecond! antibodis. specifically: w.ith a oeptide of a novcl 3ivnrct ant~uer or tso protein as d~escribed hrin. i -efcr-red anubocdics a ani-hnuman. B-2 MLnoc;,F-11 P,_ I I I 1k 1 1 I -1 .1 .1, produced 'vbrio. cells H-F2_.3D 1. HAS.12B7 and HAS. I 79. These hybrido ma ce-lls have been,- deposited with the A-mcican Type Culture- Collct-ion at ATCC AcceSsiion (HF2.S ,D ATCC Accession (HA5.2B37). and ATCC Accession No.__ (H.A3. I1F9).

A still furtiher aspect of the invention involves the use of the nucleic acids of the invention, especially the uDN1,As, to.enhance the immuniogenicity of a mammalian cell. In prefered embodiments, the mammalian cell is a tumor cell, such as a sarcoma, a lymphoma, a melanoma- a neurobiastoma. a leukemnia or a carcinoma. or an antigen presenting cell, such as a macrophage. which is transfected to allow expression of a peptide having the activity of a novel B lym-ohocyte antigen of the invention on the suri-ace or the cell. Macrophagzes that exoress a oeptide having th-_ activity of a B lymphocyte antigen. such as the 137-2 antigen.

i;;can be used as antigen pre-senting cellis, which, when pulsed with anr appnropriate pathogenrelaed ntign o tumr angen ennnceT cell activation and immune stimiain Mammnalan cells cant be transfected with a suitable exoression vector containing a acid enrcoding a oemtide having the- activity ofa novel B lvmp~hocy;te antigen, such as the 137-2 antigen. ex vivo and then Introduced into the host mammaiL or aitc-natively, cells can be transfected with the grene in vzva via gene therapy techniques. For example. the niucleic 'dacid encodiniz ti eptide having 137-2 activity can be transfected alone, or in 4 combination with nucicic acids encoding other cnstimuiatoi.' molecules. In enhancing the 20 jmrnunogenicit% of -Lumors which do not express Class I or Class 11 MHC molecules. it mav be beneficial to ac_4:oiially Lransfect appropriate class I or 11, genes into the mammralian Cells to be trantsfected with a nucleic acid encoding a peptide having the activity ofa B lymphocyte antigen, as aescribed herein- Th.- invention 0150 provides methods for inducing both gener-al immunosuppresSiofl antigen spnecif-tic toler-ance in a subijcct by, for example. biockine fe rnctlonal trractton Of the- novel 3 lymprhocyte antigens oi the Invention. 1~..37-2 and B to their natural ligand(s) on T ceilIs or other immnnune svstemT cells, to the-reby block co-simiulationi through eczotor-F-cand pair. In one embodiment. inhibitor: -oects that can be used To block- the interaction cF the natural hunan B37-2 anuEn(C to its Patural liganos ieu.CTLA4 SO and D~ nld a so luci piie having 137-2 bindingacitybtakiohebltyo cosiimul--te immne cedlls. antnbodies that block the bindinz of to its ligands and fail to ceoera o-t~uttO. :~al~s ctld biockine anti[bodies,' such as b iock I n.g anti -B 7 2 a:,tibodies'i. B--ofio Ole'ns. whk1i can be Drocuccz in accnrCancr it the teachinos of he orsn ivetto. 1 as ase. 'soul formsI of3- r aus.se s CTLA--'_g or C D 2 S I. Su:co oiocxnc _Cesan ds ase aon ,e o r ico intn in aects %-viich block iEraCtt-onP o ar Cosm::datOr-, M molecules wi th t heir -iawt-i i Ie~ ~ee. atlnmittfl t ctl es~se an iUactiOr. OCT cl lrac -c:rinim: o the anilod'.r-_ E~oiscsLne n-

I

-7methods described herein may be useful prophylacticallin preventing transplantation rejection (solid organ. skin and bone marrow) and graft versus host disease, esoCCiallv in allogzeneic bone marrow transplantation. The methods of the invention may also be useful therapeutically, in the treatment of autoiminune diseases, allergy and allergic reactions, 3 transplantation rejection, and established graft versus host disease in a subject.

Another aspect of the- invention features methods for upregulating immune responses by deliveryv of a costimtilatorv signal to T cells through use of a stimulatorv form of 137-2 antigen, which include soluble, multivalent forms of 137-2 protein, such as a peptide having B7-2 activity and B7-2 fusion proteins. Delivery of a stimulator-, form of 137-1 in conjunction with antigen may be useful prophylactically to enhance the efficacy of vaccination against a variety or pathiogens and may also he useful therapeutically to upregulate an immnune response agains- a particular pathogen duringz an infection or againist a tumor inatumnor-bearig host.

The invention also features methods of identifying molecules which can inhibit either the itrconof R ivmo~hocvTe antigens. B7-, with the;, re.-.ptors or interfere with intracellular si-cnalling through their receptors. Methods for identifying molecules which can modulate the expression of B lymp~hocyte antigens on cells are also provided. In addition. methods for identi;- InQ cytok-ines produced in response to costimulation of T cellIs by novel B lymphocyte antigzens are within the scope of the invention.

Brief Description of the Drawings Figure 1.4-B are graphic representations of the responses of CD-S T cells, as assessed by 3 H-th%-nio'ine incorporation or IL-2 secretion. to costimulation provided by either B7 (B7-1) transfected CHO cells (panel a) or syngeneic activated B lvymohnc%-[es (panel b)i cultured in media- anti-CD3 alone, or anii-CD3 in the presencoe ot the roilowing monoclonal antibodie2s or recombinant oroteins: aB7 (133. anti-B-!): CTLA-Vliz Fab Ct CD28.: control Isi Fusion protein, (isotype control for CTLA4[a'): or a55 (ant!-BS5. the isotvix control for anti-B37- Figure 2--C are 2raphe of log ruorescence intensity or cell surf ace expression of 0 B37-i on splenic B celils activated with surface immunogiobuln (siLi crosslinkinc. The total (panel 137-1 positive nane! and 137-1 negative (137-1 pane; ci actlivated 0" celIls were stained with a-nit-B7-i rronocionai antibody (T33) and i-iuoroscte:-: isoihiocv--aut (FITC) labeled goat anti-mouse- ir-m iobulin and analyzed by flow c';tornttmy Figure 3A-B3 are gaphic represcnituons or tne responses of CD'2S- T -el.as -z asesdb'H-thvrnidin-e incorporation and secr-eion, to costuutationl orovit-ed' by B7-1V (panel a) or B (roanel b) activated synugeneic B ly.mphoc%-es cut urte:- in mea anti-CD3' alone, or ant.il-CDS' ithe orese.nce ort the biliow iic mnonocionai ml~o~ir' s or recombinant proteins: ctBB-1 (133. anti-B7-l and anti-B37-3): atB7 ani-B7-I): CTLA4Iuz: Fab ctCD28; control IQ fuision vrotein or aEB5 Figure 4 is a graphic re-presentation of the cell surface expression of C-I. B 7-3 and total CTLA4 counter-recetcors on firactionated B7- I antd B7- I activated B lvmphocytes.

Figudre 5 is a graphic representation of temporal surface expression of 137-1 (CTL A41g and ri-Albs BB- I and 133). 137-3 (CTLA4lg and mAb BBI1) and (CTLA4lQ) counter-receptors on splenic R, cells activated by sIg crosslinking.

Figure 6 is a grapnic represenitation of temporal surface expression ofiB7-1 (CTLA41g and rnAbs BB-l 'and 133)7 B7-3 (CTLA41a and mnAb BI) and B 7-1- (CTLA41iz) counter-receptors on, spienic B cells activated by MVHC class 11 crosslIinrking.

Figzare -A-3 ae 2rabohic reoresentations of the response of CD28V T cells. as assessed S by -H--thvmi-dine incorpnoration and secretion. to costimulation provided-bv svnee-neic

B

:::lymphocytes acti';atedo bsLo: crossliiaikinsz for-24 hours (panel a) or 48 hours-ipande b) and ~,culturca :n media. anti-CDS- alone,. or anti-CD3 in the p)rese.-ce- of thc f-ollow-ina rnonocional antibodies or recomnolnant protein: aB7(133, anti-BC7-I); cBBl (anti-B7-l. anti-BC-3) CT LA-!ig; Fab ctCD2S;- and Figure 8 is the nucleotide and deduced amnino acid sequence ofr the human B lymphocyte antigtn- B-7-2 (hB7C-2-cione2-9).

.0***Figure 9 is a graphic representation of COS cells transfected with control plasmid (pCDNAI), piasmid. expressing BC7- 1(37-I). or plasmid expressing B7-21 stained with either control mAb -i ani (Abs t,33 and BB-I). recombinant protein CTLA4Ig, or isotvue matched control lg protein followed by the appropniate second FITC labelled a immuflogloboiin and analyzed by flow cytometry;.

a.Figure 10.4-3 show R-NA blot analyses of B7-2 expression in unstimulated and aniti- 5 IQ activated humnan spoenic B cells and cell lines (panel a) and human mycelomnas (pnlb)- Figure1 is a grapuhic representation of the proliferation of CD'S- T cells. as assessed by 3H-thvmidin.- incororation or IL-2 se-cretion. to suomitoQetlic stimulation with phorbol i-rvristic aci (P.IA and COS cells transfecred withv'ecror alone- or vectors dirctin *the Lexvression of either 117-1 or B 7-2, f:ir is a 2roi rrention of the inhibition by rTLAb's and recombinant orotexns Of the proliferation of CD323- T cellIs, as assessed by.1 -'1-1-thymidine incorporatuon and iL-?1 s!crerion- to stimu;-i or' bv PNIA and COS cells transfected with %vector alIone (ectr or wih avco x's" I Inhibition studies were "=etoried With the addi tion oFte; no antit-ody (no rnAb), antij-BC Ie. anI,-L-BC rnAb BB-1 (BBI. anti-BSf i B-51 Fab frame ianti-CD'28 'CDS Far, C'77A 1 1.

(C TLA ji or le Lontral,, pim nr c~ c l rit e to thef PXvI A s timulnate COS cl 2d CD'S

TC-I,

Fig-ure 13 shows the sequence homoloigy betweeni the human B 7-2 protein (h 137-2) deduced amino acid sequence (SEQ ID NO: 2 and the amino acid scuence- of both the human B7-1 prote-i (hi B7-1) (SEQ ID NO: 28 and 29) and the raurine B7-1 protein (m B7) (SEQ ID NO: 3 0 and 3 1).

Figure 14 is the nucleotide and deduced amino acid sequerice of the murine 137-2 antigen (mB7-2) (SEQ ID 'NO: 22 and 23).

Figure I5 is a a-ratihic reoresenitation of the camoeritive inhibition of bir~din2 Of" biotinvlated-CTLA4Icz to imamobilized 137-2 12 by 837 familv-1a fusion, proteins. The fiz fu~sion proteins examined as comucentors were: Fuill-length B7-2 Fuill-length B87-1 (hB7.lD. the variable recion-like domain of K -2 (hB7.V or, the constant region-like comai of B-7-2 (hB7.2'C).

'4Fizure 16.4-3 are -crachic reoresentationis of Lhe comnPeitIv initii of bindingi~ of bi]otinvlated-B'7-'-I-z fiane,!A) or B7- 2 ?-le (nanelB) to im-mo'ilize-' CJAcbyicasing S*concentrations of unlahelled K -1I (cnae A) or 3 -2-12 (pnel 0B1, The exot.imentall'; lj determ ined IC:;0 values are indicated in he upper righi corner of ct paincls.

Figure 17 denictLs flow cytomearic profiles of cells stainee %Vith an anti-hB37-2 monoclonal antibod'v. HA3-.TF9. Cells Stained with tne a-niriodv were CHO cellIs tranisfected to eXDress human B7-2 (CHO-hB7.2). NIH ZT', cells -~ansie~e to cxnre-ss human 8-2 0* (T3-hB72T) and control transfected NIH cLls(T-e The ati-hB antibodyv 870 was used as a posit!ive control.

Figu~re 18 depicts flow cyiometnic orofiles ofclsisained with an ariri-hB37-2 :monoclonal antibody. HA-5.22B7 Cells stained with the antibod%- weret CTEO cells transfected to-c eO xpress human 8.7-2 CHO-hB7.2). N1IH 3T3 cells trans.-ecc to exort-ss human B87-2 (3T3-hB--2) and control transfected NIH T3- cells TSSe The- anri-h8Th2.- ami-bodv. *2'was used as a oosizive control Figure 19 demet[s flow Cvtqom-eic profiles of cells stained- w.ith an anti-i 17-2 monoclonal antibody. I-IPISDI). Cell stained with the atbdweeCH-O cets transteC=21c to exr-ess human B7- (CH-O-hB N1IH ccls rrntce o ex,7rcss human 837-2 ('1T3-hW2) and coantrol rasctdNIH, -T3 cells i Thie an7i-3Th antib odI. 870 was usead 2S a~ rosir-ev cnt-rol.

I ;zzre 20 isz a Zraohic. reo-resentation of tmrcell gr w-th (is mezasured by tumnor Slzel in mice feliowi ra!7spanta.!noI§ is:etm :lso 58camctm cells trans:ected; txaress B7_1 (J-5 3-37,l o 1r 137- i _TS-BT2 DeailedDecriin f the dneiN In a-ddition to thc pr-eiousiv chnaracterized B ivmnrhoc!:eauao rie B7 rei-errec_- to 3ere 1.BTf human B ivmohocytes e:-:'FCSS 1111ner m ntoiccUdtS n I I a I I I costimulate- T cell activation. Thiese cosiimulatory' moleculc!s. include- antigenis on the surfacLe of B lymohocyltes. proressionai antigen presenting cells ~eemonec'.tes. cendritic cells.

Lansitrhan cells) and other cells ~eg.keratiricytes. endothi-ilal clls. asrcvtes. fibroblasts.

olip-odendroc,'tes) which present antigen to imm un-, clls, an whch bind cIther CL4 CL)?S both CTI-A4 and CD28 or other known or as ye, undefined recectors on immune cells. Costimulatory mroleculies within the Scone of the invention areie red to herein -q CTLA4J/CDS ljands 'COunter-reCcPtors) or B lymphocyter anitigens. Novel B lymphocyte antigens whichi prvide cotimulation to activated T cells to thereby inducez T cell proljiferation andior cyiokine secretion include the B7 -2 (human and murlnei and the_ B 7-3 ariicns described anrd characteiZed_ hereinl.

The B i-.mionocy te 3_1tigen B-7-2 is expressed uma,,n B cil; s at about 24hours oio iesi uation w ei ther aiti-im munogiobuiin ,or m ant i- -C cassI rionoclonal antibody.. T he 37-i tic induces det~ctable IL-I_ se a cret on and T,:tell oroiiferation. Atk abou.-4 to Thours post activati or,. niuman el xrs oh3- n hr TA coupl:e7-recector. M. tet'~o a mnocionai alitibod'; BB-L. %v*-ch also bind[-s B7l (Yokochi, 2L 19S"K Immunoo'12 II 53-SIT)._ The B7-3 atcnis also expre.ssed on B-i* neurativeaz c:i."atc-i E cells and can. cosimulte T cell oroi*Ierai'nr. wihout deteczabie LcoducriOn. Pncun that the 37-1 and BT-S molecules are Birat 1 -3 is exp~ressed on a wic variet~y oF ceismciudinQ activated B cells, acivated mopnocvies. dcndritic cells.

Lana-z-zhan ceil an: :ra:oc5 72- hours oost B cell acrivanoien eh2zxoresslori of B7 -1 and B--3 beamRs to decfine. The presence of these costimnuiaton; mroic-cuies on the surTface of, activated B i:mhcns~ecthrar T cell cost imulation is reczuiared. i Z121 7v bthle 4 temeioral exressianr ri s molecules following B cell activation.

Accr~e:..one aspect ilt -ius invention pertains ro isoiated nu--clc acrIds comurIsino2 a euceo.2 coina a novel- cosimuiaor-; moiecuie. suc- as meL B !ymiphocyte ant~~ B f suh nu~e~cacids- or eauivaiet th-re-: Thc tem.nuclecic acd ausd -7nue to include such Fragmnt oeui.In. etermn 1iaint is:cueacetd eune cdn': Lto aiveuiValcVnt B ivmchocvt an -ictonalfy auivalent pepCd(Les havirta an. acf::vity or nve C1 ieC'* acitv to oind to tne r'naturl i'laari~L I 3 lyphocyte aln.1v111n or,'.S SUch as CTILA4- andLor CD'S on T c '-r'ibian, otock) or sin :i _m-oszeLCO iniuianiJ)r S~uchni-ucie consicr sscuence nor n' S SEI :tD aN 0:ann -Z:C Sro:r.co.

In one .h nucie;zc ac;u isi a cD-N n Uz of 1 L Pemti.m nu c::C d I! L I I k m consistinR of at least a portion of a nucleotide sequence encoding humran as Shown in Figure 8 (SEQ ID NO: i) or at least a cortion of a nucleotide sequence encoding murine B7-2.

as shown in Figure (SEQ [D NO:22). A preferred portion of the cDiNAo molecule of Figure 8 (SEQ ID NO:!1) or 1igur= 14 (SEQ ID NO:22) includes the cod:,iL region of the molecule.

Lin another e, 1 moooiment_ the nucleic acid of the invention encodes a pentide having an activity of B7-2 and comprisinig an amino acid sequence- shown in Figwre 8 (SEQ [D NO:?) or Fieure 14 (SEQ ID NO--31- Preferred nucleic acids encode a nentide having B37-2) activity! and at least about 50% hornoiogv. more Drcfc:rablv at least about homoloay and most preferably at Ileast about 70% homolog': with an amino acid sequenice shown, M FIgure 3 ID NO:2). Nucleic ac-,ds which encode ptptde s having B7-?acivt and at least about more preferabiy at least, about 95%1,. and most preferably at leas: about 9-9 noonous witih a seiuecc set fort _1nf Figure 8 (SEC) ID ,0*2i are ais, within -he Scope of '-.the invention. Homology rfer to scuence sirniiaritv betwetn two pecride having the tit activity of a novel B :I,,mcnocv~e anEinl". Such as B-7-2. or between two nucie!ic acid *molecules- Homoloqv can benere-mined by compiaring a positio in each- sen-uece wnich mlay be ailined for curooses of comopaison- When a position in, the conarca- senue,_nccs is occuoied bv the same riucieoide base or amino acid- then the mnolecuites are! homnoiocrous at htposition- A defzree (or oerceniage) of homology betLween secuences "I a_ r'ncioor o e number of matching or homologous Dositlons shared the seauences.

-Another asnect of the invention -orovides a nucilc acid w' hi bvriczsune a .:or low stringency conditions to a nucleic acid which encodes a peptit avin.e or a norruon -:ee of an amiuno acid sequence snowni in Figure 8 (SEQ ID NO:?)I or a pearid hvin a11 ora portion orf-, amarnno a-c Id seqcenct shown in Fi gure 14 (S EQ ID 0:OCP, mynriate stringe-ncy. conditions wncn Dromote DNA hybridization. taor exarripit. 6_o:x chloride./sodium Oir~ SSGi at about -15ZC. followed by a wash of:_0 x S a r e knowni to those skilled i.n tlie -ant or can, be found in Currer.t ProrocoI ci:iror.

John Wiiev &Sons. N.Y. C i989)_ For txani Sait ocnrO' wa,;sh steo can be seiectzd f'ror ra low s-Lnncv of a out 2.0 x SSC a: 21o E-=TC ~0 s-n-.in.cnc-v or ahout 0_1 SSC :0OC. in addition. thte teprtueahe _s 2zf icreased from low sL,-ngenc-v conc-diions at room ternperarurc. about lCt i ,o o ~conottions. at. about ~x i So iatzezd anu c I c a -ds4 en:c di rt_ erid e haviga c~ivo a t *antigen, as dcescribc ere n an:, Jacas Cuene Wfj.Cflnte TISfro 71Z:e, 7- c show.in lF-gurz 83 FRAD \NO: "1 r 14 A(iSEQ V NO:Z-2 duc :a geni,c code! are also wihi aC scone ofih ivnton uc nN runcionatv uu~viez cen:CzS::B7_ c Ionai, l ,2 I l l 3 i a.

-12from the sequence of Figure 8 or Figure 14 due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC are synonyms for histidine) may occur due to degeneracy in the genetic code. As one example, DNA sequence polymorphisms within the nucleotide sequence of a B7-2 (especially those within the third base of a codon) may result in "silent" mutations in the DNA which do not affect the amino acid encoded. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the B7-2 antigen will exist within a population. It will be appreciated by one skilled in the art that these variations in one or more nucleotides (up to about 3-4% of the nucleotides) of the nucleic acids encoding peptides having the activity of a novel B lymphobyte antigen may exist among individuals within a population 0* due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of the invention. Furthermore. there-ma be one or more isoforms or related, cross-reacting family members of the novel B lymphocyte antigens .i described herein. Such isoforms or family members are defined as proteins related in function and amino acid sequence to a B lymphocyte antigen the B7-2 antigen), but encoded by genes at different loci.

A "fragment" of a nucleic acid encoding a novel B lymphocyte antigen is defined as a nucleotide sequence having fewer nucieotides than the nucleotide sequence encoding the 29 entire amino acid secuence of the B lymphocyte antigen and which encodes a peptide having an activity of the B lymphocyte antigen the ability to bind to the natural ligand(s) of the B lymphocyte antigen on immune cells. such as CTLA4 and/or CD28 on T cells and either stimulate or inhibit immune ceil costimulation). Thus. a peptide having B7-2 activity binds CTLA4 and/or CD2S and stimulates or inhibits a T cell mediated immune response. as evidenced by. for example, cytokine production and/or T cell proliferation by T cells that have received a primary activation signal. In one embodiment, the nucleic acid fragment encodes a peptide of the B7-2 antigen which retains the ability of the antigen to bind CTLA4 and/or CD28 and deliver a costimulatory signal to T lymphocytes. In another embodiment.

the nucleic acid fragment encodes a peptide including an extracellular portion of the human B7-2 antigen approximately amino acid residues 24-245 of the sequence provided in Figure S (SEQ ID NO:2)) which can be used to bind CTLA4 and/or CD2S and. in A monovalent form. inhibit costimuiation. or in multivalent form. induce or enhance costimuiation.

Preferred nucleic acid ragments encode peptides of at least 20 amino acid residues in length. preferably at least 40 amino acid residues and length. and more preferably at least amino acid residues in length. Nucleic acid fragments which encode peptides of at least SO amino acid residues in length, at least 100 amino acid residues in length, and at least 200 or I J I L I -13more amino acids in length are also within the scope of the invention. Particularly preferred nucleic acid fragments encode a peptide having the activity of human B7-2 and an amino acid sequence represented by a formula: Xn-Y-Zm In the fomula. Y comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). Xn and Zm are additional amino acid residue(s) linked to Y by an amide bond. Xn and Zm are selected from amino acid residues contiguous to Y in the amino acid sequence shown in Figure 8 (SEQ ID NO:2). In the formula, Xn is amino acid residue(s) selected from amino acids contiguous to the amino terminus of Y in the sequence shown in Figure 8 (SEQ ID NO:2), from amino acid residue 23 to I. Zm is amino -cid residue(s) S selected from amino acids contiguous to the carboxy terminus of Y in the sequence shown in Figure 8 (SEQ ID NO:2). from amino acid residue 246 to 329. In addition, in the formula, n is a number from 0 to 23 (n=0-23) and m is a number from 0 to 84 A particularly preferred peptide has an amino acid sequence represented by the formula Xn-Y- Zm as above, where n=0 and m=0.

Nucleic acid fragments within the scope of the invention include those capable of hybridizing with nucleic acid from other animal species for use in screening protocols to detect novel proteins that are cross-reactive with the B lymphocyte antigens described herein.

These and other fragments are described in detail herein. Generally, the nucleic acid encoding a fragment ofa B lymphocyte antigen will be selected from the bases coding for the mature protein, however, in some instances it may be desirable to select all or pan of a fragment or fragments from the leader sequence or non-coding portion of a nucleotide sequence. Nucleic acids within the scope of the invention may also contain linker sequences.

modified restriction endonuclease sites and other sequences useful for molecular cloning, expression or purification of recombinant protein or fragments thereof. These and other modifications of nucleic acid sequences are described in further detail herein.

A nucleic acid encoding a peptide having an activity of a novel B lymphocyte antigen.

such as the B7-2 antigen, may be obtained from mRNA present in aci.vat.d B ivmphocytes.

It should also be possible to obtain nucleic acid sequences encoding B i-'ymhocycte antigens from B cell genomic DNA. For exampie. the gene encoding he B7-: antign c be cioned from either a cDNA or a genomic library in accordance with protocols ihereCin iescribed. A cDNA encoding the B7- 2 anntien can be obtained by isolating total .:.RNA .r-o an appropriate cell line. Doubie stranded cDNAs can then prepared fromi :te.;ot: mn-RA.

Subsequently the cDNAs can be inserted into a suitable p!osmid or fvira. i bae:eriophage i vector using any one ot a number of known technicues. Genes encodi::-n nove; B iymphocyte II Ii II p m WlA i e -14antigens can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention. The nucleic acids of the invention can be DNA or RNA. A preferred nucleic acid is a cDNA encoding the human B7-2 antigen having the sequence depicted in Figure 8 (SEQ ID NO:1). Another preferred nucleic acid is a cDNA encoding the murine B7-2 antigen having the sequence shown on Figure 14 (SEQ ID NO:22).

This invention further pertains to expression vectors containing a nucleic acid encoding at least one peptide having the activity of a novel B lymphocyte antigen, as described herein, operably linked to at least one regulatory sequence. "Operably linked" is intended to mean that the nucleotide acid sequence is linked to a regulatory sequence in a S manner which allows expression of the nucleotide sequence in cis or trans). Regulatory o" sequences are art-recognized and are selected to direct expression of the desired protein in an appropriate host cell. Accordingly, the term regulatory sequence includes promoters, enhancers and other expression control elements. Such regulatory sequences are known to I those skilled in the art or one described in Goeddel, Gene Expression Technoiogy: Methods in Enymology 185, Academic Press, San Diego, CA (1990). It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transfected andior the type of protein desired to be expressed. In one embodiment, the expression vector includes a nucleic acid encoding at least a portion of the B7-2 protein, such as an extracellular domain portion. In another embodiment, the expression vector includes a DNA encoding a peptide having an activity of the B7-2 antigen and a DNA encoding a peptide having an activity of another B lymphocyte antigen, such as B7-1. cDNAs encoding the human B7-1 and mouse B7-1 antigens are shown in SEQ ID NO:28 and SEQ ID respectively. The deduced amino acid sequences of these antigens are also shown in SEQ ID S2 NO: 2 0 and SEQ ID NO:31, respectively. Such expression vectors can be used to transfect cells to thereby produce proteins or peptides, including fusion proteins or peptides encoded by nucleic acid sequences as described herein. These and other embodiments are described in further detail herein.

The invention also features methods of producing peptides having an activity of a novel B lymphocyte antigen. For example. a host cell transfected with a nucieic acid vector directing expression of a nucleotide sequence encoding a peptide having an activity o: the B7-2 protein can be cultured in a medium under appropriate conditions to allow expression of the oeptide to occur. In addition, one or more expression vectors containing DNA encoding a peptide having an activity of B7-2 and DNA encoding another peptide. such as a peptide having an activity of a second B lymphocyte antigen B7-1. BS-3) can be used to transfect a host cell to coexpress these peptides or produce fusion proteins or peptides. In one embodiment, a recombinant expression vector containing DNA encoding a iusion I ri g LI I I protein is produced. A B7-2 fusion protein can be produced by recombinant expression of a nucleotide sequence encoding a first peptide having B7-2 activity and a nucleotide sequence encoding second peptide corresponding to a moiety that alters the solubility, affinity, stability or valency of the first peptide, for example, an immunoglobulin constant region. Preferably, the first peptide consists of a portion of the extracellular domain of the human B7-2 antigen approximately amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID The second peptide can include an immunoglobulin constant region, for example, a human Cyl domain or Cy4 domain the hinge, CH2 and CH3 regions of human IgCyI, or human IgCy4, see Capon et al. US 5,116,964, incorporated herein by reference). A resulting B7-2Ig fusion protein may have altered B7-2 solubility, binding affinity, stability and/or valency the nuiber of binding sites available per molecule) and may increase the S efficiency of protein purification. Fusion proteins and peptides produced byrecombinant S technique may be secreted and isolated from a mixture of cells and medium-contining the protein or peptide. Alternatively. the protein or peptide may be retained cytoplasmically and .16 the cells harvested, lvsed and the protein isolated. A cell culture typically includes host cells.

media and other byproducts. Suitable mediums for cell culture are well known in the art.

Protein and peptides can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins and peptides. Techniques for transfecting host cells and purifying proteins and peptides are described in further detail herein.

Particularly preferred human B7-2Ig fusion proteins include the extracellular domain portion or variable region-like domain of human B7-2 coupled to an immunoglobulin constant region. The immunoglobulin constant region may contain genetic modifications which reduce or eliminate effector activity inherent in the immunoglobulin structure. For example. DNA encoding the extracellular portion of human B7-2 (hB7-2). as well as DNA encoding the variable region-like domain of human B7-2 (hB7.2V) or the constant regionlike domain of human B7-2 (hB7.2C) can be joined to DNA encoding the hinge. CH2 and CH3 regions of human Ig Ci and/or IgCy4 modified by site directed mutagenesis. The preparation and characterization of these fusion proteins is described in detail in Example 7.

Transfected cells which express peptides having an activity of one or more B lymphocyte antigens B7-2. B7-3 on the surface of the cell are also within the scope of this invention. In one embodiment. a host cell such as a COS cell is transfected with an expression vector directing the expression of a peptide having 17-2 activity on the surface of the cell. Such a transfected host cell can be used in methods ofidentifying molecules which inhibit binding of B7-2 to its counter-receptor on T cells or which interfere with intracellular signaling of costimulation to T cells in response to B7-2 interaction. In another embodiment.

a tumor cell such as a sarcoma. a melanoma, a leukemia. a lymphoma. a carcinoma or a neuroblastoma is transtected with an expression vector directing the expression of at least one I i 91 i a SII I I I1 I

CCC

CC..

C.

o 9 peptide having the activity of a novel B lymphocyte antigen on the surface of the tumor cell.

In some instances, it may be beneficial to transfect a tumor cell to coexpress major histocompatibility complex (MHC) proteins, for example MHC class II a and p chain proteins or an MHC class I a chain protein, and. if necessary, a p2 microglobulin protein.

Such transfected tumor cells can be used to induce tumor immunity in a subject. These and other embodiments are described in further detail herein.

The nucleic acid sequences of the invention can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See Itakura et al. U.S. Patent No. 4,598,049; Caruthers ef'aL U.S. Patent No. 4.458.066: and Itakura U.S. Patent Nos.

4,401,796 and 4,373.071. incorporated by reference herein).

Another aspect of the invention pertains to isolated peptides having an activity of a novel B lymphocyte antigen B7-2. B7-3). A peptide having an activity of a B 45 lymphocyte antigen may differ in amino acid sequence from the B iymphocyte antigen. such as the human B7-2 sequence depicted in Figure 8 (SEQ ID NO:2). or murine B7-2 sequence depicted in Figure 14 (SEQ ID NO:22). but such differences result in a peptide which functions in the same or similar manner as the B lymphocyte antigen or which has the same or similar characteristics of the B lymphocvye antigen. For example. a peptide having an "20 activity of he B7-2 protein is defined herein as a peptide having the ability to bind to the natural ligand(s) of the B7-2 protein on immune cells, such as CLTA4 and/or CD28 on T cells and either stimulate or inhibit immune cell costimulation. Thus, a peptide having B7-2 activity hinds CTLA4 and/or CD28 and stimulates or inhibits a T cell mediated immune response (as evidenced by, for example, cytokine production and/or proliferation by T cells 25 that have received a primary activation signal). One embodiment provides a peptide having B7-2 binding activity, but lacking the ability to deiiver a costimulaiory signal to T cells.

Such a peptide can be used to inhibit or block T cell proliferation and/or cvtokine secretion in a subject. Alternatively, a peptide having both B7-2 binding activity and the ability to deliver a costimulatory signal to T cells is used to stimulate or enhance T cell proliferation and/or cvtokine secretion in a subject. Various modifications of the B7-2 protein to produce these and other functionally equivalent peptides are described in detail herein. The term "peptide" as used herein. refers to peptides. proteins and polypeptides.

A oeotide can be produced by modification or the amino acid sequence of the human B7-2 orotein shown in Ficre 8 (SEQ ID NO:2) or th murine B7-2 protein shown in Figure 14 (SEQ ID NO:23). such as a substitution. addition or deletion ofan amino acid residue which is not directiv involved in the function of B7-2 ii.e.. the ability ofB7-2 to bind CTLA and/or CD2S and/or stimuiate or inhibit T cell costimuation). Peptides of the invention are 4 C Ca

**C

C C CCC CI a I i II SI L -17typically at least 20 amino acid residues in length, preferably at least 40 amino acid residues in length, and most preferably 60 amino acid residues in length. Peptides having B7-2 activity and including at least 80 amino acid residues in length, at least 100 amino acid residues in length, or at least 200 or more amino acid residues in length are also within the scope of the invention. A preferred peptide includes an extracellular domain portion of the human B7-2 antigen about amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). Other preferred peptides have an amino acid sequence represented by a formula: Xn-Y-Zm where Y is amino acid residues selected from the group consisting of: amino acid residues 55-68 of the sequence shown in Figure 8 (SEQ ID NO:2): amino acid residues 8189 of the S sequence shown in Figure 8 (SEQ ID NO:2): amino acid residues 128-142 of the sequence shown in Figure 8 (SEQ ID NO 2 amino acid residues 160-169 of the sequence shown in Figure 8 (SEQ ID NO:2); amino acid residues 188-200 of the sequence shown in Figure 8 (SEQ ID NO:2); and amino acid residues 269-282 of the sequence shown in Figure 8 (SEQ ID NO:2). In the formula, Xn and Zm are additional amino acid residues linked to Y by an amide bond. Xn and Zm are amino acid residues selected from amino acids contiguous to Y in the amino acid sequence shown in Figure 8 (SEQ ID NO:2). Xn is amino acid residues selected from amino acids contiguous to the amino terminus of Y in the sequence shown in Figure 8 (SEQ ID NO:2). Zm is amino acid residues selected from amino acids contiguous to the carboxy terminus of Y in the sequence shown in Figure 8 (SEQ ID NO:2). According to the formula, n is a number from 0 to 30 (n=0-30) and m is a number from 0 to 30 (m=0-30).

A particularly preferred peptide has an amino acid sequence represented by the formuia X n Y-Zm, where n=0 and m=0.

Another embodiment of the invention provides a substantially Lre re rearation of a peptide having an activity of a novel B lymphocvye antigen such as B7-2 or B7-3. Such a preparation is substantially free of proteins and peptides with which the Peptide naturally occurs in a cell or with which it naturally occurs when secreted by a cell.

The term "isolated" as used throughout this application refers to a nucleic acid.

protein or peptide having an activity of a novel B lymphocyte antigen, such as B7-2.

substantially free of ceilular material or culture medium when produced bv recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.

An isolated nucleic acid is also free of sequences which naturally flank the nucleic acid rie..

sequences located at the 5' and 3' ends of the nucieic acid) in the organism from which the nucleic acid is derived.

i I

I

I hIlI I 1 I I ig ~I ii -I

C

.*o Se C a S S I -18- These and other aspects of th-is invention are described in detail in the following subsections.

I. Isolatio ofNucleic Acid From Cell Lines Suitable cells for use in isolating nucleic acids encoding peptides having an activity of a novel B lymphocyte antigen include cells capable of producing mRNA coding for B lymphocyte antigens B7-1, B7-2, B 7-3) and appropriately translating the mR.NA into the corresponding protein. One source of mRNA is normal human splenic B ccefls. either restinR or activated by treatment with an anti-irnmunogziobulin antibody or an anitlivINHC class 11 antibody, or from subsets of neoplastic B cells. Expression of the human B7-2 antigen is detectable in restina B cells and in activated B cells, with m-NA lev,.els increasing 4-fold from resting levels following stimulation. Total cellular RNA can be obtained using standard techniques from resting or activated B cells during these intervals and utilized; in the construction of a cDNA library.

15 In addition. various subsets of neoplastic B cells may express B37-2 and B7-3 and can alternacively serve as a source of the mR.NA for construction of a cDNA libraryi. For example. tumor cells isolated from patients with non-Hodgkins lymphoma express B37-11 mR-NA. B cells from nodular, poorly differentiated lymphomna (NPDL). diffulse large cell lymphoma (LCL) and Burkitt's lymphoma cell lines are also suitable sources of humnan 137- 1 0 mRNA and, Potentially B7-2 and B7-3 mRNA. Mveiornas generally express B-7-2. but not B7-l mR-NA. and, thus can provide a source of 137-2 mRINA. The Burkittfs lymphomra cell Sline Raji is one source of B lympthocyte antigen mR-N-A. Preferably. 137-2 mRNA is obtained.

from. a opulation of both resting and activated normal human B cells. Activated B cells can, :be obtained by stimulation over a broad spectrum of time from minutes to days) with.

ex-ampl[e. an anti-immunogilobulifl antibody or an arnti-MICH class 1I antibody% *5 cc.

S

11. Isolation of mRN",A and Construcion of c)NA Libran;, Total cellular uR-NA can be isolated by a variety of techniques. by usinu tE 2cuarnicntum-tniocvarnate e-xtraction procedure of Chilrqwin e, aL Biociiemisiry 19. 5294-- 52110 (19 9) According to this Method. Poly nR-NA is prepared and ouri'ted for use In aDN\A library~ construction usingi oligo (dT) cellulose selection. cDNA ithen Synhsie tro RN usne ligdT~ ormin an reers trnscipts.Nlolonc'

MVLV

from Gibcoi;BRd. Bethesda. or AMV r'e transCrioiaSe C aiai from Seikagiku America- inc.. St. Petersburg. FL) are p~ret -era I o 'A01-viflC rever-se tranctt~l 'h RADA hvbrid molecuiciscnetct doub"le strande DNA usinL, conventional techniquec- and iricomro~atea lnin a suitable vector.

I VI* I I I -19- The experiments herein employed E_ coli DNA polymerase I and ribunuclease H in the conversion to double stranded cDNA.

Cloning of the cDNAs can be accomplished usIn- anyv of the conventionial techniques for joining double stranded DNA with an appropriate vector- The use ofsvnthetic adaptors is Particularly preferred, since it alleviates the possibility of cleavage of the cDNA with restriction enzyme prior to cloning. Using this method. non-self complemenm-v kinased adaptors are added to the DNA prior to ligation with the vector. Virtu'allv any adaptor can be employed. As set forth in more detail in the examples below, non-self complementary BsL-XI adaptors are preferably added to the cDNA for Cloning, for ligation into a p)CDM8vf vector prepared for cloning by digestion with BstXl.

Eucarvotic cDNA can be expressed when placed in the sense orientation in a vector that supplies an appropriate euca-votic promoter and origin of replication andother elements including2 enhancers, splice acceptors and/or donor sequences and polvadcrnvldtion signals.

The cDNAs of the present invention are placed in suitable vectors containing, a eucarvotic promoter, an origin ofreplication functional in E coli. an SV4 o in of renlication which ~*allows growth in COS cells. and a cDNA insertion site. Suitable vectors include -mH3 (Seed and Aruffo, Proc. NVat! A cad Sci-, 84:3365-3369 (1987)), 7 Hm (.A~uf and Seed. rc Nat?. Acad Sci-, 84:8573-8577 (1987))7 pCDN4f7 and pCDMS (See-d.. Narzre. 329-8-10-841 (1987). with the pCDMv8 vector being particularly preferred (available comm-crcially from lnvitrog2e-, San Diego, CA).

ii. ranfetinofHsCes and Scretnino for Novel R Lymphocy Acivtion Atgn The thus prepared cDNA library is then used to clone !he gene of interest by expression cloning te-chniques. A basic expression cloning technique has becn described by Se ed an d A ru ffo. Pro c. Na L.4 Acad Sc USA. 8 4:3 365 3369 19 87 an d Annuff-o an d S eed.

-Proc. NVar. Acad Sc. USA. 84:85 73-8577 11987). aitnough modifIcations to this techniqlue may be necessary.

According to one emoonient. piasraid DNAk 's introd into simian COS cell line (Gluman. Cell 23:175 (198 by kncwvr merhods ot transtec-Lon DFAE-Dextran) and allo-wed to rep~licate and exoress the cDN A insets. The -avsfecmants exoressinR 3 7-l antigen are depleted with an anti-B37-1mroon 133 rd B 1J) and anti- ~mu-me IgG and I LgM coated imuTancb~~ ransfr_ tan is z.xorcssinoe human B 7-2 antigen can be positively selected by raactin- e zrcansFc-ctants with the rfusion croteinls CTLA412 and CD2S~g. followed by panrirng wizh ai-human 14, antibody coated plates.

Althougzh human CTLX'Iz and CD28l rusionCL Mren wr s inMe examcies described herein, given the cross-speifes reactivity betxe~ B 7-1 1,r::aaiiur;c~ I can oe expected that other husion proteins r-eac7've~aonrC;-cc:.ese~ cudh I It ILLI 1 used. After panig. episomal DNA is recovered from the panned cells anda transformecd into a competent bacterial host, preferably E coii. Plasmid DNA is subsequently reintroduced into COS cells and the cycle of expression and panning repeated at least two times. After the 'final cycle, plasmid DNA is prepared from individual colonies, transfected into COS cells and analyzed for expression of novel B lymphocyte antigens by indirect imv-munofluorescence with, for example, CTLA4Ig- and CD281g.

