MXPA01011079A - Mutant human cd80 and compositions for and methods of making and using the same. - Google Patents

Abstract

Improved vaccines and methods of using the same are disclosed Immunosuppressive compositions for treating individuals who have autoimmune diseases or transplants and methods of using the same are disclosed.

Description

CD80 HUMAN MUTANT AND COMPOSITIONS AND METHODS WILL HAVE TO DO AND USE THE SAME FIELD OF THE INVENTION The present invention relates to compositions and methods for immunizing individuals, with immunosuppressive compositions, with components thereof, and with methods for making and using same.

BACKGROUND OF THE INVENTION This application is related to the United States Provisional Patent Application Serial Number 60 / 131,764, filed April 30, 1999, which is incorporated herein by reference. CD 28 is a cell surface glycoprotein, which is expressed constitutively in most T cells and mature thymocytes, although the CTLA-4 receptor is not present in latent T cells, and can only be detected from 48 to 72 hours after the activation of the T cells. The major ligands for the CD28 / CTLA-4 molecules are B7.1 (CD80) and B7.2 (CD86) which are expressed on the surface of the cells presenting the antigen ( APC) professional. The fundamental biological reason for the existence of at least two receptors (CD28 and CTLA-4) and two ligands (CD80 and CD86) is not clear. Initially it was shown that the CD80 and CD86 antigens were functionally similar. However, different roles for these costimulatory molecules were first suggested, when the different patterns of their expression were determined. CD86 is constitutively expressed in APC, and after activation of APC, CD86 expression is up-regulated rapidly, followed by a gradual return to baseline levels. The expression of CD80 is delayed compared to CD86, and its expression is maximal 48 to 72 hours after the start of an immune response. Because CD86 was constitutively expressed and up-regulated earlier than CD80, it was suggested that CD86 expression is important for the early phase of an immune response, whereas CD80 is important for the second. Additionally, functional differences between CD80 and CD86 are suggested by the data on the binding kinetics of costimulatory molecules with CD28 and CTLA-4. The analysis of surface plasmon resonance (SPR) has shown that both ligands bind to CTLA-4 with greater avidity than to CD28. Other measurements revealed that the CD86 / CTLA-4 complex dissociates faster than the CD80 / CTLA-4 complex. These binding differences combined with the similar delay in the expression of CTLA-4 and CD80 suggest that the functional relationship between CTLA-4 and CD80 is probably more potent than the functional relationship between the CTLA-4 and CD86 molecules. Multiple functions have also been reported for the CD80 and CD86 molecules in vi tro and in vivo. Anti-CD86 but not anti-CD80 antibodies block the development of the disease in a mouse model of autoimmune diabetes, while the opposite effect is seen with these antibodies in a murine model of experimental allergic encephalomyelitis. Many experimental systems demonstrate an important role for CD86 in initiating a T cell response to the antigen, and that the CD80 molecule can play an important role in providing modulating signals to these cells. It was observed that expression of CD86, but not CD80, exogenous human provides important activation signals to murine T cells, after vaccination of DNA with HIV-1 envelope proteins. Similar results were observed after immunization of mice with DNA encoding HIV-1 or influenza antigen, and plasmids encoding murine CD80 and CD86. In this way, the functional differences between CD80 and CD86 were not connected with the differential immunogenicity of the human costimulatory molecules that are expressed in the mouse organism. It is believed that CD86, but not CD80, of exogenous human or murine stimulates the activation of antiviral T cells during DNA immunization.

Vaccines are useful for immunizing individuals against target antigens such as pathogenic antigens, or antigens associated with cells involved in human diseases. Antigens associated with cells involved in human diseases include tumor antigens associated with cancer, and antigens associated with cells involved in autoimmune diseases. In designing these vaccines, it has been recognized that the vaccines that produce the target antigen in the cell of the vaccinated individual are effective in inducing the cellular weapon of the immune system. Specifically, live attenuated vaccines, recombinant vaccines using avirulent vectors, and DNA vaccines all lead to the production of antigens in the cell of the vaccinated individual, which results in the induction of the cellular weapon of the immune system. On the other hand, subunit vaccines, which comprise only proteins, and killed or inactivated vaccines induce humoral responses, but do not induce good cellular immune responses. Frequently a cellular immune response is necessary to provide protection against infection by pathogens, and to provide effective immuno-mediated therapy for the treatment of pathogen infection, cancer, or autoimmune diseases. In accordance with the foregoing, vaccines that produce the target antigen in the cell of the vaccinated individual are often preferred, such as live attenuated vaccines, recombinant vaccines using avirulent vectors, and DNA vaccines. Although these vaccines are often effective to immunize individuals prophylactically or therapeutically against infection by pathogens? human diseases, there is a need for improved vaccines. There is a need for comparisons and methods that produce an improved immune response. Gene therapy, in contrast to immunization, uses nucleic acid molecules that encode non-immunogenic proteins, whose expression confers a therapeutic benefit to an individual to whom the nucleic acid molecules are administered. A specific type of gene therapy is related to the application of genetic material that encodes non-immunogenic proteins, which modulate the immune responses in the individual, and in this way confer a therapeutic benefit. For example, protocols may be designed to apply genetic material that encodes non-immunogenic proteins, which down-regulate the immune responses associated with an autoimmune disease in an individual, and thus confer a therapeutic benefit to the individual. There is a need for compositions and methods that can be used in gene therapy protocols, to modulate immune responses. Modulation of immune responses by alternative means is equally desirable for treating diseases such as autoimmune disease and cell / tissue / organ rejection. There is a need for compositions and methods that can be used to modulate immune responses, and for designing and discovering compositions useful for modulating immune responses.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the data of the experiments described in the Example, showing antigen-specific antigenic CTL responses to the antigen. Figures 2A and 2B show the data of experiments described in the Example, which show the production of lymphokine induced by different constructions. Figure 3 shows the data of the experiments described in the Example, which shows the activity of CTL after the administration of the constructions. Figure 4 shows the data of the experiments described in the Example, which shows the CTL activity after the administration of the constructs, measured after the removal of this population of cells. Figure 5 are photographs of the experiments described in the Example, showing the infiltration of the lymphocytes into the muscle of mice immunized with constructions. Figure 6 is a graphic representation of the CD80 molecule.

DESCRIPTION OF THE PREFERRED MODALITIES OF THE INVENTION Applicants have discovered that the C region of human CD80 is responsible for transmitting a negative signal when an antigen presenting the cell (APC) interacts with a T cell. The negative signal results in a reduction in the activity of the T cell, and in this way a reduction in the immune response generated against the antigen presented by the APC to the T cell. Specifically, the interaction between a T cell receptor (TCR) in a T cell with a MHC / antigen complex, which has been formed in an APC by the formation of a complex between a major histocompatibility complex protein (MHC), and an antigen, is accompanied by the interaction between the costimulatory molecules CD80 and CD86 present in the APC, with the CD28 molecules in the T cell. This interaction results in the activation of the T cells, and a high immune response. However, after activation of the T cells, the T cells express CTLA4. CTLA4 interacts with CD80, and this interaction results in a dominant negative signal that eliminates the previous costimulatory effect caused by the interaction of CD80 and CD86 with CD28. The result of the interaction of CD80 with CTLA4 is a reduction in the immune response with which the T cells are involved. The discovery of the applicants provides two distinct aspects of the invention. In accordance with one aspect of the invention, CD80 mutants and the nucleic acids encoding them are provided, which possess the costimulatory activity of CD80, but which do not transmute the negative signal associated with the interaction of CD80 with CTLA4. These CD80 mutants are useful in the immunization protocols in which they are applied, such as proteins or nucleic acids that encode these proteins, together with the immunogens that are applied as immunogens of proteins or nucleic acid molecules that encode immunogens. The CD80 mutants of this aspect of the invention are molecular auxiliaries in immunization protocols. In accordance with another aspect of the invention, CD80 mutants and the nucleic acids encoding them are provided, which possess the C region of CD80, such that they transmute the negative signal associated with the interaction of CD80 with CTLA4. These CD80 mutants are useful in the treatment of autoimmune diseases, and immunosuppression protocols associated with cell, tissue and organ transplants. The CD80 mutants that provide the negative signal can be applied as proteins or nucleic acids that encode those proteins. The CD80 mutants of this aspect of the invention are autoimmune / immunosuppressive therapeutics. The nucleotide and amino acid sequences of human CD80 are well known and are set forth in Freeman et al. (1989) J. Immunol. 143 (8): 2714-2722, Selvakumar et al. (1992) Immunogenetics 36 (3): 175-181, Freeman et al. (1991) J. Ex. Med. 174 (3): 625-631, Lanier et al. 1989) J. Immunol. 154 (1): 97-105, and Genbank access code P33681 (www.ncbi.nlm.nih.gov), which are incorporated herein by reference. CD86 (B7.2) was first described in Azuma, M. et al. 1993 Nature 366: 76-79, which is incorporated herein by reference. Figure 2B of that publication describes the predicted nucleotide and amino acid sequence of the B7.2 protein. Sequence information is also available in the Genbank database as U04343, which is incorporated herein by reference. Human CD80 is expressed as a 288 amino acid protein (1-288), which is processed to a mature protein (35-288). CD80 is divided into four regions: the variable region (V), the constant region (C), the transmembrane region (tm), and the cytoplasmic tail region (CT). Amino acids 35-242 make up the extracellular domain of the protein, amino acids 43-123 make up the V region, which is also referred to as the type V domain resembling Immunoglobulin. Amino acids 155-223 make up the C region, which is also referred to as the C2-like domain of Immunoglobulin. Amino acids 243-263 make up the transmembrane region. The amino acids 264-288 make up the cytoplasmic tail. As used herein, the terms "CD80 mutants", "C region CD80 mutants", "C region deficient CD80 mutants" and CD80? "Mutants are used interchangeably, and are intended to refer to molecules containing a functional region either CD80 or CD86, at least one non-C functional region of CD80, and which are free of a functional region C of CD80, such that, through the absence of all or part of region C, those molecules do not transmute the negative signal associated with the interactions of the C region of wild type CD80 with CTLA 4. As used herein, references to a "functional region of CD80" as used in the phrases to "at least one non-C functional region of CD80" and "functional region C of CD80" is intended to refer to the regions ^^^^ - ^ ¡j ^ egi of complete proteins of CD80, as well as to the partial regions that retain the activity of the entire region. For example, a functional region V of CD80 refers to amino acids 43-123 of CD80 or a fragment thereof, including proteins that include other sequences, including but not limited to other CD80 sequences, which retain the ability to be fixed to CD28. A functional C region of CD80 refers to amino acids 155-223 of CD80 or a fragment thereof, including proteins that include other sequences that include but are not limited to other CD80 sequences, which retain the ability to bind to CDLA- 4 and transmute a negative signal. In this manner, a free protein of a C-functional region of CD80 can contain a fragment of amino acids 155-223 of CD80, that fragment does not bind to CDLA-4 and transmutes a negative signal. Similar free proteins of a functional region C may include amino acids 155-223, if the adjacent sequences are changed to produce the non-functional C region through conformational changes or other changes. A functional CD80 tm refers to amino acids 243-263 of CD80 or a fragment thereof, which retains the anchor to a mutant CD80 protein comprising it within the membrane of the cell, and thereby prevents secretion . A functional CD of CD80 refers to amino acids 264-288 of CD80 or any fragment of the 1 They are retained in the cytoplasm when the mutant CD80 protein is expressed. As used herein, the terms "CD80 region proteins" 1"C" and "C region proteins" are used interchangeably, and are intended to refer to those proteins that comprise a functional CD80 region C, and in the presence of all or part of region C, those molecules transmute the negative signal associated with the interactions of the C region of wild type CD80 with CTLA4. One aspect of the invention relates to improved methods and compositions for vaccination, particularly DNA vaccination, in which DNA encoding target immunogens is administered, within the individual in whom the DNA is taken and expressed, and an immune response is generated in against the immunogen. In accordance with aspects of the invention, the DNA encoding a mutant protein of CD80α is co-applied to the individual, and the expression of that DNA produces the mutant protein of CD80α that improves the immune response induced against the immunogen. It has been found that co-production of the mutant CD80 [beta] C protein in the cells of a vaccinated individual, which are target expression antigens, results in a surprisingly improved immune response against the target antigen. By providing an expressible form of the nucleotide sequence encoding the CD80? C mutant proteins, vaccines that function by expression of the target antigen in the cells of the vaccinated individual, such as DNA vaccines, vaccines, are improved. recombinant vector, and vaccines, attenuated. The co-production of the CD80? C mutant proteins in the cells that produce antigens results in improved cellular immunity against the antigen. In accordance with the foregoing, the present invention provides improved vaccines, by providing a nucleotide sequence encoding the CD80? C mutant protein, operably linked to the regulatory sequences necessary for expression in vaccines, as part of vaccines such as DNA vaccines, recombinant avirulent subunit vector vaccines, and live attenuated vaccines. Alternatively, the CD80? C mutant protein is applied as an auxiliary protein, together with an immunogen or gene construct encoding an immunogen. In accordance with some embodiments of the invention in which CD80? C mutants are provided as molecular auxiliaries in immunization protocols, the CD80? C mutants contain either a functional CD80 V region, or a functional CD86 V region. The CD80? C mutants do not contain a functional CD80 C region. In some embodiments, region C is deleted, and region V is linked directly to the transmembrane region. In some embodiments, the C region of CD86 is inserted instead of the C region of CD80. In some embodiments, non-CD80 and non-CD86 sequences are included in the CD80? C mutants, after the V region. Some embodiments include the CD80 transmembrane region. Some modalities include the transmembrane region of CD86. In some embodiments, the transmembrane region of CD86 is deleted and is not substituted with any other sequence. Some modalities include non-CD80 sequences, not CD86 instead of the CD80 tm. Some modalities include the cytoplasmic tail of CD80. Some modalities include the cytoplasmic tail of CD86. In some embodiments, the cytoplasmic tail of CD80 is deleted, and is not replaced by any other sequence. Some modalities include non-CD80 sequences, not CD86 instead of the CD80 ct. It has been found that in those embodiments in which the CD80? C mutants are applied to the cells, by administration of genetic material encoding the CD80? C mutant, those CD80? C mutants that include a transmembrane region and cytoplasmic tail. , are particularly effective in stimulating immune responses. In some embodiments, the tm of CD80 and the ct of CD80 are provided. In some embodiments, the CD86 tm and the CD86 ct are provided. In some embodiments, the tm of CD80 and the ct of CD86 are provided. In some embodiments, the tm of CD86 and the ct of CD80 are provided. In those embodiments in which the CD80? C mutants are applied to the cells, by the administration of CD80? C mutant proteins, the CD80? C mutant proteins can be provided as a soluble protein in which the transmembrane region is suppressed and the cytoplasmic tail and, in some cases, are replaced with a soluble fraction. The aspects of the present invention relate to isolated proteins comprising 80V, 80tm and 80ct, and are free of 80C; where that protein comprises either 80V or 86V or both, and optionally comprises one or more of 80tm, 86tm, 80ct, and 86ct, and wh 80V is the variable domain of CD80 or a functional fragment thf; 86V is the variable domain of CD86 or a functional fragment thf; 86C is the C domain of CD86 or a functional fragment thf; 80tm is the transmembrane region of CD80 or a functional fragment thf; 86tm is the transmembrane region of CD86 or a functional fragment thf; 80ct is the cytoplasmic tail of CD80 or a functional fragment thf; and 86ct is the cytoplasmic tail of CD86 or a functional fragment thf. According to some embodiments, these have the formula: R1-R2-R3-R4-R5-R6-R7-R8-R9 whn R1 is 0-50 amino acids; R2 is 80V or 86V; R3 is 0-50 amino acids; R4 is 86C or 0 amino acids; R5 is 0-50 amino acids; R6 is 80tm or 86tm; R7 is 0-50 amino acids; R8 is 80ct or 86ct; and R9 is 0-50 amino acids. In some embodiments R1 is 0-25 amino acids; R3 is 0-25 amino acids; R5 is 0-25 amino acids; R7 is 0-25 amino acids; and / or R9 is 0-25 amino acids. In some embodiments R1 is 0-10 amino acids; R3 is 0-10 amino acids; R5 is 0-10 amino acids; R7 is 0-10 amino acids; and / or R9 is 0-10 amino acids. In some embodiments, the protein is a CD80 mutant selected from the group consisting of: 80V / dele / 80tm / 80ct; 80V / dele / 80tm / 86ct; 80V / dele / 86tm / 80ct, 86V / dele / 80tm / 80ct; 86V / dele / 80tm / 86ct; 86V / dele / 86tm / 80ct, 80V / dele / 86tm / 86ct, 80V / 86C / 80tm / 80ct, 80V / 86C / 80tm / 86ct, 80V / 86C / 86tm / 80ct, 86V / 86C / 80tm / 80ct, 86V / 86C / 80tm / 86ct, 86V / 86C / 86tm / 80ct, 80V / 86C / 86tm / 86ct, 80V / dele / 80tm / dele; 86V / dele / 80tm / dele; 80V / 86C / 80tm / dele1 SOV / sec / Sdtm / dele, 86V / 86C / 80tm / dele, 86V / 86C / 80tm / dele, 86V / 86C / dele / 80ct, 80V / 86C / dele / 80ct 80V / dele / dele / 80ct; 86V / dele / dele / 80ct; 80V / 86C / dele / dele; and 80V. In some embodiments, the CD80 mutant has the formula selected from the group consisting of R-80V-R-dele-R-80tm-R-80ct-R; R-80V-R-dele-R-80tm-R-86ct-R R-80V-R -dele-R-86tm-R-80ct-R R-86V-R- • dele-R-80tm-R-80ct -R R-86V-R- dele-R-80tm-R-86ct-R R-86V-R- • dele-R-86tm-R-80ct-R R-80V-R- dele-R-86tm-R -86ct-R R-80V-R- • 86C-R-80tm-R-80ct-R R-80V-R- • 86C-R-80tm-R-86ct-R R-80V-R- • 86C-R -86tm-R-80ct-R R-86V-R-86C-R-80tm-R-80ct-R R-86V-R-86C-R-80tm-R-86ct-R R-86V-R-86C- R-86tm-R-80ct-R R-80V-R-86C-R-86tm-R-86ct-R R-80V-R- dele-R-80tm-R-dele-R R-80V-R- -R-86tm-R-dele-R R-86V-R- dele-R-80tm-R-dele-R R-80V-R-86C-R-80tm-R-dele-R R-80V-R- 86C-R-86tm-R-dele-R R-86V-R-86C-R-80tm-R-dele-R R-86V-R-86C-R-80tm-R-dele-R R-86V-R -86C-R-dele-R-80-R-R-80-R-86C-R-dele-R-80-R-R-80-R-dele-R-dele-R-80ct-R; R-86V-R-dele-R-dele-R-80ct-R; R-80V-R-86C-R-dele-R-dele-R; and R-80V-R; whn 80V is the variable domain of CD80 or a functional fragment thf; 86V is the variable domain of CD86 or a functional fragment thf; 86C is the C domain of CD86 or a functional fragment thf; 80tm is the transmembrane region of CD80 or a functional fragment thf; 86tm is the transmembrane region of CD86 or a functional fragment thf; 80ct is the cytoplasmic tail of CD80 or a functional fragment thf; 86ct is the cytoplasmic tail of CD86 or a functional fragment thf; del is 0 amino acids; and R are each independently 0-100 amino acids. In some embodiments, R are each independently 0-50 amino acids. In some embodiments, R are each independently 0-30 amino acids. In some embodiments, R are each independently 0-20 amino acids.