TV. Sequercina of Novel B Lv.mphoc%.Te Antigens Plasmids are prepared from those clones which are strongly reactive with the CTLA41g andlor CD2ig. These plasmids are then sequenced. Any of the conventional sequencing techniques suitn~le for sequencing tracts of DNA about 1.0 kb or larger can he employed.

As describedi in Example 4- a human B7-2 clone (clone2 9) was obtairicticonzainin a insert of I l20 base Tnairs with a singie long open reading frame of 987 nucleotides and approximately 2 7 nucleotides of 3'rnoncoding sequences (Figure 8. SEQ ID NO:l1). The 8 redcte amio aid equnceencoded by the open reading frame of the protein is shown below the nucleotide sequence in Figure 8- The encoded human B7-- protein. is predicted to be 329 amnino acid residues in length (SEQ ID NO0:2). This Protein sequence exhibits many features common to other r'.pe I 1g superfamilly membrane proteins. Protein translation is predicted to begat th mehonine codon (ATG. nucleotides 107 to 109) based on the DNA homology in this region with the consensus eucaryotic translation initiation site (see Kozak.iM1 (1 987). NucL A4cids Res. 15:8 125-8 148). The amino terminus of the B7-2 protein "amino acids I to 23) has the characteristics of a secretory, signal peptide with a predicted cleavago between the alanines at positions 23 and 24 (von Fleine (i987')!Vuc!. Acids Res. 1-4:4683)- Processirng at this site would result in a B37-2 membrante bound protin of 306 amnino acids 8 having an unmodified molecular weight of approximately 34 kDa- This prote-in would consist of an aurroximnate extracellular Is: suoerfamily V -and C like domains of from about amn 'cd residue 24 to 245. a hydrophobic transmembrane domain oft tram aboutarnino id residr-e 246 to 168, and a long cvtopiasmic domain of fromn about amino acid residue 269 to 329. The homologies to the [g superfamily are due to the two coniguous 1g-like domains in the extrac2!Iuiar region bound by the cysteines at positions 410 to 1 0 and 157 to 218S. The extracelluiar domain also contains eight potontial N-linko-d glvcosvlatiori sites ana.

like 137-i. is orobablv glvcosyiate d. GlycosvIation of,,he humnan B -27 mrtef may itcase the molecula w.emntL to aoout 50-70 "Da. The c,.topiasmic Jaomain ci hu-man B 7-2. while somewhat liuer than B7-I contains a comnmon rcgion of riuitipiu c.sitincs followed by positiveiv charq2!d aminpo acids which presumabiy. Erunc:1ior -IS Si nafing Or rgit[ domains within an atn--p:rcs.nfinLg cell (APC;. Comparisoni 01 cotrl te riucle-otide, and

I

9 Ii 1 1 0 1 Ai I- -21amino acid sequences of the human B7-2 with the GenBank and EMBL databases yielded significant homology (about 26% amino acid sequence identity) with human B7-1. Since human B7-1, human B7-2 and murine B7-1 all bind to human CTLA4 and CD28. the homologous amino acids probably represent those necessary to comprise a CTLA4 or CD28 binding sequence. E. coli transfected with a vector containing a cDNA insert encoding human B7-2 (clone 29) was deposited with the American Type Culture Collection (ATCC) on July 26, 1993 as Accession No. 69357.

V. Cloning Novel B Lymphocte Antigens from Other Mammalian Species The present invention is not limited to human nucleic acid molecules and contemplates that novel B iyriphocvte antigen homologues from other mammalian species that express B lymphocyte antigens can be cloned and sequenced using the techniques described herein. B ivmphocyte antigens isolated for one species humans.) which exhibit cross-species reactivity may be used to modify T cell mediated immune responses in a different species mice). Isolation of cDNA clones from other species can also be accomplished using human cDNA inserts, such as human B7-2 cDNA. as hybridization probes.

As described in Example 6. a murine B7-2 clone (mB7-2, clone 4) was obtained containing an insert of 1,163 base pairs with a single long open reading frame of 927 nucleotides and approximately 126 nucleotides of 3' noncoding sequences (Figure 14, SEQ ID NO:22). The predicted amino acid sequence encoded by the open reading frame of the protein is shown below the nucleotide sequence in Figure 14. The encoded murine B7-2 protein, is predicted to be 309 amino acid residues in length (SEQ ID NO:23). This protein sequence exhibits many features common to other type I [g superfamily membrane proteins.

Protein translation is predicted to begin at the methionine codon (ATG. nucleotides I l to 113) based on the DNA homology in this region with the consensus eucarvotic translation initiation site (see Kozak M. (1987) .uci. Acids Res. 15:8125-8148). The amino terminus of the murine B7-2 protein (amino acids 1 to 23) has the characteristics of a secrerorv signal peptide with a predicted cleavage between the alanine at position 23 and he valine at position 24 (von Heijne (19S7) N.uc. A.cids Res. 14:4683). Processing at this site would result in a murine B7-2 membrane bound orotein of 286 amino acids having an unmoditied molecular wxeight of ranroximae!v 32 kDa. This protein would consist of an approx:mate e:-:racellular i_ superfamiv V and C like domains of from about amino acid residue 24 to 2- 6. a hydrophobic transmembrane domain of from about amino acid residue 2-'7 to 265. and a long cytoolasmic domain of from about amino acid residue 266 to 309. The homologies to the Ig superramiiy are due to the two contiguous Ig-like domains in the extracelular region bound by the cvsteines at positions 40 to i 0 and 157 to 216. The extraceliular domain also I I

I

*contains nine potential N-linked glycosylation sites and, like murine B7- I. is probably glycosylated. Glvcosylation of the mw-ine 137-2proteCin may increase the molecular weight to about 50-70 kDa. The c-vtovlasmic domain of murine B7-2 contains a common reg2ion which has a cysteine followed by positively charged amino acids which presumably Thnctis as signalin or regulatory domain within an APC. Comparison of both the nucleotide and amino acid sequences of mur-ine B7-2' with the Gen-Bank and E-MBL databases yielded significant homology (about 26%11 amino acid sequence idenitity) with human and murine 137- 1. Murie 137-2 exh~bits about 50% identity and 67% similarity with its human homologue.

*hB7-2-. E. coli (DHiO6/p3) transfected with a vecItor (piasmid pmBx1) cont~aining a CDNA insert encoding murine 137-2 (clone 4) was deposited with the American Type Culture Collection (ATCC) on Augukt 18, 1993 as Accession No- 69388.

*Nucleic acid-- which eIncode novel B lymphocy;te antiaens from ati-er scecles. such as the murine B7 -2 car. be used to generate either transgenic animals or "knock dbt'anirnals which. in turn. are us-eful in the development and screening of therapeutill useful reagents.

iransgenic animai a mouse) is an animai haviLn2 cells that coniain a1 transgene. wnicn transgene was introduced into the animal or an ancestor of the animal at a ore-natal- an embr-/onic stage. A -ransgene is a DNA which is inte2.rated into the qcnome of a cell from which a transgenic aimal develops. in one embodiment. mu-toe B-7-2 cDN,.A or an appropriate sequence thereof "can be used to clone genomic 137-2 in accord ance- with established technioues and the- Qenomic sequences used: to 2-enerate t7asei a ias that contain cells which exuress 37-2 protein. Metodsfr gerveratin transoenic aimals.

particularly animals such as -nice. have become conventional in the artL and are described, for oexample, in U.S. Patent Nos. 1.736.866 and 4,870,009. Typically, partLicular caL-ls woL"'a be *::targeted for 137-2 tiransge-ne incorporation with tissue spectfi ie nhaact-5. wvnici could rf-sult in T cell costimuiatron and enn-anc.d Tcell orollieatich and auzoinmmuriv, Trapnnc .animals that include a copy of a 137-2 transuene introduce.d into the germ ie or P inirrial at an eryonic stage carr be used to examine the effect r ocres B7 cxoressior. Suc' animals car be used as tester- animals -,or reagents thought to conrer protection tom. ter example. autoimrmunie disease- In accordance with this faceri o;f iho invenion. afl animat is trated with the reagent and a renuce icine of the disease- cornparco o utr aied animals bearing the- tmanscene- would inlicato a potenial :herameucic or thenen~o disease.

Alie.-nativeiy. tie ron-Oinimn nomoor.Iues o" B 7 C~n us. A cita knock out a1inal whico n eetv leotj ~o~O11 3e recornotatio r~ederiu

N

~introduc-c ;Ito an eoFO2ceil Of -he an Ma. ror nk .DAcnc used to cB.n 2 7 n acomac etaomisOnt ectn(:CS n~rot) genomic 137-2 DNA such as an exon which encodes an extracellular domain) can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kiobases of unaltered flanking DNA (both at the 5' and 3'enids) are included in the vector (see- T'homnas, K.R_ and Capecchi, M. R._ (1987) Cell 51:503 for a description of homologous recombinat ion vectors). The vector is introduced into an embr-vonic stem cell line by electroporation) and cells in which the introduced DNKA has homoiousiv recombined with the endogzenous DNA are selected (see Li- E_ et at- (1992) Cell!6-~9.-15). The selected cells are then injected into a biastocyst of an animal a mouse) to form aggregation chimeras (see Bradley, A. in Teratocarcinomas and Enibrvonjc Stem Cells: A Pracrica! Avnroach, E.J. Robertson. ed.

(IRL, Oxford. 1987) pp. 1113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embrvo brought to term to create a "knoc'k out" *:animal. Progenyv harbouri ct homologously recombined DN A in their ge5 &ells can be identified by standard technioues and used to breed animals in which all cells of the animal ocontain the homoincousiv recombined DNA. Kniock.out animals can Ice characterized for their ability to accept, grafts, reject tLumors and deffend against infectious diseases and can be used in the study of basic immunobiology.

VT. Expression!of B Lymphocvte Antigens Host cells transfected to express peptides having the activity of a novel B lymphocyte antigzen are also within the scoine of the invention. The host cell may be any Drocarvotic or eucarvotic cell. For example, a rpnide having 137-2 activity may be expressed in bacterial ccllssuch as E ccii. insect cells (bacuiovirus) s, ormmainclssc sCinese hamster ovani cells (CHO) and NSO cells. Other suitable host cells mnay be found in Goeddel, 1990) suzwra or are! kniow-n to those skilled In the artL.

For xamcle. exoression in eucariotic cells such as mammalian. yeast, or insect cells can lead to partLial or comolete glycosylation and/or formauion of rele' -a't inter- or intra-chainr.

disultide bonds of recombinant protein. Examplies of vector s _E'r exrrlss;o es £cer! vi;sae include o)YeoSecl (Baldan i. at_ a H (987) Emno 2 Ma Kj r ~0 Herskowitz (1982) Ceff 3 0:933-943). pJRY88 (Schultz at al-9)Cr1-ti1- 3 n (hniroe Co -rton. Sani Diego- CIA Baculovi-us vectors 1v'ol or exoiression of rot.eias in cultured insec, cells (SF 9 ce lls) Icud the cc series (Smith at i- (19 8 3) Wol. Cel H EX Z. f:16-2 i6-i) and the oVL series (Luckiow. and Summers.

(1989) Viroiogay 170.-31-39). Genetrally. COS calIls (Giluzrnan. (i98 li Ceil 23:1 for transient amrol I F.cationiecxc~ressi on i n mnamnmaii an cells, while1 CHO idh r- C hinese Hams:z2- O'var7v 'i~s ar-e use-' vith veczors such as :).%T2PC K'autfrPa S7' *1 I I

I

I I I I

K

-24- EMWBOJ. 6:187-195) for stable amplificationexpressiofl in mammalfian cellIs.Aprfre cell line for production of recombinant protein is the NSO myeloma cell line available from the ECACC (cataloa 485 110503) and described in Gaifre, G_ and _Milstein. C. ((198 1) Methods in Enz-vmoiog~y and Preparation of Aonocional.Antibodies: Strategies and Procedures, Academic Press. Vector DNA can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co-precipitaton. DEAE-dextran-mediated transfection. lipofectin. or electroooratbon.

Suitable methods for trasforminz host cells can be found in Sambnrook et aL (Nfolecular Cloning: A Laboratory .anual. 2nd Edition. Cold Spring Harbor Laboratory press 1989)).

and other laborator., textbooks. When used in marnraiian cells. the exnression vector's :control functions are oten orovided by viral material. For examenle. cammironlv usend promoters are derived from polyorna. Adenovirus 2.cvtomegaiovtfis amomst frccuentlv.

Simian Virus4O into It is knownm that a small fcinof cells (about i out of7 lc :ici ifterate DNA it heir genornecs. in ordertio :aentllr these integrants. a gene that conia;ns a selectable markerl resistance, to asitiolotics) is generally introduced Into the host cells alona with the gzene of Interest. Preferred selectable markers include those which cofe rsistancc to drugs, such as 1S. livu.r-mvcin anid methotrexate. Selectable mnarke-rs mayv be intraduct-_i on the ~same olasru-id as the_ gene at" itrest or may be introduced on a senarate oiasmid. Cells containing the gene of interest can be identified by drug selection: cze;!s mLat, nave :incornorated the selectable marker- gene will survive, whil the other cel;is die. The sur-;rvinc2 .:cells can then be screenied t-or production of novel B lvmrohoc-yte animuens Oy cell1 surfacec staining with ligandcs to the B celi antigens fe.g.. CTLA4Ig and CD2S1gI. Aliernalivell. the protein can be metabolically radiolabtied with a labeled amino acid and immuiorm.laitaten from ceil suvernarant wi th an anti-B Ivmphocyte antigen monocionai anii dy or a fusion Prote~ti such as CTLA.Alg or CD2S1g.

Exnresston in orocarvotcs is mpost ofrten carr ied out in£ iZWflytrsctang constittive or tnducibie proMOtors directing the expression of elilter -fusion or non-tusion ororeins. t-uSion vectors ann a numero, amino acids usualily to the aino terminus or- the exrtssion of recombinant orotin 2) to in1crease the solubiiv ortn trgct reccom on2=n nrote: and 3 to in .a .urficai"on of' the target recombinant roen :1v 2r-,rga sa .igartd in~ a-Tnnt On.tuen. in, fu-s.in eXpre1ssion1 v:ctorsZ. 2 r:C2yt C avagct site I s -1n, ro du ccCO at o toe t imit and :he tarce pC~Ctr :rote. to -,iao senaranon ot tne -,7rttez recm~~ ZLMO rotein from the fusion moie'. seseUzntt o~rtal o teuaonT i oro S; iezyme s, andei cognate r:cogITio 'Or. c~ muO Factor tnr -7ii an-; cneo:iac Tma neio e L x reso c v ,e Cto4rsC L:nCU 2 6 E A mo 'El I I a. I 's I Corp., 'Melbourne. Australia), pMAL-L (New England Biolabs. Beverly., and vRITS' (Pharm acia, Piscatawav. NJ) which use glutathione S-tranf'erase, maltose E binding protein, or protein A. respectively, to the targt recombinant protein- E. coli expression systemns include the inducible expression vectors pl-rc (Arnann et siL, (1988) Gene 69-30 1-315) and pET 11I (Studier el al., Gene Etoressicn Technolo Methods in Enzvmoicgy 18, Academnic Press. Sani Diego. California (1990) 60-89; commercially available from Novagen). In the pTrc vector system. the inser-ted gene is expressed with a DelB signal secinenc2 by host PUNA nolvmerase transc'muon from a hybrid trp-lac fusion promoter. After induction, the recombinant protein can be purified from the peripiasmic fraction. In the pET I11 vector system. the target gene is expressed as non-ftision :protein byv transcrintion frofthec T.7 agnO-lac 0 fuision promoter mediatcd a coexoressed e.e*viral RLNA polvmerase (1 gi i. This viral polymerase is supplied by host E._co"T strains BL21I(DES) or HMS i74"(DES-) from a -sidenit .prophage harboring a T- gnlne the :transcriotionai control of the lacUV 5 nromoter. In this system, the recomb nant7 jrote'nca be purified from inclusion hod'es in a d-ataured formn and, if desired. rernatured bystep :graditm dilsis to remove denaturants.

One stratem-i to maximize recombinant B7-2 exnression in E- cciiis to exoress the protein in a host bacteria iid an impaired capacity to proteolyticalfly cleave the recombinant protein (Gottesman. Gene Ex-Pressior Techncoc.~v: MAvethods in Er~ymologt 1K1.

Academic Press. San Diego. Catifornia N1990) 119-123). Another strategy would be to alter the nucleic acid seauence of the B7 -2 qene- or other DNA to be inserted into an exoression.

vector so that the individual codons for each amino acid would be those! nrfrnial utiiized :in highly exo~resse-d coi oroteins (Wada e, al-, (1992) iNuc A4cds Res. 70:21 ji1-2 Is).

~~Such alteration of nucleic acid sequences or- 1he Inv'ention could he carriec out by~ standard s':nihesis techniques.

*Novel B lymtphocytce anticenis and c or-Lions thereCo. e xpressed in r- m a j;-ri cells or other-Wise, can be purified accorc-nc tlo stwan&rd procedures of the ari- including arnmoniurr sulfate orecioiration- ftactionation colum-rn crtrorrnaoLgaph'.t(e-g. ion e-xchanue. geci ltto.

elc-rooboresis. afflnimv romteah:t and ultimatel'.-. cr.-stallizatin (sz!:.nraIv 0 Enzyvme Purification and Relate-.d Tehi~e~ ferhn n 'vmcc (1971)). Once puritted. part'aiy ortohom,,:)t~ the recombiniantiv ciroduceC, B ivmoihoc-te antilcens or DororoS; .Pneo.u can iJinComooslaun Suitar',e to roba-;-ac'~'iic2! itrnilnisrration as iec~odn i-ct' i hc:r.k I I

I

VII. Modifications ofNucleic Acid and Amino Acid Sequences of the In and Assays for B7 Lymphocyte Antifen Activit It will be anoreciated by those skilled in the art that other nucleic acids encoding peptides having the activity of a novel B lymphocyte antigen can be isolated by the above process. Different cell lines can be expected to yield DNA molecules having different sequences of bases. Additionally. variations may exist due to genetic polymorphisms or cellmediated modifications of the genetic material. Furthermore, the DNA sequence of a B lymphocyte antigen can be modified by genetic techniques to produce proteins or peptides with altered amino acid sequences. Such sequences are considered within the scope of the present invention, where the expressed peptide is capable of either inducing or inhibiting activated T cell mediated immune responses and immune function.

SA number of processes can be used to generate equivalents or fragments of an isolated I DNA sequence. Small subregions or fragments of the nucleic acid encoding the"B7-2 protein, for example 1-30 bases in length, can be prepared by standard, synthetic organic chemical means- The technique is also useful for preparation of antisense oligonucleotides and primers for use in the generation of larger synthetic fragments of B-2 DNA.

Larger subregions or fragments of the genes encoding B lymphocyte antigens can be expressed as peptides by synthesizing the relevant piece of DNA using the polymerase chain reaction (PCR) (Sambrook. Fritsch and Maniatis. 2 Molecular C!oning: A Laborarory Manual. Cold Spring Harbor, (1989)). and ligating the thus obtained DNA into an appropriate expression vector. Using PCR. specific sequences of the cloned double stranded DNA are generated. cloned into an expression vector, and then assayed for CTLA4/CD28 binding activity. For example, to express a secreted (soluble) form of the human B7-2 protein, using PCR. a DNA can be synthesized which does not encode the transmembrane and cytopiasmic regions of the protein. This DNA molecule can be ligated into an appropriate expression vector and introduced into a host cell such as CHO. where the B -2 protein fragment is synthesized and secreted. The B7-2 protein fragment can then readily be obtained from the culture media.

In another embodiment. mutations can be introduced into a DNA by any one of a number of methods. including those for producing simple deletions or inserions. systematic deletions, insertions or substitutions ofclusters of bases or substitutions of single bases, to generate variants or modified equivalents of B lymphocyte antigen DNA. For example.

chanes n the human B7-2 cDNA sequence shown in Figure 8 (SEQ ID NO:l) or murne B7-2 cDNA sequence sihwn in Figure 14 (SEQ ID NO-:2 such as amino acid substitutions or deletions are bre'rrao l obtained by site-directed mutagenesis. Site directed mutagcnesis systems are well known in the art. Protocols and reagents can c obtained commercially firom Amersham intenational PLC. Amersham.

U.K.

I

I I I I

I

Peptides having an activity of a novel B lymphocyte antigen, the ability to bind to the natural ligand(s) ofa B lymphocyte antigen on T cells and either stimulate (amplify) or inhibit (block) activated T cell mediated immune responses, as evidenced by, for example, cytokine production and/or T cell proliferation by T cells that have received a primary activation signal are considered within the scope of the invention. More specifically, peptides that bind to T lymphocytes, for example CD28 cells, may be capable of delivering a costimulatory signal to the T lymphocytes, which, when transmitted in the presence of antigen and class II MHC, or other material capable of transmitting a primary signal to the T cell, results in activation ofcytokine genes within the T cell. Alternatively, such a peptide can be used in conjunction with class I MHC to thereby activate CD8' cvtolvtic T cells. In addition, soluble, monomerib forms of the B7-2 protein, may retain the ability to bind to their natural ligand(s) on CD28- T cells but, perhaps because of insufficient cross-linking with the ligand, fail to deliver the secondary signal essential for enhanced cytokine production and cell division. Such peptides, which provide a means to induce a state of anergy or tolerance in the cells, are also considered within the scope of the invention.

Screening the peptides for those which retain a characteristic B lymphocyte antigen activity as described herein can be accomplished using one or more of several different assays. For example, the peptides can be screened for specific reactivity with an anti-B7-2 monoclonal antibody reactive with cell surface B 7 -2 or with a fusion protein, such as 2. CTLA4Ig or CD28Ig. Specifically, appropriate cells, such as COS cells, can be transfected with a B7-2 DNA encoding a peptide and then analyzed for cell surface phenotype by indirect immunofluorescence and flow cytometry to determine whether the peptide has B7-2 activity.

Cell surface expression of the transfected cells is evaluated using a monoclonal antibody specifically reactive with cell surface B7-2 or with a CTLA4Ig or CD281g fusion protein.

Production of secreted forms of B7-2 is evaluated using anti-B7-2 monoclonal antibody or C TLA4Ig or CD28 fusion protein for immunoprecipitation.

Other, more preferred, assays take advantage of the functional characteristics of the B7-2 antigen. As previously set forth, the ability of T cells to synthesize cvtokines depends not only on occupancy or cross-linking of the T cell receptor for antigen (the "primary activation signal" provided by. for example anti-CD3. or phorbol ester to produce an "activated T cell"), but also on the induction of a costimulator- signal, in this case. by interaction with a B iymphocyte antigen, such as B7-2. B7-1 or B7-3. The binding of B7-2 to its natural ligand(s) on, for example. CD28- T cells, has the effect of transmitting a signal to the T cell that induces the production of increased levels ofcytokines. articularly of interleukin-2. which in turn stimulates the proliferation of the T lymphocytes. Other assays for B7-2 function thus involve assaying for the synthesis ofcytokines. such as interleukin-2.

I

I 1

I

-28interleukin-4 or other known or unknown novel cytokines. and/or assaying for T cell proliferation by CD28 T cells which have received a primary activation signal.

In vitro, T cells can be provided with a first or primary activation signal by anti-T3 monoclonal antibody anti-CD3) or phorbol ester or, more preferably, by antigen in association with class II MHC. T cells which have received a primary activation signal are referred to herein as activated T cells. B7-2 function is assayed by adding a source of B7-2 cells expressing a peptide having B7-2 activity or a secreted form of B7-2) and a primary activation signal such as antigen in association with Class II MHC to a T cell culture and assaying the culture supernatant for interleukin- 2 gamma interferon, or other known or unknown cytokine. For example, any one of several conventional assays for interleukin-2 can be employed, such as je assay described in Proc. Natl. Acad Sci. USA. 86:1333 (1989) the pertinent portions of which are incorporated herein by reference. A kit for an assay for the production of interferon is also available from Genzyme Corporation (Canbtidge,

MA.).

S T cell proliferation can also be measured as described in the Examples below. Peptides that retain the characteristics of the B7-2 antigen as described herein may result in increased per cell production of cvtokines. such as IL-2, by T cells and may also result in enhanced T cell proliferation when compared to a negative control in which a costimulatory signal is lacking.

The same basic functional assays can also be used to screen for peptides having B7-2 activity, but which lack the ability to deliver a costimulatory signal, but in the case of such peptides, addition of the B7-2 protein will not result in a marked increase in proliferation or cvtokine secretion by the T cells. The ability of such proteins to inhibit or completely block S the normal B7-2 costimulatory signal and induce a state of anergy can be determined using 4: subsequent atempts at stimulation of the T cells with antigen presenting cells that express cell surface B7-2 and present antigen. If the T cells are unresponsive to the subsequent activation attempts. as determined by IL-2 synthesis and T cell proliferation, a state of anerv has been induced. See. Gimmi. C.D. et al. (1993) Proc. Nad. Acad. Sc:. USA 90. 6586- 6590; and Schwartz (1990) Science, 248. 1349-1356, for assay systems that can used as the basis for an assay in accordance with the present invention.

It is possible to modify the structure of a peptide having the activity of a novel B lymphocyte antigen for such purposes as increasing solubility. enhancing therapeutic or prophylactic efficacy, or stability shelf life ex viv and resistance to proteolytic dearadation in vio). Such modified peptides are considered functional equivalents of the B lvmohocvte antiens as defined herein. For example. a peptide having B7- activity can be modified so that it maintains the ability to co-stimulate T cell proliferation and'or produce cvtokines. Those residues show-n to be essential to interact with the CTLA4-,CD2S receptors on T cells can be modified by replacina the essential amino acid with another. preterably similar amino acid residue a conservative substitution) whose presence is shown to enhance.

I 1 1 I I -29diminish, but not eliminate, or not effect receptor interaction. In addition, those amino acid residues which are not essential for receptor interaction can be modified by being replaced by another amino acid whose incorporation may enhance, diminish, or not effect reactivity.

Another example of modification of a peptide having the activity of a novel B lymphocyte antigen is substitution of cysteine residues preferably with alanine, serine, threonine, leucine or glutamic acid residues to minimize dimerization via disulfide linkages.

In addition, amino acid side chains of a peptide having B7-2 activity can be chemically modified. Another modification is cyclization of the peptide.

In order to enhance stability and/or reactivity, peptides having B7-2 activity can be modified to incorporate one or more polymorphisms in the amino acid sequence of the antigen resulting from any nitural allelic variation. Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce a modified protein within the scope of this invention. Furthermore, the peptides can be rmodified using 18 0 polyethylene glycol (PEG) according to the method of A. Sehon and co-workers (Wie et al..

supra) to produce a peptide conjugated with PEG. In addition. PEG can be added during chemical synthesis of the peptide. Other modifications of the peptides include reduction/alkylation (Tan- in: Methods of Protein Microcharacterization. J. E. Silver ed., Humana Press, Clifton NJ 155-194 (1986)); acylation (Tarr, supra); chemical coupling to an appropriate carrier (Mishell and Shiigi. eds, Selected Methods in Cellular Immunoiogy, WH Freeman, San Francisco, CA (1980), U.S. Patent 4,939.239; or mild formalin treatment (Marsh (1971), Int. Arch. ofAllergy and Appl. Immunol. 41:199-215).

To facilitate purification and potentially increase solubility of a peptide. it is possible to add an amino acid fusion moiety to the protein backbone. For example, hexa-histidine can be added to the peptide for purification by immobilized metal ion affinity chromatography (Hochuli, E. et a, (1988) Bio/Technolog' 6i:1321-1325). In addition, to facilitate isolation of a 94 a B lymphocyte antigen free of irrelevant sequences, specific endoprotease cleavage sites can be introduced between the sequences ofa fusion moiety and the peptide. It may be necessary to increase the solubility of a peptide by adding functional groups to the peptide, or by omitting hydrophobic regions of the peptide.

VIi. Uses of Nucleic Acid Sequences Encoding B Lymphncyte Antigens and Penoides Having B7-2 Activity A. Molecular Probes The nucleic acids of this invention are useful diagnostically. for tracking the progress of disease. by measuring the activation status of B vlmphocvtes in biological samples or for assaving the effect of a molecule on the expresssion of'a B iympnocyte antigen te.g..

I B I I II LE I I a detecting cellular mRNA levels). In accordance with these diagnostic assays, the nucleic acid sequences are labeled with a detectable marker, a radioactive, fluorescent, or biotinylated marker and used in a conventional dot blot or Northern hybridization procedure to probe mRNA molecules of total or poly(A+) RNAs from a biological sample.

A i v d t The peptides and fusion proteins produced from the nucleic acid molecules of the present invention can also be used to produce antibodies specifically reactive with B lymphocyte antigens. For example, by using a full-length B7-2 protein, or a peptide fragment thereof, having an amino acid sequence based on the predicted amino acid sequence of B7-2.

anti-proteinianti-peptide polclonal antisera or monoclonal antibodies can be made using standard methods. A mammal, a mouse, hamster, or rabbit) can be immunized with an S immunogenic form of the protein or peptide which elicits an antibody response ifr the S mammal. The immunogen can be, for example, a recombinant B7-2 protein. or fragment thereof, a synthetic peptide fragment or a cell that expresses a B lymphocyte antigen on its surface. The cell can be for example, a splenic B cell or a cell transfected with a nucleic acid encoding a B lymphoc:te antigen of the invention a B7-2 cDNA) such that the B lymphocyte antigen is expressed on the cell surface. The immunogen can be modified to increase its immunogenicity. For example, techniques for conferring immunogenicity on a 20 peptide include conjugation to carriers or other techniques well known in the art. For example, the peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies.

Following immunization, antisera can be obtained and. if desired, polyclonal antibodies isolated from the sera. To produce monoclonal antibodies. antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused with myeloma cells bv standard somatic cell fusion procedures thus immortalizing these cells and yielding hvbridoma cells. Such techniques are well known in the art. For example, the hybridoma technicue oriinallv developed by Kohler and Milstein (.Vanre (1 975) 256:495-497) as well as other techniques such as the human B-cell hybridoma technique (Kozbar et al.. Immunol.

Today (1983) 1 the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Mo:ociona i .4::ribodies in Cancer Tiera.' 1985) Alien R. Bliss. Inc.. pages 77- 96). and screening of combinatoriai antibody libraries (Huse et ai.. Sience (119S9) 246:12751.

Hvbridoma cells can be screened immunochemically for production of antibodies specifically reactive with [he peptide and monoclonal antibodies isolated.

'I i I II a 11 I The term antibody as used berein is intended to include fr-agments thereof which ar also specifically reactive with a peptide having the activity of a novel B lymphocyte antigen or fusion protein as described herein. Antibodies can be &agrnerted using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(abD2 fragments can be generated by treating antibody with pepsin. The resulting F(abD-; fragmnent can be amed to reduct: disulfide bridges to produce Fab t fragments. T1he antibody of the present invention is further intended to include bispecific and chimeric molecules having an anti-B lymphocyte antigen 137-2, 137-3) portion- Particularly preferred antibodies are anti-human B7-Z monoclonal antibodies produced by hybridomas IIA3.1F9, HA5.2B7 and HF2.3DJ1. The preparation and characterization of these antibodies is described in detail in Example 8. Monoclonal antibody HA3.1F9 was determined to be of the IgGI isotype; monoclonlal antibody HA5.2B7 was determined to be of the IgGab isotype; and monoclonal antibody HFZ.3D1 :s was determined to be of the IgG2a isotype. Hybridotna cells were deposited with the American Type culture collection, which meets the requirements of the Budapest Treaty, on July 19, 1994 as ATCC Accession No. HB11688 (hybridoma HAMMF9, ATCC Accession o No. 11B11687 (HA5.2B7] and ATCC Accession No. HB116 (HF2.3D1].

'Whe n antibodies produced in non-human subjects are used therapeutically in humans, they are recognized to varying degrezs as foreign and an immune res-ponse may be generated in the patient One approaca for minimiaing or eliminating this problerm. which is preferable *to general irnmunosuvoression, is to prodiuce chimeric antibody derv;atives. antibody :*molecules that combine a non-human animal variable rezion and a hum an constant rezion.

Chimeric antibody mnoiecles can include, for example, the antigen binding domain from an 2_1 antibody of a mouse. rat, or other species. with human constLant regions. A varnety 0-1 *:approaches for making chirneric antibodies have beeni descr1ibed and can be .se-d to inaic chimeric antibodies containing theirMuncelobulin variable region which -Cconrniztes the gene product of-the novei B iymphocywc antizens of Mhe inve:1 ion. Sesz. for examnple.

5 Mol ison et al., Proc- Xar!. A cad ScZ -S-4 81:6851 (1985); Takeda ez al. .Nature SI34 (1985), Cabilly e.:al, U.S. Patent No. 1,816,567; Boss et~al. ?aten;Nc. 43637 Tana-auchi etal., European Parent Puhiicatiot E 171496. European Patent Publcatic!'.