In some embodiments of the invention the CD80 mutant is selected from the group consisting of: CD80 with deleted domain C; CD80 with the suppressed domain C, and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with the suppressed domain C, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with the deleted domain C, and a domain V of CD86 substituting the V domain of CD80; CD80 with the deleted domain C, and a V domain of CD86 substituting the V domain of CD80, and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with the deleted domain C, and a V domain of CD86 substituting the V domain of CD80, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with the deleted C domain, and a transmembrane region of CD86 substituting the transmembrane region of CD80, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80 and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80 and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80 and a V domain of CD86 substituting the V domain of CD80; CD80 with a C domain of CD86 substituting the domain C of CD80, and a V domain of CD86 substituting the V domain of CD80, and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80, and a V domain of CD86 substituting the V domain of CD80, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with a C domain of CD86 substituting the domain C of CD80 and a transmembrane region of CD86 substituting the transmembrane region of CD80, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with the deleted domain C, and the suppressed cytoplasmic tail region; CD80 with the suppressed domain C, and the suppressed cytoplasmic tail region, and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with the deleted domain C, and the suppressed cytoplasmic tail region, and a V domain of CD86 substituting the V domain of CD80; CD80 with a C domain of CD86 substituting the domain C of CD80, and a transmembrane region of CD86 substituting the transmembrane region of CD80, and a cytoplasmic tail region of CD86 substituting the cytoplasmic tail region of CD80; CD80 with a C domain of CD86 substituting the C domain of CD80, and the suppressed cytoplasmic tail region; CD80 with a C domain of CD86 substituting the C domain of CD80, and the suppressed cytoplasmic tail region, and a transmembrane region of CD86 substituting the transmembrane region of CD80; CD80 with a V domain of CD86 substituting the domain V of CD80, and a C domain of CD86 substituting the C domain of CD80, and the suppressed cytoplasmic tail region; CD80 with a V domain of CD86 substituting the domain V of CD80, and a C domain of CD86 substituting the C domain of CD80, and the deleted transmembrane region; CD80 with a C domain of CD86 substituting the C domain of CD80, and the deleted transmembrane region; CD80 with the deleted domain C, and the deleted transmembrane region; CD80 with the deleted domain C, and the V domain of CD86 substituting the CD80 domain V, and the deleted transmembrane region; CD80 with a C domain of CD86 substituting the domain C of CD80, and the deleted transmembrane region, and the suppressed cytoplasmic tail region; CD80 with the deleted domain, the deleted transmembrane region, and the suppressed cytoplasmic tail region; and The variable domain of CD80 or functional fragments thereof. The protein forms of the CD80? C mutants can be formulated as components in vaccines or genetic constructs, which include coding sequences encoding the CD80? C mutants that can be provided as vaccine components. In any case, these vaccines can be used in prophylactic or therapeutic methods. In accordance with some preferred embodiments of the invention, DNA vaccines containing DNA molecules containing coding sequences that encode an immunogen and a mutant of CD80? C are provided. An improvement of the present invention relates to the inclusion of genetic material for the coproduction of a mutant protein of CD80α, in addition to the production of the antigenic target encoded by the nucleic acid sequences of the DNA vaccines. The present invention relates to methods for introducing genetic material into the cells of an individual, for the purpose of inducing immune responses against proteins and peptides that are encoded by means of the genetic material. The methods comprise the steps of administering to the individual's tissue, either a single nucleic acid molecule comprising a nucleotide sequence encoding a target protein, and a nucleotide sequence that encodes a mutant protein of CD80?; or a composition having two nucleic acid molecules, one comprising a nucleotide sequence encoding a target protein, and one comprising a nucleotide sequence encoding a CD80? C mutant protein. The nucleic acid molecule (s) can be provided as plasmid DNA, the nucleic acid molecules of recombinant vectors, or as part of the genetic material that is provided in an attenuated vaccine. In accordance with the present invention, compositions and methods are provided which prophylactically and / or therapeutically immunize an individual against an pathogen or abnormal cell, related to disease. The genetic material that encodes a target protein, i.e., a peptide or protein that shares at least one epitope with an immunogenic protein that is found in the pathogen or target cells, and genetic material that encodes a mutant protein of CD80? C. The genetic material is expressed by means of the individual's cells, and serves as an immunogenic target against which an immune response occurs. The resulting immune response reacts with a pathogen or objective cells, and is broad-based: in addition to a humoral immune response, both arms of the cellular immune response are produced. The methods of the present invention are useful for conferring prophylactic and therapeutic immunity. Thus, a method for immunization includes both methods to protect an individual from an attack by pathogens, or the occurrence or proliferation of specific cells, as well as methods to treat an individual suffering from infection by pathogens, hyperproliferative disease, or autoimmune disease. As used herein, the terms "target protein" and "immunogen" are used interchangeably and are meant to refer to peptides and proteins encoded by constructs of genes that act as protein targets for an immune response. The target protein is a protein against which an immune response can be produced. The target protein is an immunogenic protein that shares at least one epitope with a protein of the pathogen or of the undesirable cell type, such as a cancer cell or a cell involved in autoimmune disease, against which immunization is required. The immune response directed against the target protein will protect the individual against, and treat the individual for the specific infection or disease with which the target protein is associated. The target protein need not be identical to the protein against which an immune response is desired. Rather, the target protein must be capable of inducing an immune response that cross-reacts with the protein against which the immune response is desired. The present invention is useful for producing broad immune responses against a target protein, i.e., proteins specifically associated with pathogens or with the "abnormal" cells of the individual himself. The present invention is useful for immunizing individuals against pathogenic agents and organisms, such that an immune response against a pathogenic protein provides protective immunity against the pathogen. The present invention is useful for combating hyperproliferative diseases and disorders such as cancer, by producing an immune response against an objective protein that is specifically associated with hyperproliferative cells. The present invention is useful for combating diseases and autoimmune disorders, by producing an immune response against an objective protein that is specifically associated with the cells involved in the autoimmune condition. In accordance with the present invention, DNA or RNA encoding a target protein and a mutant protein of CD80α are introduced into the cells of the tissue of an individual where it is expressed, thereby producing the target protein and the mutant protein of CD80? C. The DNA or RNA sequences encoding the target protein and the CD80? C mutant are linked, each one, to regulatory elements necessary for the expression in the individual's cells. Regulatory elements for DNA expression include a promoter and a polyadenylation signal. In addition, other elements, such as a Kozak region, may also be included in the genetic construct. Preferred embodiments include nucleotide sequences encoding the target protein and the CD80? C mutant protein, which are provided as separate expressible forms in which each of the target protein and the CD80? C mutant protein binds to its own set of regulatory elements necessary for expression in the individual's cell. However, the present invention is further related to modalities in which the target protein and the CD80? C mutant protein are provided as a single genetic construct. In some of these embodiments, the polyprotein that is produced by the only expressible form, can be processed into two separate proteins, or it can exist as a chimeric protein that functions both as the target protein and the CD80? C mutant. In some embodiments, nucleic acid sequences encoding two or more copies of the target protein and / or two or more copies of the mutant CD80? C protein can be provided in a single expressible form of a gene construct. The polyproteins that are encoded therein can be processed into subunits after expression, or can be maintained as functional polyproteins. As used herein, the term "expressible form" refers to constructs of genes that contain the necessary operable regulatory elements, linked to a coding sequence that encodes a target protein and / or a CD80? C mutant protein, of such that when they are present in the individual's cell, the coding sequence will be expressed. As used herein, the term "sharing an epitope" refers to proteins that comprise at least one epitope that is identical to, or substantially similar to, an epitope of another protein. As used herein, the term "substantially similar epitope" is meant to refer to an epitope having a structure that is not identical to an epitope of a protein, but which nonetheless invokes a cellular or humoral immune response, which It reacts cross-wise with that protein. Genetic constructs comprise a nucleotide sequence that encodes a target protein and / or a CD80? C mutant protein operably linked to the regulatory elements necessary for the expression of genes. In accordance with the invention, combinations of gene constructs are provided which include one comprising an expressible form of the nucleotide sequence encoding a CD80? C mutant protein. The incorporation into a living cell of the DNA or RNA molecule (s) that include the combination of gene constructs, results in the expression of DNA or RNA, and the production of the target protein and a mutant protein of CD80? C. The result is a sisingly improved immune response against the target protein. The present invention can be used to immunize an individual against all pathogens such as viruses, prokaryotes and pathogenic eukaryotic organisms such as unicellular pathogenic organisms and multicellular parasites. The present invention is particularly useful for immunizing an individual against those pathogens that infect cells, and which are not encapsulated such as viruses, and prokaryotes such as gonorrhea, listeria and shigella. In addition, the present invention is also useful for immunizing an individual against protozoan pathogens, including a stage in the life cycle where they are intracellular pathogens. As used herein, the term "intracellular pathogen" is intended to refer to a virus or pathogenic organism that, at least part of its reproductive or life cycle, it exists inside a host cell and in it produces or causes the production of pathogenic proteins. Table 1 provides a listing of some of the viral families and genera for which vaccines may be made in accordance with the present invention. In vaccines, DNA constructs comprising the DNA sequences encoding the peptides, comprising at least one epitope identical or substantially similar to an epitope displayed on a pathogen antigen, such as those antigens listed in the tables, are useful. In addition, the present invention is also useful for immunizing an individual against other pathogens, including prokaryotic and eukaryotic protozoan pathogens, as well as multicellular parasites such as those listed in Table 2. For the purpose of producing a genetic vaccine to protect against infection by pathogens, a genetic construct should include genetic material that encodes immunogenic proteins against which a protective immune response can be mounted, such as the coding sequence for the target. Whether the pathogen is infecting intracellularly, for which the present invention is particularly useful, or extracellularly, it is unlikely that all pathogenic antigens will produce a protective response. Because both DNA and RNA are relatively small, and can be produced relatively easily, the present invention provides the additional advantage of allowing vaccination with multiple pathogenic antigens. The genetic construct that is used in the genetic vaccine may include genetic material that codes for many pathogenic antigens. For example, many viral genes can be included in a single construction, thereby providing multiple targets. Tables 1 and 2 include lists of some of the pathogenic agents and organisms for which genetic vaccines can be prepared, to protect an individual from infection by them. In some preferred embodiments, methods for immunizing an individual against a pathogen are directed against HIV, HTLV or HBV. Another aspect of the present invention provides a method for conferring a protective immune response based on amplitude, against hyperproliferative cells that are characteristic in hyperproliferative diseases, and a method for treating individuals suffering from diseases .-. and hyperproliferative. As used herein, the term "hyperproliferative diseases" is intended to refer to those diseases and disorders characterized by cell hyperproliferation. Examples of hyperproliferative diseases include all forms of cancer and psoriasis. It has been found that the introduction of a genetic construct that includes a nucleotide sequence encoding a protein associated with immunogenic "hyperproliferative cells" within the cells of an individual results in the production of those proteins in cells vaccinated from a individual. As used herein, the term "protein associated with hyperproliferatives" is intended to refer to proteins that are associated with a hyperproliferative disease. To immunize against hyperproliferative diseases, an individual is given a genetic construct that includes a nucleotide sequence that encodes a protein that is associated with a hyperproliferative disease. In order for the protein associated with hyperproliferatives to be an effective immunogenic target, it must be a protein that is produced exclusively or at higher levels in hyperproliferative cells, compared to normal cells. Target antigens include those proteins, fragments thereof and peptides that comprise at least one epitope that is found in these proteins. In some cases, a protein associated with hyperproliferatives is the product of a mutation of a gene that encodes a protein. The mutated gene encodes a protein that is almost identical to the normal protein, except that it has a slightly different amino acid sequence, which results in a different epitope that is not found in the normal protein. These target proteins include those which are proteins encoded by oncogenes such as myb, myc, end, and the translocation gene bcr / abl, ras, src, P53, neu, trk and EGRF. In addition to the oncogene products as target antigens, the target proteins for anti-cancer treatments, and protective regimens include variable regions of antibodies made by B cell lymphomas, and variable regions of T cell receptors of T-cell lymphomas which, in some modalities, are also used as target antigens for autoimmune disease. Other proteins associated with tumors can be used as target proteins such as proteins that are found at higher levels in tumor cells, including the protein recognizing monoclonal antibody 17-IA, and folate binding proteins. Although the present invention can be used to immunize an individual against one or more of many forms of cancer, the present invention is particularly useful for prophylactically immunizing. an individual who is predisposed to develop a particular cancer, or who has had cancer and is therefore susceptible to relapse. Developments in genetics and technology, as well as in epidemiology, allow the determination of the probability and risk assessment for the development of cancer in the individual. Using the genetic classification and / or medical history of the family, it is possible to predict the probability that a particular individual has of developing any of many types of cancer. Similarly, those individuals who have already developed cancer, and who have been treated to remove the cancer, or are otherwise in remission, are particularly susceptible to relapse and recurrence. As part of a treatment regimen, these individuals can be immunized against the cancer that has been diagnosed, as if they had it, for the purpose of combating a recurrence. In this way, once it is known that an individual has had a type of cancer and is at risk of a relapse, it can be immunized for the purpose of preparing your immune system, to combat any future appearance of cancer. The present invention provides a method for treating individuals suffering from hyperproliferative diseases. In those methods, the introduction of genetic constructs serves as an immunotherapeutic, which directs and promotes the individual's immune system to combat the hyperproliferative cells that produce the target protein. The present invention provides a method for treating individuals suffering from autoimmune diseases and disorders, by conferring a protective immune response based on amplitude against targets that are associated with autoimmunity, including cell receptors and cells that produce "auto" antibodies. "- directed. T-cell mediated autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, egener granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by T cell receptors that bind to endogenous antigens, and initiate the inflammatory cascade associated with autoimmune diseases. Vaccination against the variable region of T cells would produce an immune response, which includes CTLs, to eliminate those T cells.