0173494, United Kinzdom Patent[ CD 21 1096B. It is expec-.ed that stuch chrni ttcdies would be less irnmumocanIc in a numnan subject than th-e cocspor&i.-E rc1mr anitibody.

~~~For hua hrc':cpuroses. ite mrlocional or'Z!Z' cnnecan=odiCsS iec:ncailv reactive With a cezitlae aat'th Ecvt of a B ivnoic:'e gn s252 a be fu-.Iier hnu-anr_---_ ucn '=ran vanao-"Y'O "zgon M 2s. :2'.'ntCn as t: -32variable regions, especially the conserved framework regions of L~le antigtia-bindine domain.

are of hiuman origin and only the hypervanable regions are of non-human origtin. General reviews of "humanized" chimeric antibodies are provided by Mforrison. S. L. (1985) Scl~ence 202-1207 and by Oi et al. (1986) Bio Techniques 4:214. Such altercd initmunoglobulin molecules may be made by any of several techniques known in the art. Teng et al., Proc. XatL Acad. Sci. US1.A., 80:7308-73 12 (1983); Kozbor et al., Immunology. Today, 4:7279 (19835); Olsson e, al., Werht EnzvymoL., 92:3-16 (1982)), and are preferably made according to the teachings of PCT Publication W092.106 193 or EP 0239400. Humanized antibodies can be commercially produced by. for example. Scotgeni Limitedi 2 Ho lly Road.

Twickenham. Mididlesex. Great Britain. Suitable "humanized" antibodies can be alternatively produced by COR or CEA substitution (see U.S. Patent 5.225.539 to Winter; ::Jones et al. (1986) 'iature 12j:55-7- 5 -1 5 Verhoeyan et al. (1988) Scienco 2 39-15 34; an-rd 0Beidler et al. (19S 3) J1 Imrnunol. .1 :405 3 4060). Humanized anil omeis wnz chilnave ~*reduced immunogenicitY are preferred for immunotherapy in human subjecrs.

mmunothrpy with a humanized antibodyv will likely reduce the nesst or an'.' concomitant iinmuriosuppression and may result in increased long term effectiveniess for the treatment of chronic disease situations or situations req~uiring repatec artibhodv treatments.

As an alte-ntive to nuimanizing a monoclonal antibody from a mouse or other species, a human monoclonal antibody dircted against a human protein can be generated. I ransgentc *.2)mice- carrying human antibody repertLoires have been created which can be imamuni zen with a human B lvmvhoc-'te anruaen. such as B7-2. Spienocytes from these immunized transaenic mice- can then be used to cre.ate hybridomas that secrete human monoclonial antibodies specifically reactive with a human B lypoct anien (see, Wood t al. PCT *..:pubuication WO 91100906. Kuche.riapati et al. PCT publication WVO 91,10741i: Lon'berg et al.

publication WO 9110391M; Kay l. PCT publication 92/039 17: Lunbera2. N. e: ai.

(1994) Naturel3:856-85 9 Green. L.L. etal. (1994) :Vature Gene!. 71-1 lr~~iSL et eaL (1994) Proc. Narl. Acad. Sc!. US4 Lj:6851-6855, Bruggmane, alf. 119 2) Yea) Immunnol 7:33 -40: Tu ail!on tte al. (199; 3) FPYAS 90:3 72 0-3724: and B r- ee7--m et 1. c1991) Monoclonal antibod'. comccosittons of the invention can aisobne :roiucec tne methods well known to these skilile' ir. the artL of recombinant DNA r cnnnioO'. An atraIve method. reere o as th combiatorial antiod dna .u a ne developed to e' 'an:ae andt t trauvrtics having a 1-:t:-cn ac~w~: and can, be UtiliZesd to roCIUC :onoc:onal anLOcOies that binid a B anl ign 01 th e 3 in-vertton (For desc:rwtic'ns ol corac-z-toriai a-ntibody adisplay setegSa-r t11 P.VAS !:57 28: Huse eal. 1 939 SL:;enc:=! 26: 12.7 and Oriandi e, 2J. 1v8 86: 3 8i After :mmtiZ fl an 2r'm2i with a B l,;mpnhocyte antigen. d eeor 1 1. L I I I -33of the resulting B-cell pool is cloned. M1ethods are generally known for directly obtaining the DNA sequence of the variable regions of a diverse population of immunoglobulin molecules by using a mixture of oligomer primers and PCR. For instance, mixed oligonucleotide primers corresponding to the 5' leader (signal peptide) sequences and/or framework I (FRI) sequences, as well as primer to a conserved 3' constant region primer can be used for PCR amplification of the heavy and light chain variable regions from a number of murinme antibodies (Larricket al. (1991) Biorechniques l:152-156). A similar strategy can also been used to amplify human heavy and light chain variable regions from human antibodies (Larrick et al. (1991) Methods: Companion to Methods in Enzymolo, 2:106-110).

In an illustrative embodiment. RNA is isolated from activated B cells of, for example, peripheral blood cells, bone marrow, or spleen preparations. using standard protocols (e.g.

Patent No. 4,683 202; Orlandi, et al. PNAS (1989) 86:3833-3837; Sastrv et at., PNAS S(1989)-86:5728-5732; and. Huse et al. (1989) Science 246:1275-1281.) First-strahid cDNA is synthesized using primers specific for the constant region of the heavy chain(s) and each of the ic and 1. light chains, as well as primers for the signal sequence. Using variable region *PCR primers, the variable regions of both heavy and light chains are amplified, each alone or in combinantion, and ligated into appropriate vectors for further manipulation in generating the display packages. Oligonucleotide primers useful in amplification protocols may be unique or degenerate or incorporate inosine at degenerate positions. Restriction endonuclease recognition sequences may also be incorporated into the primers to allow for the cloning of the amplified fragment into a vector in a predetermined reading frame for expression.

The V-gene library cloned from the immunization-derived antibody repertoire can be expressed by a population of display packages. preferably derived from filamentous phage. to form an antibody display library. Ideally, the display package comprises a system that allows the sampling of very large diverse antibody display libraries, rapid sorting after each affinity seoaration round, and easy isolation of the antibody gene from purified display packages. In addition to commercially available kits for generating phage display libraries the Pharmacia Recombinant Phage Antibody System. catalog no. 27-9400-01 i and the Stratagene Sur pTZ4PTM phage display kit. catalog no 24061. examples of methods and reagents particularly amenable for use in generating a diverse antibody displa. library can be tound in.

for example, Ladner et al. U.S. Patent No. 5.223.409; Kang et al. Intemnational Publication No WO 92118619: Dower et al. Intermational Publication No. WO 911 7271: Winter et a! international Publication WO 922079 1: Markland eci al. International Publication No. WO 9115679: Breiling et ai Interntional Publication WO 930 1288: McCaffe:r et aL.

Intemrnational Publication No. WO 92.01047: Garrard et al. International Publication No. WO 91'09690: Ladner et al. International Publication No. WO 90/02809: Fuchs e: a. (I 90 ii Bic Tec'noiou 9: 370-1372 Hay et al. 11992) h:n? Aio -v-ran: s i -85: Huse e II- I- I I -34- (1989) Science 2 6:l275-1281; Griffths et al. (1993) EM-BOJI1:725-731; Hawkins etaL (1992)J JVol BioI226889-896; Clackson et al. (1991). Nature j--)624-628; Gram et at, (1992) PiVASU:3S76-3580; Garrad et al. (1991) BiolTechnolm.r'2:1373-1377; Hoogenboom et al. (1991),Nuc.Acid Res 19:4133-4137; and Barbas et al. (199 1) PlAAS J:7978-7992.

In certain embodiments, the V region domains of heavy and light chains can be expressed on the sa-me: polypeptide, joined by a flexible linker to form a single-chain Fv frag-ment, and the scFV gzene subsequently cloned into the desired expression vector or phage genome. As generally described in McCafferty et al., Naiure (1990) 3-48:552-554. complete VH and VL domains of an antibodyjoined by a flexible (Glya-Ser)3 linker can be used to produce a single chain antibody which can render the disiplay package scparable based on antigen affinity. isolated sCf V antibodies immunoreactive with a peptide having acti-vity of a B lymphocyte antigen can subsequently he formulated into a pharrnacr uticai preparation for use in the subject, method.

Oncze dis-olayed on the surface of a display package filamentous phage). the 5 antibody libran, is screened wiffh a B lymphocyte antigen protein, or peplic Iragment heref. t ideni~ ad islatepackages that express an antibody havn sci lcit for theB lymphocyte antigen. Nucleic acid encoding the selected antibodv can be recovered from the display package from the phaq.e genome) and subcioned into other expression vectors by standard recombinant DNA techniques.

The antibodies of the current invention can be used therapeutically to inhibit T cell activation through blockina receptor:ilgand interactions necessary for costimulation of the T cell. These so-called "blocking antibodies" can be identified by their ability to Inhibit T cell proliferation andor cytokine production when added to an in vitro costimulation assay as *~.:described herein. The abili of blockin2 antibodies to inhibit T cell functions may resuilt in anidior tolerarnce when these antibodies are adrernistere nvivo.

0 Protein Puritle2tion The polvcionai or rronoclonai antibodies ofthe current invention, such as an aritibody; seificaly recive wit a ecombian osyheipeptide having B-7-2 activity, or 37-3 activity can also be used to isoiate The native B lymphocyte antigen from ceils. For example.

antibodies reactive with the neatude can he used to isolate the niaturallv-occurrflg or native formr of from acti-vaite: 3) vmchocvtIes by imnnainycroaorpy oaddition.

tnative -om o7 *73cnb solate from B cells by immunioaffit'i Chromatogrr with monoclonal anilbodyv BB- I.

3F I. I I i I I D. Other Therapeutic Reagents The nucleic acid sequences and novel B lymphocyte antigens described herein can be used in the development of therapeutic reagents having the ability to either upregulate amplify) or downregulate suppress or tolerize) T cell mediated immune responses. For example, peptides having B7-2 activity, including soluble, monomeric forms of the B7-2 antigen or a B7-2 fusion protein, B7-2!g, and anti-B7-2 antibodies that fail to deliver a costimulatory signal to T cells that have received a primary activation signal, can be used to block the B7-2 ligand(s) on T cells and thereby provide a specific means by which to cause immunosuppression and/or induce tolerance in a subject. Such blocking or inhibitory forms ofB lymphocyte antigens and fusion proteins and blocking antibodies can be identified by their ability to inhibit T cell proliferation and/or cytokine production when added to an in vitro costimulation assay as previously described herein. In contrast to the monomeric form.

stimulatorv forms of B7-2, such as an intact cell surface B7-2, retain the abilitv totransmit the costimulatory signal to the T cells, resulting in an increased secretion of cytokines when compared to activated T cells that have not received the secondary signal.

In addition, fusion proteins comprising a first peptide having an activity of B7-2 fused to a second peptide having an activity of another B lymphocyte antigen B7-1) can be used to modify T cell mediated immune responses. Alternatively, two separate peptides having an activity of B lymphocyte antigens. for example, B7-2 and B7-1. or a combination of blocking antibodies anti-B7-2 and anti-B7-1 monoclonal antibodies) can be combined as a single composition or administered separately (simultaneously or S sequentially), to upregulate or downregulate T cell mediated immune responses in a subiect.

Furthermore, a therapeutically active amount of one or more peptides having B7-2 activity and or B7-i activity can be used in conjunction with other immunomodulating reagents to influence immune responses. Examples of other immunomodulating reagents include blocking antibodies, against CD28 or CTLA4, against other T ceil markers or against S cytokines, fusion proteins, CTLA4Ig, or immunosuppressive drugs. cyclosporine A or FK506.

The peptides produced from the nucleic acid molecules of the present invention may also be useful in the construction of therapeutic agents which block T cell function b' destruction of the T ceil. For example, as described, secreted forms ofa B lymhnocyte antigen can be constructed by standard genetic engineering techniques. By linking a soluble form of B7-I, B7-2 or B7-3 Eo a toxin such as ricin. an agent capable oforevenEin T ceii activation can be made. Infusion of one or a combination ofimmunotoxins. B7-2-ricin.

B7-1-ricin, into a patient may result in the death ofT cells particularly of ictivaied T ce!is that express higher amounts of CD2S and CTLA4. Soluble forms of BT-2 in a monovalent I I I 1 .1 t~ U l I E form alone may be useful in blockinQ 137-2 function, as described above. in which case a carrier molecule may also be employed.

Another method of preventing the function of a B lymphocyte antigen is through the use of an antisense or triplex oligaonucleotide. For example, an oligonucleotide complementary to the area around the 137-1, B7-2 or B7-3 translation initiation site, for B7-1, TGGCCCATGGCTTCAGA. (SEQ ID NO:20) nucleotides 326-309 and for B7-2, GCCAAAATXGGATCCCCA (SEQ ID NO.2 can be synthesized. One or more antisense oliaonucleotides can be added to cell media, typically at 200. .giml- or administered to a patient to prevent the synthesis of B7-1, 137-2 andior B7-3. The anti15e.iss oligonucleoride is 0 taken up by cells and hybridizes to the appropriate B lymphocyte antigcen mR-NA to prevent translation. Alktenativ. an oigonucleotide which binds double-stranded DNA to form a triplex construct to prevent DNA unwinding and transcription can be usd. AIs aresult of either. synthesis of one or more B lvmp~hocyte antigens is blocked.

e.

8* p

C.

C

eCCE CSSe 1

*C

CC

C.

C C C4 '15 F_ Therapeutic I es by Dowreculation of Immune ResponSes, Given the structure and function of the novel B lymphocyte anigens dicodheen it is possible to do-woregulate the function of a B lympohocyte antigen, and thereby doweuate immune responses. in a number of ways. Dovqregulation may be in the form of inhibitine or blocking an immune response already in progress or may involve p)reventin 20 the induction of an imimune response. The functions of activated T cells may be inhibited by suppressing I cell responses or by inducing specific tolerance in T cells, or both.

Immunosuppression of T cell responses is generally an active. non-antigen-Specific. process which reouires continuous exposure of the T cells to the suppressive agenit. Tolerance-- which.

S invoives Inducing rion-resoonsivefless or aneRgy in T cells, is distingushable from Simmunosuppresiofi in that it is generally antigen-specific. and persists after exposure to the tolerizinq agent has ceased. Operationally. tolerance can be demonstrated by the lack of a T cellI resnonsc unon reexuosure to sneeitic antigen in the absence of the tolerizing agent.

Dowaregulatifle or preventig one- or more B lymphioc,.te antigen functions. preventing hiigh level lymonhokine syn1thesis by activated T cells, will be useful in siLuattons1 of tissue. skin and orgyan trahsPlantatiot 'and in graft-versus-host disease (GVHD). For exampile, biockage of T cell function should result in reduced tissue destruction in tisstue transolantation. Typically, in tissue trarisplants. feiection of the transplant is Initiated thr'ough its cecogninion as foreign by T cells, followed by an immune! re-action thiat destroys the transplant. The administration of a molecule .vnIcn :ihibits or blocks Interaction of a B 7 y.mnhocyze anien with its natural IgandflO( on imm ''une celIls (suchn as a soluble. rnonorc Corm of a pepridE hav.ing 137-2 activity aione or in coniunction with amonomrrc: torm of a ocottee naving an acrivtty- or another B 1I'inoo-tc :e nt;ueieC. T- or biocking= aM I I I

I

Ii *4 *4 antibody), prior to transplantation can lead to the binding of the molecule to the natural ligand(s) on the irrmune Cells without transmitting the corresponding costi mulatory signal.

Blocking B lymphocyte antigen function in this manner Prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an immunosuppressant. tMoreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymohocyte antizen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To acheive sufficient irnmunosuppression or tolerance in a subject. it may also be necessary to block the function of a combination of B lymphocyte antigens. For example, it may be desirable to block the function of 137-2 and B-l. 137-2 and 137-3 137-1 and 137-3 or 137-2, 137-1 and B37-3 by ad ministering a soluble rdi-rn of a combination of peptides hnaving an activity of each of these antigens or a blocking antibody (separately or together in a sinz-!e composition) prior to *;transplantation. Alternativ. inhibitor forms of B lymp hocvte andierns can be used with other suppressive agents such as blocking antibodies against other T cell markers or- against ~cyto'kines. other fusion proteins. CTLA4Ig. or immunosunnressive drugs- The efficacy of oarticular blocking reagents in preventin2 organ transolant rejection or GVHD can be assessed-using animal models that are predictive or- efficacy in humans. The functionaly importa nt aspects of B-7-1 are conserved structurally beivween species and it is therefore likely that other B lymphocyte antigens can function across snecies. therecby -'29 allowing use of me agents composed of human proteins in animal system-s. Examples of ':.appropriate systems which can be used include ailocreneic cardiac 2rafits in rats and xenovenelc pancreatic islet cell grafts in mice. both of which have been used t-o examine -dhe immunosuppressive effects of CTLA-4Ig fusion proteins in vivo -as cscrioeo tnLnehw aL. Science, 2L:- 789-792 ("1092) and Turka et: al.. Proc. N'at. .4Icaar LUSA, 81: 11 i-- 11105 (1992). In addition. -innc models of GVHD f see- Paul ed.. FuniamaenraZ" o:*Imrnunoioc-t' Raven Press. New.k York. 1989. pp. 346-8A47) can be usedi to determnine the effect of bloclking B lyrrphocyte antigen function in vivo on the deveicoment oftrhat disease.

Blocking B lymnphocyte antigen function. by use of a oeotide having B7activity alone or in combiniation with a reptide havit3-I-P activity andL or a oe~iae iiaying 137-3 activity. may also be ther-apeutically useful for treatine autoimnmunc,- diseases. M-any autoirnune disorders are the result of inappropriate activation of T 1c;!k that are reactive against se-7tiSsue aae wbichipromote the production of cyiokines and autoanilbcodies involved in the oazhoiocv of thc diseases. Preventinaz the activation oi uioreactiVe T cells may reduce oreiiat disease svm-otoms. Administration ofr-aet which lc cosimulation ofT ceils by Sr- IM ieceutor:ligand intieractions of B lvmphocyt e antigens can be used to irnibit T cell activationi and prevent proacuon Of autoan:ttooes or Tcz2lderived cvtokines wh1i may11 be invoiveda in the dise-ase process- Additionally. hiockine-

II

PIi reagents may induct antijen-specific tolerance of auioreactive T cells which could lead to long-term relief from the disease. The etffcacv of blocking reagents in preventing or alleviating autoirnrnune disorders can be determined usingz a number of well-characterized animral models of human autoinrune diseases. Examples include murine experlimental auroirr-nmune encephalitis, systemi c lupus erythxnatosis in M1vRLUlpr/i'pr mice or NZB hybrid mice. murine autoimmune- collagen arthritis, diabetes meltlitus in NOD mice and BB rats. and *munine exper-imentai to vasthenia gravis (see Paul ed.. Fundamental JmnmunoioT. Raven Press, New York. 1989, pp. 840-856)_ The IaE antibody response in atopic allergy is highly T cell dependent and- thus, inhibition of B ivmpnocvte antigen induced T cell activntion may he userul theraoeuticailv -in the- treauLe at of allergy and allergic reactions. An" inhibitor';- form of 13. 7-2 protein, such as a penrtide having 37-2 activity alone or in combination with a peptidie having the activ of another B lymphocyte antigen. such as B 7-l1. can e administered to an allerEic subiec: to Inhibit T cell mediated aller2ic responses in the ~S subiect. Inhibition of'B !lymmhocvte antigen costimulation ofTlls yb accomipagnied by exposure to allergen in conjunction with appirooriate MHC molecules.

Allergic reactions may be systemic or local in nature, depending on the route of enitr of the allergan and the partem 1 of deposition of IRE on mast celIls or basoonis. Thus. it may be necessarv to iohibit T cell mediared allergic responses locally or syster-nically by 20 proper administration of an inhibito-n- fornofB1,7-2 protein.

a In-bition of T co!T activation through blockage of B lymohocyte antig-en Function may also be important therapeutical 1 in viral infections of T cells. For example. in the accuired immune aer-iciency syndrome (AIDS), viral replicalion is stimulated by T cell activation. Blocking B- function could lead to a lower lelof v-ita feication and thereby amnejiorare. the cou~rse of .AIDS. In addition. it mnay also be ecsa-to block the functicn of a CO mbination of "B lymnphocyt e antigens ie_. 137-l. B7- ad Surprisingly.

HTL V-I infected Tceiis express i and 137-2. This expressionrmayb im unortant in the gro-wth of 'HTL V'-I infcz2 cells and the blockage of B- function toe:neJmr with therunction of BT2andiYor B 7-3 may. slow the gzrowtLh of HTLV-1 induced ie ukemias.

Aftenatively. stimulation uof vi ai re-plication T cell activation may be Induced contact wijth a s-Li-uiator':- form of 37-20,roitein. for such purposes asaeera-Lm-1 -t~rovirUses various isoiate!si in sz:fflcient quantities for isoiatation and use.

F. Themane-uic I se< Ivy imm~tia~~ 0 ttune Responises Iiereauniamion of a B Ivmchoc'.te antigen -LnctLon- as a mezans ;n t um-,~!fO rl~iil responses. ma%- aiso be usen--ii in tnUap.Lreguiattfo Ot!.r~ ripne mYc n the 1Mon G i raIn c~ an e:smgmmm reoneo tcinaniYC mu ~noise- For Ip 1 -1 1 I 191 example, enhancing an immune response through stil .l.aring B lymphocyte atigen function may be usefu in cases of viral infection. Viral infections are cleare:d primarily by cytolytic T cells. In accordance with the present invention, it is believed that 137-2 -and thus, B7-1 and 137-3 w ith their natural lizand(s) on T. -iayresult in an increase in the cvtolvic activity of at least some T cells- It is also belie, 9* 7-2, R7-1, and 117-3 are involved in the initial activation and genieration of CD8+' ;-toxtc T cells. The addition of a solubleiuptde haviniz B7-2 activity. alone, or in combination with a pcptide having the activity of ai~other B lymphocyt-e antig:en, in a muiti-valent form. to simrulate T cell activir, througzh the costimulation pathway would thus be therapeutically usefill in situazionr where more rapid-or thorougzh clearance of virus would he beneficial. These wou'idinclu,_' viial skin diseases *such as Homues or shingles. f-h which cases the multi-valent sulT.' 1-tide having 137-2 or combination Of Such peptide arid/or a peptide havin~z BT i c:~vvtyand/or a Deptide having B7-3 activity is delivered tooicallV to the skin. Er: _i:o n. sysRCtemic vura _disa such as inrluen,-i the common cold, and encephalitis migi: 'dieviaied by the 71Sk administration of stimulator. forms of B lymphocyte antigens systemically.

Alternatively, anti-viral immune responses may be enhanced in an infeced patient by re1moving T cells from the patient. costimuiatinu the T cells -in vitro with viral antigen-pulsed APCs either expressing a pertice having B7-2 activity (alone or in combination with a peptide having B- I activity anidlor a peptide havinY B7- 3 activity) or togethier with a -2D stimulatory form of a soluble neritide having B7-2 activity (alone or in comrbination with a petid havng T-I activ iv. and.Ior a Dentide having Rl7-3 ,actvitv) and reintroducing the in vitro activated T ce!l IntMo the! patient- Ano6ther method o f enhdancing an[;-viral immune resonseswould be to Isolate itfected cells 'from a patient, transfect the, with a niucleic acid :~encoding a p-eotide: having the activity or ,a B lympihocyte anigen as described herein such that the cells exnrcss all Or a nor-,ion olfa 3 lvm[;hoc-yte antigen or. their surfac:2_ oe-, B-7-2 or and reintroduce the transfoctedc "is -nto the patient- The inf'ec-edcells would now be capable of deli1ve,ri -a costumulatorv \-aQnal to- and thereby activate. T cells In Vivo.

Stimulatoirv fiuus oif'r 'vmohocv1re arittgens mav also be used; -roohvlactically i vaccines agaueis .!at -ous pathagns f 1 m 'nn% against ancatnogen- eQ_ a virus, could he 30 induced by vaccinat;my- with. a m v'a rtfil ih a sttmitr amo ap;iehvn B2actpit\ or'c'' etc 'i .tv fB lymphocy-te! ant'i-en in an aoorn t~ adiu'.ar Aiterr'te aIn d%7re'ssion ector which encodes cnsfrbt tiathoqP~n'c antuae OceLLe hav'ingi-.pe activity of-a B lymp-hcyte ariicen. a vacc: f; a virus o Creciz--d to express a nuclei-c a-cid eW1CodiAu a_ '.iral crotIn111 and~ ci nu.4 Bi'o -2 activity as dcscnrec nfrcln. -2an be used fr vac wirt class I N4HC rriteins by. itar -xamole. a cel zrn~ ~'-terav~a 7"B7 activir--and MPIC cases ciiam protemn andL him 4'

'I-I

I I I I I I I j P2 microglobulin may also result in activation of cytolytic CDS+ T cells and provide immunity from viral infection. Pathogens for which vaccines may be useful include hepatitis B, hepatitis C, Epstein-Barr virus, cytomegalovirus, HIV-1, HIV-2, tuberculosis, malaria and schistosomiasis.

In another aspect, a stimulatory form of one or more soluble peptides having an activity ofa B lymphocyte antigen can be administered to a tumor-bearing patient to provide a costimulatory signal to T cells in order to induce anti-tumor immunity.

G. Modification of a Tumor Cell to Express a Costimulatorv Molecule The inability of a tumor cell to trigger a costimulatory signal in T cells may be due to a lack of expression of a cdtimulatory molecule, failure to express a costimulatory molecule even though the tumor cell is capable of expressing such a molecule, insufficient expression of a costimulatory molecule on the tumor cell surface or lack of expression ofari-appropriate costimulatory molecule expression of B7 but not B7-2 and!or B7-3). Thus. according to one aspect of the invention, a tumor cell is modified to express B7-2 and/or B7-3 by transfection of the tumor cell with a nucleic acid encoding B7-2 and/or B7-3 in a form suitable for expression of B7-2 and/or B7-3 on the tumor cell surface. Alternatively, the tumor cell is modified by contact with an agent which induces or increases expression of B7- 2 and/or B7-3 on the tumor cell surface. In yet another embodiment. B7-2 and/or B7-3 is coupled to the surface of the tumor cell to produce a modified tumor cell. These and other emodiments are described in further detail in the following subsections.

a Transfection of a Tumor Cell with a Nucleic Acid Encoding a Costimulatorv Molecule Tumor cells can be modified ex vivo to express B7-2 or B7-3. alone or in combination or in combination with B7-1 by transfection of isolated tumor cells with a nucleic acid encoding B7-2 and/or B7-3 and B7-! in a form suitable for expression of the molecule on the surface of the tumor cell. The terms "transfection" or "transfected with" refers to the introduction of e::ogenous nucleic acid into a mammalian cell and encompass a variety of techniques useful for introduction of nucleic acids into mammalian cells including electroporation, caicium-phosphate precipitation. DEAE-dextran treatment. lipofection.

microinjection and infection with viral vectors. Suitable methods for transfecting mammalian cells can be found in Sambrook et al. (Moiecular Clonin: A Laborator: Manual, 2nd Edition. Cold Spring Harbor Laboratory press (1989)) and other laboratory textbooks.

The nucleic acid to be introduced may be. for example. DNA encompassing the genels) encoding B7-2 and.or B7-3. sense strand RNA encoding B7-2 and'or 87-3 or a recombinant -SEE e I I I I I I I -41expression vector containing a cDNA encoding B7-2 and/or B7-3. The nucleotide sequence of a cDNA encoding human B7-2 is shown in the Sequence Listing.

A preferred approach for introducing nucleic acid encoding B7-2 and/or B7-3 into tumor cells is by use of a viral vector containing nucleic acid, e.g. a cDNA. encoding B7-2 and/or B7-3. Examples of viral vectors which can be used include retroviral vectors (Eglitis, et al., Science 230, 1395-1398 (1985); Danos, 0. and Mulligan. Proc. Natl. Acad.

Sci. USA 85, 6460-6464 (1988); Markowitz, et al., J. Virol. 62, 1120-1124 (1988)), adenoviral vectors (Rosenfeld, et al., Cell 68, 143-155 (1992)) and adeno-associated viral vectors (Tratschin, et al., Mol. Cell. Biol. 5, 3251-3260 (1985)). Infection of tumor cells with a viral vector has the advantage that a large proportion of cells will receive nucleic acid, thereby obviating a need for selection of cells which have received nucleic acid, and Smolecules encoded within the viral vector, e.g. by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid.

Alternatively. B7-2 and/or B7-3 can be expressed on a tumor cell using a plasmid expression vector which contains nucleic acid, e.g. a cDNA, encoding B7-2 and/or B7-3.

0* Suitable plasmid expression vectors include CDM8 (Seed, Nature 329. 840 (1987)) and S pMT2PC (Kaufman. et al.. EMBOJ. 6, 187-195 (1987)). Suitable vectors and methods for expressing nucleic acids in host cells, such as tumor cells are described in further detail herein.

When transfection of rumor cells leads to modification of a large proportion of the tumor cells and efficient expression of B7-2 and/or B7-3 on the surface of tumor cells, e.g.

S when using a viral expression vector, tumor cells may be used without further isolation or subcloning. Alternatively. a homogenous population of transfected tumor cells can be prepared by isolating a single transfected tumor cell by limiting dilution cloning followed bv expansion of the single tumor cell into a clonal population of cells by standard techniques.

Induction or Increased Expression of a Costimulatorv Molecule on a Tumor Cell Surface A tumor cell can be modified to trigger a costimulatory signal in T cells by inducing '0 or increasing the level of expression of B7-2 and/or B7-3 on a tumor cell which is capable of expressing B7-2 andior B7-3 but fails to do so or which expresses insufficient amounts ot B7-2 and/or B7-3 to activate T cells. An agent which stimulates expression of B7-2 and/or B7-3 can be used in order to induce or increase expression of B7-2 and/or B7-3 on the tumor cell surface. For examoie, tumor cells can be contacted with the agent in ":ro in a culture medium. The agent which stimulates exaression of B7-2 and/or B7-3 may act. for instance.

by increasing transcriotion of B7-2 and/or B7-3 gene, by increasing transiation of B 7 -2 and/or B7-3 mRNA or by increasine stabiiity or transport of B7-2 andor B^-3 t to he cel I I S Il i surface. For example, it is known that expression of B7 can be upregulated in a cell by a second messenger pathway involving cAMP. Nabavi, et al. Nature 360, 266-268 (1992).

B7-2 and B7-3 may likewise be inducible by cAMP. Thus, a tumor cell can be contacted with an agent, which increases intracellular cAMP levels or which mimics cAMP, such as a cAMP analogue, e.g. dibutyryl cAMP, to stimulate expression of B7-2 and/or B7-3 on the tumor cell surface. It is also known that expression of B7 can be induced on normal resting B cells by crosslinking cell-surface MHC class II molecules on the B cells with an antibody against the MHC class II molecules. Kuolova, et al., J. Exp. Med. 173, 759-762 (1991).

Similarly, B7-2 and B7-3 can be induced on resting B cells by crosslinking cell-surface MHC class II molecules on the B cells. Accordingly, a tumor cell which expresses MHC class II molecules on its surface can be treated with anti-MHC class II antibodies to induce or increase B7-2 and or B7-3 expression on the tumor cell surface. In addition. interleukin-4 (IL-4) which has been found to induce expression of B7-2 on B cells. may be.used to upregulate expression of B7-2 on tumor cells (Stack RM.. et al., J. Cell. Biochern. Suppl 1(18):434(1994).

Another agent which can be used to induce or increase expression of B7-2 and/or B7- 3 on a tumor cell surface is a nucleic acid encoding a transcription factor which upregulates transcription of the gene encoding the costimulatory molecule. This nucleic acid can be transfected into the tumor cell to cause increased transcription of the costimulatory molecule gene, resulting in increased cell-surface levels of the costimulatory molecule.

S(31. Coupling of a Costimulatory Molecule to the Surface of a Tumor Cell In another embodiment, a tumor cell is modified to be capable of triggering a S costimulatory signal in T cells by coupling B7-2 and/or B7-3 to the surface of the tumor cell.

2? For example, B7-2 and/or B7-3 molecules can be obtained using standard recombinant DNA technology and expression systems which allow for production and isolation of the costimulatory molecule(s). Alternatively, B7-2 and/or B7-3 can be isolated from cells which express the costimulatory molecule(s) using standard protein purification techniques. For example, B7-3 protein can be isolated from activated B cells by immunoprecipitation with an anti-B7-3 antibody such as the BB i monoclonal antibody. The isolated costimulatory molecule is then coupled to tie tumor cell. The terms "coupled" or "coupling" refer to a chemical. enzymatic or other means antibody) by which B7-2 and/or B7-3 is linked to a tumor cell such that the costimuiatory molecule is present on the surface of the tumor cell and is capable of triggering a costimulatory signal in T cells. For example. B7-2 and/or B7-3 can be chemically crosslinked to the tumor cell surface using commercially available crosslinking reagents (Pierce. Rockford IL). Another approach to coupling B7-2 and'or B7-3 to a tumor cell is to use a biscecific anibody which binds both the costimulatory molecule and a cell- I

I

L I i I I i i -43surface molecule on the tumor cell. Fragments, mutants or variants ofB7-2 and/or B7-3 which retain the ability to trigger a costimulatory signal in T cells when coupled to the surface of a tumor cell can also be used.

S 5 4 a" e 1 t rv lecule Another aspect of the invention is a tumor cell modified to express multiple costimulatory molecules. The temporal expression of costimulatory molecules on activated B cells is different for B7, B7-2 and B7-3. For example, B7-2 is expressed early following B cell activation, whereas B7-3 is expressed later. The different costimulatory molecules may thus serve distinct functions during the course of an immune response. An effective T cell response may require that t1e T cell receive costimulatory signals from multiple Scostimulatory molecules. Accordingly, the invention encompasses a tumor cell which is modified to express more than one costimulatory molecule. For example, a tumor cell can be modified to express both B7-2 and B7-3. Alternatively, a tumor cell modified to express B7- 5, 2 can be further modified to express B7-1. Similarly, a tumor cell modified to express B7-3 S can be further modified to express B7-1. A tumor cell can also be modified to express B7-1, B7-2 and B7-3. A tumor cell can be modified to express multiple costimulatory molecules B7-1 and B7-2) by any of the techniques described herein.

Before modification, a tumor cell may not express any costimulatory molecules, or S'O. may express certain costimulatory molecules but not others. As described herein, tumor cells can be modified by transfecting the tumor cell with nucleic acid encoding a costimulatory molecule(s), by inducing the expression of a costimulatory molecule(s) or by coupling a costimulatory molecule(s) to the tumor cell. For example, a tumor cell transfected with nucleic acid encoding B7-2 can be further transfected with nucleic acid encoding B7-1. The cDNA sequence and deduced amino acid sequence of human B7-1 is shown in the Sequence Listing. Alternatively, more than one type of modification can be used. For example, a tumor cell transfected with a nucleic acid encoding B7-2 can be stimulated with an agent which induces expression of B7-1.

(51 Additional Modification of a Tumor Cell to Express MHC Molecules Another aspect of this invention features modified tumor cells which express a costimulatory molecule and which express one or more MHC molecules on their surface to trigger both a costimulatory signal and a primary, antigen-specific, signal in T cells. Before modification. tumor cells may be unable to express MHC molecules. may fail to express MHC molecules although they are capable of expressing such molecules, or may express insufficient amounts of MHC molecules on the tumor cell surface to cause T cell activation.

Tumor cells can be modified to express either MHC class I or MHC class II molecules. or III I i l I i e .h i -44both. One approach to modifying tumor cells to express MHC molecules is to transfect the tumor cell with one or more nucleic acids encoding one or more MHC molecules.

Alternatively, an agent which induces or increases expression of one or more MHC molecules on tumor cells can be used to modify tumor cells. Inducing or increasing expression of MHC class II molecules on a tumor cell can be particularly beneficial for activating CD4 T cells against the tumor since the ability of MHC class II- tumor cells to directly present tumor peptides to CD4- T cells bypasses the need for professional

MHC

class II- APCs. This can improve tumor immunogenicity because soluble tumor antigen (in the form of tumor cell debris or secreted protein) may not be available for uptake by professional MHC class II APCs.

One embodiment of the invention is a modified tumor cell which expresses B7-2 andior B7-3 and one or more MHC class II molecules on their cell surfac- MHC class II a molecules are cell-surface caip heterodimers which structurally contain .ft into which antigenic peptides bind and which function to present bound peptides to the antigen-specific :A5 TcR. Multiple, different MHC class II proteins are expressed on professional APCs and different MHC class II proteins bind different antigenic peptides. Expression of multiple SMHC class II molecules, therefore, increases the spectrum of antigenic peptides that can be presented by an APC or by a modified tumor cell. The a and P chains of MHC class II molecules are encoded by different genes. For instance, the human MHC class II protein HLA-DR is encoded by the HLA-DRa and HLA-DRP genes. Additionally. many polymorphic alleles of MHC class II genes exist in human and other species. T cells of a Sparticular individual respond to stimulation by antigenic peptides in conjunction with self MHC molecules, a phenomenon termed MHC restriction. In addition, certain T cells can also respond to stimulation by polymorphic alleles of MHC molecules found on the cells of other individuals, a phenomenon termed allogenicity. For a review of MHC class II structure and function, see Germain and Margulies. Ann. Rev. Immuno. 11: 403-450. 1993.

Another embodiment of the invention is a modified tumor cell which expresses B7-2 andior B7-3 and one or more MHC class I molecules on the cell surface- Similar to MHC class II aenes. there are multiple MHC class I genes and many polymorphic alleles of these genes are found in human and other species. Like MHC class 11 proteins, class I proteins bind peptide fragments of antigens tor presentation to T cells. A functional cell-surface class I moiecule is composed of an MHC class I a chain protein associated wvail a 02microglobuiin protein.

Tr nstectionr. of a Tu mor Ct eli wiithd uci Encodiin. IHC llce Tumor cells can be modified ex vivo to express one or more XMHC ciass Ii molecules bv transfection of isolated tumor cells with one or more nucic. acids encodin one or more M| I N .1 MHC class II a chains and one or more MHC class 1I P chains in a form suitable for expression of the MHC class II molecules(s) on the surface of the tumor cell. Both an a and a p chain protein must be present in the tumor cell to form a surface heterodimer and neither chain will be expressed on the cell surface alone. The nucleic acid sequences of many murine and human class II genes are known. For examples see Hood, et al. Ann. Rev. Immunol. 1, 529-568 (1983) and Auffray, C. and Strominger, Advances in Human Generics 15, 197- 247 (1987). Preferably, the introduced MHC class II molecule is a self MHC class II molecule. Alternatively, the MHC class II molecule could be a foreign. allogeneic. MHC class II molecule. A particular foreign MHC class II molecule to be introduced into tumor cells can be selected by its ability to induce T cells from a tumor-bearing subject to proliferate and/or secrete cyt6kines when stimulated by cells expressing the foreign MHC class II molecule by its ability to induce an allogeneic response). The tumor cells to be S transfected may not express MHC class II molecules on their surface prior to tianrfection or may express amounts insufficient to stimulate a T cell response. Altematively, tumor cells which express MHC class II molecules prior to transfection can be further transfected with additional, different MHC class II genes or with other polymorphic alleles of MHC class II genes to increase the spectrum of antigenic fragments that the tumor cells can present to T cells.

a a.

*I

o I Fragments. mutants or variants of MHC class II molecules that retain the ability to .26. bind peptide antigens and activate T cell responses, as evidenced by proliferation and/or lymphokine production by T cells, are considered within the scope of the invention. A preferred variant is an MHC class II molecule in which the cytoplasmic domain of either one or both of the a and P chains is truncated. It is known that truncation of the cytoplasmic Sdomains allows peptide binding by and cell surface expression of MHC class II molecules but 25 prevents the induction of endogenous B7 expression, which is triggered by an intraceilular signal generated by the cytoplasmic domains of the MHC class II protein chains upon crosslinking of cell surface MHC class II molecules. Kuolova. et al., J. Exp. Med. 173, 759-762 (1991); Nabavi, et al. Vature 360, 266-268 (1992). Expression of B7-2 and B7-3 is also induced by crosslinking surface MHC class II molecules. and thus truncation of MHC class II molecules may also prevent induction ofB7-2 and/or B7-3. In tumor cells transfected to constitutively express B7-2 and/or B7-3. it may be desirable to inhibit the expression of endogenous costimulatory molecules. for instance to restrain potential downregulatory feedback mechanisms. Transfection of a tumor cell with a nucleic acid(s) encoding a cytoplasmic domain-truncated form of MHC class II a and P chain proteins would inhibit endogenous B7-1 exoression and possibly also endogenous B7-2 and B7-3 expression. Such variants can be produced by. for example, introducing a stop codon in the MHC class II chain gene(s) after the nucieotides encoding the transmcmbrane spanning region. The cytoplasmic I

I

i i I. I I II i i -46domain of either the a chain or the 3 chain protein can be truncated, or. for more complete inhibition of B7 (and possibly B7-2 and/or B7-3) induction, both the a. and P chains can be truncated. See e.g. Griffith et al., Proc. Natl. Acad. Sci. USA 85: 4847-4852, (1988). Nabavi et al., J. Immunol. 142: 1444-1447, (1989).

Tumor cells can be modified to express an MHC class I molecule by transfection with a nucleic acid encoding an MHC class I ca chain protein. For examples of nucleic acids see Hood. et al. Ann. Rev. Immuno. 1, 529-568 (1983) and Auffray, C. and Strominger, J.L., Advances in Human Genetics 15, 197-247 (1987). Optionally, if the tumor cell does not express p-2 microglobulin, it can also be transfected with a nucleic acid encoding the 0-2 microglobulin protein. For examples of nucleic acids see Gussow, et al., J. Immunol. 139, 3132-3138 (1987) and Parns. et al., Proc. Natl. Acad. Sci. USA 78. 2253-2257 (1981).

As for MHC class H molecules, increasing the number of different MHC class I genes or polymorphic alleles of MHC class I genes expressed in a tumor cell can increaseThe spectrum of antigenic fragments that the tumor cells can present to T cells.

When a tumor cell is transfected with nucleic acid which encodes more than one S molecule, for example a B7-2 and/or B7-3 molecule(s), an MHC class II c chain protein and S: an MHC class II chain protein, the transfections can be performed simultaneously or sequentially. If the transfections are performed simultaneously. the molecules can be introduced on the same nucleic acid, so long as the encoded sequences do not exceed a .0 carrying capacity for a particular vector used. Alternatively, the molecules can be encoded by separate nucleic acids. If the transfections are conducted sequentially and tumor cells are S: selected usina a selectable marker, one selectable marker can be used in conjunction with the first introduced nucleic acid while a different selectable marker can be used in conjunction S with the next introduced nucleic acid.

S23 The expression of MHC molecules (class I or class II) on the cell surface of a tumor cell can be determined, for example, by immunoflourescence of tumor cells using S fluorescently labeled monocional antibodies directed against different MHC molecules.

Monoclonal antibodies which recognize either non-polymorphic regions of a particular MHC molecule (non-allele specific) or polymorphic regions of a particular MHC molecule (allelesoecific) can be used and are known to those skilled in the art.

17. Induction or Increased Expression of MHC Molecules on a Tumor Cell Another approach to modifying a tumor cell ex vivo to express MHC molecules on the surface of a tumor cell is to use an agent which stimulates expression of MHC molecules i order to induce or increase expression of MHC moiecules on the tumor cell surface. For example. tumor cells can be contacted with the agent in vitro in a culture medium. An agent which stimulates expression of MHC molecues may act. otr instance, by increasing I I 1 .1l A -47trncito lo H ls I, In/r i transcription of MHC class I and/or class II genes, by increasing translation of MHC class I and/or class II mRNAs or by increasing stability or transport of {HC class I and/or class II proteins to the cell surface. A number of agents have been shown to increase the level of cell-surface expression of MHC class II molecules. See for example Cockfield. S.M. et al., J Immunol. 144, 2967-2974 (1990); Noelle, R.J. et al. i Immunol 137, 1718-1723 (1986); Mond, et al., Ji Immuno 127, 881-888 (1981); Willman, C.L. er al. J Exp. jMed., 170, 1559-1567 (1989); Celada, A.and Maki,. R. IJ mmunol. 146, 1 14-120 (1991) and Glimcher, L.H. and Kara, CJ. Ann. Rev. ImmunoL. 10, 13-49 (1992) and references therein. These agents include cvtokines, antibodies to other cell surface molecules and phorbol esters. One agent which upregulates MPHC class I and class II molecules on a wide variety of cell types is the cytokine interferon- 7 Thus, for example, tumor cells modified to express B7-2 and/or B7-3 and B7-1 can be further modified to increase expression of MHC molecules by contact with interferon-v.

Another agent which can be used to induce or increase expression of an MHC o I' molecule on a tumor cell surface is a nucleic acid encoding a transcription factor which upregulates transcription of MHC class I or class II genes. Such a nucleic acid can be transfected into the tumor cell to cause increased transcription of MHC genes, resulting in increased cell-surface levels of MHC proteins. M1HC class I and class II genes are regulated by different transcription factors. However, the multiple MHC class I genes are regulated coordinately, as are the multipie MHC class II genes. Therefore. transfection of a tumor cell with a nucleic acid encoding a transcription factor which regulates MHC gene expression 0**S :may increase expression of several different MHC molecules on the tumor cell surface.

Several transcription factors which regulate the expression of MHC genes have been identified, cloned and characterized- For example. see Reith. W. et al.. Genes Dev. 4, 1528- 1540, (1990); Liou. et al., Science 247 1581-1 584 (1988): Didier. et al.. Proc.

Nal. Acad Scz US4 S5, 7322-7326 (1988).

(L Inhibition of Invariant Chain Expression in Tumor Cells Another embodiment of the invention provides atumor cell modified to express a T cell costimulatory molecule B7-2 and/or B7-3 and B7-1) and in which exoression of an MHC class l-associated protein. the invariant chain, is inhibited- Invariant chain exoression is inhibited to promote association of endoeenouslv-deried TAA petides with MHC class 11 molecules to create an antigen-MH C compiex This complex can trigger an antigen-specitic signal in T cells to induce activation ofT cells in conjunction with a cosimulaory signal.

MHC class II molecules have been sho-n to be capabie of presenting endogenousiv-derived peptides. Nuchem. et al. Naure 343. 74-76 (1990): Weiss. S. and Bogeen. B. 767- 776 (1991) However,. in cells which naturally express MiC cllss I moecules. the ct and B p F=I- 's I ii1. 11 0 0e a.

9 a~o ft0 o *a a

C

0 chain proteins are associated with the invariant chain (hereafter Ii) during intracellular transport of the proteins from the endoplasmic reticulum. It is believed that Ii functions in part by preventing the association of endogenously-derived peptides with MHC class II inolecules. Elliott, et al. J. immunol. 138, 2949-2952 (1987); Stockinger, et al. Cell 56, 683-689 (1989); Guagliardi, et al. Nature (London) 343, 133-139 (1990); Bakke, O., et al. Cell 63, 707-716 (1990); Lottreau, et al. Nature 348,600-605 (1990); Peters, et al. Nature 349, 669-676 (1991); Roche, et al.Nature 345, 515-618 (1990): Tevton. et al. Nature 348, 39-44 (1990). Since TA-As are synthesized endogenously in tumor cells.

peptides derived from them are likely to be available intracellularly. Accordingly. inhibiting the expression of Ii in tumor cells which express Ii may increase the likelihood that TAA peptides will associate with MHC class II molecules. Consistent with this mechanism. it was shown that supertransfection of an MHC class II. Ii- tumor cell with the Ii gene prevented Sstimulation of tumor-specific immunity by the tumor cell. Clements. et dl. J- Immunol.

149. 2391-2396 (1992).

Prior to modification, the expression of Ii in a tumor cell can be assessed by detecting the presence or absence of Ii mRNA by Northern blotting or by detecting the presence or absence of Ii protein by immunoprecipitation. A preferred approach for inhibiting expression ofli is by introducing into the tumor cells a nucleic acid which is antisense to a coding or regulatory region of the Ii gene. which have been previously described. Koch. et al., £i EMBO J. 6. 1677-1683, (1987). For example, an oligonucleotide complementary to S nucleotides near the translation initiation site of the Ii mRNA can be synthesized. One or more antisense oiiaonucleotides can be added to media containing tumor cells, typically at a S concentration of oligonucieotides of 200 jgiml. The antisense oligonucleotide is taken up by tumor cells and hybridizes to ii mRNA to prevent translation. In another embodiment, a 25* recombinant expression vector is used in which a nucleic acid encoding sequences of the Ii g eene in an orientation such that mRNA which is antisense to a coding or regulatory region of the li gene is produced. Tumor cells transfected with this recombinant expression vector thus contain a continuous source of Ii antisense nucleic acid to prevent production of Ii protein.

Altenative!v. Ii expression in a tumor cell can be inhibited by treating the tumor cell with an agent which interferes with Ii expression. For example, a pharmaceutical agent which inhibits Ii gene expression. li mRNA translation or Ii protein stability or intracelular transport can be used.

TVres of Tuor Cells to be Modified The tumor ceils to be modified as described herein include tumor cells which can be transfected or treated bv one or more of the approaches encompassed by the present invention to excress B7-2 an. or B7-3. alone or in combination with If necessar. the tumor I I a ~m a Liceils can be further modified to express MHC Molecules or an inhibitor of I' expression.

A

tumor from which tumor cells are obtained can be one !hat has arisen spontaneouslyv. e.g in a human subject, or may be experimentally derived or induced, e.g. in an animal subject. The tumor cells can be obtained, for example, from a solidtmoofaornscasauorf the lung, liver, breast, colon, bone etc. Malignancies of solid organs include carcinms sarcomas. melanomas and neuroblastomas. The tumor cells can also be obtained from a blood-borne (ie. dispersed) malignancy such as a lymphoma. a mveloma or a leukemia.

The tumor cells to be modified include those that express MI-C molecules on their cell surface prior to transfection and those that express no or low levels of MHC class I and/or class 1i molecules. A minority of normal cell types express.MI-C class 11 molecules- 1t is therefore expected that Aianv tumor cells will not express MHC class [I molecules .:naturally. These tumors can, be modified to express 137-2 andi/or 137-3 an. MC class II molecules. Several types of tumors have been Lnd to naturally express sufic:_fCclass II Molecules, Such as melanomas (van Duinen et al., Cancer Res, A8. l0!9-10?i 1988)7 0. 1 diffuse large cell ivmphornas (O'Keane al.. Cancer 66. 11 47-1153. 1994) squamnous cell carcinomas of the head and neck (M~attijssen et al.. M. .J Cancer 6,9-0.199 1) and *:colorectal carcinom as (M'voller etal.. Inr J Cancer 6, 155-162. 199 Tumor cellIs which naturally express class HI molecules can be modified to express 137-2 and/or B-7-3. and. in addition, other class HI molecules which can increase the spectrumi of TA-IA peptides wvhich can be presented by the tumor cell. Most non-malignant cell types exp~ress ,NHC class[f **molecules. Howcver, Malignant transformation is often accomnpanied dowvnregzularion of *S expressiorn of -MI-C class molecules on the surface of tumor cells. Csiba- c, al.. Brit. J.

Cancer 50, 699-709 (1 98 4) Importantl.y. loss of expression of MIHC class I antigens by *000tumnorcells is associated with a gnreater aggressiveness and.'or merastric2'oteariali of [he V tumor cells. Schrier, et ci. Nature 305. 771-775 (1983). Holden- er a .1 ACadr Dermarol. 367-871 (1983): Banivash. eta.J Immunol 129. l31S-3" !92! TyVpes of tumors in which MNHC class Lexpres§ion has been show,,n to be i22ibitecd include melanomas, colorecral carcinomas and squamnous Cell carcinomas, van Duinen et, C7ancer Res. 48. 1019-1025 (1988): M~ollereial. Inf J Cancer 6. 155-16 1(19OCT C i ea.

SO Brir. J Cancer 50. 699-709 (1984): Hoiden. et .1 rr 4 cczdrr S I87 (1983). A tumor cell which fails to exp-ress class i. molecules or whichn Lxaresses only lowv levels ofJ4 class I molecules can be modified by one or mnore' of the Zec hnicue S dcsc-i bed herein to induce or increase expression of MIHC class 1molecules on tumor c-;i surface to enhiance tumor cell immuhozenicitvy (101- Moldification of Tumor Cells In Vivo Another aspect of the invention provides methods for increasing the i nunogeni city of a tumor cell by modification of the tumor cell in vivo to express. 137-2 andfor B37-3 and B7- I to trigger a costiniulatory signal in T cells. In addition, tumor cells can be 6irther modified in vivo to express LMHC mole-lules to trigge7 a primary, anti len-specific, signal in T cells.

Tumor cells can be modified in vivo by introducing a nucleic acid encoding 137-2 and/or 87-3 and 7-1 ntothe umorcels in a form suitable for expression of the costimuitr molecule(s) on the surface of the tumor cells.- Likev~ise, nucleic acids enicoding MAHC class I or class II molecules or an antisense sequence of the li terie can be introiduced into tumor cells in vivo. In one embodiment. a recombinant expression vector is used to deliver nucleic acid encoding B7-2 and/or 137-3 and 137- i to tumor cells in vivo as a form of'gene therapy.

.040 Vectors useftul for in viv.o gene therapy~ have been~ previously described and include retrovirall P .:.vectors. adenoviral vectorsand adeno-associated viral vectors. See e.2. RosdnfcHid. M1.A..

*:.Cell 68, 141,3-155 (1992): Anderson. Science 226. 401-409 (1984); Friedman. T., Science 2 4, 1275-12'Si 1'(1989). Altern atively, nucleic acid can be delivered to tumor ctalls in vivo by direct iqjettion of nalked nuclic acid into tumor cells. See e.g. Acsadi. et al., SNaiure 332, 815-818 -(1991)- A delivery apparatus is commercially available (BioRad).

Optionally. to-be suitable forinjection, the nucleic acid can be complexed with a carrier such as a liposaime. Nucleic acid encoding an MHC class I molecule complexed with a liposome has been directly injected into tumnors of melanoma patients. Hoffiran!. .Sc:ence 256, 305- 3 309 (1992).

4 Tumor cells can -also be modi ied Znvivoa by use of anagentwhich idcsor increases expression ofB17-2 andfor 137-3 and 137-1 (an d. if necessar.. MHC molecules) as-1 described herein. The agent mav.be administered systemically. e.g. bv intravenous tojection.

r, preferablv. local to the tur cels.

we A4~ Tie Ef-,-eor Phase of ihe Anti-Tumor T Cell-Mediaied Immune Response The mocmfeo rmr cells ofl the invention are useful for stimultn an~ anti-rUmor T dlmemae iantm esoneby trignn anaue-oci wI an 'a costimulator.

~rp ntmr~eucTei.Foilowing this Inductiv~e. or afFerem. Ohase otan immune respnise- eftector poulaticus ofT cells art: gaieraied. These dffecor Tcc i ooouiations can inciu~ eboth r D T celis and CDR :T cell. The effcror Oolutamons art- responsible 6-1 ~'mnaua o tuorscel. v. or xamie.c~ti~tS t te tmorcels.Once T cells are aclivatcd ex=rssion orf a costlmu iator-v mol) ecu le is noti rea uire d on- a trqet cellI for A enrto ro~tagtcl yefco T cells ;r.fr toe retrtctoso th! T-r.lls.

Harainoz F.A xand Allison. j.P. J. Ik L~ b -761~ Teeoe h n tumor T ccl-medi-ateum.niun responise mrnuucea by :he mioutneL: Tumor L:Lis oi tnicinvention II I is effective against both the modified tumor cells and unmodified tumor cells which do not express a costimulatory molecule.

Additionally, the density and/or type of MHC molecules on the cell surface required for the afferent and efferent phases of a T cell-mediated immune response can differ. Fewer MHC molecules, or only certain types of MHC molecules MHC class I but not MHC class II) may be needed on a tumor cell for recognition by effector T cells than is needed for the initial activation of T cells. Therefore. tumor cells which naturally express low amounts of MHC molecules but are modified to express increased amounts of MHC molecules can induce a T cell-mediated immune response which is effective against the unmodified tumor cells. Alternatively. rumor cells which naturally express MHC class I molecules but not MHC class II molecules which are then modified to express MHC class II molecules can induce a T cell-mediated immune response which includes effector T ceil populations which can eliminate the parental MHC class class II- rumor cells.

o (12i. Therapeutic Compositions of Tumor Cells Another aspect of the invention is a composition of modified iumor cells in a biologically compatible form suitable for pharmaceutical administration to a subject in vivo.

This composition comprises an amount of modified tumor cells and a physiologically acceptable carrier. The amount of modified tumor cells is selected to be therapeutically effective. The term "biologically comDatible form suitable for pharmaceutical administration S in vivo" means that any toxic effects of the tumor cells are outweighed by the therapeutic effects of the tumor cells. A "ohvsiologically acceptable carrier" is one which is biologically compatible with the subject. Examples of acceptable carriers include saiine and aqueous B buffer solutions. In ail cases, the compositions must be sterile and must be fluid to the extent 2 that easy syringabilit- exists. The term "subject" is intended to include living organisms in which tumors can arise or be experimentally induced. Examples of subiects inciude humans.

dogs, cats, mice, rats. and transgenic species thereof.

Administration of the therapeutic compositions of the oresent invention can be carried out using known procedures, at dosages and for periods of time effective to achieve the desired result. For example. a therapeutically effective dose of modified tumor cells may vary according to such factors as ace. sex and weight of the individuai. :he tpe of tumor cell and degree of tumor burden, and the immunological competency ofthe subject. Dosage regimens may be adijsted to urovide optimum therapeutic responses. For instance, a singie dose of modified tumor cells may be administered or several doses m ay be adminiisere over time. Administration may be by iniection. including intravenous. intramuscular.

intraperitonea! and subcutaneous inections.

o (I3S) Activatin ofTumo[-speciic T Lvmphoc'nres kIn trn Another approach to inducing or enhancing an ant-i-tmor T cell-mediated immune response by trigering a costirnulatorv signal in T cells is to obtain T lymphocytes from a tumor-bearing subject and activate them in viro by stimulating them with tumor cells and a siimulatorv form of B7-2 andior B7-3, alone or in combination with B7-1. T cells can be obtained from a subj ect. for example, ftrm peripheral blond. Peripheral blood can be further fractionated to remove rcd blond cells and enrich for or isolate T lymnophocytes or T lymphocyte subpopulations. T cells can be activated in viiro by culturing the T cells With tumor cells obtained from the subject from a biopsy or from peripheral blood in the case of ~blood-borne malignancies) together with a stimulatory form of B7-2 and/or B7-3 or, alternatively, by exposure tca modified tumor cell as described herein. The term g@a-9: "siultr form" means that the costimulatnry molecule is capable of crossiking its recepDtor on a T cell and triggering a costimulatory signal in T cells. The stimulatary form of 400 the cosimulatorv molecule can be. for example. a soluble multivalent mojecule or an

J

9 5 mmoilied ormof te csriulaorvmolecule. for instance coupled to a solid support.

0 Fragments, mutants or variants rusion proteins) of B7-2 and-,or B7-3 which retain the ability to trigger a costimuiatory signal in T cells can also be used- In a prerred embodiment, a soluble extracellular portion of B7-2 and/or B7-3 is used to provide costimulation. to the T cells- Following culturing of the T cells in viiro with tumnor cells and *2P B--2 andior 137-3. or a modified tumror cell, to activate tumnor-specif-ic T cells, the T cells can be administered to the subject. for example by intravenous injection.

Therapeutic i *,ec of Modified Tumor Cells The modified -L-nor cells of the present invention can be used to inicreaSe tumor 0 imrnunoeenicitv. and therefore can be used therapeutically for inducing or enhancing T ymhocyte-mediated anti-tumor immunity in a subject wkith a tumor or at risk of developing a turr A methiod for treating a subject with a tumor involves obtalrung tumor cells from the sub ject- modif.-ing the tumor cells ex vivo to express a T cell costimul ator-v molecule. for examnile by trainsfecting themwith an appropriate nucleic acid. and adm.inistering a tleraeutcaliv effrective doS.- of the modified tumor cells to the subiect. Appropriate nucleic acids to be introduced into a tumor cell include nucleic acids crncocim: K, -1 andior B7-3.

alone or tonether with!-- nucleic acids encodinQ B7-1. MHC molecules (class I or class 11) or [i antisenlse seouecoces il Aiternativi. afe;inrc~s arc obtained from a subject. they can be nc)Lii.c-- 2xvivo usiniz an agent wnich induces or; tncrealses Cxpression of 137-2 arndiorB-S adpsbvas uieaens hc ndc ricrae3- orNMHC mnolecule~s).

U .1 -53- Tumor cells can be obtained from a subject by, for example, surgical removal of tri or cells, e.g. a biopsy of the tumor, or from a blood sample from the subject in cases of biood-borne malignancies. In the case of an experimentally induced tumor, the cells used to induce the tumor can be used, e.g. cells of a tumor cell line. Samples of solid tumors may be treated prior to modification to produce a single-cell suspension of tumor cells for maximal efficiency of transfection. Possible treatments include manual dispersion of cells or enzymatic digestion of connective tissue fibers, e.g. by coliagenase.

Tumor cells can be transfected irnim.ediatel after being obtained from the subjector L can be cultured in vitro prior to transfection to allow for further characterization of the tumor cells determination of the expression of cell surface molecules). The nucleic acids chosen for transfection can b determined following characterization of the proteins expressed by the tumor cell. For instance. expression of MHC proteins on the cell surface of the tumor cells and./or expression of thel i protein in the tumor cell canr be asseset. Tumors which express no. or limited amounts of or types of MHC molecules (class I oi class I) can be transfected with nucleic acids encoding MHC proteins: tumors which express Ii protein S can be transfected with Ii antisense sequences. If necessary. followin transfection tumor cells can be screened for introduction of the nucleic acid by using a selectable marker (e.g.

drug resistance) which is introduced into the tumor cells together wiith the nucleic acid of interest.

*0 i Prior to administration to the subject. the modified tumor cells can be treated to render 5.0* them incapable of further proliferation in the subject, thereby preventing any possible S, ,outgrowth of the modified tumor cells. Possible treatments include irradiation or mitomycin C treatment. which abrogate the proliferative capacity of the rumor cells while maintaining S the ability of the tumor cells-to trigger antigen-specific and costimuator- signais in T cells and thus to stimulate an immune response.

The modified tumor cells ri be administered to te subject by iniection of the tumor cells into the subject. The route of injectioncan be, for example inravenousl intramuscular, intraneritoneal or subcutaneous. Administration of the modified tumor cells at the site of the original tumor may be beneficial for inducin lbailT cell-mediated immune resDonses against the original tumor. Administration of the modified tumor cells in a disseminated mannier. e.g. by intravenous iniection. mtay provide systemic anti-tumor immunitv and, furthermore. may prorect:ageamst memstatic spread of tumor cells fron the original site. The modified tumor cells can be administered to a subiect orior to or in conuinction with other forms of therapv or can be administered afer other treatments such as chemotherapy dr suraical intrr.-etion.

Additionaily. more than one type of modified tumor cell can be administered to a suoiect. For exampie. an effectiye T ccii response ma' require cxposurz ot h T ice to more ZII F' BB~ EWA I X I I -54than one type ofcostimulatory molecule. Furthermore, the temporal sequence of exposure of the T cell to different costimulatory mocules may be important for generating an effective response. For example, it is known that upon activation, a B cell expresses B7-2 early in its response (about 24 hours after stimulation). Subsequently, B7-1 and B7-3 are expressed by the B cell (about 48-72 hours after stimulation). Thus, a T cell may require exposure to B7-2 early in the induction of an immune response by exposure to B7-1 and/or B7-3 in the immune response. Accordingly, different types of modified tumor cells can be administered at different times to a subject to generate an effective immune response against the tumor cells.

For example, tumor cells modified to express B7-2 can be administered to a subject.

Following this administration, a tumor cell from the same tumor but modified to express B7- 3 (alone or in conjunction with B7-1) can be administered to the subject.

S Another method for treating a subject with a tumor is to modify tumor cells in vivo to express B7-2 and/or B7-3, alone or in conjunction with B7-1, MHC molecules and/or an inhibitor of Ii expression. This method can involve modifying tumor cells in vivo by 5 providing nucleic acid encoding the protein(s) to be expressed using vectors and delivery methods effective for in vivo gene therapy as described in a previous section herein.

Alternatively, one or more agents which induce or increase expression of B7-2 andior B7-3, and possibly B7-1 or MHC molecules, can be administered to a subject with a tumor.

The modified tumor cells of the current invention may also be used in a method for 20 preventing or treaing metastatic spread of a tumor or preventing or treating recurrence of a S* tumor. As demonstrated in derail in one of the following examples, anti-tumor immunity induced by B7-1-expressing tumor cells is effective against subsequent chailenge by tumor cells, regardless of whether the tumor cells of the re-exposure express B7-l or not. Thus.

S administration of modified tumor cells or modification of tumor cells in vivo as described 5 herein can provide tumor immunity against cells of the original, unmodified tumor as well as metastases of the original tumor or possible regrowth of the original tumor.

The current invention also provides a composition and a method for specifically inducing an anti-rumor response-in CD4- T cells. CD4- T cells are activated by antigen in conjunction with MHC class II molecules. Association of peptidic fragments of TAAs with MHC class II molecules results in recognition of these antigenic peptdes by CD4 T cells.

Providino a subject with tumor cells which have been modified to express MHC class II molecules aione with B7-2 and/or B7-3, or modified in vivo to express MHC class II molecules along with B7-2 and!or B7-3. can be useful for directing tumor antigen presentation to the MHC class 11 pathway and thereby result in antigen recognition by and activation of CD4- T ceils specific for the tumor cells. Depletion of either CD4 or CDUS T cells in vivo. by administration ofanti-CD4 or anti-CDS antibodies. can be used to I I i i 1 I Is 1i demonstrate that specific anti-tumor immunity is mediated by a particular CD4 4 T cell subpopulation.

Subjects initially exposed to modified tumor cells develop an anti-tumor specific T Scell response which is effective against subsequent exposure to unmodified tumor cells. Thus the subject develops anti-tumor specific immunity. The generalized use of modified tumor cells of the invention from one human subject as an immunogen to induce anti-tumor immunity in another human subject is prohibited by histocompatibility differences between unrelated humans. However, use of modified tumor cells from one individual to induce antitumor immunity in another individual to protect against possible future occurrence of a tumor may be useful in cases of familial malignancies. In this situation, the tumor-bearing donor of tumor cells to be modified id closely related to the (non-tumor bearing) recipient of the modified tumor cells and therefore the donor and recipient share MHC antigens. A strong hereditary component has been identified for certain types of malignancies, fdr example S certain breast and colon cancers. In families with a known susceptibility to a particular malignancv and in which one individual presently has a tumor. tumor cells from that S individual could be modified to express B7-2 and/or B7-3, alone or in combination with B7-1 and administered to susceptible, histocompatible family members to induce an anti-tumor response in the recipient against the type of tumor to which the family is susceptible. This anti-tumor response could provide protective irmmunity to subsequent development of a S..O tumor in the immunized recipient.

5V Tumor-Specific T Cell Tolerance In the case of an experimentally induced tumor, a subject a mouse) can be exDosed to the modified tumor cells of the invention before being challenged with unmodified tumor cells. Thus, the subject is initially exposed to TAA peptides on tumor S cells together with B7-2 and/or B7-3, and B7-1 which activates TAA-specific T cells. The activated T cells are then effective against subsequent challenge with unmodified tumor cells.

In the case of a spontaneously arising tumor. as is the case with human subjects, the subject's immune system will be exposed to unmodified tumor cells before exposure to the modified tumor cells of the invention. Thus the subject is initially exposed to TAA peptides on tumor cells in the absence of a costimulatory signal. This situation is likely to induce TAA-speclic T cell tolerance in those T cells which are exposed to and are in contact with the unmodified tumor cells. Secondary exposure of the subject to modified tumor cells which can trigger a costimulatorv signal may not be sufficient to overcome tolerance in TAA-speciic T cells which were anergized by primary exposure to the tumor. Use of modified tumor cells to induce anti-tumor immunity in a subject already exposed to unmodified tumor ceils may therefore be most effective in early diagnosed patients with small tumor burdens. tor instance

I

I I a a small localized tumor which has not metastasized. In this situation, the tumor cells are confined to a limited area of the body and thus only a portion of the T cell repertoire may be exposed to tumor antigens and become anergized. Administration of modified tumor cells in a systemic manner, for instance after surgical removal of the localized tumor and modification of isolated tumor cells, may expose non-anergized T cells to tumor antigens together with B7-2 and/or B7-3 alone, or in combination with B7-1 thereby inducing an antitumor response in the non-anergized T cells. The anti-tumor response may be effective against possible regrowth of the tumor or against micrometastases of the original tumor which may not have been detected. To overcome widespread peripheral T cell tolerance to tumor cells in a subject, additional signals, such as a cytokine, may need to be provided to the subject together with the m6dified tumor cells. A cytokine which functions as a T cell growth factor, such as IL-2. could be provided to the subject together with the modified tumor cells. IL-2 has been shown to be capable of restoring the alloantigen-specific responses of previously anergized T cells in an in vitro system when exogenous IL-2 is added at the time of secondary alloantigenic stimulation. Tan. et al. 1 Ex. Mea. 177. 165-173 (1993).

Another approach to generating an anti-tumor T cell response in a subject despite tolerance of the subject's T cells to the tumor is to stimulate an anti-tumor response in T cells from another subject who has not been exposed to the tumor (referred to as a naive donor) and transfer the stimulated T cells from the naive donor back into the tumor-bearing subject so that the transferred T cells can mount an immune response against the tumor cells. An anti-tumor response is induced in the T cells from the naive donor by stimulating the T cells in vitro with the modified tumor cells of the invention. Such an adoptive transfer approach is generally prohibited in outbred populations because ofhistocompatibity differences between the transferred T cells and the tumor-bearing recipient. However, advances in allogeneic bone marrow transplantation can be applied to this situation to allow for acceptance by the recipient of the adoptively transferred cells and prevention of graft versus host disease. First, a tumor-bearing subject (referred to as the host) is prepared for and receives an allogeneic bone marrow transplant from a naive donor by a known procedure. Preparation of the host involves whole body irradiation, which destroys the host's immune system. including T cells tolerized to the tumor, as well as the tumor cells themselves. Bone marrow transplantation is accomoanied by treatment(s) to prevent graft versus host disease such as depletion of mature T cells from the bone marrow graft. treatment of the host with immunosuppressive drags or treatment of the host with an agent, such as CTLA4-g. to induce donor T cell tolerance to host tissues. Next. to provide anti-tumor specific T cells to the host which can respond against residual tumor cells in the host or regrowth or metastases of the original tumor in the host. T cells from the naive donor are stimulated in itro with tumor cells from the host I I I I IM -57which have been modified, as described herein, to express B7-2 and/or B7-3. Thus, the donor T cells are initially exposed to tumor cells together with a costimulatory signal and therefore are activated to respond to the tumor cells. These activated anti-tumor specific T cells are then transferred to the host where they are reactive against unmodified tumor cells.

Since the host has been reconstituted with the donor's immune system, the host will not reject the transferred T cells and, additionally, the treatment of the host to prevent graft versus host disease will prevent reactivity of the transferred T cells with normal host tissues.

H. Administration of Therapeutic Forms of B Lymphocvte Antigens The peptides of the invention are administered to subjects in a biologically compatible form suitable for pharmaceutical administration in vivo to either enhance or suppress T cell mediated immune response. By "biologically compatible form suitable for administration in vivo" is meant a form of the protein to be administered in which any toxic effects are 9 outweighed by the therapeutic effects of the protein. The term subject is intended to include living organisms in which an immune response can be elicited, mammals. Examples of subjects include humans, dogs. cats, mice, rats, and transgenic species thereof.

Administration of a peptide having the activity of a novel B lymphocyte antigen as described herein can be in any pharmacological form including a therapeutically active amount of peptide alone or in combination with a peptide having the activity of another B lymphocyte antigen and a pharmaceutically acceptable carrier. Administration of a therapeutically active amount of the therapeutic compositions of the present invention is defined as an amount effective, at dosages and for periods of time necessav to achieve the desired result. For Sexample, a therapeutically active amount of a peptide having B7-2 activity may vary according to factors such as the disease state, age, sex. and weight of the individual, and the ability of peptide to elicit a desired response in the individual. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

The active compound peptide) may be administered in a convenient manner such as by injection (subcutaneous. intravenous. etc.). oral administration, inhalation.

transdermal application, or rectal administration. Depending on the route of administration, the active compound may be coated in a material to protect the compound from the action of enzvmes, acids and other natural conditions which may inactivate the compound.

To administer a peptide having B7-2 activity by other than parenteral administration.

it may be necessary to coat the peptide with. or co-administer the peptide with. a material to prevent its inactivation. For example, a ueptide hving B7-2 activity may be administered to an individual in an approriate carrier. diluent or adiuvant. co-administered wit 1 i' enzyme 1