In RA, many variable regions specific for T cell receptors (TCRs), which are involved in the disease, have been characterized. These TCRs include Vß-3, Vß-14, Vß-17 and Va-17. In this way, vaccination with a DNA construct that encodes at least one of these proteins will produce an immune response that will target the T cells involved in the RA. See: Howell, M. D., et al., 1991 Proc. Natl. Acad. Sci. USA 88: 10921-10925; Paliard, X., et al., 1991 Science 253: 325-329; Williams, WV, et al., 1992. "Clin.Invest.90: 326-333, each of which is incorporated herein by reference.In the MS, many specific variable regions of TCRs have been characterized, which are These TCRs include Vß-7, and Va-10. In this way, vaccination with a DNA construct that encodes at least one of these proteins will produce an immune response that will target the T cells involved in the disease. MS See: Wucherpfennig, KW, et al., 1990 Science 248: 1016-1019; Oksenberg, JR, et al., 1990 Nature 345: 344-346, each of which is incorporated herein by reference. scleroderma, many variable regions specific for TCRs have been characterized, which are involved in the disease.These TCRs include Vß-6, Vß-8, ___ Vß-14 and Va-16, Va-3C, Va-7, Va-14, Va-15, Va-16, Va-28 and Va-12. In this way, vaccination with a DNA construct that encodes at least one of these proteins will produce an immune response that will target the T cells involved in the scleroderma. In order to treat patients suffering from autoimmune disease mediated by T cells, particularly those for which the variable region of the TCR is still going to be characterized, a synovial biopsy can be performed. Samples of the T cells present can be taken, and the variable region of those TCRs can be identified using standard techniques. Genetic vaccines can be prepared using this information. Autoimmune diseases mediated by B cells include Lupus (SLE), Grave's disease, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, asthma, cryoglobulinemia, primary biliary sclerosis, and pernicious anemia. Each of these diseases is characterized by antibodies that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases. Vaccination against the variable region of antibodies would produce an immune response that includes CTLs, to eliminate those B cells that produce the antibody. In order to treat patients suffering from autoimmune disease mediated by B cells, the variable region of the antibodies involved in autoimmune activity must be identified. A biopsy can be performed, and samples of the antibodies present in a site of inflammation can be taken. The variable region of these antibodies can be identified using standard techniques. Genetic vaccines can be prepared using this information. In the case of SLE, it is believed that an antigen is DNA. Thus, in patients who will be immunized against SLE, their serum can be classified to look for anti-DNA antibodies, and a vaccine can be prepared that includes the DNA constructs that encode the variable region of those anti-DNA antibodies. that were found in the serum. The common structural characteristics between the variable regions of both the TCRs and the antibodies are well known. The DNA sequence encoding a particular TCR or antibody can generally be found following well-known methods, such as those described in Kabat, et al. 1987 Se? Ouence Prote Proteins of Immunological Interest U.S. Department of Health and Human Services, Bethesda MD, which is incorporated herein by reference. In addition, a general method for cloning functional variable regions of antibodies can be found, in Chaudhary, V. K., et al., 1990 Proc. Natl. Acad. Sci. USA 87: 1066, which is incorporated herein by reference. The present invention provides an improved method for immunizing individuals, comprising the step of applying gene constructs to the cells of individuals, as part of vaccine compositions including DNA vaccines, live attenuated vaccines, and recombinant vaccines. Gene constructs comprise a nucleotide sequence that encodes an immunomodulatory protein, and which is operably linked to regulatory sequences that can function in the vaccine to effect expression. Improved vaccines result in an improved cellular immune response. In some immunization methods, individuals are administered a gene construct that encodes an immunogen, and a genetic construct that encodes a CD80? C mutant protein. In some immunization methods, the individual is administered a gene construct that encodes both an immunogen and a CD80? C mutant protein. In some alternative methods of immunization, the individual is administered an immunogen and a CD80? C mutant protein. In some alternative immunization methods, the individual is administered a protein immunogen and a genetic construct that encodes a CD80? C mutant protein. In some alternative immunization methods, the individual is administered a gene construct that encodes an immunogen and a CD80? C mutant protein. In accordance with another aspect of the invention, proteins of the C region of CD80 are provided, to suppress the immune responses associated with autoimmune diseases and transplant rejections. The CD80 region C proteins contain a functional CD80 C region. The functional fragments of the C region of CD80 can be routinely identified. In some embodiments, the functional fragments of the C region of CD80 are less than 60 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 50 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 40 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 30 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 20 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 15 amino acids. In some embodiments, the functional fragments of the C region of CD80 are less than 10 amino acids. In some embodiments, the V region is deleted. In some embodiments, the V region of CD80 or CD86 is present. Some modalities include the transmembrane region of CD80. Some modalities include the transmembrane region of CD86. In some embodiments, the transmembrane region of CD80 is deleted and is not replaced by any other sequence. Some modalities include non-CD80 sequences, not CD86. Some modalities include non-CD80 sequences, not CD86 instead of the CD80 tm. Some modalities include the cytoplasmic tail of CD80. Some modalities include the cytoplasmic tail of CD86. In some embodiments, the cytoplasmic tail of CD80 is deleted, and is not replaced by any other sequence. Some modalities include non-CD80 sequences, not CD86 instead of the CD80 ct. According to some embodiments, the non-CD80 protein comprises at least the C domain of CD80, or a functional fragment thereof. As used herein, the term "non-CD80 protein" is intended to refer to a protein that differs from wild type CD80, but that comprises a CD80 domain C or a functional fragment thereof. In some embodiments, the non-CD80 protein has the formula: R1-R2-R3-R4-R5-R6-R7-R8-R9 wherein R1 is 0-50 amino acids; R2 is 80V or 86V; R3 is 0-50 amino acids; R4 is 80C; R5 is 0-50 amino acids; R6 is 80tm or 86tm; R7 is 0-50 amino acids; R8 is 80ct or 86ct; and R9 is 0-50 amino acids, wherein 80V is the variable domain of CD80 or a functional fragment thereof; 86V is the variable domain of CD86 or a functional fragment thereof; 80C is the C domain of CD80 or a functional fragment thereof; 80tm is the transmembrane region of CD80 or a functional fragment thereof; 86tm is the transmembrane region of CD86 or a functional fragment thereof; 80ct is the cytoplasmic tail of CD80 or a functional fragment thereof; and 86ct is the cytoplasmic tail of CD86 or a functional fragment thereof. According to some embodiments of the invention, the isolated non-CD80 protein comprising at least the C domain of CD80, or a functional fragment thereof, has the formula selected from the group consisting of: R-dele-R-80C -R-80tm-R-80ct-R; R-dele-R-80C-R-80tm-R-dele-R; R-80V-R-80C-R-80tm-R-dele-Rj R-80V-R-80C-R-dele-R-dele-Rj R-86V-R-80C-R-80tm-R-80ct- R; R-86V-R-80C-R-80tm-R-dele-R; R-86V-R-80C-R-dele-R-dele-Rl R-80V-R-80C-R-86tm-R-80ct-R; R-dele-R-80C-R-86tm-R-80ct-R; R-dele-R-80C-R-86tm-R-dele-R; R-80V-R-80C-R-86tm-R-dele-R; R-80V-R-80C-R-80tm-R-86ct-R; R-dele-R-80C-R-80tm-R-86ct-R; R-86V-R-80C-R-86tm-R-80ct-R; R-86V-R-80C-R-80tm-R-86ct-Rj R-86V-R-80C-R-86tm-R-dele-R; R-dele-R-80C-R-86tm-R-86ct-R; and R-86V-R-80C-R-86tm-R-86ct-R; wherein 80V is the variable domain of CD80 or a functional fragment thereof; 86V is the variable domain of CD86 or a functional fragment thereof; 80C is the C domain of CD80 or a functional fragment thereof; 80tm is the transmembrane region of CD80 or a functional fragment thereof; 86tm is the transmembrane region of CD86 or a functional fragment thereof; 80ct is the cytoplasmic tail of CD80 or a functional fragment thereof; 86ct is the cytoplasmic tail of CD86 or a functional fragment thereof; del is 0 amino acids; and each R is independently each 0-100 amino acids. In some embodiments, each R is independently 0-50 amino acids; in some embodiments each R is independently 0-30 amino acids; in some embodiments, each R is independently 0-20 amino acids. In some embodiments of the invention the non-CD80 protein is selected from the group consisting of: a mutant CD80 with the deleted variable domain; a mutant CD80 with the deleted variable domain and the suppressed cytoplasmic tail; a mutant CD80 with suppressed cytoplasmic tail; a mutant CD80 with the suppressed transmembrane region and the suppressed cytoplasmic tail; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and the suppressed cytoplasmic tail; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and the deleted transmembrane region, and the suppressed cytoplasmic tail; a mutant CD80 with a substituted transmembrane region in place of the transmembrane region of CD80; a mutant CD80 with the deleted variable region and a substituted CD86 transmembrane region in place of the transmembrane region of CD80; a mutant CD80 with the deleted variable region, the suppressed cytoplasmic tail, and a substituted CD86 transmembrane region in place of the transmembrane region of CD80; a mutant CD80 with suppressed cytoplasmic tail, and a substituted CD86 transmembrane region in place of the transmembrane region of CD80; a mutant CD80 with a substituted CD86 cytoplasmic tail in place of the cytoplasmic tail of CD80; a mutant CD80 with the variable region deleted, and a cytoplasmic tail of substituted CD86 in place of the cytoplasmic tail of CD80; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and a transmembrane region of substituted CD86 in place of the transmembrane region of CD80; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and a cytoplasmic tail of substituted CD86 in place of the cytoplasmic tail of CD80; a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and a transmembrane region of substituted CD86 in place of the transmembrane region of CD80, and the suppressed cytoplasmic tail; a mutant CD80 with the deleted variable domain, and a substituted CD86 transmembrane region in place of the CD80 transmembrane region, and a substituted