I

I a I I I I I I I g 1 -58inhibitors or in an appropriate carrier such as liposomes. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and nhexadecyl polyethylene ether. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water emulsions as well as conventional liposomes (Strejan et al., (1984) J. Neuroimmunol 2:27).

The active compound may also be administered parenterally or intraperitoneally.

Dispersions can also be prepared in glycerol. liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol. polyol (for example, glycerol, propyiene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case ofdispersion and by the use ofsurfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol. phenol, asorbic acid. thimerosal. and the like. In many cases, it will be preferable to inciude isotonic agents, for example, sugars, polyalcohols such as manitol. sorbitol, sodium chloride in the S comoosition. Prolonged absorption of the injectable compositions can be brought about by.

including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating active compound peptide having B7- 2 activitv- in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required. followed by filtered sterilization.

Generally. disoersions are prepared by incoroorating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients trom those enumerated above. In the case of sterile powders for the preparation o0 sterie iniectable solutions. the preferred methods of preparation are vacuum dryng and treezedrvine which yields a powder of the active ingredient peptide) plus any additional desired ingredient from a previously sterile-filtered solution thereof.

I I

I

I I 1.a l I I I b ,Id I I -59- When the active compound is suitably protected, as described above, the protein may be orally administered, for example, with an inert diluent or an assimilable edible carrier. As used herein "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents.

and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated.

Supplementary active compounds can also be incorporated into the compositions.

It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units stited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaeufical carrier.

The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular Stherapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.

*C I. Identification ofCvtokines Induced by Costimulation I2. The nucleic acid sequences encoding peptides having the activity of novel B lymphocyte antigens as described herein can be used to identify cytokines which are produced by T cells in response to stimulation by a form of B lymphocyte antigen. B7-2.

T cells can be suboptimally stimulated in vitro with a primary activation signal, such as phorbol ester, anti-CD3 antibody or preferably antigen in association with an MHC class II molecule, and given a costimulatory signal by a stimulatory form of B 7 -2 antigen, for instance by a cell transfected with nucleic acid encoding a peptide having B7-2 activity and expressing the peptide on its surface or by a soluble, stimulatory form of the peptide. Known cvtokines released into the media can be identified by ELISA or by the ability of an antibody which blocks the cvtokine to inhibit T cell proliferation or proliferation of other cell types that is induced by the cvtokine. An IL-4 ELISA kit is available from Genz-me (Cambridge MA), as is an IL-7 blocking antibody. Blocking antibodies against IL-9 and IL-12 are available from Genetics Institute (Cambridge. MA.

An in virro T cell costimulation assay as described above can also be used in a method for identifying novel cvtokines which may be induced by costimulation. If a particular activity induced uoon costimulation. e.g. T cell proliferation, cannot be inhibited by addition of blocking antibodies to known cvtokines. the activity may result from the action of an Ii 1 I r unkown cytokine. Following costimulation, this cytokine could be purified from the media by conventional methods and its activity measured by its ability to induce T cell proliferation.

To identify cvtokines which prevent the induction of tolerance, an in vitro T cell costimulation assay as described above can be used. In this case, T cells would be given the primary activation signal and contacted with a selected cytokine, but would not be given the costimulatory signal. After washing and resting the T cells, the cells would be rechallenged with both a primary activation signal and a costimulatory signal. If the T cells do not respond proliferate or produce IL-2) they have become tolerized and the cvtokine has not prevented the induction of tolerance. However, if the T cells respond, induction of tolerance has been prevented by the cytokine. Those cytokines which are capable of preventing the induction of tolerance can betargeted for blockage in vivo in conjunction with reagents which block B lymphocyte antigens as a more efficient means to induce tolerance in transplant Srecipients or subjects with autoimmune diseases. For example, one could administer a B7-2 blocking reagent together with a cvtokine blocking antibody to a subject.

*54 Identification of Molecules which Inhibit Costimulation Another application of the peptide having the activity of a novel B lymphocyte antigen of the invention B7-2 and B7-3) is the use of one or more of these peptides in screening assays to discover as yet undefined molecules which are inhibitors of costimulatory ligand'bindingand/or of intracellular signaling through T cells following costimulation. For S example, a solid-phase binding assay using a peptide having the activity of a B lymphocyte antigen, such as B7-2, could be used to identify molecules which inhibit binding of the antigen with the appropriate T cell ligand CTLA4. CD28). In addition. an in vitro T cell costimulation assay as described above could be used to identify molecules which interfere with intracellular signaling through the T cells following costimuiation as determined by the ability of these molecules to inhibit T cell proliferation and/or cytokine production (vet which do not prevent binding ofB lymphocyte antigens to their receptors).

For example, the compound cyclosporine A inhibits T cell activation through stimulation via the T cell receptor.oathwav but not via the CD28/CTLA4 pathway. Therefore. a different intracellular signaling oathway is involved in costimulation. Molecules which interfere with intracellular signaling via the CD2S/CTLA4 pathway may be effective as immunosuppressive agents in vivo (similar to the effects of cvclosporine

A).

K. Identification of Moiecuies which Modulate B vmphoc'.'te Aitn Expression 5 The monoclonai antibodies produced using the proteins and peptides of the current invention can be use. in a screening assay for molecules which modulate the expression of B lvmhocvte antigerns on cels. For example. molecules which effect inraceiiular signainn B- I I .1 I ll -61which leads to induction ofB lymphocyte antigens, e.g. B7-2 or B7-3, can be identified by assaying expression of one or more B lymphocyte antigens on the cell surface. Reduced immunofluorescent staining by an anti-B7-2 antibody in the presence of the molecule would indicate that the molecule inhibits intracellular signals. Molecules which upregulate B lympilocyte antigen expression result in an increased immunofluorescent staining.

Alternatively, the effect of a molecule on expression of a B lymphocyte antigen, such as B7- 2, can be determined by detecting cellular B7-2 mRNA levels using a B7-2 cDNA as a probe.

For example, a cell which expresses a peptide having B7-2 activity can be contacted with a molecule to be tested, and an increase or decrease in B7-2 mRNA levels in the cell detected by standard technique, such as Northern hybridization analysis or conventional dot blot of mRNA or total poly(A+)RNAs using a B7-2 cDNA probe labeled with a detectable marker.

Molecules which modulate B lymphocyte antigen expression may be useful therapeuticallv for either upregulating or downregulating immune responses alone or in conjuncti n with soluble blocking or stimulating reagents. For instance, a molecule which inhibits expression 1 I5, of B7-2 could be administered together with a B7-2 blocking reagent for immunosuppressive purposes. Molecules which can be tested in the above-described assays include cvtokines such as IL-4, yINF, IL-10, IL-12, GM-CSF and prostagladins.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references and published patent applications cited throughout this application are hereby incorporated by reference.

The following methodology was used in Examples 1. 2 and 3.

METHODS AND MATERIALS A. Cells Mononuclear cells were isolated by Ficoll-Hypaque density gradient centrifugation from single cell suscensions of normal human spleens and were separated into E- and E+ fractions by rosetting with sheep red blood cells (Boyd. et al. (1985) J. Immunol. 14, 1516). B cells were purified from the E- fraction by adherence ofmonocytes on plastic and depletion of residual T. natural killer cells (NK) and residual monocytes by two treatments with anti-MsIgG and anti-MsigM coated magnetic beads (Advanced Magnetics. Cambridge, MA). using monocionai antibodies: anti-CD4. -CDS. -CD I b.-CDI4 and -CD 6. CD4- T cells were isolated from the E- fraction of the same spleens after adherence on plastic and depletion of NK, B ceils and residual monocytes with magnetic beads and monocional antibodies: anti-CDaO. -CD! Ib. -CD8 and -CDI6. CD2S- T cells were identicallv isolated from the E- fraction using anti-CD20. -CD Ilb. -CD 14 and -CDI6 monoclonai antibodies.

The efficiency of the curification was analyzed by indirect immunofuLre.scence and flow I 1 WI I 1 1 E -62ctometiy using an EPICS flow cytomneter (Coulter). B cell preparations were >95% CD2O CD3+, CD CD4-; T cell preparations were >98% CD3-. >98% CD4+.<l% CD8-. <1 CD20-'- <1 CD 14-. CD28- T cell preparations were >98% CD3+, >98% CD28+;, CD20-+, CD 14 B. tyonoclonal AN-rtibodies and Fusion Proteins Nionoclonal antibodies were used as purified Ig unless indicated othenrvise: anti- B7:133IgM is a blockingi antibody and has been previously described (Freedman. A.S. et al.

(1987) ImmunoL 127, 3260-3267); anti-B7:B 1.1, IgGI (ReoliGen Corp_ Cambridge. MA) (NIckoloff. et al (1993) Am. Ji Paihol. 142, 1029-1040) is a non-blocking monoclonal bov;133-: gl antibdy B lM is a blockinQ antibody (Dr. E. Clark. University of Washington. Seattle, :WA) (Yakochi. etal. (l 9 8 J Immunol. 11S, 823-827); anti-CD2O: B3L fL7G2a (Stashenko, P..et ai.(i9 8 O. Jimmunofl.2i 16718-1685): anti-BS-: mM %,(Freednan. et at.

(1985)j ImmunoL ja., 22222-35). anti-CDS: 7PT3179. lgG2a: anti-CD4-: l9Thy5D7, IgG2a. anti-CD 17b: IMol 1 cM~v and anti-CDI14: M1vo2, 1gMv (Todd. R. et al. (19831)1J Imunnl- 126, 1435-14412); andiMHFC class It: 9-49, IgG2a (Dr R. Todd. University of Michigan. Ann Arbor) (Todd, et al. (1984) Hum i'mmunol. 10, 23-40;, anti-CD'28 9-3, lQG2a (Dr. C.

June, Naval Research Institute. Bethesda) (Hansen. et al. (1980) Immunzogenetics. 0,2 2 47-26M); anti-CD 16: 3G8, IgGI (used as ascites) (Dr. 1. Ritz, Dana-Farber Cancer Institue :2P) Boston); anti-CD3: OKT3. IgG'-a hvbridoma was obtained from the American Type Culture Collection and the purified monoclonal antibody was adhered on plastic plates at a :concentration of Iltqimi; anti-CD28 Fab fraaments were generated from the 9.3 monoclonal antibo dy- by 7)apain digestion and purificatino rti column. according to the mnanufacturer's Instructions (Pierce. Rockfori. 1L). Human CTLA4 fusion protein (CTLA4Ic) and control fusion protein (control-Ig) were prepared as prev iously described (Gimmi. et at. (1993) Proc. N'adL Acad Sci USA 90:6586-6590): Boussiolis. eL al J Exp. Med. (accepted for publication)).

C. CHO Cell Transection 137-1 transfectants (CHO-B7) were prepared from the 37 -I negative chinese hamster ova-ry% (CHO) cell line. fixed with oaraforma'dehvde and used as pre% iously ciscribcd (Gimmi. et al- Proc. Vard .cad. Sci USA 38. 6575-6579).

Q. hn Viir 3 Cell Activation ad Selecion of B37 and B7- Cells Spienic B celIls were culture.d at %x106 cellsr/mI in complete culture nwes! i-1 FY1ll 16-40 with heat inactivated fe---ai calf serum 2miN giutarninc. 1 m'M sodiumn nyruvate. penicillin (100 unit's/mll. StreomyinV1 SuLtht1C (100LIL.-MiI and eeniaincin suIlfat -63- (Spg/ml)). In tissue Culture flasks and were activated by czosslinkirIg of sjg with affinitV purified rabbit anti-human 1gIM coupled to Affi-Gel 702 beads (Bio-Rad), Richmond.

CA)

(Boyd, et al., (198 jImmunol. 13.4,15 16) or by crosslidnkin of MHC class 11 with 9- 49 antibody coupled to Affi-Gel 702 beads. B cells activated for 72 hours, were used as total activated B cell populations or were Indirectly stained with anti-B7 (B3 1 monoclonal antibody and fluorscein isothiocvanate (FITC) labeled goat anti-mouse iromunoglobulin (Fisher, Pittsburgh. PA), and fractionated into 137-1- and B37-1- Fopuiations by flow cy-tometric cell sorting (EPICS Elite flow cytometer. Coulter).

E. Immunofipuoescence and Flow Cvtomerv For surface Dhenotvp analysis populations of B cells activated by either slg or MHC class 11 crosslinking for 6. 12, 21. 48. 72 and 96 hours were stained with either anii-B37 (133), 1313B-1 monoclonal antibodies, control h1M antibody, CTLA4Ig or control-1g. Cel susensos wer stie-tose indirect membrane staining with I Oi~ml of prmz jD monoclonal antibody followed by the appropriate secondary reagents. Specifically.

immunorcactivirv with anii-37 (133) and BB-I monoclonal antibodies was studied by indirect staining using goat anti-mouse Ig or immunoglobulin FITC (Fisher1 as secondary reageent: and immuunoreactivity with fusion proteins was studied using biotinyla ted CTLA4Ig or biotinvlated control-Ig and streptavidini-phycoerythrin as secondan' reagent.

PBS

2 containing 10% AB serum was used as diluent and wash media. Cells were fixed with 0D. 1 o paraforrnaldehyde and analyzed on a flow cvtometer (EPICS Elite Cotifter)- 4;F-Proliferation Assay 6T cells were cutured at a concentration of IX1O5 celIls per wel in 96-well flat bottom ~microtiter plate at 37TC for-3 days in 5% CO-) Svngeneic activated B cel.ls (total B cell population or B37 and 137-tfractions) were irradiated (2500 tadl and added into the cultures at a concentration of lxl05 cells per well. Factors under study were added t o the required conce2ntration for a total final volume of 20041i per well. When indicated. T cells wereincubated with anti-CD2S Fab (final concentration of I Oug./mI). for 10 m- inutes at 4'C, prior to addition in experimental plates. Similarly. CHO-B37 or B cells were incubated with CTLA41g or-contro1-T,,1-Ou!Z I) for ,O minutes atz!O 4 ,CiThvmidIne incnoratlori as an index of-mitogenic actvity, was assesse dafter incubation wvith lrtCi (Sk rh~ Hmdti-Mf thrnidine (Du Pont. Boston. A)r the last 15 hours of the culture. The cells wvere harvested onto filters and the radoactl itv on the dried filters was mneasured-, ii a Pharmacia, plate Iaouio sciniiiauon. couinter ~f.1 I i. jI .1 d hk. ~h -64- G. and IL-4 Assay IL-2 and ILA4 concentrations were assayed by ELISA (R&D Systems, M~inneapolis, MfN and lBioSource, Camarillo, CA) in culture supernatants collected 2t 24 hours after initiation of the culture.

EXAMPLE I Expression of a Novel CTLA4 Ligand on Activated B Cells Which Induces T Cell Proliferation Since crossiinking stirface 1g induces human resting! B cells to ext:ress B7-1 a maxially(50-80%l at 72 hours, the ability of activated human B ivninhoctst induce subrnitogenically activated T cells to proliferate and secrete IL-2 was determiiedi- Figure1 depicts the costimuiatorv responise of human splenic CD2S T cels sbioeically activated with anti-CD3 monoclonal antibody, to either B7 (137-1) transfected CHO) cells a (CHO-B7) or syneeneic splenic B cells activated with anti for 72 hours- H -Thv;midine incorporation was assessed ror the last 15 hours of a 72 hours culture. was assessed by ELISA in supernatants after 24 hours of culture (Detection limits of the assay: 3 1-2000 pu/,mi). Figure 1 is representative of seventeen experiments.

a,*0 Submitogenicaliv activated CD2S T cells proliferated and secreted high evels of IL- 2Mi response to B"-1 costiraulation provided by CHG-B7 (FigureL1 panel Both proiifethion and 1L-7 sece ,ion were totally inhibited by blocking the BT- molecul -on CHO cells with either anti-517 1 monoclonal antibodv or bv a fusion Drotein ior is niun affinity receptor, CTLA4- Similariy. proliferation and IL-2 secretion weeabrocatediuv biocingp B7 inalling via CID2S wit- i,-h Fab anti-CD28 monoclonal anaibodv_ Control rnmonoclonal antibody or control fuision proteirn had no effect. Nearly identical casdiruation of proliferation and IL-2 secreion was provided by SDoknic B cells activated, with anti-Ig for 72 hours (panel Though ariti-B37-l monoclonal antibody could cornujetei abrogiate both piiferation and fL-? secretion delivered by CHO-B37. anti-B7-l mnocional anti oca consistently inhibited Droiif.-MauoP Induced by activated B cells by only- 5O9"o whereas IL-- 1 secretion was totaily inhibi[.elJ In contrast to the partial blockaute oi roetion 'Tnuuccd b% anti-B7-l monoclonal antibody both CT'LA4ii and Fab anti-CDS monocional Lntibody corrtuetel% blocked Clrohrernu"'on arid HL-2 secretion- These results arecon u vllhnin hivuohesis that activated httn-an B celIls expressone or more additional CTLA-!CD2S eSlizarids which can induce T-eel1l r'roi;!'eation and IL-2 secretion.

I I

AI

1I 9 1

I~

i. i I I I I I

S

0 0

C

0

S

OS

C

EXAMPLE 2 Activated Human Spienic B Cells ExpresCTLA4 Ligand(s) Distinct from 137-1 In lieht of the above observations, whether other CTTLA4 bindi" one-eetr S wee exressd o actvate B ellswas etemine. Tothi end, human peicBcells wr wrexseoractivated Bo 72ehou s with at- ndterstined- withi nd nti-B7- mo n Bce ls wereod (Bivte 1.o) whichos ot nii and meithed stim to. loocin ishanat-B- otoc na td (FITC) -and B 1. 1 were used with flow cvtornerric cell sorting to isolate 137- 1 and B7-1 fractions. The resulting post-sort positive population was 99% B-7-1 and the nost-sort negaiive population was 98% B7 I- (Fi gure 2).

coo:To examine the costinulatory potential of each population. hum i1 splenic CD2'S- T >*cells were submitoarricallv stirnulatedNrith anti-CD3 monoclonal ar uody in 'he presence I% of irradiated 137-1 or 137-1- ati-Jo, acivated (72 hours) solenic B'c 3U-ThmVttidine .4.incorporation was assessed for the last 15 hours of a 72 hours culture. I ')'xas assessed by ELISA in supernatarts after 24 hours of culure (Detection limits at hezassax: 31-2000 -gM1). The results of Figure 3 are reoresentative of ten experiments-. -B77-± Ilsinue anti-CD3 activated T cejls to-oroliferate and secrere IL-2 (Figure 3a) but no~t IL- -As w~as observed with the up-fractionated activated -B cell population, ant-B-I m ohbal antdbod-v (133) inhibited proliferation only 50M but consistently abrogated IL-2 secretion X-s above.

?QCTLA4Ig bindinga or blockade of CD2_S with Fab anti-CD28 monoclonal antibody~ corripletelv iibited both proliferation and IL-2 secretion.~ C6 ttro[ monoclonal antibody and:C OnMrol-le -0 0were not inhibitorv- In an attempt to identitfy other potential CTLA4/CD2S binnin.a **,costirnulatorv ligand(s) which might account for the residual. non-B7 mediated 1 otrr'on :0 delvered y B7±B ce~sdie Ofi' oBB- I monoclonial antibod-y on proliferatiniarA Ssecrezion was examined. As seezn. BIB- I r-ineo-lonaI antibody comple-cli Cn~' bothf.

proif eration an 2scr tioi(Fig re a) F!g ure 3b displays the cosiimulator'- potential of 1374- activated human spienic B ce.~-I Irradiated B7- I activated (72 bi hrB ce'is coaldalso-: delivtr a siificant cosurnutarorv-ig sa to'suornito~eajcallv; activated CD4- lvmnoc';tes:! This costimulation was not accompanied by- detecable IL3Fi be l or L -4 aCcurnulation SO and anti-B-7-i monoclonal antibou odid nor inhibir rol Ife on. Ho.0 CT vk L I ant.-CD2S monoclon-'! antmbod, and 3,13i mono on~at aniion' aii co-.Ditt&' vntbjoite Phenrvic ar-'lis o' ihe B. I- and B j ac'ivated solenic B Ce~k CLnre above runctional resuis. 1i -4shows thL cc'!~rac expression oi:~ n U- 3 onitracuionate-d B7i- I m-d B 1 activated B cL A ee n -iur B 'ria solenic B cells staineed with _-,u-B37-i 13 o-conlaioy.B- nhe ariuouv. and boun' CL--e.In contrrasi: B u t-cd svienic B cCll15i n" S.I t I SI I In a I anti-137-1 (I.33) monoclonal antibody but did stain with 81B- I monoclonal antibody and CTLA41g. These phenotypic and *functional results demonstrate that both 137-l- and 137-1lactivated (72 hours) human Bivrnahocytes express CTLA4 binding counter-receptor(s) which: can in1duce submitogenicallv activatcxi T cells to proliferate without detectable IL- 2 secretion: and 2) are identified by the BB-I roannclonal antibodv but not anti-B7-l monolonl aniboy. ~hus thee CL4CIDIS linzands can be distinauished on the basis of their temporal expression alter B cell activation anid their reactivity with CTLA4Io- and anti- 37 monoclonal antibodies. The results of Figur&-4 are re"rresentative of Five ex" erimeits- EXNMPLE 3 Three Distinct CTLA4/CD2.1 Lityands Are Expressed Foll owin- Human B CellActivatin

C.

To determ ire the seauenziai exp-ression of CTLA,4 bindinv countzer-r.eolaorS 175 foiiowinz activation. numan sD[ai-c B cells wert: activated by crossln-kinia of either surface la or.%MHC class if and the e xpression of Rl7-1. B7-3 and 137-2 binding proteins were excamined4 bv flow cevtomeLrlc anaiysis. 12 br M.vHC class 11 cr-osslinkine induced a similar panem of CTLA4Ig bindink (Figures 5 and Figure 5 is representative of the results of exaertments for arai-B37- arid BB bundinq and 5 exneriments; for CTLA4Igz bindling.

ZtU Figure 6 -is rep~resentative of 25 xperments f-or ariti-B7-I bindingz and 5 experiments for CTLA412 binding. Thne resuits or these experiments tndIctes that prior ro 24 hours, none of these:.molecules are expressed. Athours post-activation, the maiority of cells express a .:protein that binds CTLA-'JQ (Bi howv er. fewer than express -'ier 137-1 or B73 Crosslinkinn of.%MHC ciass 11 induce-s maximal,5xpression and intensity of137-I and 137-3 at a~48 hours whereas crosslinkin2 of Ia induces maximal expression at 72 hours ania expression declines thereafter. These results suqenest that an, additional CTLA4 bindinn counter-rceptor is exipresse 1 by hours and that the temporal expression of the distinct 137-1 and B7-3 proteins appears to coinci;e.

A series or experimerns was coriuuctcui to detrmine w.hcihcr the irmoorai expression of CT'LA4- bindina counter-eetr difrtially correlated with the r abiiivr:-o cosrmulate I cil oroliferation anidior TL- szecretio0n. Human sLpienic CD2-S- T czlls suibmirogonical1,; stini"_-d with anti:-CDS wer culitured ta 7 ours in the przisence of irradiateda humnan spienic B cellIs that 'iae oem pireviousiv activateo nu rro by in crTossiaxmni 11!1 D.-_.or nours. IL-2 seceton was 25asse by ELISA- :nspratnsater lc 1'ur 'C:2 proateratic,, as asszessed by6 'H-thyrnid~iriz tcorcorarioi 'or the las1 hours, a *:oUr culture. The results ocF~ue 7/ arc rlearcsc n~tttve~ o' xperiments. As seen in Fieurc 7-1.21 nour activated B :celHs criovi-ea cos- muiator;. siitnai %v tca w.as accontpapuiod av 7Oo~ I I -67 levels of IL-2 production, although the magnitude of prolifer-atio ssinfcnllesta observed with 48 and 72 hours ar.itivated human Bcls( ote difrecs sini canyles han H-Tlwrnidine incorporation!. 4.Neither proliferation nor IL-2 accumulation was inhibitdb ~aniti-B7-l (133) or BB- 1 In contrast, with CTLA41~ an antiC2 bayoocoa 5 antibody totally abrogated prif~ration and IL-2 accumulation. B Cells activated for 48 hours, Provided costirntulation which resulted i1n nearly naximal Proliferation and IL-2 secretion (Figure 7b). H-ere"anti-B37-1 (133) monoclonal antibody. inhibited proliferation aProximately 500% but totally blocked IL-2 accumulation. B B-I monoclonal antibody total iv inhibited both proliferation and IL-2 secretion. -As above. CTLA41g and Fab anti-CD28 also totally blocked proliferation and IL-2 production. Finally. 72 hour activated cells induced T cell rospofise identical to that nducedjby 48 hour act-xe BclsSIia results are obse, ed if th submitoenic: sinal is delivee bynobi m slic acid (PM-VfA) and if the human sp! eot.c B cls ar V acivte b HCciass 11 rather thd.:1 Ig 1O~slinkjnQ_ aow These results inaca t' feeaetreCTA idn oeue h' r cnoaexpressed on aciivatio B1,13 an eac ca nues itogeni$call I stiuated T cells to n~roiiferate. Two or these molecules, the early CT LA4 bindin' one~eetr(72 n B7-1 (133) induce IL-2 production whereas B7-3 induce proliferation without detectable IL-2 production.

Previous sti dies crovie cofiting evidence Whether the anti-137 monoclonal antibodv.133 and monocional antibody B B3-j itifie~r te same molecule (Freediman.,

AS

0or eal. (1987)1irmunol' B1732-60-32' 67: Yokochil T-..er-i i(1982)J !mrnroj. 128. 813-8"7 Freeman- I eaLH99J mmr _4,21-721.A ouich both monoclonal antibodies identified molecules- expiressed 48 hours f'ollowing human, B3-cll activation, several reports suggzesed that B37 (B-l and the molecule 'dentifie-; by mnrocionai anti'*d *X BB- were distinct since they,. were ditfferentially .xoressed on celIl lines an d B ~i eoam t-man.A.S. et al. (9T.hrnIMt,17031 Yokocl-i ei l. (J9S1 Jmmtzo Free i man. GJ.. tl 19)!inw N327-7 Clar- E and N okochi; T_ (198) Le Isti 111ernatia!R;resWrso 33-346: *Clark. E_ ot aL 0 984i) Lem;tcocvte ipng 4st br rerndtuo?.a! fte'.cs qrJ'cho. 740). In -0 addition. 11rnmufloo& 1 0 1 ~rt t± rand Westerrn Bloripg w.ith t-[eLo-i monclonal anibOdies suQ2'eted thar they :oen: fe, 4 -Crcenei'riolecules I'Clark E anci Yokocmdi. P 1 9S1 Letz.oc';!e Typing ist -mrai7 !Rjeen~ Tem 1984 LeukovIe voinz I [r n nc frso 2~ 'lni n i-B monoclonal atibbodc-iv was by- ~oC mulatc-~hacoui j_ activated humnan B :-hhc:e 'els-z 138c BB.U oncio--I wic'x s lene.-amed bv *immunization wvit'. baboon11 Lne_ nus. the BB-1 rue2c;RU musn "r2oz rUZ!e Tuvc CeltOpe o1 huan .J ht zerved- be~w baroorsan, I-

I

j I I j msi

I

-68- Following the molecular cloning and expression of the human B7 gene B7 transfected COS cells were found to be identically stained with the anti-B7 (133) and BB-1 monoclonal antibodies and that they both precipitated the identical broad molecular band (44-54kD) strongly suggesting that they identified the same molecule (Freeman. et al.

(1989) J lnmunol. 14., 2714-2722). This observation was unexpected since the gene encoding the molecule identified by the BB-1 monoclonal antibody had been previously mapped to chromosome 12 (Katz, et al. (1985) Eur. J. Immunol. 103-6), whereas the B7 gene was located by two groups on chromosome 3 (Freeman, et al. (1992) Blood. 79, 489494; Selvakumar. et al. (1992) Immunogenetics 3i, 175-181.). Subsequently, additional discrepancies between the phenotypic expression of B7 (B7-1) and the molecule S identified by the BB-1 moncdonal antibody were noted. BB-l monoclonal antibody stained S thymic epithelial cells (Turka, et al. (1991) J. Immunol. 146. 1428-36: Munro. et S al. Blood submitted.) and keratinocytes (Nickoloff. et al (1993) J. Pauihol.142 1029- 1040: Augustin. et al. (1993) J. invest. Dermatol. 100, 275-281.) whereas anti-B7 did not. Recently. Nickoioffet al. (1993) Am. J. PaihoL 1 1029-1040. reported discordant expression of the molecule identified by the BB-1 monoclonal antibody and B7 on keratinocytes using a BB-1 and anti-B7 (B1.1 and 133) monoclonal antibodies. Nickoloffet al. also demonstrated that these BB-I positive cells did not express B7 mRNA yet bound CD28 transfected COS cells providing further support for the existence of a distinct protein :0 which binds monoclonai antibody BB-1.

The present indings confirm that there is an additional CTLA4 counter-receptor identified by the BB-1 monoclonal antibody, B7-3. and that this protein appears to be functionally distinct from B7-1 (133). Although the expression of B7-1 and B7-3 following B ceil activation appears to be concordant on B7 positive B cells, these studies demonstrate that the B7-3 molecule is also expressed on B7 negative activated B cells. More importantly.

the B7-3 molecule appears to be capable of inducing T cell proliferation without detectable S IL-2 or IL-4 production. This result is similar to the previous observation that ICAM-i could costimulate T cell proliferation without detectable IL-2 or IL-4 production (Boussiotis. V. et al J. Ex. ed. (accepted for publication)). These data indicate that the BB-1 monoclonal antibody recognizes an epitope on the B7-1 protein and that this epitope is also found on a distinct B7-3 protein, which also has costimulatory function. Phenotypic and blocking studies demonstrate that the BB-I monoclonal antibody could detect one (on B7 negative ceils) or both (on B7 positive cells) of these proteins. In contrast, the anti-B 7 monoconal antibodies. 133 and B -i detect only the B7-i protein. Taken together. these results suggest that by 48 hours post B-ceil activation by crosslinking or suriace immunog!obulin or MHC class 11. B cells exaress at least two distinct CTL.-4 bididing counter-receptors. one ident:e II II I I I II -I I -69by both anti-B7 and BB-I monclonal antibodies and the other identified only by BB-1 monoclonal antibody.

The B7-2 antigen is not detectable on activated B cells after 12 hours, but by 24 hours it is strongly expressed and functional. This molecule appears to signal via CD28 since proliferation and 1L-2 production are completely blocked by Fab anti-CD28 monoclonal antibody. At 48 hours post activation. IL-2 secretion seems to be accounted for by B7-1 costimulation, since anti-B7 monoclonal antibody completely inhibits IL-2 production.

Previous studies and results presented here demonstrate that B7 (B7-1) is neither expressed (Freedman, A.S. et al. (1987) Immunol. 137, 3260-3267; Freedman, et al.

(1991) Cell. Lmmunol. ,37, 429-437) nor capable of costimulating T cell proliferation or IL-2 Ssecretion until 48 hours post'B-cell activation. Previous studies have shown that activation of T cells via the TCR in the absence of costimulation (Gimmi, et al. (1993) Proc. Nat.

S" Acad Sci USA 90:6586-6590: Schwartz, et al. (1989) Cold Spring Harb7 S rp. Quat.

N Bioi 51 605-10; Beverly, et al. (1992) nt. Immunol. 4661-671.) and lack of IL-2 (Boussiotis, et al J. Exp. Med. (submitted); Beverly, et al. (1992) Int. Immunol. 4, 661- 671; Wood. et al. (1993)J. Exp. Med. 177, 597-603) results in anergy. If B7-1 were the only costimulatory molecule capable of inducing IL-2 secretion, T cells would be anergized within the first 24 hours following activation since there is no B7-1 present to costimulate IL-2 production. Therefore, the existence of another, early inducible costimulatory molecule.

which can costimulate IL-2 secretion during the first 24 hours would be necessary to induce an effective immune response rather than anergy. The appearance of the early CTLA4 binding counter-receptor. B7-2. between 12 and 24 hours post B cell activation, fulfills this function.

Two observations shed light on the biologic and potential clinical significance of these two additional CTLA4 binding counter-receptors. First, B7 (B7-1) deficient mouse has been developed and its antigen presenting cells were found to still bind CTLA41g (Freeman and Sharpe manuscript in preparation). This mouse is viable and isolated mononuclear cells induce detectable levels of IL-2 when cultured with T cells in virro. Therefore, an alternative CD2S costimuiatory counter-receptor or an alternative IL-2 producing pathway must be functional. Second. thus far the most effective reagents to induce antigen specific anergy in murine and human systems are CTLA4Ig and Fab anti-CD28. whereas anti-B7 monocional antibodies have been much less effective (Harding. et al. (1992) .aure 356. 607-609: Lenschow. et (1992) Science. :57 789-792: Chen. et al. (1092) C!l. 71, 1093- 1102: Tan. et al. (!993) J. Ex.. Med 177, 165-173.). These observations are also consistent witth the hothesis that alternative CTLA4iCD28 ligands capable otfinducin, IL-2 exist. and taken together with the results presented herein. suggest that all three CTLA4 bindine counter-receto:rs may be critical for the induction of T cell immunity. Furhermorc.

I

I

their blockade will likely be required for the induction of T cell anergy. Identical results have been observed in the murine system with the identification of two CTLA4 binding ligands. corresponding to the human 137-1 and 137-2 molecules. APCs in the B7 deficient mouse bind to the CTLA4 and can induce IL-2 secretion. Taken together, these observations indicate that multiple CTLA-4 binding counter-receptors exist and sequentially costimulate T cell activation in the miurine system.

EX-AMPLE 4 Cloning. Sequencing aind Expression of the B7- Anien A. Construction of cDNA Lrbrar-, *A eIDNA libraryv was consructed in the pCDMv8 vector (Seed. ,Vature. 329:S40 S:(198S7)) using poly RNA from the human anti-IgMI activated B cells as de~sc'ribed .:(Aruffo et at, Proc. Nat. Acad SciL USA4, 84:3365 (1987)). Splenic B celIls were cultured at )xl~ 20 6 cells/mi in complete culture media. {RPMiv 1640 with 10% heat inactivated fetal calf *~:.serum (ECS), 2miyl alutamine, I1 M sodium pvruvate, penicillin (100 uniitml).

strepromycin sulfate (IOQ0tg/ml) and gentarnycin sulfate (5u.g!ml),1, In tissue culture flasks and were activated by crosslinking of slg with affinity purified rabbit anti-human 1gMI coupled to Affi-Gel 702 beads (Bio-Rad), Richmond. CA) (Boyd, et al.. (1985) J ImmunoL' 1',4,1516). Activated B cells were harvested after 1/6. 112 4. 8 24, 48. 72 and 96 hours.

RiNA was prepared by homogzenizing activated B cells in a solution of 4M Quaridine *.:thioc\'anate. 0.5%1, sar-kosyl. 25mN. EDTA. pH 7-5, 0. t3% Sigma. anti -foam Ak. and 0.7% mecatoehaol R as purified from the homogenate by centrifuigation for hour at 2D 32.000 rpm through a solution of 5.7Mi CsCl, 10mMl EDTA. 25mM' Na acetate, pH 7. The pellet of RNA was dissolved in sarkosyl. 1mMv EDTA. 10mM Tris. pH 7.5 and extracted with two volumes of 50% phenol, 49%1/ chloroform, 1% isoamyl alcohol. RNA was ethanol precipitated twice. Polv (AT RNA used in cDNA library construction was purified by two cycles of oliu-o (dT)-ce-luiose selection.

Compliemrentary DNA was synthesized from 5.5u.g of anti-lgM activated human B cell DolvAVj RNA- in a reaction containing 50mNM Tris. pH- l 3M jMgCl2 10mM1 dithioithreioi. 500 vi dATP. dCTP. dGTP. dTTP. 5oiremil oiCodTl2-80 units..ml R_\asin. and 110.000 units/mI Nfolonev-il-V reverse transcriptase in a total volume of f u! at 370 for i hr. Following reverse transcrnonon. the cDN!A xas converted to double- 3 5 stranded DNA bv adiustIng the solution to 25mMlv Tis. pH 8,3. 100mMI KCI. 5miM MNu:Cl2.

'250u.\M each dATP1.,JCTP. dGTP. -FFP. 5mMk dithiothretol. 250 units. ml DNA poivmerase units'mL riaonuciease H andi incubatinQ at 16: Cor '2 hr. EDTA was addod to 18miM and -71the solution was extracted with an equal volume of 50% phenol. chloroform. 1% isoamyl alcohol. DNA was precipitated with two volumes of ethanol in the presence of ammonium acetate and with 4 micrograms of linear polyacrylamide as carrier. In addition, cDNA was svnthesized from 4.g of anti-IgM activated human B cell poly(A)+ RNA in a reaction containing 50m.M Tris, pH 8.8, 50u1g/ml oligo(dT)l2-18, 327 unitslin!l-as in, and 952 units/mI -AMNV reverse transcriptase in a total volume of IO0pul at 42" for 0.67 hr.

Following reverse transcription, the reverse transcriptase was inactivated bv hentina at 700 for 10 min. The cDNA was converted to double-stranded DNA by addingy 320u1 H')0 and 8OLil of a solution of 0.1M Tris, pH 7.5, 25mM MRCla), 0.5M KCI, 25O.uz/ml bovine serum albumin, and 50mM dithiothreitol, and adjusting the solution to 200iiM each dATP. dCTP, dGTP, dTTP, 50 units/mI MIA polymerase 1, 8 unitsimI ribonuclease H and incubatingt at 16 C for 2 hours. EDTA was added to IS mM and the solution was extracted with an equal *volume of 50 pheniol. 49 chloroform, I isoarnyl alcohol. DNA, was orecioiate.d with 0:two volumes of ethanol in the presence of 2.5M ammonium acetate and with 4 micrograms oF 15'linear polyacrvlamioe as carrier.

*The DNA from 4pIg of AMV reverse transcription and 2ug of M1,oloneyv MLV reverse transcription was combined. Non-selfcomplementary BstXKI adaptors were added to the DNA as follows: Thne double-stranded cDNA from 6u.g of polv(A7- RNA was incubated With 3.6uL g of a kinased oligonucieotide of the sequence CTTEAGAGGACA (SEQ ID NO: 15) and 2.4 :2j.ig of a kinased oligonucleotide of the sequence CTCT.AAAG (SEQ ID NO: 16) in a solution .containing 6mM'v Tris. pH 7.5. 6mMv MRCF), 5mM NaCI. 350~ig/ml bovine serum albumin.

7mM vmercaptoethaniol. 0.1mM mM dithiothreitol, 1mIM spermidine. and 600 units T14 :DNA ligase in a total volume of 0.45m1I at 150C for 16 hours. EDTA was added to 34mMy and the solution was extracted with an equal volume of 50% phenol. chloroform. 1% 2 isoamvl alcohol. DNA was precipitatedvwith- two volumes of ethanol inl the presence of 2.51.,V amnmon'um acetat.

DNA larger than 600bp was selected as follows: The adaptored D-NA was redissolved in I10mMI Tris. pH S. I1mM. EDTA. 600mM NaCl. 0. 19% sarkosyl and chreinatographed on a Sepharose CL-4B3 column in the same buffer. DNA in the void volume of the column (containing DNA greater than 600bp)) was pooled and ethanol precipitated.

The pCDM~vS vector was prepared for cDNA cloning by digestion with Bs[XI aind picatino a aarose Qge! .Xdaptored DNA from 6Lug of ooly(AfRNA was ligated to of Bst~l cu CDMS ini a solution containing 6mM%, Tris, pH 7.5 m Mu NaCI. 350ua!/mi bovine- serum albumin. 7mM mercaptoethanol. 0.1m.M ATP. 2miM dithiothreitol. 1m.M soerroidine. and 600 units T4 DNA ligase in a total volume of 1.5SmI at 150 for 24 hr. The liation reaction mixture was transf -ormedi into competent Ecoli MClI/PS and a total of 4_290.OOO independent cDNA clonesweecann -72- Plasmid DNA was prepared from a 500 ml culture of the original transformation of the cDNA library. Plasroid DNA was purified by the alkaline lysis procedure followed by twice banding in CsCI equilibrium gradients (Maniatis et al, Molecuiar Cloning: A Laboratory Manual, Cold Spring Harbor, NY (1987)).

ar In the first round of screeninm thirt 100 mim dishes of 50% confluent COS cells were transfected with 0.O5p.glml anti-JgM--v activated human B cells library DNA using the DEAE- Dextra method (Seed et al, Proc. N~ai. Acad Sci- MiS. 84:3365 (1987)). The cells were tyvpsiized and re-plated after 24 hours. After 47 hours, the cells were detached by incubation in PBSiO._5 mn.M EDTA. pH 7.4/0.02% Na azide at 37'C for 30 min. The detached cells were treated with 10 itg!ml/CTLA4Ig and CD2812 for 45 minutes at 4'C. Cells were :washed and distributed into panningz dishes coated with afffiniy-purified Goaran6-human IgG antibodv and allowed to attach at room temperature. After 3 hours, the plates were :1 .H ently washed twice! with PBS/O5mM EDTA. PH 7.4.10.02% Na azide. FCS and once Swith 0. 1 5M NaCI. 0.0 1 ?k Heoes, pH 7.4, 5% FCS. Episomal DNA was recovered from the panned cells and transformed into E. coli DH IOBJP3. The plasmid DNA was re-introduced into COS cells via spheroplast fusion as described (Seed et al, Proc. Nal A4cad ScE.LIA 84:3365 (1987)) and the cycle of expression and panning was repeated twice- In the second 7G and third rounds of selection, after 47 hours, the detached COS cells were first incubated with t-137-1 mAbs (133 and BI1.l1. 10 timI). -and COS cells expressing B37-1 were removed by a~mouse LeaG and I1cM, coated masznetic beads. COS cells were then treated with 10 jig/mI of human CTLA41g (hCTLA4Jg) and human CD281g (hCD2S1g) and human B7-2 expressinei COS cells were selected by panning on dishes with goat anti-human 12 atbdy plates- After the third round, plasmid DNA was prepared from individual colonies and transfected into COS cells by the DEAE-Dextran method. EXprFession of 137-2 on transfected COS cells o was analy zed by indirect imm unofresence with CTLA4Ig.