CD86 cytoplasmic tail in place of the cytoplasmic tail of CD80; and a CD80 mutant with a variable domain of CD86 substituted in place of the variable domain of CD80, and a transmembrane region of substituted CD86 in place of the transmembrane region of CD80, and the cytoplasmic tail of CD86 substituted in place of the cytoplasmic tail of CD80. Proteins of the C region of CD80 are provided either as proteins or as genetic constructs encoding the C region of CD80. The application of genetic constructs comprising the coding sequences encoding wild-type CD80, dele / 80C / 80tm / 80ct, dele / 80C / 80tm / 86ct, dele / 80C / 86tm / 80ct, or dele / 80C / 86tm / 86ct they provide particularly effective results in immunosuppression and the treatment of autoimmune diseases. The methods of this aspect of the invention are useful for treating diseases and autoimmune disorders. Those skilled in the art can identify individuals who have autoimmune diseases or disorders. Examples of autoimmune diseases and disorders include T cell-mediated autoimmune diseases such as rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, spondylitis ankylosing, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis, and autoimmune diseases mediated by B cells such as Lupus (SLE), Grave's disease, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia , asthma, cryoglobulinemia, primary biliary sclerosis, and pernicious anemia. Methods of this aspect of the invention are also useful for suppressing immune responses in individuals undergoing transplantation procedures, including cell transplants such as bone marrow and brain cell grafts, tissue transplants such as cornea grafts, and skin, and myoplasty procedures, and organ transplants such as liver, lung, kidney and heart. The methods for making and applying the compositions of the present invention are generally the same for immunization protocols, as well as non-immunogenic therapeutic protocols. As used herein, the term "protein" is intended to include proteinaceous molecules, including peptides, polypeptides and proteins. Some embodiments of the invention relate to the application of proteins through the administration of nucleic acids, particularly DNA, and methods for using same. For example, in some immunization methods, nucleic acids encoding immunogenic proteins and mutant CD80? C proteins are administered to individuals. In the same way, in some methods to treat autoimmune diseases, and to avoid rejection of grafts / transplants by immunosuppression, nucleic acids encoding proteins of the C region of CD80 are administered to the individuals. As used herein, the term "gene constructs of the invention" is meant to mean constructs of genes that include coding sequences that encode immunogenic proteins, CD80? C mutant proteins, and proteins of the C region of CD80, which can each be produced by similar means, and which can be formulated and administered in a similar manner, for use in the methods of the invention. In U.S. Patent Number 5,593,972, U.S. Patent Number 5,569,466, PCT / US90 / 01515, PCT / US93 / 0233d, PCT / US93 / 04d31, and PCT / US94 / 00699, which are incorporated herein by reference, describe DNA vaccines. In addition to the application protocols described in those applications, alternative methods for applying DNA are described in U.S. Patent Nos. 4,945,050 and 5,036,006, both incorporated herein by reference. DNA vaccine protocols are useful to immunize individuals. The teachings can be applied in the present invention, to aspects in which individuals with autoimmune disease and rejection of transplants are treated, using constructs of genes that encode proteins of the C region of CDdO. In those embodiments, no coding sequence encoding immunogens is provided. When captured by a cell, the genetic constructs of the invention can remain present in the ... cell as an extrachromosomal molecule in operation and / or integrated into the chromosomal DNA of the cell. DNA can be introduced into cells, where it remains as a separate genetic material in the form of a plasmid or plasmids. Alternatively, linear DNA that can be integrated into the chromosome can be introduced into the cell. When DNA is introduced into the cell, reagents that promote the integration of DNA into chromosomes can be added. DNA sequences that are useful to promote integration may also be included in the DNA molecule. Alternatively, RNA can be administered to the cell. It is also contemplated to provide the genetic constructs of the invention as a linear minichromosome including a centromere, telomeres and a replication origin. The genetic constructs of the invention include the regulatory elements necessary for the expression of genes of a nucleic acid molecule. The elements include: a promoter, a start codon, a stop codon, and a polyadenylation signal. In addition, enhancers are often required for the expression of genes of the sequence encoding the protein of the invention. It is necessary that these elements are operably linked to the sequence encoding the desired proteins, and that the regulatory elements are operable in the individual to whom they are administered. The start codons and stop codon are generally considered to be part of a nucleotide sequence encoding the desired protein. However, it is necessary that these elements be functional in the individual to whom the gene construction is administered. The start and end codons must be in frame with the coding sequence. The promoters and polyadenylation signals that are used must be functional within the individual's cells. Examples of promoters useful for practicing the present invention, especially in the production of a human genetic vaccine, include but are not limited to promoters of Simian Virus 40 (SV40), promoter of the Mouse Mammary Tumor Virus (MMTV), Human Immunodeficiency Virus (HIV) such as the Long Term Repetition HIV (LTR) promoter, Moloney virus, ALV, Cytomegalovirus (CMV) such as the CMV immediate early promoter, Epstein Barr Virus (EBV), Virus of Rous Sarcoma (RSV), as well as promoters of human genes such as human actin, human myosin, human hemoglobin, human muscle creatine, and human metallothionein. Examples of polyadenylation signals useful in practicing the present invention, especially in the production of a human genetic vaccine, include but are not limited to the polyadenylation signals of human and bovine growth hormone, SV40 polyadenylation signals, and LTR polyadenylation signals. In particular, the SV40 polyadenylation signal is used which is a pCEP4 plasmid (Invitrogen, San Diego CA), which is referred to as the SV40 polyadenylation signal. In addition to the regulatory elements that are required for DNA expression, other elements may also be included in the DNA molecule. Those additional elements include breeders. The enhancer can be selected from the group including, but not limited to: human actin, human myosin, human hemoglobin, human muscle creatine, and viral enhancers such as those of CMV, RSV, and EBV. The genetic constructions of the invention can be provided with the mammalian origin of replication, with the purpose of maintaining the construction extrachromosomally and producing multiple copies of the construction in the cell. The pCEP4 and pREP4 plasmids from Invitrogen (San Diego, CA) contain the replication origin of the Epstein Barr virus, and the nuclear antigen EBNA-1 encoding the high copy episomal replication region, without integration. In some preferred embodiments related to immunization applications, nucleic acid molecule (s) is applied, which includes (n) nucleotide sequences encoding a target protein, a CD80? C mutant protein and, additionally, genes for proteins that further improve the immune response against those target proteins. Examples of those genes are those that code for cytokines and lymphokines such as a-interferon, gamma-interferon, platelet-derived growth factor (PDGF), GC-SF, GM-CSF, TNF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12. For the purpose of maximizing protein production, regulatory sequences that are well suited for gene expression in the cells within which the construct is administered can be selected. On the other hand, codons can be selected that are transcribed more efficiently in the cell. One of ordinary skill in the art can produce DNA constructs that are functional in cells. The methods of the present invention, whether immunization methods or immunosuppression methods, comprise the step of administering nucleic acid molecules to the individual's tissue. In some preferred embodiments, the nucleic acid molecules are administered intramuscularly, intranasally, intraperitoneally, subcutaneously, intradermally, intravenously, by aerosol administration to lung tissue, or topically, or by washing mucosal tissue selected from the group consisting of vaginal , rectal, urethral, buccal, and sublingual. One aspect of the present invention relates to pharmaceutical compositions useful in the methods of the present invention. The pharmaceutical compositions comprise a nucleic acid molecule, preferably a DNA molecule comprising a nucleotide sequence that encodes one or more proteins operably linked to the regulatory elements necessary for expression in the individual's cells. The pharmaceutical compositions additionally comprise a pharmaceutically acceptable carrier or diluent. The term "pharmaceutical" is well known and widely understood by those skilled in the art. As used herein, the terms "pharmaceutical compositions" and "injectable pharmaceutical compositions" are intended to have their ordinary meaning, as understood by those skilled in the art. The pharmaceutical compositions are required to meet specific standards regarding sterility, pyrogens, particulate matter, as well as isotonicity and pH. For example, injectable pharmaceutical compositions are sterile and pyrogen-free. The pharmaceutical compositions according to the present invention may comprise about 1 ng to about 10,000 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain about 2000 μg, 3000 μg, 4000 μg, or 5000 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain about 1000 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain from about 10 ng to about 800 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain from about 0.1 to about 500 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain from about 1 to about 350 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain from about 25 to about 250 μg of DNA. In some preferred embodiments, the pharmaceutical compositions contain approximately 100 μg of DNA. The pharmaceutical compositions according to the present invention, which comprise the genetic constructions of the invention, are formulated in accordance with the mode of administration to be used. One of ordinary skill in the art can easily formulate a vaccine or non-immunogenic therapeutic product, that includes a genetic construction. In cases where intramuscular injection is the chosen mode of administration, an isotonic formulation is preferably used.

Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, isotonic solutions such as saline regulated at their pH with phosphate are preferred. The 5 stabilizers include gelatin and albumin. In some embodiments, a vasoconstriction agent is added to the formulation. The pharmaceutical preparations according to the present invention are provided sterile and free of pyrogens. The pharmaceutical compositions according to the invention include application components in combination with nucleic acid molecules, which also comprise pharmaceutically acceptable carriers or vehicles such as, for example, saline. Any means that allows the successful application of the nucleic acid can be used. One skilled in the art would readily understand the multitude of pharmaceutically acceptable media that can be used in the present invention. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, A. Osol, a standard reference text 20 in this field, which is incorporated herein by reference. In some embodiments, the nucleic acid molecule is applied to the cells in conjunction with the administration of a facilitating agent. Reference is also made to the 25 facilitating agents as enhancers of the function of ? J »JWW < < . .-, »> I. .. ....... dz polynucleotides or genetic vaccine facilitators. The facilitating agents are described in U.S. Patent Number 5, 630, 676 issued November 3, 199d, U.S. Patent Number 5,593,972 issued January 14, 1997, and the International Application. with serial number PCT / US94 / 00699 filed January 26, 1994 (U.S. Patent Application Serial Number 0d / 979.3d5 filed November 29, 1997), which are incorporated herein as reference. In addition, the facilitating agents are described in U.S. Patent No. 5,739,118 issued April 14, 1998, U.S. Patent No. 5,837,533 issued November 17, 1996, PCT / US95 / 12502 filed September 28, 1995, and PCT / US95 / 04071 filed March 30, 1995, each of which is incorporated herein by reference. The facilitator agents that are administered in conjunction with nucleic acid molecules can be administered as a mixture with the nucleic acid molecule, or administered simultaneously separately, before or after administration of the nucleic acid molecules. In addition, other agents that can function as transfection agents and / or replicating agents and / or inflammatory agents, and that can be co-administered with or without a facilitating agent, include growth factors, cytokines and lymphokines such as α-interferon, gamma-interferon, platelet-derived growth factor (PDGF), GC-SF, GM-CSF, TNF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-6, IL- 8, IL-10, IL-12 and B7.2, as well as fibroblast growth factor, surface active agents, such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analog including monophosphoryl lipid A (MPL), muramyl peptides, quinone analogs and vesicles such as squalene and squalene, and hyaluronic acid. In modalities that relate to immunization methods, coagents that preferably improve immune responses are selected. In modalities that relate to immunosuppression methods, coagents are selected that do not improve immune responses. In some preferred embodiments, the genetic constructs of the invention are formulated with, or administered in conjunction with, a facilitator selected from the group consisting of benzoic acid esters, anuides, amidines, urethanes, and the hydrochloride salts thereof , such as those in the family of local anesthetics. In some preferred embodiments, the facilitators may be a compound having one of the following formulas: Ar - R1 - O - R2 - R3 Ar - N - R1 - R2 - R3 or R4 - N - R5 - R6 or R4 - 0 - R1 - R7 wherein: Ar is benzene, p-aminobenzene, m-aminobenzene, o-aminobenzene, substituted benzene, p-aminobenzene substituted 177-aminobenzene, substituted o-aminobenzene substituted, wherein the amino group in the compounds of aminobenzene can be amino, alkylamine of 1 to 5 carbon atoms, 1 to 5 carbon atoms, dialkylamino of 1 to 5 carbon atoms , and the substitutions in the substituted compounds are halogen, alkyl of 1 to 5 carbon atoms, and alkoxy of 1 to 5 carbon atoms; R1 is C = 0; R2 is alkyl of 1 to 10 carbon atoms, including branched alkyl; R3 is hydrogen, amine, alkylamine of 1 to 5 carbon atoms, 1 to 5 carbon atoms, dialkylamine of 1 to 5 carbon atoms; R2 + R3 can form a cyclic alkyl, a substituted alkyl of 1 to 10 carbon atoms cyclic alkyl, a cyclic aliphatic amine, a cyclic aliphatic amine substituted by alkyl of 1 to 10 carbon atoms, a heterocycle, a substituted heterocycle by alkyl of 1 to 10 carbon atoms, including a heterocycle N-substituted by alkyl of 1 to 10 carbon atoms; R4 is Ar, R2 or alkoxy of 1 to 5 carbon atoms, a cyclic alkyl, a cyclic alkyl substituted by alkyl of 1 to 10 carbon atoms, a cyclic aliphatic amine, a cyclic aliphatic amine substituted by alkyl of 1 to 10 atoms carbon, a heterocycle, a heterocycle substituted by alkyl of 1 to 10 carbon atoms, and a heterocycle substituted by alkoxy of 1 to 10 carbon atoms, including an N-substituted heterocycle by alkyl of 1 to 10 carbon atoms; R5 is C = NH; R6 is Ar, R2 or alkoxy of 1 to 5 carbon atoms, a cyclic alkyl, a substituted alkyl of 1 to 10 carbon atoms cyclic alkyl, a cyclic aliphatic amine, a cyclic aliphatic amine substituted by alkyl of 1 to 10 atoms carbon, a heterocycle, a heterocycle substituted by alkyl of 1 to 10 carbon atoms, and a heterocycle substituted by alkoxy of 1 to 10 carbon atoms, including an N-substituted heterocycle by alkyl of 1 to 10 carbon atoms; and R7 is Ar, R2 or alkoxy of 1 to 5 carbon atoms, a cyclic alkyl, a substituted alkyl of 1 to 10 carbon atoms cyclic alkyl, a cyclic aliphatic amine, a cyclic aliphatic amine substituted by alkyl of 1 to 10 carbon atoms, a heterocycle, a heterocycle substituted by alkyl of 1 to 10 carbon atoms, and a heterocycle substituted by alkoxy of 1 to 10 carbon atoms, including a heterocycle N-substituted by alkyl of 1 to 10 carbon atoms. Examples of esters include: benzoic acid esters such as piperocaine, meprilcaine, and isobucaine; para-aminobenzoic acid esters such as procaine, tetracaine, butetamine, propoxycaine, and chloroprocaine; esters of meta-aminobenzoic acid including metabutamine and primacaine; and esters of para-ethoxybenzoic acid such as paretoxicain. Examples of anuides include lidocaine, etidocaine, mepivacaine, bupivacaine, pirocaine and prilocaine. Other examples of such compounds include dibucaine, benzocaine, dyclonine, pramoxine, proparacaine, butacaine, benoxinate, carbocaine, bupivacaine methyl, picrate butasina, phenacaine, diotan, lucaína, intracaína, nupercaine, metabutoxycaine, piridocaine, biphenamine and bicyclic derivatives botanically such such as cocaine, cinnamoylcocaine, truxilina and cocaethylene, and all those compounds complexed with hydrochloride. In the preferred modalities, the facilitator is bupivacaine. The difference between bupivacaine and mepivacaine is that bupivacaine has an N-butyl group instead of an N-methyl group of mepivacaine. The compounds can have in N, from 1 to 10 carbon atoms. The compounds can be substituted with halogen such as procaine and chloroprocaine. The anuides are preferred. The facilitating agent is administered before, simultaneously with, or subsequent to genetic construction. The facilitating agent and the genetic construct can be formulated in the same composition. Bupivacaine-HCl is chemically designated as 2-piperidinecarboxamide, 1-butyl-N- (2,6-dimethylphenyl) -monohydrochloride, monohydrate, and is widely available commercially for pharmaceutical uses, with any source including Astra Pharmaceutical Products Inc. (Westboro , MA) and Sanofi Winthrop Pharmaceuticals (New York, NY), Eastman Kodak (Rochester, NY). Bupivacaine is commercially formulated with and without methylparaben, and with or without epinephrine. Any of these formulations can be used. These are commercially available for pharmaceutical use at a concentration of 0.25 percent, 0.5 percent, and 0.75 percent, which can be used in the invention. If desired, alternative concentrations can be prepared, particularly those between 0.05 percent - 1.0 percent, which produce desirable effects. In accordance with the present invention, from about 250 μg to about 10 milligrams of bupivacaine are administered. In some embodiments, about 0.5 milligrams to about 3.0 milligrams are administered. In some embodiments, they are administered from about 5 to 50 μg. For example, in some embodiments, from about 50 μl to about 2 milliliters, preferably from 50 μl to about 1500 μl, and most preferably about 1 milliliter of 0.25-0.50 percent bupivacaine - HCl and 0.1 percent methylparaben are administered. , in an isotonic pharmaceutical carrier, in the same site as the previous vaccine, simultaneously with, or after, the vaccine is administered. Similarly, in some embodiments, from about 50 μl to about 2 milliliters, preferably from 50 μl to about 1500 μl, and most preferably about 1 milliliter of 0.25-0.50 percent bupivacaine-HCl, is administered in a carrier Isotonic pharmaceutical, in the same place as the previous vaccine, simultaneously with, or after the vaccine is administered. Bupivacaine and other compounds that act in a similar manner, particularly those of the related family of local anesthetics, may be administered in concentrations that provide the facilitation of desired uptake of genetic constructs by cells.