After the final round of selection. piasmid DNA was prepared from individual colonies. A total of 4 of 418 candidate clones contained a cDN A insert of aooroximateiv 1.2 kb. Plasmid DNA frm these four clones was transftected into COS cells. All four clones were strongly positive f or B7-2 expression by indirect immunoftuoresccnce using CTLA-IeL and flow- CtoMetric anal vsis.

3 5 The B-1-2 cDNA insert;,in cione-" 9 was sequeictd in dte pCDNl31 e!xoression vector emplo% Ing the followinc: straieev. Initial sequencing w.as pcrtorrned usinu seuuenc~pnuprimers T7. CD)MSRM (Invitrogen ihomiologous to pMNI vector sequences adjacent to thc ~I I Lim~ -73cloned B37-2 cDNA (see Table Sequencing was per-formed using dye terminator chemistry and an ABI automated DNA sequencer. (ABI, Foster City, CA). DNA sequence obtained usig these primers was used to design additional sequencing primers (see Table This 'cycle of sequencing and selection of additional primers was continued until the 137-2 cDNA was completely sequenced on both strands.

TABLE I

IN

T7(F) (SEQ ID NO:3) CDNIS(R) (SEQ ID NO:4) CDIY8 RGV(2) (SEQ ID NG1:5) HBX29-SP (2R) (SEQ 1D NO:6) :HBX29-4;P (217) (SEQ ID \N0:7) a:HBX29-5P? (SEQ ID NO:8) 4. 5PA (SEQ [D NO:9) (31A) (SEQ ID NO: 10) HBX2Q-5P(lR) (SEQ ID NO: 11) HBX2)9-3P(lR) (SEQ ID NO:12.) HBX29-5P(3-R) (SEQ ID NO: 13) HBX29-3P(IP) (SEQ ID NO:14) 5'd[TAATACcIACTCACTATAGGGj3' 5'd[ACTGGTAGGTATGGiAAGiATCCj3' 5'd[ATGCGAATCATTCCTGTcIGGC]3' 5'd[.A-AAGCCCACAGGAATGATTCG-3 5'd[CTCTCAA-A.ACCAAB CCTGA G]3' 5!d[TTAGGTCACAGCAGAAGCAGCi-3 5'dIITCTGG.AAA-CTGACA-AGACGCGj 3' 5'd[CTCAGGCT-ITGGTTITGAGAG]3' 5'd[CACTCTCTTC CCTCTC CAT TG]3 5'drGACAkAGCTOATGGAAACGTC

GIY

5'd(CAATGGAGAGGGAAGAGAGTG]3' The human B7-2 clone 29, contained an insert of 1, 1 -0 base pairs with a single long aopen reading frame of 987 nucleotides and approximately 27 riucleotides of 3' noncoding 2:sequences (Figure 8 (SEQ ID NO:lI)). The predicted amino acid sequence encoded by the a*open reading firamne of the protein is shown below the nucieutide sequence in Figzure 8. The encoded protein, human B7-2. is predicted to be 329 amino acids in length (SEQ ID NO:2).

This protein sequence exhibits many features common to other type I [a superfamnily embrane proteins. Protein translation is predicted to begin at the ATG codon (nucleotide 107-109) based on DNA homology in this region with the consensus eukairytic translation initiation site (Kozak (l01987) KwHc Aciis. Res- 15l_5 848 The amino terminus of the human B7-2 protein (amino acids 1!to 23) has tY characteristics o C a sccretor. siganal peptide with a predicted cleavage bet-weeni the alanines at positions 23 and 24 (von H-eij ne (1986) Nu!Acid Res-1:63) Processing at this site, would result in a human B-2 membrane 33bound protein of 306" am ino acid with ant unmodified molecular weight oF approximately J4 kDa. This protein would consist of an extracellular Ig- superf-amily V and C like domains, of fiom about amino acid residiue a hydrophobic transmembranc domain of from about -74- Samino acid residue 246-268 and a long cytoplasmic domain of from about amino acid residue 269-329. The homologies to the Ig superfamily are due to the two contiguous Ig-like domains in the extracellular region bound by the cysteines at positions 40 to 110 and 157 to 218. The extracellular domain also contains eight potential N-linked glycosylation sites. E coli transfected with a vector containing the cDNA insert of clone 29, encoding the human B7-2 protein, was deposited with the American Type Culture Collection (ATCC) on July 26, 1993 as Accession No. 69357.

Comparison of both the nucleotide and amino acid sequences of human B7-2 with the GenBank and EMBL databases showed that only the human and murine B7-1 proteins are related. Alignment of the three B7 protein sequences (see Figure 13) shows that human B7-2 has approximately 26% amirio acid identity with human B7-i. Figure 13 represents the comparison of the amino acid sequences for human B7-2 (hB7-2) (SEQ ID NO:2) human B 7-1 (hB7-1)(SEQ ID NO: 28 and 29) and murine B7 (mB7) (SEQ ID NO: 30 and I31.The amino acid sequences for the human B7-1 and murine B7 (referred to herein as murine BI7-) can be found in Genbank at Accession \M27533 and X60958 respectively Vertical lirnes in Figure 13 show identical amino acids between the hB7-2 and hB7-1 or mBT. Identical afin acids between hB7-1 and mB7 are not shown. The hB7-2 protein exhibits the same general structure as hB7-1 as defined by the common cysteines (positions 40 and 110, IgV domains; positions 157 and 217, IgC domain) which the Ig superfamily domains and-by many other common amino acids. Since both hB7-l and mB7 have been shown to bind to both human CTLA4 and human CD28. the amino acids in common between these two related proteins will be those necessary to comorise a CTLA4 or CD28 binding sequence. An example of .5 such a s juence would be the KCYMGRTSFD (position 81-89, hB7-2) (SEQ ID NO:17) pr KSQDNVTELYDVS (position 188-200, hB7-2) (SEQ ID NO:18). Additional related sequences are evident fro' the sequence comparison and others can be inferred by S* considering homologous related amino acids such as aspartic-acid and glutarnic acid. alanine and glycine and other recognized functionally related amino acids. The 87 sequences share a highly positive charged domain with the cytoplasmic portion WKWKKKKRPRNSYR:IKC *I (position 269-282, hB7-2) (SEQ ID NO:19) which is probably involved in intracellular signaling.

EXAMPLE Characterization of the Recombinant B7-2 Antiuen A. 17-2 Binds CTLAlg andi Not Anti-B7-I and Anti-B7- onoclona Anibodie COS cells transfected with either vector DNA (pCDNAD. or an expression nlk:sid containing B7-1 (B7- i or BT-2 (17-2 were preparez. Afte' 2 hours. the transfected COS

SI

I I m 2 a 1 -1 cells were detached by incubation in PBS containing 0.5 mMv EDTA and 0.029% Na azide for min. at 37C. Cells were analyzed for cell surface expression by indirect immunofluorescence and flow cytometric analysis using fluoroscein isothiocyanate conjugated (FITC) gzoat-anti-mouse Ig or goat-anti-human lgG FITC (Figure Cell surface expression of B7-1 was detected with mAbs 133 (anti-B37-1) and BB-1 (anti-137-l and anti- B7-3) and with CTLA41g, whereas B37-2 reacted only with CTLA4Jg. Neither of the B7 mrasfectants showed any staining with the isotype controls (12M or control IgY). The vector transfected COS cells showed no stainingz with any of the detection reaaents. In addition, none of the cells showedl any staining with the FITC labeled detection reagents and alone.

This demonstrates that B7-2 encodes a protein that is a CTLA4 counter-receptor but is .distinct from 137-1 land B7-3 RINA Blot Analysis, of B7-' Expre ssirin in U nstimulated and Activated HunhBCls ~Cell Lines, and Mvelomas Human soleniic B cells were isolated by, rernoviuT cells and m.,onocvtes as ::previously described (Freedman, Freeman. Horowitz, Daiey, 1_ Nadler. L.

J, Immunol f1987) 137:3260-3267). Splenic B cells were activated using anti-Ig beads and cells were harvested at the indicated times (Freedman et al., (1987), cited supra). Huma n ryelomas from bone marrow specimens were enriched by removing T cells and monucytes Susing E rosettes and adherence as previously described (Freeman. et aL J ImmunaL (1989) 143:2714-2722). RNA was prepared by guanidine thiocyanate homobeftization and cesium chloride cenrugation. Equal amounts of RNA (20.ie) were clectrophoresed on an _agarose LyeL blotted, and hybridized to 3 2 P-label .led B37-2 cDNA. Figure 10. Danel a. shows *..:RINA blot analysis of unstimulated and anti-Ig activated human splenic 6 cells and of cell lines inldn ai(B cell Burkirts lvmuhoma), Daudi (Bcl uKitts lVMohoma). RPM1 ***822_6 (mveloma). K562 (ery duo leukemia)_ and R-EX (T cell acute lvmonoblasiic leukernia)l.

Fiaure 10. panel b shows RINA blot analysis of human myeloma specimens.

Three MRNA transcripts of 1.35. 1 .65 and 3.0 kb were identificcd bv hvbtidization to the B7-2) cDNA (Fi-ure 10. panel RNA blot analysis demonstrated that B37-2 mRNA is.expressed in urnstimulated hum.an splenic B cceiis afid increases 4-foki foilovwin a ctivation (Figure 10. panel rnRNA was expressed in B cell neoplastic lines (Rajil Daudi'i and a my~eloma (R-PMI 8226) but not in the erythroleukemnia K562 and the T cell line REX. Ir, contrast, we have previously shown that B37-1 mRNA-I is not expressed in resigB cclV wid is transienitly expressed following activation Freeman et at. f!981) stwraV E,:n-nrtion *mRNA isolated human mvelomras demonstrates that B7_1 mRNA is Cx~relicU in C, o1 o atienis wherea B7-1 was found in only t ot"these 6 Freeman Lt al. 0 9%N) sup'J'f.- Ths. ad17--exnrcssion annears to beinecetLruat.

A

I

al I C.Costimulation Human C628. T celis were isolated by immunomag-netic bead depletion using monoclonal antibodies directed afainst B cells, natural killer cells and macrophages as described (Gixmrni, et al- (1993) Proc- Nail Acad Sci., US.4 20, 6586-6590), B7-1. 137-2 and vector transfected COS cells were harvested 72 hours after transfection, incubated with tgz/ml of mitomycin-C for 1 hour, and then extensively washed. I105 CD28S;' and T cells were incubated with I ng/ml of phorbol myristic acid (PM''VA) and the indicated numnber of COS transfectants (Figure 11). As shown in Figure 11. panel a, T cell proliferation was measured by 3 H-thymidine (I .Ci) incorporated for the last 12 hours of a 72 hour incubation. Panel b'of Figure I I shows IL-2 production by T cells as measured by ELISA (Biosource. CA) using supernatants harvested 24 hours after the intainofculture.

o e0 84 5 a a a..

be.

5 base *4 .1 D. B7-2 Costimuiation is not B 1ocked bv Anti-B37-1 and Aniti-B7-3 mAbs but is Blocked by 15 CTLA4-Tg and Anti-CID28 -Fab SHuman CID-S±- T celIls were isolated by immunomagneticb bead depl[etion using mAbs directed against B cells. natural killer cells, and macrophages as previously described (Gimmni. Freeman, Gribben. Grayi, Nadler. L.M. (1993) Proc. Na!. A4cad Sci US4 90, 6586-6590). B37- B 7-2. and vector transfected COS cells were harvested 72 .20 hours after transfection, incubated with 25,.±giml of mitomycin-C for I hour. and then extensively washed. 10~ CD28 T cells were incubated with I ng/ml of phorbol myristic acetate (PMAok) and 2 x 10- COS transfectants. Blocking agents (IOuirfMl) are indicated on the left side of igure 12 and include: 1) no monoclonal antibodv (no blocking agents), 2) mAb 133 (anci-B-7-1 mAb). 3) rnAb BB I (anti-B37-l and anti-B 7-3 rm-b), 4) mAb B n- (control 12M tnAb). 5) ani-CD2S Fab CmAb 6) CTLA-Ia. and 7) control 1g. Panel a of Figure 12 shows proliferation measured by -)H-thyrnidine (IluCi) incorporation for the last 12 husof a 72 hour incubation. Figure 12, panel b, shows IL-2 producedon as measured by ELISA (Biosource. CA) using supernatants harvested 2-1 hours after the initiation of culture.

B 7-1 and 137-2 transf'ected COS cells costimulatcd equivalent leveis ofT cell proliferation when tested at various stimulator to responder ratios (Ficure 11). Like B-7-l.

137-2 transfected COS cell costimulation resulted in the Droduciion olf L--2 u-er avwide ranac of stimulator to -aonder ceil ratios (Ficure 11). In contrast. vector Lrans. ected COS cells did not costimrulate T cell oroiiferation or IL-2 oroduction.

I .I i d W :1 1 IM I 4 E. B7-2Csiuains.~~okdb ~t-71adAt-73mb u sBokdb Humaen CPTS+ T cells were isolated by immunomagnetic bead depletion using tnAbs directed against B cells, natural killer cells, and macrophages as previously described (Gimtni, Freeman, Gibben. 1_G, Gray, Nadler, L!M_ (1993) Proc. ANatl. A cad Sci USA4 9Q, 6586-6590). B7 -L B7-2, and vector tuansfected COS cells were harvested 72 hours after transfection. incubated with 25u.g/ml of mitomy'cin-C for I hour. and then extensively washed. I O CD28-1- T cells were incubated with I rigimI of phorbol myristi~c acetate (pM VA) and_. 104 COS transfectants. Blocking agents (l0u/mi) are indicated on the left side of Figure 12 and in clude-: I) no monoclornal antibody (no blocking agents), 2) mAb 133 (anti-B7-l rnAb). 3lmA b BBlI (anti-B7- I and anti-B7-3 mAb'j. 4) mAb (control 1gMv m.Ab), 5) anti-CD 9 S Fab (mn,-b 6) CTLA-1a., and 7) conitroljga. Panel a of Figure 12 shows proliferation measured -V 3-1- mdne (I uCi) incorporation f&1 the lastI 2 hours of a 72 hour incubation. Figure 12 panel b. shows lL-2 production as measured by ELISA (Biosource, CA) using supernatants harvested 24 hours after the iitiation of Culture.

be To distinuuish B7-2 from B7-1 and B7-3, rn.Abs directed against B7-I and B7-3 were used to inhibit proliferation and IL-2 production of sub.-itogeniically activated human CD28- T cells. Both B7-1 and B7-2 COS transfectants costimulared T cell proliferation and IL-2 production (Figure MAbs 133 (Freedman, A.S. et al. (1987) supra) (anti-B7-l), and BB1 *~(Boussiotis. et al., (in review) Proc. Mad!. A cad. Sci. U'SA: Y okochi. T..:Holly, R-D-.

Clark. E.A. (1982)J Immuiol. 128 8-87) (anti-B'7- I nd anti -B 7- comoleteplv inhibi5ie ,d proliferation and IL-2 secretion Induced by B7-1 but had no effect uon costimulation by B7- S2transfected COS cells. lsotvpe matched coifrol BS mAb had no effect- To determine wk-ther B7-2 sianals via the CD28/CTLA4 pathway. anti-CID28 Fab and CTLA-l1 fusion protein were tested to determine whether they inhibited B7-2 costimulation. Both anti-CD2S8 eFab and CTLA4-ILg inhibited proliferation and IL-2 production induced by elther B7-! or B 7- 2 COS transfectants whereas control Ig fusiont protein had no effect,(Figuze 12). Wh IlIe CTLA4-iu inhibited B-1-2 costimulation of 'roliferation by, only 909%,. in other experiments inhibition was more pronouniced (98-100%). None of the blocking agentu inhibited T ceill proliferation or IL-2 production induced by the combination of PMA and i:h-yt-oiemaggiutinin.

Like acounter-receptor for the CD2S andCfLA-! T cell surface molecuies. Both proteins are stmiiar in that they are: 1) expressed on the surf -ace of APCs:- 2) structurallv related -Lo the la suce-,uene fanmilvn with an IgV and ILC domain which share 3 5 26 0 amino acid identity, and 3) cacable of costimuiating T cells to produce IL2and nrdlirerai However. B7-l and B7- differ in severail fundamental wvays. First. 3 B-2 n-RN.'.

is consthtutiveiv excressed in unstimujated B cells, whiereas B -1 mk-N.- d not aooeir II

I

I I until 4 hours and cell surface protein is not detected until 24 hours (Freedman. et al.

(1987) supra; Freeman, et al. (1989) supra). Unstimulated human B cells do not express CTLA4 counter-receptors on the cell surface- and do not costirnulate T cell proliferation (Boussiotis. et aL supra). Therefore, expression of 37-2 mRNA in unstimulated B cells would allow rapid expression of 137-2 protein on the cell surface frollowving activation, presumably from storedi mRNA or protein. Costiinulation by 137-2 transfectants is partially' sensitive to paraformaldehyde fixation, whereas 137-2 costimulation is resistant (Gimmi.

et al. (199 1) Proc. NatL -Acad. Sci. USA 6575-6579). Second, expiression of 137-1 and B71-2 in cell lines and human B cell neoplasms substantially differs. T-hird, B7-2 protein contains a longer cvtoplasmic domain than 137-1 and this could play a role in signaling B-cell differentiation. These phen~tvpic and functional differences suggest that these homologous molecules may have biologicaly distinct functions.

EXAMIPLE 6 ~Cloning and Sequencing of the -Muz-ine B37-2 Antigen A. Construction of cDNA Librarv A cDNA library was constructed in the pCDM8 vector (Seed..Vature, 329:840 (1987)) using poly A) R-NA from dibutry yci A4 (cAMIP) activated N112 cells (a 'Q murine B cell tumor li ne) as described (.Aruffo et al, Proc. NodL.4 cad. Sci. US 4:3 365 (1987)).

M1 Sel weeclue*tI16el/iiconeeuuemda I-114 with 10% heat inactivated fetal calf seium (FOS). 2mMv glutamine. I mM sodium pyruvaie.

penicillin (100 unlis!). strentomycin sulfate (I 00ugfmrl) and gentamrvcin sulfate (5 Li/ml).

in tissue culture flasks and were activated by 300uei-ml dibutrvI cAMP (Nabavi. N, et al.

1992) Na Le6(), 266-268)_ Activated Ml?2 cells were harvested after 0. 6. 12 I S.'14 and hours.

RNA was prepared by homogenizing activated N412 cells in a soluiion of 4M 'undine thiocvanate, 0-59% safkosvl. 25mMl EDTA. pH 7.5. 0.131%o Sigma anti-foamn A. and 0_7% mercaptoethanol- RNA wvas purified From the homoszenate by centn uatio for 24 hour aL 32.000 rpm through a solution of 5.7M CsCI. [0mM[ EDTA _1mM Na_'cetrae. pH 7 The Deilet of RNA was dissolved in sarkosvl 1 mM- EDTA. 10mrM Tri's. DH -1 and extracted with two volumes of phenol, 49% chloroform. 1% isoamvl alconol. IRNA was etha-nol precipitated twivc.- Poiv (A RNA used in cDNA lbayconstruction was purifie-d oby -wo cycles of ofiuo (dT)-cei!lulosc selection Complementaryv DN A was s,,nthfesized from 5.5ug ofJilbutryi cAMP activated murneMV ~l cov(7 R\Atnarecun cntinig 0mMThs.ol4 S 33 1M iKC I it S A. H E- 3mMI MulCh-, 10mMl dithiodireitol, 500tiM dATP, dCTP, dGTP, d-TP. 504'm~rl oligo(dT)12x18, 180 units/mI R-Nasin, and 10,000 units/mI %MIolonv-!,VLV reverse transcriptase in a total volume of 55u1 at 3 7"C for I hr.. Following reverse transcription, the cDNA was converted to double-strajided DNA by adjusting the solution to 25mM Ens. Ii 8.3, 100mMN KCI, _MgCh, 25OiiM'v each dATP, dCTP, dGTP, dTTP, dithinthreitol, 250 units/mI1 DNA.polv merase 1,.9-5 units/rnl ribonuciease H and incubating at 16 C for 2 hr. EDTA was added to I18mMk anid the solution was extracted with -an equal volume of 50% phenol, 49% chloroform, 1% isoamyl alcohol. DNA was precipitated with two volumes of ethanol in the presence of 2.SM ammonium acetate and with 4 micrograms of linear polvacrvlamide as carrier. Following reverse transcription, the reverse transcriptase was inactivated by heating at 70o 0 C for !0 min. The cDNA was converted to double-stranded DNAby adding _'30ul 1-1Q and S0ul of a solution of 0.l1M Tnis. pH 7 5. 2_mM MgICI'?, KCI. 2iuzm bovine serum albumnin- and 50mMX- dithiothrejtol. and adius~tinE the solution to 200i~tM each dATP. dCTP. dGTP. dTTP. 50 units,,mI DNA polymerase 1. S ITunits/!mI nibonuclease H anid incubating at 16 6C for 2 hours. EDTA was added to I S mM'v anid the solution was extracted with, an equal volume of 50% phenol, 49% chlorofo.rm, 1% .:isoamvl alcohol. DNA wvas precipitated with two volumes of ethanol in the presence of amnmonium. acetate and with 4 micrograms of linear polvacrvlIamide as carrier.

24g of non-selfcomplementam' BsLXI adaptors were added to the DNA as follows: T-he double-stranded cDNA. from. 5.5ug of poly(A). R-NA was incubated with 3 6 ug of a *SS. Kinased oligonucleotide of the sequence- CT-TAGAGCACA (SEQ ID NO0.l5' and '2 4 o a kinased oiiopucleotde of the seun2CTCTAAkAG (SEQ INO: 6 na ou'o containing 6mM\, Tris. pH 7.5. 6m.M Me4CFx 5mMk NaCI. 3 5 0.LQ rnI bovine seruLm albumin.

7mMk mercantoethanol, 0.1mM AT. 2mM dithiothicitol. 1m.M spermidine. and 600uJnits. T4 *~'DNA liuase in a total volume of 0.45m1 at 150 for 16 hours- EDTA was added to 34rMand the solution was extracted with an equal volume of 50% phenol, 49% chioroform.n I?" isoarruvi alcohol. DNA was precipitated with two volumes of ethanol in the presence of 21M.7 ammonum ace-tate.

DNA\ larger than 600bo was selected as follows: Tile adaptored DN A was redissolved in 10mM,- Th's. pH S. 1mMv EDTA. 600mM% NaCl. 01%P sarkosvi anid chromatographed on a Sepharose CL-4'B column in the same buffer. DNA in the void voium.e offthe column (containinLg DNA greater than 600bp) was pooled and ethanoloritam.

TFhe U)CDM%.S vector was orenared For cDNA cloning by digestion with BszXl and Purification on -an acarosL- gei. Adiapor-2d DNA from oru~ of olv(A7_RNAv.was ligated to oI2ua of BszX! cut :nCDMS1 in, a solution contaiining oruM%- Tris. pH 7.5. 6mM NaCl. 350uig_'mi bo-*ine serum albUMin. 7m.J mercactoethanol. .1MATP. Im~i Otiotflr:1T'ot)!. mMscertnidine-. and 600. uniis DN.A iicase in a -totai It 1I for 24 hr. Tne 1lication reaction mnixture was transformed into competent E.coli M'VC106I1/P3 and a total of 200 x 10 6 independent cDNA clones were obtained- Plasmid DNA was prepared from a 500 ml culture of the original t-rnsformation of tda.cDNA library. Plasmid DNA was purified by thie alkaline iysis proce!dure followed by Stwvice band'n in CsCI equilibriurn gradients (N[aniatis e, al. Molecutar Cloripng:A LabdraltOrvanua[. Cold SorineHar-bor. NY.(i98)) B. Clonin2 Procedure In the first round of screeniri2. thirty 100 mm dishes of 50% confluent CPS cells were transfected with 0.0pgimI activated M12 murine B ce'l iibrarv DNA ujsin2 the DEAE- ~Dextran method (Seed et al. Proc. NarLAcad Sci17 S- 3S65(19.37). The cells wr trvpsinized and re-olated after 24 hours. After 47 hours, the cel wer- dtce b s:aincubation in PBS.'0_5 mM%. EDTA. pH 7.4/:0.02% Na azide. at .37 'C ftor 30 min. T he detached .ecells were treated with 10 Lu:mLhurnan CTLA41Q and murine CD-SI2 for 45 minutes at C Cells were washed -and distributed into oanninz dishes coated with affinity-purifie~d Goat anti- *human luiG antibody, and allowed to attach at room temperature. Afte7 3 hours. the plates were aentlv washed twice with PBS/ 0.5mM EDTA-,. pH 7_-'0.021% Na azide. 5%1 ECS and once with 0.1 5\1 NaCI. 0.0 1 M Heocs, pH 7.4. 5% FCS_ Episomal DNA was recovered from the panined cells and transformed into E. col DHlI0B/P3. The plasmid DNA was re- 550ntroduce~d into COS cells ia spheropiast ibsion as descrilbed (See-d e, al. Proc. Vat. A4cadi Sci. U&4_ 84:3365 (1987)) and the cycle of expression and pannLingz was repeated twice. In -:the second and thir-d rounds Of selection. after 47 hours. the dietached COS cells were first incubated with a-murine 137-i mAb (16-IOAl, 10 Lig.m!l. and COS cellis express ing 137-1 were removed by a-mnouse liG and IEM coated macneti1c beads. COS cells were then treated *.251 with I Oua~mi of human CTLA.±lq and murine CD2-Sl~ -and murint E3-2 expressina COS acells were selected by nanirtisa on dishes coated with goat anti-numnan [leG antibody. After the third round, plasmid DNA was prepared trom individual colonies and transtected inlto COS cellts by The DE-AE-De-xrran method. Exuression of "07-2 on. transtfected COS cells was analvzed ov :nuii[r-: inmnunoflurescence with CTLA-1Ie.

After The final round of selection. olasmid DNA was oren-ared :rru i- %-idu colonte-s. A total o;f6 of S candidate clones contained a cD)NA insert r 17ar~xirnlt'v L-2 PlaSraid DNA :tromn tneSE! Z-ent clones was transiected into COS cze-lls. All; six clones wit th 1 T-1% cDNA insert were! stroneLlv positive 60r B -xFSif n. tnure immunoiLuorescence ISMinu CTLA4 1 and tlow c':torniemc C. Sequencin.' The 137-1 cDtNA insert in clone4 was sequenced in the pCDMNS expression vectoremploying the following strateigv. Initial sequencing was perforned using sequencing primers T7, CDMvSR (Tnvitrogen) homologous to pCDMS vector sequences adjacent to the S cloned 137-2 cDNA (see Table 11). Sequencing was performed using dye terminator chemistry and an ABI automated DNA sequencer. (ABI. Foster City. CA)- DNA sequence obtained using these primers was used to design additional sequencing! primers (see Table 11).

This cycle of sequencing and selection of addition al primers was continued until the mtrine B7-2 cDNA was completely sequenctd on both strands.

l0 TABLE 11 T7(F) (SEQ ID NO:3) 5 'd!TAA--TACGACTCACT.ATAGGQJS.' us. CDMS(Rl (SEQ ID N0:4) ;'dFTAA-GGTTCCTTCACAA.\

G

S MB4- I (SQ EDNO:2 1 dIACATAAGCCTGAkGTGAG TGG13S' MB1X4-2R (SEQ ID Yd,[ATGATGAGCAGCC.TC.\CAAGG1; B. MBX- 14 (SEQ ID >JO:26) N4BX4-2F (SEQ ID NO:27) S'd[GACGAG-thGTAACATACAGTGB.', A murine B 7-2 cione (m]37-2. clone 4) was obtained containing an insert of 1. 163 base pairs with a- single long open reading frame o17927, nucleotides and approximatelv 126 nucleorides oC3S noncoding sequences (Figure 14. SEQ ID N0:22). The predicted amnino acid sequenc2 encode-d by the open reading frame uf tne protein is shown uclow,% the r nucleotide sequence_ in Figure. 14. The encoded murine 137-2 DrOU!"P. is predicted to be 309 25 amino acid residues in lenczth (SEQ ID NO:23). This protein sec=7ce exhibits many features common o other- pvce fIgT suuerfamnily membrane proteins. Pr-otein translation is predicted to begin at zhe methionine codon (ATG. nucleotides 1ll to S7 !3based on the DNA homology -i this region with the consensus eucaryotic translation initiat1_qion site (set Kozak.

M. 0 9,97) YucL .4cids Res. 15:8 125-8143). The amino ter-minus oi'dhe-_ murine- B7-2 orotein (amino acids !to :asthe zharacteristics of a sec,-etor' signa! i i with a predicted *cleavage between, the alarilne at position 2-3 and the valine at posit!Ion'- ior i-ieijne (19S7) ucl. Acidls Res. 1-1:-i683S Processing at ihis site wVould rcsuil in a 21 rncnrana bound protein oc 2S6 aminoc acids having an unmodified moeua app nroximnatelv 32 kDa. This Protein WOUld consist of an aroitecreerl ivV and C 3 5 like doim.ains of frm about amino acid residu 241 1c45 a hvcirorh .t''m:irn domain of from about- armino acid residue 2417 to 265. and a ionuL Cv:rrmcOm-T rn about amino acid rcsiafie 26c) to 309. The Lhomnologies to Llic L: Surtc--;i ~i-L.w L0 rl.

two contiguous Ig-like domains in the extracellular region bound by the cysteines at positions to 110 and 157 to 216. The extracellular domain also contains nine potenitial N-linked glycosylation sites and, like murine B7-1, is probably glvcosvlated. Glycosylation of the munne B7-2 protein may increase the molecular weight to about 50-70 0~a. The cytoplasmic domai n o f murine B7-2 containas a common region which has a cysteine followed by positively charged amino acids which presumably functions as signaling or regulatory domain within an AEC. Comparison of both the nucleotide and amino acid sequences of murine B37-2 with the Gen.Bank and EMBL databases ved sgnificant homology (about 26% amino acid sequence identity) with human and murine 117-1. iMurine 10 B7-2 exhibits about 50% identitv and 67% similarity with its human homologue. h137-2. E.

cvii (DH1.0o6/p3) transfected with a vector (plasmid pmBx4) containing a cDNA insert enooinM'rn 3-2 (coe4 w dpsted with the Amer-can Tvoe Cultqre Collection (ATFCC) oniAugust 18. 1993 as Accession No. 69388.

D. Costimulation C*eCD4 murine- T cells were purified by First depleting red blood cells by treatment with Tris-NH,.CI. T cells were enriched by passage over- a nylonl wool colun. CD4 T cells were purified by two-fold treatment with a mixtrure ofanti-M-HC class HI arnd anti-CD2S Abs and rabbit complement. NMurine 137-1 (obtained from Dr. Gordon Freeman. Dana- 21) Farber Cancer In-stitute, Boston, MA, see also, Freeman. G.J. et al (1991) J, Exo,. Wcl 174, 625-63 1) murine B37-2. and vector transfected COS cells were harvested 72 hours ater rnafecion inubaedwith 25ug/Yml mitomvcin-C for one hour. and then extensively washed. 10~ murine CD4-' T cells wvere incubated with Ing/mi of phorbol rnvristic acid (PMA) and 2 x to' COS tranisfectants (Table 111). T cell proliferation wkas measured by Htyiin icroaedfrtelast 12 hours of a 72 hour inicution.

TABLE III ,H--Thvmidine Tncomonration (crm) 0 CD-17T cells17 CD_4 T cells ieml P\4\ 49 CD4! T cells COS-vector 1750 CD-! T cells -COS-B7- 1 4400 *CD4I T cells -COS-BT 2 2 36 5 CD- T cells I n niml PMIVA- COS-veotor 2)354; CD4! T cells 1 ngml PMA COS-B7-l 67935 CD4-T cels- lnge'ml PN'IA COS-B--2 433847 1 a. I1 1 I1 EX-AMPLE 7 Cnstrution and Characterization of Human B7-2 mnnaoui uinPoen A, Preparation uf Huan 37-2 0 Fuain Proteins The eXtracellular porion of htiman B7-2 was repared as a fusion protein coupled dto an irnmunciglobtifj 0 constant region. The immunoglo bulin constant region MtaVntn genetic modifications including those which reduce or eliminate effector activity inherent in the immunogiobuljn structure. Briefly, DNA encoding the extracellular portion of hB7-2 was O joined to DNA encoding the hinge., CR2 anid CH3 region ohua gyorly4 moi1e by direce muaenesis. This was accomplished as described in the f'ollowing subsections.

II

Preparation of-Chne Fusions DNA fragments correspondingz to the- DNA seauences o~f inres- wer ornae b Spolymerase chain reaction (PC R) using primer pairs de'scribed belo. In

PCP

:reactions were orepared in 100 il Final volume comp~osed ofI Tao. [ooi'.mrerase buffer (Gene Amp PCR Kit. Perkin-Elmunr/Cews. Norwalk, CT) containing primers (I u.iM each dNTPs (200 M~ each) I ng of template DNA, and Taq, poivm erase (Saiki. et al. (I9H8) Science 7-39:487-491). PCR DNA aMplifications were run on a therrnoc,:cler (--ricomp. San Diego, CA~) for-1 to 10 cycles each composed of a denaturatio stp"mnuea 4C), a renaturation step (30 seconds at 54-C), and a chain elongation step (I minute at '7 The structureC of each hiB7-2 1g genetic fusion consisted ofa signal selr'uenc.- to f'ailiztute seCretton *coupled to the extraceIllar domain of 137-2 and the hinge. CH-I and CH3' domnains of human SIQC-11 or 'gcC-.4- The IzgC gamma I and 12C gamma 4 sequences cont~ained_- nuele~otidc *chanees within the hinge region to replace: cysteine residues available ;*Or disulfide bn *formation with seine residue-s and may contain nucleotido clhanics to repiacc amino acids within the CH2 domain thought to be required for IaC binding to P c rcea:tors an-' complement activation.

Sequence analysis conifirmed strucrures ofboth arid 6ts. 2nd echn con.Struct was used to transfect 293 cells to test, transient expression. hl gG ELIS.-A csrucn~re transient expression levels aporoximateiv cqual to 1011 ng prote'inml cell szunern-.acani Cur Dotf constructs. NSO cell !ines wvere transfeczed fo r p ermanent1 CXorIeSSion 'tnL tue tusiOr PlofltCis.

C_ Genetic Consrucien of hBT-'2f Fsion Proteins PCR 2Molification wvaS used to czenerate an smtnc.c i s-eIi SLe1ueneeZ Suitable for scerton of the B

T

-Z'Ig fuion -rtin from mammrralian cL:k~. The: s ecuertcc was 11 1 I I

I

-1 I prepared from a plasmid containiniz the murine 1foG heav'. chain gene I Orland. R. etai.

(1989) Proc. NVall. .4cad. Sd. US.1 86:38333837) using the oii~mnuclootide c GGCACTAkGGTCTCCAGCTTGAGATCACAGTTCTCTCT-AC--- (SEQ ID NO: as the forward primer and tooligonucieotide C-j-TTCGGACGGGAACTTG3("O-)(E DN:)a 5~ GCEAT1TAAGGGGGGAACTT 3 pri0e) (SEQ ID NO: astan the reverse PCR orimer. The fradPRpie(SQDNO)coansrecognition sequences for restriction enzymeiits Bsal and is homologous to sequences 5' to the initiating methionine of the 1g signal sequence. The reverse POR primer (SEQ ID NO: is composed of sequences derived from the 5 end of the extraceilular domain of hiB7-2 and the 3'end of the I- signal sequence. PCR amnplification of the rnurine IQ signal template DNA using these primers resulted in a 224 bn' product which is composed of Bsa[ restriction sites followed by the sequence of the Ig signal recion fused to the first 20 nucleotides of the coding sequence of the exiracellular domain of hB7-'. The function between the signal seciuence iind hB7-2- is such that protein translation beginning at the signal sequence will continue Into and thr-ough hB 2 in the correct reading frame.

Preparation of the hB7-2 Gene Seurnent The extraceliular domain of the hB7.2 gene was prepared by PCR amplification of *piasmid containing the h3-2 cDNA inserted into eXDression vector pCDNAI (Free.man et 20 al., Science 261:909-11I (l9 The extracellular domain of 0BT-2 was prepared by PCR amplification using ol~onc~etid S-CTCTCTGku.TTCAGC3 (03)(SEQ ID NO: as the forward primer and olgonucleotide 'GC TTGT GG GAGTG GTC3(04 S(SEQ ID NO: asterever-se prime.-. The forward PCR primer contained sequences 5 corresponding to thle first, -0 nucleotides of the 137-2 extracellular domai n and thie reverse PCR primer contained sequentces corresponding to the last 22 nucleotide-s of the 137-2 extr-acellular domain followed' by a Bel I rest iction site and 7 noncodie nucleotides. PCIR amplification with primer 03 and 04 vie ids a 673 bp product corresponding to the extracellular IgV and iL7C like d omains of hB7-2 followed by a unioue Bcl I resiriction site.

'0 Th-. sienal Sequence wvas attached to dhe extracellular portion of hB7- by PC' as follows. DNA-PCR proiuc-S obtainedi above corresponding to the sienai seoucrice and the hB 2 extracellular domnain were, mixed in equirrolar amounts. denatureC' nv neatine. to0 IOCC held a: 54W for SOW to allokv the complementary ends to anneal:! dnd thc strands wvere tilled in USi-EL dNTPS i-d TFoo cc)ivmer-ase. PCR primers 01 and #"01 were added and aS the e-ntire tra2mnt noue OCR. molificationto yield a -58 ramn cmoao a Bsai rest-riction Site foi0WLloe ytesealsuec ue o h xrclua domnain of,1 h7 2followed by a Bc, I reszr.c in ste (3 .C hrual alnd Moiication of Immunoolobulin Fusion Domn Plasmid pSP7'1 I gGl was prepared by cloning the 2000 bp sc2enn of human le~l heavy, chain genomnic DNA (Ellison, et al. (1982) NucI,. Acids. Res- 10:401 -4079) it 5 the multiple cloning site of cloning vector pSP72 (Promega. Madison, WI)- Plasmid pSP721gGl contained genomic DNA encoding the CHI, hinge, CH2 and CH3 doma is of the heavy chain human IgCyl gene. PCR primers designed to ampljify the hinize-CH2-CH3 portion of the heavy chain along with the intervening DNA were prepared as follows. The forward PCR primer GACA.AAACTCACACATCTCCACCTCTCCAGGTAAGCC-3' (SEQ ID NO: contained HindlI! and Bcl rrestriction sites and was homologous to the hingze domain sequence except for Five nucleotide substitutions which would change the three cysteine residues to serines. The reverse PCR primer 5TAATACGACTCACTAT AGG- (SEQ ID NO: was identical to the commercially available T7 primer (Promena..Madison. WI).

Amplification with these primers yielded a 1050 bp fragment bounded on the 5' end by HintlIlI and BclIl restriction sites and on the 3' end by BamHl. SinaI. KpnI. Sacl. EcoRI, Cial, E-coRS and 132li1 restriction sites. This fragment contained the IQC hingye domain in which the three cysteine codons had been replaced by serine codons followed by an intron.

*the CH2 domain. an intron. the CR3 domain and additional 3'seouences. After PCR amplification, the DNA fragment was digested with Hindill and EcoRi and cloned into Sexpression vector oNR.DSH- digested with the same restriction enzymes- This created plasmid *.:pNRDSH/gGl.

A similar PCR based strategyv was used to clone the hinge-CH2-CH3 domains of *:humnan IaCgara4 constant regions. A plasmid. p428SD (Medical Research Councl.

*2S. London, Engfland) containing the complete lgCgamma4 heavy chain cenomic seauence' (Ellison.J. Buxbaui-.J. and Hood. L.E. (1981)DiV4 1: 11 -18) was used as a template for PCR amo~lification using oligonucleotide GTCC.AA-ATATCTGTCCCCCATCCCUATC ATICCCCAGGjTAA-'GC-CAACCC (S EQ ID NO: as the forward PCR primer and oligonucieotide 30 5i'GCAc 1 CCGCTCTGCCTCCC-3' (SEQ ID NO: as the reverse PCR primer. The fror-ward PCR primer (SEQ ID NO: )contains a Bc 11 restriction site followed by the coding sectuefle for *the hinge domain of laCgantma-1. Nucieotide substitutions have bee-n mIac- in th1C hing ~region to replace the cystelncs reslte.t serines. Thle reverse PCR arime- tSEQ ID NO.

.a contains a PspAl restriction sui5CCG-).PRaplfcto wt h ea~n results ini a 1179 bp DNA fr-agment. ThL PCR roduct was digested wit'l Bcu arnI Pspc l andic ligated to pNRDSHi~oGI digested wvith the same restriction enzvmcs to -nasmid 1 h I z all 'M pRDSE-i 11G. In this reaction. the- lg:C- 4 dmn elcdthe ILC-.

4 dom-in peeti pNR D SHRIagG1.

,Modification of the CH2 domain in IgC to replace amnino acids thouaht to be involved in binding to Fc receptor was accomplished as follows. Plasmid pLNRDSHVlgG I sered as template for modifications of the 12C-11 CH2 domain nnd piasmid pNRDSI-1gG4 served as template for modifications of the [gCy ,4 CR2 domain. Plasrnid pNRPDSK/1gGI was PCR amplified using a forward PCR primer (SEQ ID NO: and oligonucieotide GGGGGGAAGAGGA-AGACTGACGGTGCCCCC TCGGCTTCACGGTGCTGiAGGAAG-3' (SEQ ID NO: as the reverse PCR primer. The forward PCR primer (SEQ ID NO: has been previously described and the reverse PCR primer (SEQ IDINO: was homoiogous to Sthe amino terminal portion bf the CR2 domain of 1gG I eXCetL for five nucleotide ~.substitutions designed to change amino acids 234. 235. and 237 (Canfield, and e* Morrison, S. L (1991) J Exol. Med 173:. 1483 -149 1) from L-ou to Ala, Lea to'. Gfiu, and Gly to Ala. respectively. A-\mplification with these PCR primers will vield a 239 bo DNA 0 e 5 fragymentc consistin2 of a modified hinge domain, an intron and modified portion of the CH2 domain. Plasmid oN4RDSH/lgGlI was also PCR amplified with the CATCTCTTC CTCAGCACCTGAA.GCCGAGGGGGCACCGTCAGTCTTCCTCTTCCC CC-l' (SEQ ID NO: as the forward primer and oligoniueleotidc (SEQ ID NO: as the reverse PCR primer. The forward PCR primer (SEQ MDNO:) is complementary- to primer 62;~0 (SEQ ID .NO: and contains the five complementary nucleotide changies necessary for the CH2 amino acid replacements. The reverse PCR primer (SEQ ID NO: has been previously described. Amplification with these primes yields a S-)5 bp fragment consisting of the modified portion of the CH-2 domain, an intron, the CR3 domain, and 3'addiional sequences.

The complete ligC-, segment consisting of modified hinge domain, mnodified CH2 domain and CH3 domain was prepared by an additional PCR reaction. The purified products of the two PCR reactions above were2 mixed. denatured (1)5'C.l minute) and then renatuared seconds) to allow complementary ends of the two firagments to anneal. The strands were filled in using dNTP and Tau poiymcrase and the entire fragment amplified usinig forward PCR primer (SEQ ID NO: and reverse PCR primer (SEQ ID NO: ).The resulting fragment of 1050 bp was pur-ified, digested with Rindfil and Eco{i! and ligated to p\,RDSH previouslv digested with the saerestrititon enzymes to yield asmdp DSqji.

Two amnino acids at immunogiohulin positions 235 and 237 were change d front Leu to Giu arid Gly to Ala. respectively, within the. luCy.- C1-'2domnain to eliminate Ec receptor biLnding. Plasmid pNRDSlHIgG-! was PCR amplified using the f'orwvard primer (SEQ ID NO: )and the oilonueleotide CGCA.)CGTGACCTCAGGGGTCCG(JGAA1-A-I GAG.\uGTGVICCTTGU~jTTTTG(3'C GGA.-'CAGGkAGACTG.--TGc3TGCCCCCTCG.\ACTCAGGTGC'IGAGu.-',' SE 7(:D 1 I 1 1 I 7- i..

NO: )as the reverse primer. The forward primer has beenr pre,;iouslv; described and the reverse pimer was homologous to the amin trinal por-tion of the CH2 domain. excet. o three nucleotide substitutions designed to replace the amino acids described above. This Primer also contained a Pmnl restriction site for subsequent cloning. Amplification with these primers yields a 265 bp fra-gment composed of the modified hinge region, and intron. and the modified 5' portion of the CH2 domain.

Plasmid pNRDS-ilQG4 was also PCR amplified with the oligonucleotide

'-CCTCAGCACCTGAGTTCGAGGGGGCACCATCAGTCTCCTGTTICCCCCC

AAA ACCCAAGOGACACTCTCATGATCTCCCGGACCCCTGAGGTCACG-..GCG-3 (SEQ ID No:. as the forward primer and oligonuc leotide (SEQ IDI NO: as the reverse PCR :primer. The for-ward PCR Drimer (SEQ ID NO: )is comoiementary to Primer-- (SEQ ID NO: se* and contains the three_ complementaryv nueleotide changes necessary for the C-H2 amino acid oreplacements. The reverse PCR primer (SEQ ID NO: has been PreVIOUSlV described.

Amplifieation w.ith these primes yields a 1012 bp fragment consisting of Lt modified poi-ron the CH2 domain. an intron, the CH3 domain, and 3'additional sequiences. The complete ig&y4 segment consisting of modified hige domain, modified CH2 domain and CH-,om~ was prepared by a-n additional PCR reaction. The purified products of the two PCR reactions above were mixed, denatured (95 0 C.l minute) and then re-natured (54'C. 30 seconda) to allow complementary ends of the two fragzments to anneal. The strands were filled in using dNTP an Taq polvmerase and the entire fragment amplified using foarward PCR pImer EQI o ad reersePCR rimer (SEQ ID NO:) The resulting fragment of179hwa purified, digested with Bell and PspAl and ligated to pNRDSH- previously digested wvith the sane restriction enzymes to yield plasmid pNRDSHJTgG4m_ Ass-mbly of Final hB7-21a, enes *oThe PCR firagment corresponding to the iz signal-hB7-2 gene fuision prepared above was digzested with Bsal and BcIll restriction enzymes and ligated to DNRDSHFII2gGI.

pNRDSH/IgGlm, pNRDSH/lgG4. and pNRDSH/lgG4m oreviously-iiested w'ith Hnd IIl and Bcll. The ligated ciasmids were transformed into E. cofiJM 1H09 usin2 CaCI- comoetent cells and transfor-mants were selected on L-agar containing amopicilihn (50Lrmi: Molecular *Cloning: A Laboratory Manual (I Eds. Maniatis. Fritscn. E. and Sarnbrook. T.

Cold Spring Harbor Lort':.Plasraids isolated from thetrnfrrel.coier anaqi'.zcd bv restrictilon enzvme ciiges-loni Plasniids with the exnpected resiriction pilamici were seciuenced to veritV' all! cor-tons of the sienal-hBE7-2-ILG iCrn uionserens D. Expr-ersion Clonin of hB7-2V-ftY-;l and hR7-?C lt7zfli Thn! vaniabe and constant domains of human B7-1- were separatek, clonied into pINRDSIgIGl. These clonings were accomplished usingz PCR. The porions of 1113-2 corresponding to the variable and constant regions were determined from inr onriexo n mapping anid previously published gene structure analysis.

Humian B7-2 Variable Domain GAA CTGTCAGTGCFIT3' (SEQ ID NO:) A P L K I E L S V L (SEQ ID NO: Humnan B7-2 Constant Domain GCTA- ACTTCAGTCAA CCTTT7CTCTATAG.-G3, (SEQ ID NO: A N F S Q P ES I E (SE0 ID NO:) 01.'*5 As;sembly of hB7-2Vlu The hB7--2V domain 12 sequence wvas assembled using a PCR strategy similar to that shown above. The signal senuence was derived from the onco I geieby PCR amoliication of a plasmid containing the onco, M gene using oligonucleo tide to GCAACCGGAAGOCTTGCCACCATGOGGGjTACTGCTCACACAGAGQ.GACG-3' .4 (SEQ ID NO: as the forward PCR primer and to AGTCTC ATTGAAA\IT.AAGCTTGA- ATCTTFCA GAG GAGC CATGCTG GC C ATGCTTGGA AACAGGAG-3'(#06) (SWQ ID NO\: asthe rever-seprimer. The for-.ard PCRo:)rerc HInd III restiIction site and the amino terninalporion of the onio \1 siona sequenice. The reverse PCR (f06) contains the sequence corresponding to the 3' orton oi the onco si nal sequence- fused to the 5'end of ile hB-7-_1 IgV like domain.

The hB7-2, k~V III,- domain was obtained by.i PCR amplification, of the hB7-2 cDNA usinQ oigonucleotid 5CTC -tYTCCAA,-GCATGGCC.AGCATGGCVFCCTCTGAA GATTCAGGCTTATTTCAA-TGAGAC-T'(;(YJ) (SEQ ID NO: as ilei rorward and oliaonucleooide 30 TGTGTGTGGAATTICTCATTACTCATCA-AGC:ACTGAC AGTTCAGAA17T.CATC

-T

(SEQ ID NO )as the reverse PCR primer. P CR amplification w.-ih these orier vields the h-2IqV domain wvith a pori-Eon of the 3' end of the onco.%,f signal seouen.:,- on *the 5' end and a BclI restriction site on the -Tend- The sicrnal and 1ieV domalill ivrkcut to-et-her in a PCR reaction in wvhich cuimolar amtounts of thie onco NI siuznai and Ig' dominl DNA fragments wvc-r mixed.onue. annealel -rc; Thce strands, *jp!i u O amplification usin ITf K irmer -'05 and reverse Drimerr"1)8 vielcied a DN A tra 27Th:n coniainina a H-ind ;v on site- foilow.ed by the onc r I siu ial us& To -V -89domain foilowed by a Bcl I restriction site- This PCR fragmentj wvas digested with Hind 11 and c! an clnedInto expression vector pNRDS-IIQG~ 1 digested with the same restrictio enzymes to vield iNRDS H/B 7-2Ghz.

LL Assemnbly f hB7-)Glu Tore expression plasmid for hB37-2lgC domain was prepared as described above for the IgV domain except for- using PCR primers specific for the lgC domain. The onco, M signal sequence was prepared using oh gonucleotide 1 05 as the forward PCR primer and oligonucleotide 10 AGA-AA-TTGCTACTATT1TCAGGYJGATGAAGTTAGCCATGCTGCTCTG AACAGGAG3 rSEQ ID NO: as the reverse PCR primer. The hB7-2 IgC domain was prepared using oiixgonucleo tide C TCGTGTTTCC-AAGCATGGGGAGCATGGCTAACTTIl.GC A A C T G A A~ h T~c yv~ (SEQ ID NO: as the,- re re PCR prim er.

The two PCR products were mixed and amolified with primers 05and -fl1 to assemble the onco NI signal sequence with the hB7-2IgC domain. The PGR oroduct was subsequently digested with Hind Il and Bell and ligated to pN4RDSH/IgGl dig-ested with similar *restriction enzyvmes to yield the inal expression plasmid pNR-DSR~hB72'CICG

I.

0 E. Com petition Binding Assays W i hH m n -2 fa Fusi n Pr t ins The ability of, Iaiu Bfai-g sion proteins to comoeitivelv inhii th bindingz of biotifnvi ated-CTLA41- to immobilized 137-212 w,,as determind'optto binding assays were done as folilows and analvsed according to McPherson (McPherson.

G.A. (1985)Me 01rnao Mehi h: Soluble hCTL.A4lg was labelled with to a specic activity of approximately 2 x 106 cpmfopmol. 0B7-2-1g fusion potein was *coated overnicht onto microtiter plates at I Oug/mh in 10 mM% Tris-HCI. pHS.O. 5S ul /,weil1.

The wells wvere blocked with binding buffer (D4EIM containinq 10% heat-inactivated

FBS_

0. 1% BSA- and 50 mMBES. SH .8 for 2 h at room temperature. The- la'oeied CTLA4-l! 2 (44M) was added to each wei.n the presence or absence of unlaboeled comnoeting f2 flusion proteins. includinQ fUlileth B-1-2 fhBT-?I)u) frI-lezgth B7-i (hBh).tevral region -like diomain of B7-2 ih3- Va n the constant regi;on-like domnain. ofB hB- 2Ghz,2) and all!owed to binid fr 5. h at room temoecralur2e .v eils led D ncewv:il icecol bidin bffe an -te four imes with icc-cold PBS. Bound radioactivity waqs recveedbytreatment of thVelwt N aOH-I for 5 min and dtesolubiuizt!c natcerial D removc arno courte n a g:amma coun,c-.

The results of these assayI.s are sh"ownr in 1-i1cure iS 5 in Which both- hB-1rhz 10-20 ul and hB 7- 1 V't (30-10 M)com:n;otiiivciv iniibit th iid~ oM MTL4L bo. imont

B-

i t-tIi d rn IC L r'

AI

El3' 2 protein. hB-2-CI2-- is unable to compete with soluble CTLA-1. indicating that th- B7-'C bindinLg remion is in round in the variable-rezion like domain.

F. Competitive binding Assays for 137-1 and 137-2 fusion proteins The ability of the various recombinant C ThA4 forms to bind to hB771 or hB7-2 was assessed in a competitive binding ELIS A assay as follows. Purified recombinant hB7-Ig jiwrlnl in PBS) was bound to a Costar EIAMRA 96 well microtiter dish (Costar Corp.

Camnbridge USA) in 50 tiL overnight at room temnerature. The wells were washed three times with 200 iiL of PBS and the unbound sites blocked lbv the addition of I BSA in PBS (200/well) flor 1 hour at room temperature. Thie wells were washed as above. Biotiniviated *:~hCTLA4IgGl (ref,. NFGR.I Li/il seriLally diluted in twofodd steps to 15.6 ng'~mL: *0 was added to each well and incubated for 2.5 hours at room ten'perature. Th-- wells were washed as above. The bound biotinyiated CTLA4Ig was detected by the addi-tion- of 50 [Il of a 1:2000 dilution oF streptavidin-H-RP (Pierce Chemical Co.. Rockford. IL) for 30 minutes at room temperature- The wells were washed as above and 50-uL of ABTS (Zymed. California) added and the deveionina blue color monitored at 405 rim after 30 min- A graphic reoresenhation of a ivoical binding assay is shownj in Fiaure'l6. The ability of the various forms of CTLA4 to cornpcte wi'th biotinylated CTLA4lizGI was assessed by mixing var'.,ing amounts of the comnetina jrotein with a quantitv of biotiviated CTLA412Gl1 shown to be O non-Saturadie (I 7 numL- I .511M) and performing the2 binding assays as described above (Figure 15). A reductioni in the signal (Abs 405 nm) expected for biorinylated CTLA41gG I :7indicated a competition for bindinq to 1117-1.

Cons iderucs tne previous evidence that CTLA4 was the hi eh affinity; recen to r fo~r 3- 1 th~e avidity of binding of CTLAI and CD28 to 137-1 and 137--. was comoared- B7- -Ia or 137-2-12 was iabeiled With biotin and bound to Immobilized CTLA4-Ig in the presenct: or absence- of increasina concentrations of unlabeled B7-1-Ig or B37 V-i The experiment wvas repeated with I -'-labeled B7-1-12 or 137-24c:. Usina this solid ohase bndn assay, the; avidity of!37-2 (2.2 M) f'or CTLAJ was deter-mined to be arnroximnatelv two-f~old iereaicr than that observed for 137-1 (4.6 naMv). The experimentally determined IC; 0 O values are indicated in, the uccr rient corner of the panels. The affinity of both B -I and BI-2 or C CD2 8 was lowr and was C ltffic UIL to con fi dently determ ine.

CIEI

.ll I a -91- EXAMVNPLE 8 Pro2duction and Characteri7ation of Monoclonal Antibodies to H-umun" 17-.) 2_ Immunizations5 ,nd Cell Fusions female mice (obtained firom Taconic Labs. Germantown. NY-i were immu nized intraperitoneally with 50 ig human B7.2-lq emulsified in comple-te Freund's adiuvant (SiQma Chemical Co., St. Louis, MOj or 106 CHO,-human B-3,2 Cells per mouse- The mice were guiven two booster im1-munizations with 10-251.Lg human R 3 7.2-1g emulsified in incomplete Freund's adjuivant (Sig2ma Chemical Co., St- Louis, LMO) or CHO-human B7 cel I at fourteen day Intervals follovin2 the initial immunization for the next two months. The i-ice *were bled by retro-orbital bi~ed an~d the- sera assayed forthie presence oF antibodies reactive to *the immunogen by ELISA- aecainsi hum an 137.2-12. ELISA against hCTl_--1- was also used S*to control for la tail directed antibod% -S resoses. MICE! snovwine a stron2 serological resooinse *:were boosted intravenously via the tail vein with 25tie human h137.2-ilg dilluted in phosphate- ~'buffered saline (PBS). pH 7.2 (GIBCO. Grand Island, NY). Three to four days f-ollowing this .boost. the spleens from these m ice were fused 5:1 with SP 2!0 mvelor-na cels (American Type Culture Collection. Rockville. MD. No. CR1L8006). which are inicarnab I of secrerino12 both heav-v and liiht immunoglobujin chains (Keamnev et al- (1979) j Immunol 123: 1548).

Standard methods based unon. those developed bv K ohler and N1ilsteir. (Vautr2 (1975) t' 25f495) wereusd

OS.

I

a 4

S..

.*01 0*C B_ Atibody Scremnn 0. Afe 0-21 days. sup~r-aat ~Cm els containing hybr.do colonie from tl-,e z-uson e I e reacatt'or w'hvror fuinwre scree-ned tfor th-e aresence- ofantihodie recive to humanr B37.2 as follows: Each well of a 96 well fiat bottomed plate (Costar Corp., Cat. #'3590) was coated .I1 wit Sul cer **.well of a I ti/ihuman B. -IQ soluti'on or 5 x 104 3T3-hB7_. Cells on i~iecoated a.lates nphosphate-bufferej saline, oH72ov-iht at 4 0 C. Thehma 3.-eoltnws aspirated off, or the cels er 1os-ine to the plates withi qutarald;idhvu. a="d :1h1 wlells were washed three timIes, wi1th PBS. then blocked with I% E SA solutior (in PBS) (li.1 lIwell) for one hour at z-ooln tempr),-ature-. Following t. his biocki ng incubation_ the- welIs washed three times with PB-S and 5041 o,7 ohvbridoma supernatant was aded2 r weill 7 and incubated- for- 1.5 hou-s a[ -o-nr temperate. FoiloxwincL this i!nc'a7o" washed th-reeZ times %Vii PBS and then inCubatEcd Cor 1_5 hours- at, rnorn %vz 'S' 4I Per we ilC ofa l:4j' .00 d n of horseraodisn eoh aecnu~t a a anti-mouse e or '7 ca hoi;- chi acrcatbodie h"R P: Z% San Francisco. CA, Ve iisx'ere thn w~ashed three times- with PBS.~ :biovcu: ov a 'i minute' incubation ,"rhsS ehL,.* acid (ABTS" in 0.1 M Na-Citrate. cH 4.1 "owhch7 10 iu~.o r peoide had been added as a substrate for H-RP to detect bound antiibo&:. TFn;absorbec was then determined~ at 0D, 10 on a spectrophotometric aui,7e_-der (Dynatech. Virginia).

Three h% a-ido rn-. H-A3.1IF9, HA5.2B7' and HF2.3 D1., were ideltifie-d that produced antibodies to human BT-1 e IA3.F9 was determined to be of the luG!I isorv., iIA5.2137 was determined to be of the 1gG~b isotvpe and HF.3 D I as determined to be of the It,7G2a isotvpe. Each of these hvbrildomas were subelonied two additional time-s to inisure that thev; were monoclonal. Hvbidorn-a cells were decosited with the.4American Type Culture Collection, which meets the requirements of the Budapest Treat, on July. 19. 1994 as ATCC Accession (hvbrildoma HA-3.l1F9), ATCC Accession No (A.2 B 7' and ATCC Accession -2-31DI).

C_ Competitive EtrS *Supernatants from Mne M or!'domas HA3 _1F9. HA .B7 and HP2.SD weeruie charac-Lerized by competitive E'LISA. in which tihi ability of the moniocianal anibodiets to nibtte idieo boolated hCTLA4Iu2 to immobilized hB7-' immurioun r'usion *proteins was examined. Bi'otinviation of hCTLA4Ig was performed using P~erce lrnmunopure NHS-LC Biotin (Cat. No.2 1335). B 7-2 iromunogiobulin fusion Proieins used were: hB7.2-1lu fuil-lenuth hB7-2). hB 7.2-Vlc: (liB7- varable domain onlvi and hB712-Clgz B-2constant domain onlvi. AkB7,_1! g fusion protein was used as a control- For theL ELISA. 96 well piats were: coated withi the iq Fusion protein (00 uieloa ,20 emi solution) ovemight at room temperature. The wells were wasited threct timeswith PBS.

blocked with 10%" fetal bovine serumrn (EBS). 0. 1 bovine ser-um atoumin (BS.A. in PBS for I hour at room tempuerature. and washed aizain three times wkith PBS. To each well was 50O al of B1io-hCTLA24-lo (70 nq.tnl) and 50 ul of competitor monocionai ant;Obodsuoernatant._ Controt anuicoe',-es w.ere an anti-37-i mAb (EW3'.5D 12) anidthe at-B- *mAb B70 obtained fiomn PIarrningen). The wells were washeLd au -in aind stet'din-cnigaie-' horse radish oer-oxidase (from Pier-ce. Cm. N c_ 21, dilution. 50 ul/well) vvas aded and incubated f-or 30 minutes at room temperatur,2. 1nt! weils were washed aa2i, foblowee_ iminute incubation in 50u ii! eT welfABTS in 1.1 M' Na-liate rH .2to whic- a 1:001) dilution of30 'N hydrogen pe roxidlze n-:2 bz7 addas NaCtae C!Hn arftdy T.ee assrerc .s'n1 asurate or'-!IRP ra nc- boUhasrhnew en OD_,c on'reero~e~ uoreader _D'.nate-.h. Virainia,. Ie resu 1 -io %vn .0n Table IV bciov.- =erronstraTL_ *bat e- o.ne mnks Droduced bv I F9.

HA-5-B an a:-tic to PC~~it1% tP' Ir'niOit tr in"'lr~e 1 B C -7 Clot's ot bind toB,.

hBh sno.

L.

-EWS1.512 (ani-iP7BT mAh) Yes No NoN (anri-hB7-2) No Yes Yes No HAI I1F9 (anti41'P7-2) NO Yes Yesto K-'5.227 (anti-H 7-2) NO Yes Yes Noo HF2-SDi (anli-hB7-2) No yCS Yes No D D. Flow Cvtomti.r--v Sucem aia:nt,, zfom the h---hridonsHA F9 H A wC~l a Ed H.D: wene rso cnarac~er-jzed by flov .zr Suaemwaants collectd jam the conws Were mrcn be owcvtoe11r. on CHO and cells transfectedc to express lB7 'B2r~~ 0.h72. respectiivel';) or corvr-ol ~ase~d3T3 celis (3T3-Ne-,o,. Flow; c-;oner: a performred asfoiows: 1 x :06 Mels w-.re, washed tretimes in I 'o 8SA in PBS. then the cell wre incbated in50 alhbioasuperniatant or Culture media pe: 1 'U 06&1F% mmnutes at 4 Following the incuataion, the cells were washed three :imes withI PS:-A e~..in PBS. Ohn incubated inl 50 al, Wlorscein-conjugste goatantri-mouseln IG OFrQM earticodies (Zymed Laboratories. San Francisco. CA) at 1:50 dilution ner 1 x: 100 cs Or minutes at 4 3 C. The cells wvere then washed three tOnes in I BSA in PBS and with 1 p ar'aformaidehyde solution- The cell samotes were thnaayt on aFA'~n 6 cvtometer (eco Dickinson. Sari Jose CA). The results- show-p. in Figures 1 IS and 1 ueennrate, the monoclonai antibodies praduced by the Itbi m2iB HF23DI each bind :o hB7-2 on the surface: of Cels Hybridoma supemrnats containiina anti-humanr B7,' 'm-cs were: :z-s-LeL c ability to inhibit iiBT-2 cos-Limuiation h uman T cell In this "-sav. CDur Ce B uunn T cells were treated withomtue~ amounN o &PkA (ing"mi) to.

signai and wih CHO CeAl exoresine LB 2 on ANYi srilcoto de~>w- toovmaq H-r01 -rattop as e MMr ng i ho-" :rhcnn-7rm in TaI- .Mrsuits in Somne (3oi'r n I- anc Tm ce_"I n bor' 3~ 0 n o~iu~- Oa t m( hB-~m~s esecrCiue tTC sotm~tr SiJr ce2rhrar) to hat foun d for PMA treated1 ctlls alo:ne_ showi-m2 that thtese r-,bs inhibI: T c :oiif~t bV blocking the B7'*CD-'S csiuar ah TABLFE V Addition to CD2S3 T Ce~s h 7 -2 tmb Cp I i 0 ±MA-C iB7 92 *+P'vL--CHOtHBI- 9{20 30210 -PM *H!3 2HE__1 2 P7 1-460 HASAF9 2980o EXAMPLE 9 to1 Regression of Implanted Tumor Cells Trnfce oExr 8- ~In this examnle, ururansrecteu rB- rnserdJ5 psao"c:i eeue in tumnor regress Lon studies to exam ine the eff-ect: of expr7essi1or, o f -D7-2 on thec surrace: of.

11538 phasmacyzom'a cc (obcained from the American Type Culturc Collection.

k o&kville- MD: TIB 6o wr :ransfzted with an expression, vector containing cDNA encodfha either mouse B!7-2 loDAWf\EG03;_or B7-1 ('pNRDSF-iorpAWNl-\EO3)an d a ne-mycmn- 4 esttanc gee S~pieLr~ 1 ~tars wre sct-ed based iunon their neomvcmn resistance and ce.. surfacc e-xpr~ssion opr3 -B or B! 7-inr the Ewffior ctlis was conn-=.mee SASa vsis uslnq,.ethean art-B Or aniiB 71 antibody,-.

vnuenie'c Baib;ice.t in group L W miceise!. were usec. in xetnts des'ic to d.terie whether cel' u n'ac epression cf F37-'2 on cumor celis would re-sult in reZTrrssiOIan OE dh implanted rumor ce ls. as~ce anri nfere 15: [MSCells wvere GI BC 0. Grf and Ila:-, ULov.cL Ia IC a ocnrt -a o. 'J 1-1 C S a'~r I Y' 1101_ i O ng~ht flaLk ofep'n mouscwa emnoVCCD_ ho ovif-'ito;P aOO aL (00 rumor cellsThouSe wer-e o .erK Or 'iT'O, volumc (bv Tinear measurcm-t- ni '-et2-7 en!,C_ W"C'KO 2ors Z'Ve 7 C, dut!re days using caiipersa 2~ _Iic da:S aftrxhci .1 1 S. I a 1 11 b.

I i B time the tumor size exceeded 10 of the body mass of mice transplanted with untransfected.

control J558 cells. As shown in Figure 20, J558 cells transfected to express B7-2 on their surface were rejected by the mice. No tumor growth was observed even after three weeks.

Similar results were observed with J558 cells transfected to express B7-1 on their surface. In contrast, the untransfected (wild-type) J558 cells produced massive tumors in as little as 12 days, requiring the animal to be euthanized. This example demonstrates that cell-surface expression of B7-2 on tumor cells, such as by transfection of the tumor cells with a B7-2 cDNA, induces an anti-tumor response in naive animals that is sufficient to cause rejection of the tumor cells.

030834 *0Pe *3 50S4 0o 3 o 4 'I~ *55s 4

EOUITVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

53 3* 3 33 35 4* o 50 530433

S

I P II I !I 1 l It i -L n ii -96- SEQUENCE LISTING 9 so a s *ge 25 S S o 5 50 GENERAL INORMP-ATION:

APPLICANT:

NZA.M_ DANA-FARBER CANCER INSTITUTE STREET: 44 BINNEY STREET CITY: BOSTON STATS: MASSACHUSETTS COUNTRY: USA POSTAL CODE (ZIP): 02115 (G TELEPHONE: (617) 622-4014 TEEFAX: (617) 632-4012 NAME: RE2LIGEN CORPORATION STRET: &NE KENDALL SQUARE. BLDG 700 CITY: CARIDT0GE STATE: MASSACHUSETTS COUNTRY: USA POSTAL CODE (570): 02139 LZON (617) 225-6000 (ii) TITE OF INVENT~ION:Novel CTLA4/C02 Ligarnds a-r Uses Thereror (iii) UMBER OF SEQUENCES: 31 (iv) CORRESPONDENCE ADDRESS: ADORESSSEE: LA:IVE',7 COCEFIELO STREET: EQ State Street, Suite 510 CITY: Boston STATE: Massachusetts COUNTRY: USA ZIP: 02109 COMPUTE RDABLE FORMI: DIUNi TYPrE Fony disk COMPUTR: IBM PC comnatlfle OPERATING SYSTEM: PC-DOS/MS-DOS S DTtWflt: Pfenln Release Versicn i-ri) CURRENT APPLICATION DATA: APPLICA-ION NUNMBE-: CoSSrOtr;TON (Eii PRCR APLICATION DAT: AP±LC.-TI ON NW-!BER:~: USOS/11CI6 USCS /I9.r 39, USO 0 772 ;1E: 2-JU -1 99.= 15-A;UG-1993 0- 9 92 (viii) A:TCOAE~/AGENT INO~i;TION: -ON NUMBER: 36,27 RCOE2:;IE/C~ 7~cj?~Nr*!B: RPI-00S4CP2?C 1 I I

III

I I

I

I I *eta ~ix) TELECO Itj7NCATjoN INFORMATION: TELEPHONE: (617) 227-7400 TELEFAX: (617) 227-5941 INFOPMATTON1 FOE SEQ ID NO:1: Ui) SEQUENCE Cl"ARACTERISTICS: LENGTH: 12.20 base pairs TYPE: nucleic ac-;, S CReANDEDINESS sincle TOPOLOGY: linear Ui4) t4OLECUjLE T"zp. cfONA (ix) _cEATUZ-z:.

NAKE/KEY: CUS LOCAiON: 107..1093 SEQUENCEz DESCR7PTION: SEQ jD NO:I: CACAC-CCTGA AAC-CTTTGCT TCTCTGCTC-C TGTAACAGGG ACTA~CACAC. A'CACACrGCAT a at p a a a S 35 5 .aa..t a C GAGTGCCCTC ATTTCCAGAT A-TALGGTCA-C AGCAGAAC-CA CAG TGC ACT ATG GGCA CTG AGT IAC ATT CTC TIT Gin C-:s Thr Met GIv Leti Ser Asn lie Leu Phe CTC C GGT C-CT C-CT CCT CCC- AAC- ATT CAA C-CT Leti Ser Glv Ala Ala Pro Leti Lvs Ile GinAl 20 C-CC;AA ATC C-IT CC': Me-- Aso Prc CCC ATC C-CC =CC CCC- Val Met Ala ?he Leti TAT TIC AT GAG AC: T-vr Phe AsnCG---h G .CCA GAOC CTG CCA.: TGC CAA T_7T C-CA A'AC TCT CAA-- A.C cA C- Asn Gi- Ala Asc Lau Pro GAG GTA GTA Clu Laui Val Val GTA TAC TT.A -CC Val Tyr Leu C-I- Cv.s Gla Phe .4-a Asn Ser CC C7S *aCT G Ser 7 au Sem TTT TGG CAC- CAC CA1G GAA AAC 77G -77 C'7- AA G'P TeT=~ C-n As-. C-lu Asn Lei- Val L e As n G-i" 6 AAA C-AC AAA CCCT GA: ACT CG-T CAT TCC -7AC TAT A7G L-,S C-luLs M S; Ser i.aL S.--ers S 7 53 so 307 S c CGC MCA AGT Ara Thr Sar T= CAT CCC 2. U C-AC ACT CCC ACO AC-A. 0T ZT A-r Hcuis As- 403 I I I I I i I V.

CAG ATC AAG Gin lie Lye GAC AAG Asp Lys 105 GGC FFG TAT L-AA TGT ATC ATC CAT Cly Len Tyr Gin Cys lie Ile His

CACAA

His Lye 115z AAG CCC ACA GGA ATG AT? CCC ATO CAC Lye Pro Thr C>v Met le Arc le His 120 ArC AAT TCT CAA LTG TLA Met Asn 5cr Gln Len Ser 130 GTG CTT CCT AAL TTC AGT CAA COT CAA AT.A GTA CLAk AT? Val Len Ala Asn Phe 5cr Gin Pro Gin Ile Val Pro ie 135 140 TLT AAT ATA 5cr Ago lie CAC GG7 TAC His Glv Tyr 547 ALA GAA AAT Thr Gin Aen 150 GT'G TAC ATlA AAT TTG AC'L TOO Val T-.rr Tie Asn Leu Thr Lye TCA TCrT' ATA 5cr 5cr lie 160 944O 259 CLA GAA COT AC AAG ATG Pro GIn Pro Lye Lye Met: TO CIA ACA ALL AAG AAT TOA ACT Val Len Len Ara Thr Lye Ago 5cr Thr- GAG TAT CAT CC? AT? ATG LAG AAA TOT CAA CAT AT CT C ACA Ginu Tvjr AsC 7- Mat Gin LYe 5cr Gin Aso Asa Val CTC TAL GAL CT? TCO A TC AC-C TTO TCT Len Tyr Asp Val. 5cr le 5cr Len 5cr 200 CA ITO LOT CAT 5cr Phe Pro Asp

ACG

Val Thr 2 9* a I 4 68 .330 08 4t

I

44 2 .4 St S *6 AGC AlT ATOG ACC ATL TTCL TOT 5cr Aen Met: Thr _le P. c Cys 215 ATT CTG Tic Len 220 GAG CTT Gln Len 235 GZOA ACT GAO AAO Gln Thr Asc; L-rs ACG COG CT? 225S 787 ITA TOT TCA Len Se- Se0r 230 OCT -7T!C TOT ATA Pro Phe 5cr ile GAG GC CC? LAG CCC CC-A Gin Asp Pro Gin Pro Pro Pro GC CAL AT? LOT TGC AT A 4S 7! ije Pro rp 71- GCT GTA OT: CA Al1a Val Len Pro ACA G3T7 Thr Tal AT? ATA TGT lie Crc ATC TTL TGT Met- Val P-ile Lye Len LTA TGG AA Len Tm-- Lye AA- AAC- AA-G Lye Lys Lye LvsAr GA G 1 9 0 1 4 5 cL?- Al TLT Pro Arc zAsn 5cr A;m !3 GCCGG.A ACOC Lys Lye C>L Thr ALA AT-G GA G AGOC Thr NAet: Ginu Arc 9,79 ACT GAA: LA G 5cr Glun lZO _GO AAA A-A Gl Lye Lye A rc= G -n- P20 LA? AA CC? r1~ -g rn;~ Gin. Arc 5 mc Ago Gi Ala Ar: Tel7 P e 5r Ser hw -hr 1 11 I I I A .1 a I I I

C

C

0, 0I

C.

*4 Ii

B

a .3 0 AACT GAT ACA TGT TTT TAATTAA-AGA GTAAAGCCCA AAAAAAA Lys Ser Asp Thr Cys Phe 325 INFOPr4ATT ON FOR SEQ TD2 NO:2: SEQUENCE CHJARACTERISTICS: 0 LENGTH: 32'9 amino acids TYE: amino acid TOPOLOGY: linear (ii) MOL-ECUE TYPE: rrotein ,xi) SEQUENCE DFiSCRIPTION: SEQ ID N'O:2: Met Aso Pro Gin Cys Thr Met Gly Leu Ser Asn lie La,-uP 1 Ala Phe Leu Leu Ser GI-1 Ala Ala Pro Leu LVS Tie 1A 20 25 Asn Glu Thr Ala AsD Leiu Pro Cvs Gin 'e Ala .sn' 5cr CGi: 40 Ser Leu Ser C-lu Leu Val Val. Phe To G-in zsn Cin C-lu Asn 50 DD 6D Leu Asn Cl-u Val Tyr Lea Clv Lvs Clu Lvs Ph e Asp Ser Val 5570 Lvs Tir Met Glv Ariz Thr Sem Phe Aso Ser Aso 5cr Tm-- -h 90 Leu His Asp. Leu Gin lie Lys Aso Lvs Glv Leu Gin' Cvs 100 105 His His Lvs Lvs Pro Thr Glv Me:- -ie Ara lie His Giln Me: Glu Leu Ser Val Leu Ala Asn Ph"e 5cr C-In Pro GlU 130 1, 14 Ser ASn- Tie Tr rClu As- V/al Tr 7 -Un T-u C--s Qe." 145 150 His Pr G C1u ?ro L-vs Lvs Me' Se- e r Asi- Ser Th r T 1e Trs= -vl~e Me: i v-s Sc Val Thr Glu L eu Tyr As: Va I Ser 71 e Ser Lai- Se: r S-r Do0 20C5 eVa! 5 a 7,r 0--u 14en Val Ara 1120 I I a I 1I1

III

Aspo Thr 225 Pro Ile Lys *CArg G1.

305 ae, Ser (2) -100- Val T1hr Ser Asn Met Thr Ile Phe Cys 210 215 Arg Leu Leu Ser Ser pro Phe Ser Ile 230 Pro Pro AsD p4-s Ile 2::o TIrs lie Thr 245 250 Ile Cys Val Met Val Phe Cys Leu Ile 260 265 Lys Arc pro Asn Ser Tyr Lys CYS 275 260 Giu Clu Se- G-l CGin Thr Lys Lys A-rg 29025 Ara- Ser As G -lu Ala G-in Val Pha 3 Cvs Aso Llis Ser Asz Thr Cys Pbs 325 INFCpORMATION 0CP SEQ TD NO:3: SEQENCE C2:ARACTEPIESTICS: L-ENGT?:: 20 base zairs (a)TTP:nucleic acid STRANDEONESS: S4"c-l TC-POLCC-'Y-: linear 4 MOLE2ULE TYPS: olicornucec"e C-lu Thr Glu Aso Leu Pro Lvs Tr 270 Asn Th r 295 ,le His Ser L*/S

'I

a.

*1

SI

0@

S.

I

0

*OS

0

CI

~0 ii

I.

*300

I,

10

B

a 3' 105 a a (x SEUENC DEC CN EQ ID NO:3: TAATACGACT

CA:'CTA--C-

7NCItAO SEQ 7D NC :4: fl) SEQUENCE C

-S

(A-3 base pa:.rs (ii? >!LECU-LE (xr}SEQ. uN:SEQ H; ITC:-: I I 1 1 h 25 3 5 ThAAGGTTCCT TCACAc INFORMATIONr FOR SEQ ID C)SEQUENCE CHACTEpRISTICS: LENGTE:. 21 base pairs TYPE. nucleic acid ST2-A NEDUESS: si ngle TOPOLOGY: linear (ii) MOLECULE TYPE: o1±conuclectide (xi) SEQUENCZ: DESCR7PTION: SEQ ID ACTGGTAGGT A7TGGAAGPTC

C

INFORMAkTlOv FOR SEQ ID NO:6- SEQUENCE CKAACTlS7C ENOT: 21base cairs (B)TYE:nucleic acid S=_IDEMMSs :S~gle TOPOLOGY: linear MOLECULE TYfPE: oligon'ucleotide (xi) SEQUENICE7 DESCRIPTION: SEQ MD NO:G: ATGCGAATCA TT-CCT-GTGGG C INFO~rP.LTIoi =OR. SEQ ID JC: 7: Wi SEQUENCE CH:_C=ERT~S77" LENG7h: 21. base cairs 7YPE: nucleic acid (Cj STR TDEDNESS: sinale TOPOLOGY: linlear MOLE=Y. TYPE: olicanucleotide Px:) SEQUENCE DESC-PIPTON: 5rQ _7)INO 7'C CCC7 A)L*N-7 a S Iar I I I IN -102- SRNENS:singale TO2OLOGY: linear (ii) MOLECULE TYPE: cliqanuclectide 00

S

000 SEQUENCE DESCR I1PTION: SEQ T 10:1 CTCTCAA.AAC OAA:,O-OOTGA G INFORMIATION FOP. SEQ 1D NO:9: U SEQUENCE C.i -v-RrpS"CS- U: LENC-E: 21 base pairs YPE:nu i-4 acid STPA,%DEMNESS: Sing;le (DI TOPOLOGY: lin~ear (i LELETYPE: ci~ulerd (xi) SEQE:ECE DOESCR:PTION: SEQ ID NO:9: TTAGGTCA GC;GAGC:,G C INFOP_!.j7TIo,~FRSQI (ii SEQUENCE cHA?aCTE=RSIS A)LEN GTIH: 21 base pairs YPE:nuc--elG ac-n STR.N DEDNEmSS: sni TOPOLOGY: linear (II M-OLECCE TYPE:oiace in SEQUENCE E:CEP2QOTD NO: I.

=rTH n' D'CS zc a i C a c ~o7 I~c ealI 2E1 Rol i) SEQUENCE DESCR:7?T!CIn SEQ ID NO:11: CTCAGGCTTT C-C-TTOTCAGA G2 INFQP"4ATICN FOR SEQ TD '70:12: SEQUZNCE CHAPACTERISTIS: LENGTIE: 2! base pairs '27E: micleic acid STPuIDEDSS: Single TO"POLCGY: .lnear ii) MOLE=UE TP*o 1 iacnucleotzide xi) SEUEC DESC7.7P7TIO: SE T~ D ',T:2 CACTCTCrc G 21 =op 24rc z O SQI N:3

N

i)SEQUENCE COA'-RACSI-rRSTS CA)T~'O~.21 base uairs TY2E: rnuclaic acid STPAADED)NESS: single OCLC:linear (ii) MOLECTL. TDE: Cligonucleotide (Xi) SEQ=.rN'_ SESz7T7~tr: SE Q 1D NO:13: 7 !F)R S-QEZ) CEEATSTCS LENC-7: 21 base nairs (rn near CA;ATGGAG-. C- N-O r. r LI

I

-104- LENGT: base pairs nucleic acid ST im s s: s 4-nc',e TOPOLOG-Y: 1-4-,aV M'LE=--T TYPE: oligcnuclectide (Xi) SEQUEN;CE OESCRJTyIoj~1: TD 140:!E: CTTUAGAGCA CA 1 466.: IN--~VTC 5-P SQ 7D N-O:IS *(A)LENGOTH: 8 b-ase ra-'rs 0 TYPE: flC4c acid SacEmS;sina..o Li), MOF-1L T o-?Z DNA xi) EQECE E=SC:;ZPT70ri; SEQ 1D NC:16:

CTCTAAAC

D D:,-,:kTCN H~ S -D .TC)-7 C"--IT CTEaminoYcis: iS arL cids 7 DOLGY linear Clo~ij W SEQ. D0 MC~ T r Ty r Sr Abc S P 1- S-,C-H am al~ -105- (x)SEQU_-;CE DESCR7ZPG: SEQ ID NO,-12: Lys Ser G-In Azz ASr. Val 'T*r Glu Lys T'vr Asz Val ser D~jFOR-4AT7O!. ='OR SEQ N;G:19: SEQzUEN C 2?CTEESTCS.

1S amr's acids 17E: ar-nc acici TOPOLOG-Y: linear (xf) SEQUENCE DES:rC..r 5 Q tzIO:12 ()SEQU=E 7CZ (7ACERSTZ LE NGT?: 17 base La4 rS TYPE172: rnuc-eic acid ST (C DNSS si:,gl JO(D) TOPO~LCY liea 3i TGGCcCATGG r SEUEN~CE CH;RA---7--

(D)

SEQ -7C 2 r

I_

,I I .1I 1 -106- 21 INOPN=1TC1" SZQ ID ITO:22 SE7Q=. CF ACTER.STCS: LE=T-: base p~airs r"1E ucleic acid (C sT=2mflEDNE-.sS: doubJla TCOLCCOY: 4 aear Ciiiz MOLE C77- n'D CiE cDT1

C

CC 5 0 CC *5.C

C

0= C 0*P* 0* C

C.

SSCC*

4* 4 ""-7ME'Ey: CDs (xiiSEQENC DEC PC~:SEQ ID 110:22: rACC~C CPCAC-r AC AGC7G-GC--CG AACAG W TC CAG AA~. G AGCAC.-- CC;G rT GC" n 'r a--0 AC-s Me G leLL,7e 2he al rVa.

?.30 AT-2 TCCM:GTTO T GAG ACG C! A -CT T:T Le,: ie r AS:3 a> ;aI Ser Val G 1 Th GI r Al a GC! Ac__ r- 7T; C: AAC- CC CAA ':C 2ro Thr Lvs a> GinAe GAG TC-_ CA C rn- Z- As -e Ga.. Le"

CAAAACGT

G--:HsT- Lu G17 T_r Glu LY-S _7 -A CTG CT C=O G

T=T

4 GAT-7 7 se=,f C I

I

El I I I IA~ AAGC-CCA CCC AT? AC -am- ~C CAGAC CAA c Lvs Pr:,'Pro Th, Ser 71- e 115 -,20 eLe': Gin Gin Thr 125 .Leu 7-'r Gl2u 130 CTG C-C CA G A Leu Ala Gb As 145 T-A GTG MCC CC AA C TCA GAA CC? GAA ATA AAA, Ser Val T'e A'a A_-n The r G7U VPro C-u it Lvs 1.2.4 4G GTA c -7 GG Val Ser 7.I A-T TCG A;,CC C 77a so Leu T-*hr C-is Se 7-s C-L. G-Tv C2C- AAG G 7= Dro Lvs P-c L*/s Lv*,S T -r- P'he Leu Ile 0* 0 a 0010 *0 A=~s Ser T r A s.

T. -f 644 Clu Gv C-AC AA no n~ 7, e -C AA C-AC 7 t C-AC CCC 00 *0 c.7 A~ 2C c c-7 -C GC C2 c c ::is Me Thr Val Val C-zs V I 30 e C? S-ar Me!- 7

TTT-

C-!TC- O 2 4 0 210 Li,,AC GAIG AC CCCAr C- ;-aC c-e 7, T r. -S rZ G r 222 G;0- ;ti-sc ~Q 2~G'2- *1 FL

I

Op.

A i N 1 1 .5 2

EL~

5 :Z z-

ZZ

=77 7-j E:z T '1 C77

TA

Ct cc 8a~s*o *0 S 4* 0

S.

00 0

G~P.

~0 0 *0 0 no 0* a 0 7 aTT 17D Z jj U-wz- Ll r' 7 C:7 CZ3u

CI

Sol- I I I I 1P 1C .1.E -109- 2le Ser Sen Lys Pro Leu As Phe Thr Gin Glu Phe Pro Ser Pro Gin 225 230 235 240 Thr Tyr Tp Lys Glu Ile Thr Ala 5r Val Thr Val Ala Leu Lea Leu 245 250 255 Val MeC Leu Leu Ile ile Val Cvs His Lys Lys Pro Asn Gin Pro Ser 260 265 270 Arg Pro Ser Asn Thr Ala Ser Lys Leu Glu Azg Asp Ser Asn Ala Asp 275 280 285 Arg Glu Thr le Asn Leu Lys Glu Leu Glu Pro Gin Ile Ala Ser Ala 290 295 300 J 5: Lys Pro Asn Ala Glu 305 2C ENFaTICo FOR SEQ ID NC:24: szgUNcE C2LP~~,ACr~EE sTI :c LENTH: 21 base mairs TYPE: ucleic acid STRAIN-DEDNSS singLe TOPOLOGY: linear (ii) MOLECULE TYPE: oligcnucleotide a (xi) SEQUENCE DESC 7?T!Obf: SEQ 1D NO:24: ACATALAGCCT CAC-T7GAGCTG C 2 INFORMATION FOR SEQ ID NO: Ci) SEQUENCE CBAACTPJRS7TCS: LENGT: 21 base _a rs TYPE: nuclec acid TOOLOGY: linear 4 f )ii) I OLE C-TL P E: cliccc2ectide SEQUNCE DEEC ~TICC: S~ ~D ATGTGAC-C GCATCACAG

S

tI; i -D 'CSE -110- Wi SEQUENCE C.iARACTERISTICS: LENGTHi: 21 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: aIiaonucleo tide (xi) SEQ1ENCE DESCRIPTION: SEQ ID NO:26: TGC-TCGAGTG AC-TCCGA ATA C 21 !NFORP-TIOTN FOR SEQ 7D NO:27: ~SW-QT1-MCE CEA~uACTE=RIS'--CS: 16 M LENG=~ base zDa-rs n icleic acid STRANDEDNESS: sincle TOCPOLOGYI: linear i'jMOLECULE TYPE: oligoonucleotide 9 0 xi SEQEQUE iD CESRITI: SEQIDNO2 LACC--GTAC-T 1AAAA-19 Cae-a (vi) Oz FOR SEQ .L SCOS- LCTE S: 1491c baenar OLCE TYPE: Bcel c mM CELL TLE I go 1I1lL (vii) Il'flDIATE SOURCE: LIBRARY: cDNA in pc~N8 vector CLONE: B7, Raji clone #13 (viii) POSITION IN OENOOME: CHROMOSOM/SEG4NT: 3 (ix) FEAT-UE: NAME/KEY: Open reading frame (translated region) LOCATION: 318 to 11-81 ho) IDENTIFICATION eMETHOD: similarir-;. to other pattern

FE-ATURE:

NAME/KE-Y: Alternate volvadenylation sigoal LOCATION: 1474 to 1472 ho IDENTIFTUaLTION METHOD: similarity to other nattern PUBLICAT ION INFORMATI-ON: AUT11HORS FRPEEMAN, GORDON j.

FREEDMAN, ARNOLD S.- SEGIL, JEFFREY M- LEE, GRACE WHITMAN, JAMIES F 30 NADLER, LEE N.

TITLE: 97, A Niaw Member- Of The ig Superfamily W~itb Uniquae Exnression On. Activated And Neonlastic B cells 3 5 JOURNAL: The Journal of Imounolccv VOLUME: 143

ISE

Ol a F)PAGES: 2714-2722 DATE: 15-OCT-1989 RELEVANT RE=SIDUES in SEQ TO NC:22: FROM 1 TO 1491 4 CCAAAGAAAA:' AGTC-.ATTTrGT CATTG=CTITA TAGCTTAAGGAGAACA TCCGAC GGAGTCYTAC CCTGAIATCA AAGA7TTAA. A7GAAAAAGTG GzAATTTTTCC- TCACAC-C ATCCACAAC TGGGC CGACACC CCCXB -TCTC '.2?CTT GTAA:ACTCA CTGGA:1GSGTC TC7CTACGTG3A GCAATCCC-AT TG7TCA.TCAOC CCGf---T240 T-7GC=G GAAGTCCCCT CGTACGTCCAAAT 7n=C7 300 I IIII I II

I

-112'- CCTAAGCATC TGAAGCC ATG GGC CAC ACA CGc- AGG CAG GGA ACA TCA CCA TCC 353 Met Gly His Thr Arg Arg Gin Gly Thr Ser Pro Ser AAG TGT CCA TAC CTG TTC TTT CAC CTC TC- GTG CTG GCC C-CT CTT 401 Lys Cys Pro Tyr Leu Asn Phe Phe Gin Lau Leu Val Lau -15 TCT CAC TTIC TGT TCA GGT c-TT AT C CAC CTG ACC AAG GAA Ser His Phe Cys Ser Gly Val Ile His Val Thr Lys Glu -S 2. 5 2V esee *3 0 GTG GCA ACG CTG TCC TGI? GG? CAC Val Ala Thr Leu Ser Cvs GJly His AAT GTT TCT GA.A Asn Val Ser Val Glu Ala Cly Lau GrTC- AAA GAA Val Lvs Glu GAG CTC- GCA Giln Letu Ala CTG ACT AT-- CCC ACC ATC Thr I- CAA ACT CGC A:T? TAC TGG CA-a AAG GAG Aa.G AAa AG GTG Gin T~ir r Tyr I G-rnG Lvs Glu Lvs Lvs Met Val ATC TC77 CCC GAC ATG AAT ATA Met Ser Glv Asu MeL Asn lie CCC GAG TAC PAC Pro Glu Tyr Lys 0* *3*t

U

*S0* 00 0 40

OG

o TTT G=? Phe AsD ATC ACT- AAT AAC CTC TC? AT? GTG ATC CTC GCC C-G CGC CcA: Ile Thr Asn Asn Letu Ser lie Val Ile Leu Al1a Leu Ara Pro GAC GAG GCAA TAC GAG TGT GTT GTTP ASo GIt: GlV Thr T-,r Giu Cvs Val Val AG TAT GA AAA Lvs Tv.r Lvz GC= TC AAG CGG GA.A CAC CTG GCT CP.A GTC ACC TTAm TC2 A Ala te Lvs Ar;= Glu His Leu Ala Gin VJal Thr Len: Ser Val A--A G Lvs Ala GAC TTC CCT ACA CC? AGT ATA TCT CA:C TTT7Gz- CAT Aso Pne Pr-o Thr Pro Ser Ile Ser Asp ?he GCl Pr Thr Ser Asn G.-AC CC-- Car PiTT-- AGA AC-C

T

TCs ?7CA: ACC Ser Thr TCT CCA: =C S ar j7 1C7

II

L .1

I

1 1 A L

I

CTC TCC Leu Ser 140 GI1T TCC Val Ser 155 TGG TG GA AT GG GAAGAA-113- TGGTTGGA GA AA AATTA AAT CC ATc A;AC ACAAA TrpD Leu Glu Asn Gly Giu Glu Leu Asn Ala Ile ;Asn Thr Thr 145 150 CAA GAT CCT GAA ACT GAG CTC TAT GCT GTT AGC AGC AAA CTC- Gin Asu Pro C-lu Thr Glu Leu Tyr Ala Val Ser Ser Lys Leu 160 165; 170 G-AT TTC AAT ATG ACA ACC AAC CAC AC-C TTC ATC TGT CTC ATC AAC- TAT Aso Phe Asn Met Thr Thr AstI His Ser Phe Met CvS Leu ile Lys Tyr 175 1830 185 GC-A CAT TTA AG-A GTC- A T CAG ACC TTC AAC TC-C ACA Giv 1-is Leu Val Asn Gin Thr Phe Asn Tr,-o Asn Thr 190 195 GAG CAT TTT CCT GAT AAC CTG C-C CCA TCC TGGC C AT Clu His Phe Pzro Asu ASr. Leu L~u Pro Ser Trp Ala iie 205 210 r ACC AA- C)A Thr Lys Gln 200 ACC TTA ATC Th~ z eu ile TCA AAT CC-A ATT? TTT C-TG ATA TGC TGC CTG ACC TAC TC-C T? Ser Val Asn Gly r1.e Ph Val Ile Cys Cys Leu Thr Tvr C7/s Phe 220 22S 230 CCA AC-A TGC ACA C-AG AC-A, AGGC A-C PLAT GAG AC-! TTG AC-A ACC -AA Pro Arg Cvs Ara C-lu Ara Arg Ara Asn C-lu Ara Leu Arg- Ar= C-lu 235 240 .245 GTA CC-C CCT C-TA, TACAC-TGTC CC.CAGAAC-CA AC-CGc--AAA

-GTA

Val Arc Pro Val

CC

Ala

AG?

Ser 250 1025 1073 11*;1) 1169 1221 GGTAGCCTCC: CTCA-CCCTT- CTC-C-CATACA TC-CATCGTG- C-SATCATGA- CC-CACTCTTCC 1287 4~00 CTT?,AC;AA'- TTa-C-CT0- TCACCCaCTA CCTCACCTCC T7AAAACCC- CCCCAc-ATT 1341 ?C-CC-XCA TC~~z~C CGCCC-,C CCTCTCCCT CCCAA G7TC-T10 AATTCATTA:- C-AAC

TATGA

5 (31' INFOPMATION FOR SEQ NO:S, 1-49i I M U -b A Wi SEQUENCE CFIARACTERISTICS: LENGTHi: 282 amino acids TY.PE-: amn no acid TOPOLOGY;,' linear (iMOLECULE TYPE: nrotein CA) DESCRIPTION: B cellI activation antigen; natural ligand for CD22 T cell surface antigen; transrnembrane orotelr.

(iX) FEATUIRE: NAtqE-/-KEY: signal s,.N-uence LOC:AT7I: -3-4 o -1 IDENU-FTC:ATION METHOD: amino terminal secuencing of soluble orotein (DCOTERTNORMTW h,/drcohobic

AU

a IS S a. C (ix) EA CEJRE: NAMEKEY:ext-racelu-la' domain LOCATION: 1 to IDE T7CATCN !MET.L.OD: similaritv with known seauerice (ix) FEATUP NAMEKEY:tralsmenrane domain LOCATIONI: 209 to 235 IDEN:F:CTION>~ETOD:sim' 1ari'tv wit', known;seouence Ii)FAURE NAME/.E': -4-cracellular domain LOCATIM.: 236 c 254 DE-ECAONMETHOD: similariztv withI Known1 sequence FE.A E-.

LOCAYCM 1 to ZDE~t~:ZCO MCEO: ~marz: kto~ro-n 7.s e"Iy' CA) NAME/KEY: ZA.'CoSv1at~On I

I

~19 a LOCATION: 55 to 57 IDENTIFICATION METHOD: Similaritv with known senruence (ix) FEATnm: NTAME/KE-Y: N-li7-ked glycosylatiJon LOCATION: 64 to 66 IDENTIFICATION METHOD: similar-ity wirh known seq-uence (iX) FEATtD-IE: NAME-/KZ-Y: N-i1inkled clycosylation LOCATIONq: !S2 to 154 IDEN7TIFI-CATION METHLOD: similaritv with known s ecruence (ix) FEATUPE: NAMEvl/:KEy: N ]inked givcosvlatcIo .2w LOCATION: 173 to 175 IDEN IFICATION ME'THIOD: similarity with known se-uefce (iX) FAu

C

S..

a a (A'I NAME N- 1inked glycosylation LOCATION.: 177- tc 1~79 IDENTI-FICATIOCN METHOD: similarity with known (i)FEATELPE: NAE/E i -k-d glycvoo .1atlor LOCATION: 19 to 1-94 IDE)=N-!CIOAT-ON MEITHOD: similaricyvwit-! nw (i ==7,7R ()LOCA:TION; 133 to 200 ::A:FBED ijaiywt rw I I I I aI -116- (ix) FEATURE: NAM2-/-IEEYz TIn V-set dcm,-a-4 LOCATION: 1 to 104 IDENTIFCATION METE-OD: si.milarity with knIow'n seauence (ix) FEA'T'U-.

.0 CA) NAIE/KEY: Iaq C-set doma=n LOCATION: 105 to 202 IDENTETTr-ICATION MT-D:similarity with known sentience PUBLICATION ~~'n~ZN

AJTORS:

*0S* .e S. I PErAG.CRDO'N J.

F~EED6A, ;.RNOLD S- LEE. M.AC (Rj TITLE: ANew Memtet- Of The !a Sunerfamily xi:h tlnicnue Exacresslar2 On Activated And Neoolastic Cells JOURNA-L: Tejo,,=ai of immunolOa; VCLINE: 4 (E ISSUE 8 -F)2 PAGE7-S: Z 4I- 'Z 2 DATE: 15-0CT-1929 V RV IN SEQUENCE ID NO:29: From -Z6 t~o 262 (xl) E~tZECE DSCa-7IT7ON: SEQ ID N0:29: Met Gl'rMv A.rq Am- Gin Gl' Thr Ser Pro Ser Lys C-:s

T-

Leu As" Phe. G-,n Leu Leu Val Leu Ala Giv Leu Ser His Phe C-Ys Ser Val ui 'val L-x's Gbu Val Ser C's C v Hs -Sn r ja' G- u Cli u Ala GI-n T-.r T=i 7xs*j:~-sL' e Va Leu -hif Met LMet S:2m I I II

I

I I I I im1i Ar-- Pro Ser Aso Glu Gly 7S Asn Asn Leu Ser Ie Val Ile 117- Leu Ala Leu Thr Tyr Glu Cvs Val Val Leu Lys Tyr Glu Lys Aso Ala ?he Lys Arc; R5 Q n Glu pro Ie Glu pro *Thr' 4 175 Val Asp lie 1 His Leu Ala Ser Ile Ser Cys Ser Thr 130 Asn Glv Glu 145 Glu Thr Glu 160 as Gin Thr knn Leu Leu 210) G1 u Aso 1z Ser Glu Leu Phe 1-95 Pro Val Thr 100 Phe Glu Tvr Aa Me~t Asr. Lro Ser Tro Ser Val Lvs Ala Aso Phe Pro Thr 4* 4..

4* 105 Ser Pro Thr Lvs L-vs 125 Leu 125 Tro C-jr

LCU

TJ~

205 Asr Val T1.e CTS CI/S _Tej ThTr Cvs Phe Ala Pro Arc: Cv-/sr 22S 230 a.

Glu Arg Arg Arg Asr. G5T Arc Leu 240 245 Arg Ara Clu Ual va' TN7-0 r~ FO S Q 7D 2 SLEQU-nNC= c7.iST CS: LENGTHi: base nairs C)TP: ce aci-_ S EZ-'-:ESS: TOPDOLOCGY: Ira (vi ORGINAL SOZ CRC- 71z:!. j', DEVELOPMENT7rL STAGE: germ line TISSUE TYPE: lyrnphoid CELL TYPE: S lyrnohOcVte CELL LINE: 70Z and (V4i D-TwEDIATE SOURCE: LISRAR-Y: cOTNA in DCDM8 vector CLONE: B7 I-s 1 and 29 (ix) _FEATURE: NAmE/KE-_Y: translated region LOCATICIU: 249 to bp IDENOIFICATION MET11OD: similari V to ct'ner pattern o NM/E:Alternate.ATC G iniiaton codons LU(E) LOCA'TIONr: 225 to 22-1 ar'd 270 co 272 DE~ICACON ET:-4D: ric t other cattern S"7QLT'CF DESCRIRTON: TD GAGTTT-TATA CCTC.AATAC-A CCCTACTAC- TCTCTT TCAGGTTGTG AACC:2C'Cr 6G T-CAAAGACA CTC'I:TC TT'CTCTGTG-GA C :_AAC7T C.ATCTCC'AGC ATCTGCCG'Cr_ 120 30 TC-CATCCOT CCAC-GCTTCT TTTCTA:C:AT C ITGT"TCT CGATCCT=G1C GCC7-G. CGTAG CTClrGC TC TGGCTCTCCC C!.TCAT-7777C TZO2 ACCC 24 33 rCGAGCT ATC-:GCTTCA-TTT_ :G,-ATG C_ GA C c CZA CCC CTC 290 met -a Cv. A---Crs GC, r. u MetC 0- Asn r- LeuiG, 'T'T CCA TGC AGG AjT C CTCC.JC" CG7C C-7" CTG ACC CG- .Ls _P he Pro Cvs P ro Amc Leu La Leu P a dL uLa; r *CT T CA C;AA T. GC TCC TC.:A GACGC GA- G_ C C_~C LuSer G-In Val Gar 9cr V al A s G I 'GIn 'a Ser7v Se Val CAT AAG GCA TCCC CCC' C-7, 7=C rIIIT CTCC 7 Sso Val Lai- Dr Cs A rr -i As Set 2to G-G CC GA G.AC CGA ZTC C CCCG 7.kCA GCt GAAAC Gl" Set Glu Aso Ara 11a aL

I

530 -119- TCT GTC ATT CCT GGc- AAA C7A AAA GTG TGG CCC GAG T 'AT AAC Ac CSG Ser Val lie Ala Gly LYS Leu Lys Val Trp Pro Glu Tyr Lys Asn Arc ACT TTA TAT c-AC AAC ACT ACC TAC TCT CIT ATC AICC GGCC CG G-C ThrLe Tr Aso Asn Thr Thr Tyr Ser Leu !Ie 11- Len Le, Val 65 CIT TCA c-AC Cc-c C-CC ACA TAC Ac-C TGT GTC GIT CAA AAG AAG GRA AG A Leu Ser AsD 0ly Thr Tv7r Ser Cv.s Val Val Gin Lvs Lvs c-lu Ara 8 cGA ACG TAT C-RA GTT AAA CAC TTc- GCT ITA GTA AAG TT-G TCC ATC R.AA Gly Thr Tv/r Glu Val Lv.'s His Leu Ala Leu Val Lvs Leu Se Ie LYS GCT c-AC TTC TC?_ ACC CCC AAC ATA ACT GAG TCT GGA AAC CATTcC Ala Aso Ph~e Ser- T-'r Pro Asn le Th -uSrG s cS:Al- 110 120 GAO ACT AC- AT= A CO 7c;C TT GCT TCO CCC c-CT ITO CCAm AC= Ats Z;T'r LA'S -a r GDv C1, v e PrnLv *ftft* 57a 626 674 7 22 7 ft0 a* Cc-C ITO TEOT TGG TTC- GA-MA AT c-CA -A GAA ITA C-C GC ATC A Ara Phe Ser T= LcU C-in ASn C>V Ara l c-hr pr ~o GiVi n.S-'T

IS

ACA ATT ICC Thr Ser Cc- c-AT CcT c-l a sD Pro TO?-

TAC

Scr c-lu Len Tvr r AC? AC-C CAA 71e Ser scr GIn toaf *to CTA GmA? 170 A;T Leu ASP Phe Asn Thin 170 TAT GGA c-AT c-CT CAC Ty'r G 1 y Rso Ala His AC?= CC Thr Arc a CC PAC AT? RAG IT ASn His Thr lie Lys C-is 180 7 C (572 TCA, c-Ac- cAC ial. Se: c-lu Asu TTC ACC Phe T, r Tr- C-lu Lvs c-AA c-AC CC? CC? GA? AcG-C AA CA CT? c-CC C=_TT 07:7 c-CC.Z c- c-CA! c-lu AsD Pro Pro ZOn Ser Lys AS- T_ Leu Val LeU Phe -5:Aa C-.

2 05 2 10 2 Phe Cl'; Ala 220 C-C -7e~ -u I r Pec~s -vs His s: e j h -l l ACA AR? RAC AAc- C 1=7 Ai c 7 CC Thr. 250 T r 0- I a I I I I a, I I -120- ACO GTC TTC C-77 TA-TTC7TT-CT CTGTCCATGT GC-GA'TACATG GTATTATGTG Thr Val Phe Lau GCTCATGAC-G TACAACCW'C C--TT:C-CAC CG-rGCTAGCT GATCTTTCr.G ACAA.

ACAAC-ATAGA C-TAAOTOGG AAGAGAA3LC-C Cr-T 'TGAC- GATTTCT-TC CAT: CTACGGGCAA GT=GTCG CC-TTTGXC-AG CTTGATGACT G.:AC-TGC-AAa C-GCTC ~CGT7~~~TCTGCCTGGCGCZ:*CG CAGGT-rACO-C TGGOGG!TA G GCTGT:CACTA AAAGGAGAGG TGCO-TAGrTO-T TACTGCAACT TGATA'TGTCA TGT=Z GTGrCTCTG-TC-G G.LGaCCT CC C TTCTGA G -GAAGTIPGT GGGAC-AC-TG:C-G AT cGG io GTGGGGAAL'A T =STTG z CGGAC

TATP

:TTGAC

.CGA-AG

.GGTTG

-GGI:A

1206 1266 1326 1386 1446G i S0 6 1 S66 !1a26 1686

QVO

2, .4

CC

r C. C* 4S 30 C* C 4.35

SC

C

*5 C 4 (i1 SEQUE~NCE C:AP.ACTEP:STIcS: CA) ENG~:: 06 ar-'inc ac~ds CE)W z:amno acid TO)PO:LOG-Y: llnear (ii) OEUE' ~A)DEC~~CN3 v-cc*rtae activatlor, anclcen; memer; cel', ccsrimuiazcry s~cnal (37 V~A:OT -3 (0 IE 4stC'u' i:ar sezuLence b- {:x~EACYCE 7C%- I i I1 1 IX E~-E -121- N?21EfBG-7: tz-arsmemrane dciu'ainl LOCATION: 211 to 235 4E D~i~c~:~MT:-10D Similarity witnown seauence (ix) FEATUR.E: AM/y:intracallular (cytoolasmic) doma.in LOCATION: 23i= 263 ID7T3A II M __~2Ds~nlaritv. with known seuerlc I 9. 0 -gel

FEATURE:

iA) ~.M/KEY IaV-set: dcmain LOCA;TION: 1,0 IS 10 CC) YDE===-CATTON 4CD sui-,aritv wth known,4r sencuence 2tiBLICATIO 4 (A) A U THCR S :RC S.

~DD

D

7 W7D Z=CUC 7 (2)T3TE: ress:.on, an Cell Costtniu~latzr-,: ACti:iz 1 0 T he Muie HEor 10j9Le 0 f The ;Zum a- n CUAAL: umai E:-:orimental- 0U 1vOLCYK U) DATE: INr 77EiC 7D N:L rm-7t 'xi) S2TE::~ tC2~~~:c:SEC 7D, C: 1 -ri 11 hi.

-122met Ala CYS Asa pro c-I Pro Gin- 'Jai 5Cr Ser Ljs Val Lau Lau G 1 AsP Ar= Ala Gy A s- *a.I T-rS rVa TVS 9= Ser LauTr r ;02

F,

.9 37, GW e i 0/s Gin LeU Met: Gln Asp pro Lau Leu LvS Phe -30 Lau iC.Leu~ Le.~.VJ Leu Lau Tie Ara Lau Ser pAso Val Aso GltL Lau Ser LYS S e- Val Lys AS-P I. p ro CYS Arg Tyr Asa Ser P-o Hi S Gih As,- Giu set 20 GI. Lvs H;s ASO LYS Va! valc- S-r Val Le.LSVal r Pro Glu 7 Vs -z Thr LMI Tvr Ti Se ce T,-u a Val Lati Ser T-r- Se a Cy a Val. G n L .S L,*SGlU ArS z~-lGy Thr 80 .3 '7-S Leu ALa Lau va IV Ly Lu Ia Lys ;Ala Asp0 As Tar~ Glu 5 0 o Sar Aa ASPi 120 C*.S Pe Alia Se C I C a P Lvs r Arg Asl GQir Ar- G' Leu Pro C-i a AS-. T- G -a L. 2 C' hrIaSr e L47-1 As; T LvS Cvs Lau

G~

0 a

G

0 n alC 7 -7 T s rv y

I

-123- Asn Ser Leu Thr Phe Gly Pro Glu Glu Ala Leu Ala Glu Gin Thr Val 255 260 Phe Leu 16 I.

I.

St 9' 0 J~0C 9S 5 0

S

S S

U.

S

C C 3 CS I .I 1 1 1 q

Claims (142)

1. An isolated nucleic acid molecule comprising a nucleotide sequence encoding a peptide having al least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2), said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4. 2 The isolated nucleic acid molecule of claim 1 which is a cDNA sequence. 10 3. The isolated nucleic acid molecule of claim 2. wherein the cDNA is of human origin. S: 4. An isolated nucleic acid molecule of claim 3. wherein said nucleic acid molecule encodes a peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or 15 CTLA4 and comprising a nucleotide sequence shown in Figure 8 (SEQ [D NO:1). An isolated nucleic acid molecule comprising the coding region of a nucleotide sequence shown in Figure 8 (SEQ ID NO:1) and encoding peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4.

6. The isolated nucleic acid molecule of claim 2. wherein the cDNA is of murine origin.

7. An isolated nucleic acid molecule comprising a nucleotide sequence shown in Figure 14 (SEQ ID NO:22) and encoding a peptide having the S 25 ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4

8. An isolated nucleic acid molecule of claim 6, wherein the cDNA comprises the coding region of a nucleotide sequence shown in Figure 14 (SEQ ID NO:22) and encoding a peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4

9. An isolated nucleic acid molecule encoding a peptide comprising an amino acid sequence shown in Figure 8 (SEQ ID N0:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 I I II I I I1 I An isolated nucleic acid molecule encoding a peptide comprising an amino acid sequence shown in Figure 14 (SEQ ID NO:23) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4.

11. The isolated nucleic acid molecule of claim 1. wherein the peptide is at least 70% homologous with a sequence comprising an amino acid sequence of Figure 8 (SEQ ID NO:21].

12. An isolated nucleic acid molecule encoding B7-2 peptide, wherein the peptide is encoded by a nucleic acid molecule which hybridises under high 10 or low stringency conditions to a nucleic acid molecule which encodes a S peptide comprising an amino acid sequence shown in Figure 8 (SEQ ID S NO:2), said peptide having the ability lo costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4.

13. The isolated nucleic acid molecule of claim 1, wherein the peptide is S" 15 at least 20 amino acid residues in length.

14. The isolated nucleic acid molecule of claim 1. wherein the peptide is at least 70% homologous with a sequence comprising an amino acid sequence of Figure 14 (SEQ ID NO:23]. 1* 1" An isolated nucleic acid molecule which hybridises under high or low 20 stringency conditions to a nucleic acid molecule which encodes a peptide comprising an amino acid sequence shown in Figure 14 (SEQ ID NO:23). said peptide having the ability to costimulate T cell proliferation or T cell cvtokine production or the ability to bind CD28 or CTLA4

16. The isolated nucleic acid molecule of claim 15 wherein the peptide is at least 20 amino acid residues in length.

17. The isolated nucleic acid molecule of claim 1, wherein the peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2].

18. An isolated DNA molecule comprising a nucleotide sequence encoding a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shovwn in Figure 8 (SEQ ID NO:2]. said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4, the peptide having an amino acid sequence represented by formula wherein Y comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). wherein is amino acid residues selected from amino acid I I I ii I I I residues contiguous to the amino terminus of Y in the sequence shown in Figure 8 (SEQ ID NO:2), wherein is amino acid residues selected from amino acid residues contiguous to the carboxy terminus of Y in the sequence shown in Figure (SEQ ID NO:2), wherein n=0-23 and wherein m= 0-84.

19. The isolated DNA molecule of item 18. wherein n=0 and m= 0. The isolated DNA molecule comprising a nucleotide sequence encoding a peptide of at least 20 amino acid residues or more in length having at least about 50% 0 homology with an amino acid sequence and having the ability to costimulate T cell proliferation or T cell cytokine production or 10 the ability to bind CD28 or CTLA4. comprising a sequence shown in Figure 8 (SEQ ID NO: 2). S21. An isolated nucleic acid molecule encoding a B7-2 fusion protein comprising a nucleotide sequence encoding a first peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the S' 15 amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 and nucleotide sequence encoding a second peptide.

22. The isolated nucleic acid molecule of claim 21 which is a DNA. 20 23. The isolated nucleic acid molecule of claim 22. wherein the first peptide comprises an extracellular domain of a human B7-2 protein.

24. The isolated nucleic acid molecule of claim 23, wherein the first peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). 25 25. The isolated nucleic acid molecule of claim 23, wherein the first peptide comprises a variable region-like domain of human B7-2.

26. The isolated nucleic acid molecule of claim 23. wherein the first peptide comprises a constant region-like domain of human B7-2.

27. The isolated nucleic acid molecule of claim 22 wherein the second peptide comprises an iummunoglobulin constant region.

28. The isolated nucleic acid molecule of claim 27. wherein the immunoglobulin constant region is a C-l domain, including the hinge. CH2 and CH3 region.

29. The isolated nucleic acid molecule of claim 27. wherein the immunoglobulin constant region is modified to reduce constant region- mediated biological effector functions. I I I I L Ii The isolated nucleic acid molecule of claim 29. wherein the biological effecter function is selected from the group consisting of complement activation and the receptor interaction.

31. The isolated nucleic acid molecule of claim 30. wherein the inunuoglobulin constant region is a Cy4 domain, including the hinge, CH2 and CH3 region.

32. The isolated nucleic acid molecule of claim 31, wherein at least one amino acid residue of the CH2 domain is modified by substitution, addition or deletion. 10 33. An isolated B7-2 fusion protein comprising a first peptide having at 0 least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEO rT NO:2) and having the ability to costimulate T cell proliferation or T c ytokine production or the ability to bind CD28 or CTLA4 and a second peptide 15 corresponding to a moiety that alters the solubility, binding affinity or valency of the first peptide.

34. The isolated B7-2 fusion protein of claim 33 wherein the first peptide comprises an extracellular domain of human B7-2 protein.

35. The isolated B7-2 fusion protein of claim 34. wherein the first peptide 20 comprises amino acid residues 24-245 of the sequence shown in Figure 8 SEQ ID NO:2).

36. The isolated B7-2 fusion protein of claim 34. wherein the first peptide comprises a variable region-like domain of human B7-2.

37. The isolated B7-2 fusion protein of claim 34, wherein the first peptide comprises a constant region-like domain of human B7-2.

38. The isolated B7-2 fusion protein of claim 33. wherein the second peptide comprises an inlnunoglobulin constant region.

39. The isolated B7-2 fusion protein of claim 38. wherein the inununoglobulin constant region is a Cyl domain including the hinge. CH2 and CH3 region. The isolated B7-2 fusion protein of claim 38. wherein the inmunoglobulin constant region is modified to reduce constant region- mediated biological effecter functions.

41. The isolated B7-2 fusion protein of claim 40. wherein the biological effecter function is selected from the group consisting of complement activation and Fc receptor interaction. a I I I a -A 1 9

42. The isolated B7-2 fusion protein of claim 41, wherein the immunoglobulin constant region is a C-!4 domain including the hinge, CH2 and CH3 region.

43. The isolated B7-2 fusion protein of claim 42. wherein at least one amino acid residue of the CH2 domain is modified by substitution. addition or deletion.

44. A composition suitable for pharmaceutical administration comprising a fusion protein of claim 33 and a pharmaceutically acceptable carrier. A composition suitable for pharmaceutical administration comprising 10 a fusion protein of claim 34 and a pharmaceutically acceptable carrier.

46. A composition suitable for pharmaceutical administration comprising a fusion protein of claim 36 and a pharmaceutically acceptable carrier.

47. A composition suitable for pharmaceutical administration comprising a fusion protein of claim 38 and a pharmaceutically acceptable carrier. 15 48. A recombinant expression vector including a nucleic acid molecule of claim 1.

49. The recombinant expression vector of claim 48, wherein the nucleic acid molecule is a cDNA molecule. '2 50. The recombinant expression vector of claim 49, wherein the cDNA is 20 of human origin and comprises a nucleotide sequence shown in Figure 8 (SEQ ID NO:1).

51. The recombinant expression vector of claim 49 which is a plasmid. S 52. A recombinant expression vector including a nucleic acid molecule of claim 7. S 25 53. A host cell transfected with the expression vector of claim 48 capable of directing the expression of a peptide encoded by the nucleic acid molecule.

54. A host cell transfected with the expression vector of claim 50 capable of directing the expression of a peptide having an activity of a B lymphocyte antigen, B7-2. A host cell transfected with the expression vector of claim 52 capable of directing the expression of a peptide having an activity of a B lymphocyte I antigen. B7-2.

56. An isolated, recombinant peptide having an activity ofa B lymphocyte antigen, B7-2. expressed by a host cell of claim 54. I I I I

57. A cell transfected with a nucleic acid molecule encoding a peptide having at least 50% anino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 said nucleic acid molecule being in a form suitable for expression of the peptide on the cell surface.

58. The cell of claim 57, wherein the nucleic acid molecule is a cDNA comprising a nucleotide sequence shown in Figure 8 (SEQ ID NO:1) in a 10 recombinant expression vector.

59. A tumor cell which is modified to express a T cell costimulatory 0.0 molecule having at least 50% amino acid sequence identity with a human B7- 2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2), said peptide having the ability to costimulate T cell proliferation or T S 15 cell cytokine production or the ability to bind CD 2 8 or CTLA4. The tumor cell of claim 59 which is transfected with a nucleic acid molecule encoding human B7-2 in a form suitable for expression of B7-2.

61. The tumor cell of claim 59 which is stimulated to express B7-2. S 62. The tumor cell of claim 59 which has a human B7-2 antigen coupled to 20 the tumor cell.

63. The tumor cell of claim 59 which expresses a T cell costimulatory Smolecule. B7-2. S 64. The tumor cell of claim 59 which expresses a MHC class I molecule. The tumor cell of claim 59 which expresses a MHC class II molecule. 25 66. The tumor cell of claim 59 which normally expresses a TMHC class II associated protein, the invariant chain, and wherein expression of the invariant chain is inhibited.

67. A tumor cell transfected with a nucleic acid molecule encoding a T cell costimulatorv molecule having al least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having tihe ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4, said nucleic acid molecule being in a form suitable for expression of B7-2.

68. The tumor cell of claim 67, wherein the nucleic acid molecule is a cDNA in a recombinant expression vector. I F i i L 130

69. The tumor cell of claim 67, further transfected with a nucleic acid molecule encoding a T cell costimulatorv molecule. B7-1. said nucleic acid molecule being in a form suitable for expression of B7-1. The tumor cell of claim 67. further transfected with at least one nucleic acid molecule comprising DNA encoding: at level one MHC class II a chain protein: and at least one MHC class II 3 chain protein, wherein the nucleic acid molecule is in a form suitable for expression of the a chain protein(s) and the MH-C class II 3 chain protein(s). 0* i 10 71. The tumor cell of claim 70 which does not express LMH-C class II molecules prior to transfection of the tumor cell.

72. The tumor cell of claim 67. further transfected with at least one S nucleic acid molecule encoding at least one MHC class I c chain protein in a form suitable for expression of the MHC class I protein(s).

73. The tumor cell of claim 72, further transfected with a nucleic acid molecule encoding a p-2 microglobulin protein in a form suitable for expression of the P-2 microglobulin protein.

74. The tumor cell of claim 67 which normally expresses an MHC class II S associated protein, the invariant chain, and wherein expressionl of the S 20 invariant chain is inhibited.

75. The tumor cell of claim 74, wherein expression of the invariant chain is inhibited by transfection of the tumor cell with a nucleic acid molecule S" which is antisense to a regulatory or a coding region of the invariant chain a gene. 25 76. The tumor cell of claim 67 which is a sarcoma.

77. The tumor cell of claim 67 which is a vymphoma.

78- The tumor cell of clam 67 which is selected from a group consisting of a melanoma. a neuroblastonma a leukemia and a carcinoma.

79. A method of treating with a tumor. the method including: obtaining tumor cells from the subject: transfecting the tumor cells with a nucleic acid molecule encoding a molecule having, al least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cvtokine production or the ability to bind CD28 or CTLA4 and said nucleic acid molecule being in a form suitable for expression of B7-27: and I I I administering the tumor cells to the subject. The method of claim 79, wherein the tumor cells are further transfected with a nucleic acid molecule encoding B7-1.

81. The method of claim 79. wherein the tumor cells are further transfected with at lease one nucleic acid molecul~ encoding at least one NMHC class II a chain protein and at least one MI HIC class II p chain protein in a form suitable for expression of the MHC class Ii a chain protein(s) and the NMHC class II chain protein(s).

82. The method of claim 79, wherein the tumor cells are further 10 transfected with at least one nucleic acid molecule encoding at least one MHC class II P chain protein in a form suitable for expression of the MIIHC class I protein(s).

83. The method of claim 82. wherein the tumor cells are further *transfected with a nucleic acid molecule encoding a P3-2 microglobulin protein in a form suitable for expression of the -2 microglobulin protein.

84. The method of claim 79. wherein expression of an MHC class II associated protein, the invariant chain, is inhibited in the tumor cells. S. 85. The method of claim 84. wherein expression of the invariant chain is inhibited in the tumor cells by transfection of the tumor cell with a nucleic 20 acid molecule which is antisense to a regulatory or a coding region of the invariant chain gene.

86. The method of claim 79. wherein the tumor is a sarcoma. ot 87. The method of claim 79, wherein the tumor is a lymphoina.

88. The method of claim 79. wherein the tumor is selected from a group S 25 consisting of a melanoma. a neuroblastoma, a leukemia and a carcinoma.

89. A method of inducing an antitumor response by CD4+ T lymphocytes in a subject with a tumor. the method including: obtaining tumor cells from the subject: transfecting the tumor cells with at least one nucleic acid molecule comprising DNA encoding: a molecule having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2), said peptide bearing the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4. (ii) an MHC class II a chain protein, and I I"I i i I 132 (iii) an MHC class I P chain protein, wherein the nucleic acid molecule is in a form suitable for expression of B7-2. the MHC class II C' chain protein and the MHC class 13 chain protein; and administering the tumor cells to the subject.

90. A method of treating a subject with a tumor, the method including modifying tumor cells in vivo to express a molecule having at least 50 9% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or 10 the ability to bind CD28 or CTLA4

91. The method of claim 90. wherein tumor cells are modified in ivo by delivering to the subject in vivo a nuc:-c acid molecule encoding B7-2 in a form suitable for expression of B7-2. S 92. The method of claim 91, wherein the nucleic acid molecule is S° 15 delivered to the subject in vivo by injection of the nucleic acid molecule in an appropriate vehicle into the tumor.

93. A method of treating a subject with a tumor, the method including: obtaining tumor cells and T lymphocytes from the subject: culturing the T lymphocytes from the subject in vitro with the tumor 20 cells from the subject and with a molecule having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid S sequence shown in Figure 8 (SEQ ID NO:2), said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4: and S 25 administering the T lymphocytes to the subject.

94. A peptide produced by recombinant expression of a nucleic acid molecule of claim 1- A peptide produced by recombinant expression of a nucleic acid molecule of claim 4.

96. A peptide produced by recombinant expression of a nucleic acid molecule of claim

97. A peptide of claim 96 comprising an amino acid sequence set forth in Figure 8 (SEQ ID NO: 2).

98. A peptide produced by recombinant expression of a DNA of claim 18.

99. A peptide produced by recombinant expression of a DNA of claim I I r S I I .2i I

100. A substantially pure preparation of a peptide having at least amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4.

101. A peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2), said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or 10 CTLA4 and having an amino acid sequence represented by a formula .X-Y- wherein Y is amino acid residues selected from the group consisting of: 0.:o amino acid residues 55-68 of the sequence shown in Figure 8 (SEQ ID NO:2); amino acid residues 81-89 of the sequence shown in Figure 8 (SEQIDNO:2); amino acid residues 128-142 of the sequence shown in Figure 8 [SEQ ID 15 NO:2); amino acid residues 160-169 of the sequence shown in Figure 8 (SEQ ID NO:2): amino acid residues 188-200 of the sequence shown in Figure 8 (SEQ ID NO:2]; and amino acid residues 269-282 of the sequence shown in Figure 8 (SEQ ID NO:2), wherein is amino acid residues selected from amino acid residues contiguous to the anino terminus of Y in the sequence S" 20 shown in Figure 8 (SEQ ID NO:2). wherein is amino acid residues selected S. from amino acid residues contiguous to the carboxy terminus of Y in the sequence showin in Figure 8 (SEQ ID NO:2), wherein n=0-30 and wherein m=0-30. .102. A peptide of claim 101, wherein n=0 and m=0. 25 103. An antibody specifically reactive with a B7-2 peptide produced by recombinant expression of a nucleotide sequence encoding a peptide having at least 50% amiino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cvtokine production or the ability to bind CD28 or CTLA4.

104. The antibody of claim 103, wherein the nucleotide sequence comprises a coding region of a nucleotide sequence shown in Figure 8 (SEQ ID NO:1).

105. The antibody of claim 103 which is a monoclonal antibody.

106. The antibody of claim 105 which is an IgGI antibody.

107. The antibody of claim 105 which is an IgG2a antibody.

108. A nonhuman, transgenic animal which contains cells transfected to I I I. I I 134 express a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID N0:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4

109. The nonhuman. transgenic animal of claim 1018 which is a mouse.

110. A nonhuman. knockout animal which contains cells having an altered gene encoding a B lymphocyte antigen. B7-2.

111. The nonhuman. knockout animal of claim 110 which is a mouse. 'l 10 112. A composition suitable for pharmaceutical administration comprising a peptide having at least 50% amino acid sequence identify with a human Se" B7-2 peptide comprising the anino acid sequence shown in Figure 8 (SEQ ID NO:2J, said peptide having the ability to costimulate T cell proliferation or T cell cvtokine production or the ability to bind CD28 or CTLA4. and a 15 pharmaceutically acceptable carrier-

113. The composition of claim 112 further comprising a B7-1 peptide.

114. The composition of claim 112, wherein the peptide comprises an amnino acid sequence set forth in Figure 8 (SEQ ID NO: 2). *115. The composition of claim 114, wherein the peptide comprises amino 20 acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2).

116. A method of producing a peptide having at least 50% amino acid sequence identity and a human B7-2 peptide comprising the amino acid sequence show in Figure 8 (SEQ ID NO:2), said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4. the method including: culturing a host cell of claim 53 in a medium to express the peptide; and isolating the peptide from the medium.

117. A method of producing a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4. the method including: culturing a host cell of claim 54 in a medium to express the peptide; and isolating the peptide from:the medium. 1 I I j I I, 1i

118. A method of inhibiting an interaction of a B lymphocyte antigen, B7-2, with its natural ligand(s) on the surface of immune cells, the method including, contacting an immune cell with an agent selected from the group consisting of a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production, and an antibody against B7-2 which inhibits B7-2 binding with its natural ligand[s), to thereby inhibit costimulation of the 10 immune cell through B7-2-ligand interaction.

119. The method of claim 118, wherein the agent is a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of S: 15 costimulating T cell proliferation or T cell cytokine production.

120. The method of claim 119. wherein the peptide is a soluble. monomeric peptide.

121. The method of claim 120, wherein the peptide comprises amino acid S" 2 residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2J. 20 122. The method of claim 120. wherein the agent is a B7-2 fusion protein comprising a first peptide which binds to GTLA.4 or CD28 without delivering a costimulatory signal to a T cell and a second peptide comprising a moiety that alters the solubility, binding affinity or valency of the first peptide.

123. The method of claim 122, wherein the first peptide comprises an 25 extracellular domain of the human B7-2 protein.

124. The method of claim 122. wherein the first peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2).

125. The method of claim 122. wherein the second peptide comprises an iminunoglobulin constant region.

126. The method of claim 125. wherein the immunoglobulin constant region is a C-I domain, including the hinge. CH2 and CH3 region.

127. The method of claim 119. wherein the agent is an antibody reactive with B7-2.

128. The method of claim 127. wherein the antibody is a monoclonal antibody. I i r,~r i; C *I -4. t^^ *s@o s. S S.. S 55 S S *1 S *S s S* .55 *D S

129. A method of downregulating T cell mediated immune responses in a subject, the method including administering to the subject an agent selected from the group consisting of: a peptide having at least 50% amino acid sequence identity avid a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production andin antibody against B7-2 which inhibits B7-2 binding with its natural ligand(s], in an amount effective to inhibit T cell proliferation and/or cytokine secretion in the subject.

130. The method of claim 129, wherein the agent is a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cvtokine production. 15 131. The method of claim 129. wherein the agent is an antibody reactive with human B7-2.

132. The method of claim 131. wherein the antibody is a monoclonal antibody.

133. The method of claim 129, further comprising administering to the subject an agent that inhibits mediated costimulation

134. The method of claim 133. wherein the agent is analog of a B7-1 peptide lacking the ability to deliver a costimulatory signal to T cells.

135. The method f claim 133. wherein the agent is an antibody reactive with

136. The method of claim 135. wherein the antibody is a monoclonal antibody.

137. The method of claim 129, furtherincluding administering to the subject an inununomodulating reageiIselected from the group consisting of an antibody reactive wide CD28. an antibody reactive with CTLA4. an antibody reactive with a cytokine, a CTLA4Ig fusion protein, a CD28Ig fusion protein, and an immunosuppressive drug

138. A method of treating an autoinmmune disease in a subject mediated by interaction of a B Lymphocyte antigen, B7-2. with its natural ligand(s) on the surface of immune cells. the method including administering to the subject an agent selected from the group consisting of: a peptide having at least amino acid sequence identify with a human B7-2 peptide comprising the m II I L I I 5 .1 amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production and an antibody against B 7-2 which inhibits B7-2 binding with its natural ligand(s], such that autoimmune disease is treated.

139. The method of claim 138. wherein the autoimmune disease is selected from the group consisting of diabetes mellitus, rheumatoid arthritis, multiple sclerosis, myasthenia gravis. systemic lupus enthmatosis. and autoinmmune thyroiditis. 10 140. The method of claim '138, wherein the agent is a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of 1: 5 costimulating T cell proliferation or T cell cytokine production. 15 141. The method of claim 140, wherein the peptide is a soluble, monomeric peptide.

142. The method of claim 141. wherein the peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). o 143. The method of claim 138, wherein the agent is a B7-2 immunoglobulin 0 fusion protein (B7-2Ig) comprising a first peptide comprising an extracellular S. domain of the B7-2 protein and a second peptide comprising an imnmunoglobulin constant domain.

144. The method of claim 143, wherein the extracellular domain of the B7-2 S. protein comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2).

145. The method of claim 138, wherein the agent is an antibody reactive with B7-2.

146. The method of claim 145. wherein the antibody is a monoclonal antibody.

147. The method of claim 140 further including administering to the subject a peptide having at least 50%9 amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine productinm.

148. The method of claim 138, further including administering to the subject an immunomodulating reagent selected from the group consisting of: i 1 i 6 I I b 138 an antibody reactive with B7-1. an antibody reactive with CD28, an antibody reactive with CTLA4, an antibody reactive with a cytokine. a CTLA4Ig fusion protein, a CD281g fusion protein, and an immunosuppressive drug.

149. A method of treating allergy in a subject mediated by interaction of a B lymphocyte antigen, B7-2. with its natural ligand(s) on the surface of immune cells, the method including administering to the subject an agent selected from the group consisting of: a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to 10 bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cvtokine production and an antibody against B7-2 which inhibits B7-2 binding with its natural ligand(s), to thereby inhibit costimulation of the immune cells through the B7-2 -ligand interaction

150. The method of claim 149, wherein the agent is a peptide having B7-2 t" 15 binding activity, but lacking the ability to deliver a costimulatory signal to immune cells.

151. A method of inhibiting donor T cell proliferation and/or cytokine secretion in a transplant recipient to thereby prevent graft-versus-host disease (GVHD) in the recipient, the method including contacting donor T 20 cells to be transplanted with an agent selected from the group consisting of: a peptide having at least 50% amino acid sequence identify with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production and an antibody against B7-2 which inhibits B7-2 binding with its natural ligand(s), such that donor T cell proliferation and/or cytokine secretion is inhibited in a transplant recipient.

152. The method of claim 151. wherein the agent is a peptide having at least 50%o amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production.

153. The method of claim 152. wherein the peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2).

154. The method of claim 151. wherein the agent is an antibody reactive with B7-2 I I I I IL k e84 44 4 44 *4 4 4 444 4.44 S 4 48 *04 oo -o a 40 a e D e a k 6

155. The method of claim 154, wherein the antibody is a monoclonal antibody.

156. A method of inhibiting transplantation rejection in a recipient of a tissue or organ transplant, the method including administering to the recipient an agent selected from the group consisting of a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production and an 10 antibody against B7-2.

157. The method of claim 156, wherein the agent is a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to bind CD28 or CTLA4 but being incapable of costimulating T cell proliferation or T cell cytokine production.

158. The method of claim 157, wherein the peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2) 159 The method of claim 156, wherein the agent is an antibody reactive with B 7-2. 20 160. The method of claim 159, wherein the antibody is a monoclonal antibody.

161. A method of upregulating T cell mediated inunune responses in a subject, the method including administering to the subject a B7-2 peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) and having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 in an amount effective to stimulate T cell proliferation and/or cytokine secretion in the subject

162. The method of claim 161, further comprising administering to the subject a B7-1 peptide.

163. The method of claim 161. further comprising administering to the subject a pathogen or portion thereof to thereby induce an anti-pathogen immune response in the subject.

164. The method of claim 163. wherein the pathogen is a virus.

165. A method of identifying molecules which modulate expression of a B7- 2 antigen, the method including: I I a) contacting a cell which expresses a peptide having at least 50% amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 with a molecule to be tested, under conditions appropriate for interaction of the molecule with the cell: and b) determining the effect of the molecule on cell expression of the peptide.

166. The method of claim 165, wherein the effect of the molecule on cell 10 expression of the peptide is determined by detecting the presence of the peptide on the cell surface.

167. The method of claim 166, wherein the presence of the peptide on the cell surface is detected by immunofluorescence with an antibody reactive with the peptide or with a CTLA4Ig or CD28Ig fusion protein. S: 15 168. The method of claim 165. wherein the effect of the molecule on cell expression of the peptide having B7-2 activity is determined by detecting the presence of mRNA encoding the peptide in the cell.

169. The method of claim 168, wherein the presence of mRNA is detected by hybridisation with B7-2 cDNA. "20 170. A method of identifying a cytokine produced by an immune cell in response to costimulation with a B7-2 antigen, the method including: contacting an activated immune cell and a cell which expresses a peptide having at least 50/o amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID 25 NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4, in an appropriate cell culture medium; and b) determining the presence of a cytokine in the cell culture medium.

171. The method of claim 170, wherein the immune cell is a T cell.

172. The method of claim 170. wherein the presence of a cytokine in the cell culture medium is determined by contacting the medium with an antibody reactive with the cytokine.

173. A method of identifying molecules which inhibit costimulation of immune cells by a B7-2 antigen, the method including: a) contacting an immune cell which has received a primary activation with a protein having at least 50% amino acid sequence identity with a S j I S d I I 1.1 I i'I$i human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4 and a molecule to be tested, under conditions appropriate for interaction of the molecule with the immune cell and the stimulatory form of B7-2 protein; and b) determining the effect of the molecule on costimulation of the immune cell by the protein.

174. The method of claim 173, wherein the immune cell is a T cell. '10 175. The method of claim 173, wherein the effect of the molecule on *costimulation of the T cell is determined by detecting T cell proliferation Sand/or cytokine production. S176. The method of claim 173, wherein the protein is expressed on the Ssurface of a cW. 15 177. A method f identifying molecules which inhibit binding of a B7-2 antigen to a ligand on the surface of immune cells, the method including: a) contacting a labelled B7-2 ligand and a molecule to be tested with a peptide having at least 50% amino acid sequence identity and a human B7-2 'peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID '20 NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTL4 removing unbound labelled B7-2 ligand, and c) determining the amount of labelled B7-2 ligand bound to the peptide having B7-2 activity, as an indication of the ability of the molecule to inhibit binding of the B7-2 ligand to a B7-2 antigen.

178. The method of claim 177, wherein the immune cell is a T cell and the B7 2 ligand is CTLA4 or CD28.

179. The method of claim 177. wherein the peptide is iunobilised on a solid phase support.

180. A method of identifying molecules which inhibit intracellular signalling by an immune cell in response to a protein having at least amino acid sequence identity with a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2). said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTLA4, the method including: LM I I J I aa. 142 a) contacting an immune cell which has received a primary activation signal and which expresses a B7-2 ligand on the cell surface with the protein and a molecule to be tested, under conditions appropriate for interaction of the molecule with the immune cell and the stimulatory form of said protein: and b) determining the effect of the molecule on intracellular signalling by the immune cell in response to the stimulatory form of B7-2 protein.

181. The method of claim 180, wherein the immune cell is a T cell.

182. The method of claim 181, wherein the effect of the molecule on i: intracellular signalling by the immune cell is determined by detecting T cell 1 proliferation and/or cytokine production.

183. The method of claim 180, wherein the protein is expressed on the o* surface of a cell.

184. Use of a peptide having at least 50% amino acid sequence identity with 15 a human B7-2 peptide comprising the amino acid sequence shown in Figure 8 (SEQ ID NO:2) said peptide having the ability to costimulate T cell proliferation or T cell cytokine production or the ability to bind CD28 or CTIA4 in the manufacture of a medicament for the treatment of disease in a subject. 20 185. The use of claim 184. wherein the peptide comprises Ln amino acid sequence set forth in Figure 8 (SEQ ID NO: 2).

186. The use of claim 184, wherein the peptide comprises amino acid residues 24-245 of the sequence shown in Figure 8 (SEQ ID NO:2). f* 9' oi m~ i 143

187. A hybridoma HF2.3D1 designated by ATCC Accession No. HB 11686.

188. A monoclonal antibody produced by the hybridomia of claiim 187.

189. A hybridoma HA5.2B7 designated by ATCC Accession No. HB 11687.

190. A mnonoclonal antibody produced by the hybridoma of claimi 189. -191. A hybridoia HAJ.IF9 designated by ATCC Accession No HB '11688.

192. A mnonoclonal antibody produced by the hivbridomia of claini'191. a 04 8, IDated this 8thi day of December 1998 DJANA-FARBER CANCER INSTITUTE, REPLIGEN CORPORATION Patent Attorneys for the Applicant: F B RICE CO -e a 69 8*04 S S S. S I. a a. S S0 a V SD a a -1 11 A q I