. In some embodiments of the invention, the individual is first subjected to the injection of the facilitator, before the administration of the genetic construct. That is, until, for example, approximately one week to ten days before the administration of the genetic construct, the individual is first injected with the facilitator. In some modalities, the individual is injected with the facilitator approximately 1 to 5 days, in some modalities 24 hours, before or after the administration of the genetic construction. In accordance with the above, the facilitator and the genetic construct can be combined to form a single pharmaceutical composition. In some embodiments, the genetic constructs are administered free of facilitating agents, that is, the free formulations of facilitating agents using the administration protocols in which the genetic constructs are not administered in conjunction with the administration of the facilitating agents. In some embodiments that relate to immunization, the gene constructs of the invention may remain as part of the genetic material in live attenuated microorganisms or recombinant microbial vectors. In addition to using the expressible forms of the coding sequences of the CD80, CD80? C mutant proteins, the present invention relates to improved attenuated live vaccines and improved vaccines that use recombinant vectors to deliver foreign genes encoding the antigens. In the Patents of the States United States of America Numbers 4,722,848 5,017,487 5,077,044; 5,110,567; 5,112,749; 5,174,993 5,223,424 5,225,336; 5,240,703; 5,242,829; 5,294,441 5,294,548 5,310,668; 5,387,744; 5,389,366; 5,424,065 5,451,499 5,453,364; 5,462,734; 5,470,734; and 5,482,713, which are incorporated herein by reference, describe examples of live attenuated vaccines and those that use recombinant vectors to administer foreign antigens. Gene constructs are provided, which include the nucleotide sequence encoding a CD80? C mutant protein operably linked to regulatory sequences that can function in the vaccine to effect expression. Gene constructs are incorporated into live attenuated vaccines and recombinant vaccines to produce improved vaccines according to the invention. Gene constructs can be part of genomes of recombinant viral vaccines, where the genetic material either integrates within the chromosome of the cell, or remains extrachromosomal. In some embodiments that relate to the non-immune response that induces therapy, the nucleic acid molecules encoding the protein of the CD80 C region can be administered using any of a variety of delivery components, such as recombinant viral expression vectors. or other suitable administration elements, in order to affect their introduction and expression in compatible host cells. In general, viral vectors can be DNA viruses such as recombinant adenoviruses and recombinant vaccinia viruses or RNA viruses, such as recombinant retroviruses. Other recombinant vectors include recombinant prokaryotes that can infect cells and express recombinant genes. In addition to the recombinant vectors, other delivery components are also contemplated such as encapsulation in liposomes, transfection mediated with transferin and other elements mediated with receptor. The invention is intended to include these other forms of expression vectors and other suitable administration means, which serve equivalent functions and which will become known in the art subsequently to the present. In a preferred embodiment of the present invention, the DNA is administered to the host cells of the component by means of an adenovirus. One skilled in the art will readily understand this technique for administering DNA to a host cell through these means. Although the invention preferably includes adenovirus, it is intended that the invention include any virus that provides equivalent functions. In another preferred embodiment of the present invention, the RNA is delivered to the host cells of the component by means of a retrovirus. One skilled in the art will readily understand this technique of administering RNA to a host cell by means of these means. It is intended that any retrovirus that serves to express the protein encoding the RNA be included therein. Some embodiments of the invention relate to proteins and methods for using same. For example, in some immunization methods, immunogenic proteins and CDβO ?C mutant proteins are administered to individuals. Similarly, some methods to treat autoimmune diseases and avoid rejections by grafts / transplants through immunosuppression. The CD80 C region proteins are administered to individuals. As used herein, the term "proteins of the invention" is meant to mean immunogenic proteins, CD80? C mutant proteins and CD80 C region proteins, which can be produced by similar means and which can be formulated and administering in a similar manner for use in the methods of the invention. Vectors that include recombinant expression vectors comprising a nucleotide sequence encoding the proteins of the invention can be produced routinely. As used herein, the term "recombinant expression vector" means a plasmid, phage, viral particle or other vector which, when introduced into an appropriate host, contains the genetic elements necessary to direct the expression of a coding sequence. One of ordinary skill in the art can isolate or synthesize a nucleic acid molecule encoding a protein of the invention and insert it into an expression vector, using standard techniques and starting materials that are readily available. The coding sequence is operably linked to the necessary regulatory sequences. Expression vectors are well known and readily available. Examples of expression vectors include plasmids, phages, viral vectors and other nucleic acid molecules or nucleic acid molecules containing vehicles useful for transforming host cells and facilitating the expression of coding sequences. Some embodiments of the invention relate to recombinant expression vectors comprising a nucleotide sequence that encodes the CD80? C mutant protein or a CD80 C region protein. The recombinant expression vectors of the invention are useful for transforming hosts. The present invention relates to recombinant expression vectors comprising a nucleotide sequence encoding a , A. *., .A.IA mutant protein CD80? C, a chimeric protein comprising a CD80? C mutant protein, or a CD80 C region protein. The present invention relates to a host cell comprising the vector of recombinant expression that includes a nucleotide sequence encoding a CD80? C mutant protein, a chimeric protein comprising a CD80? C mutant protein or a CD80 C region protein. Host cells for use in well known recombinant expression systems for the production of proteins, they are well known and readily available. Examples of host cells include cells from bacteria such as E. coli, yeast cells such as S. cerevisiae, insect cells such as S. frugiperda, non-human mammalian tissue culture cells, Chinese hamster ovary cells (CHO) and human tissue culture cells, such as HeLa cells. In some embodiments, for example, one of ordinary skill in the art can, using well-known techniques, insert the DNA molecules into a commercially available expression vector for use in well-known expression systems. For example, the commercially available plasmid pSE420 (Invitrogen, San Diego, CA) can be used for the production of a CD80? C mutant protein in E. coli. The commercially available pYES2 plasmid (Invitrogen, San Diego, CA) can be used, for example, for production in strains of yeast S. cerevisiae. The commercially available MAXBAC complete baculovirus expression system (Invitrogen, San Diego, CA) can be used, for example, for production in insect cells.The commercially available pcDNA or pcDNA3 plasmid (Invitrogen, San Diego, CA) can be used , for example, for production in mammalian cells such as Chinese Hamster Ovary cells, one skilled in the art can use these commercial and other vectors and expression systems to produce the proteins of the invention using the techniques of routine and readily available starting materials (See, for example, Sambrook et al., Molecular Cloning a Laboratory Manual, second edition, Cold Spring Harbor Press (1989), which is incorporated herein by reference). can prepare the desired proteins in both prokaryotic and eukaryotic systems, resulting in a spectrum of processed forms of the protein Someone having ordinary skill in the art can use any other commercially available vectors and expression systems, or produce the vectors using well-known methods and readily available starting materials. Expression systems containing the requisite control sequences, such as promoters and polyadenylation signals, and preferably enhancers, are readily available and are known in the art for a variety of hosts. See, for example, Sambrook et al., Molecular Cloning a Laboratory Manual, second edition, Cold Spring Harbor Press (1989). The expression vector that includes the DNA encoding a protein of the invention, is used to transform the compatible host, which is then cultured and maintained under conditions where foreign DNA expression occurs. The protein of the invention that is produced in this manner is recovered from the culture, either by dissolving the cells by the lysines or from the culture medium, as appropriate and known to those in the art. One of ordinary skill in the art can, using well known techniques, isolate the protein of the invention that was produced using these expression systems. Methods for purifying the proteins of the invention from natural sources, using antibodies that bind specifically to that protein are routine, as are the methods for generating antibodies (See: harlow, E. and Lane, E., AntiJbodies: A Laboratory manual, 1988, Cold Spring Harbor Laboratory Press, which is incorporated herein by reference). These antibodies can be used to purify proteins that are produced by recombinant DNA methodology or natural sources. Examples of constitutive promoters include promoters from cytomegalovirus or SV40. Examples of inducible promoters include mouse mammary leukemia virus or metallothionein promoters. Those of ordinary skill in the art can readily produce useful genetic constructs to transfect them with cells with DNA encoding the proteins of the invention from readily available starting materials. These gene constructs are useful for the production of the proteins of the invention. In addition to producing the proteins of the invention by recombinant techniques, automatic peptide synthesizers can also be used to produce the proteins of the invention. These techniques are well known to those of ordinary skill in the art and are useful if they are derivatives having substitutions for which they have not been provided in the production of proteins encoded by DNA. The proteins of the invention can be prepared by any of the following known techniques. Conveniently, the proteins of the invention can be prepared using the solid phase synthetic technique described by Merrifield, in J. Am. Chem. Soc. , 15: 2149-2154 (1963), which is incorporated herein by reference.

Other protein synthesis techniques can be found, for example, in M. Bodansky et al., (1976) Peptide Synthesis, John Wiley & Sons, 2nd edition, which is incorporated herein by reference; Kent and Clark-Lewis in Synthetic Peptides in Biology and Medicine, pages 295-358, eds. Alitalo, K. et al., Science Publishers, (Amsterdam, 1985), which is incorporated herein by reference, as well as other reference works well known to those skilled in the art. A summary of the synthesis techniques can be found in J. Stuart and J.D. Young, Solid Phase Peptide Synthelia, Pierce Chemical Company, Rockford, IL (1984), which is incorporated herein by reference. Synthesis can also be used by solution methods, as described in The Proteins, volume II, 3rd edition, pages 105-237, Neurath, H. et al., Eds., Academic Press, New York, NY (1976), which are incorporated herein by reference. Protective groups suitable for use in these syntheses will be found in the above texts, as well as in J.F.W. McOmie, Protective Groups in Organic Chemistry, Plenum Press, New York, NY (1973), which are incorporated herein by reference. In general, these synthetic methods include the sequential addition of one or more amino acid residues or protected amino acid residues suitable for a chain of growing peptides. Normally, either the amino or the carboxyl group of the first amino acid residue is protected by a suitable, selectively removable protective group. A selectively different, removable protective group is used for amino acids that contain a reactive side group, such as lysine. Using a solid phase synthesis as an example, the protected amino acid or derivative is attached to an inert solid support through its carboxyl or amino-deprotected group. The protecting group of the amino or carboxyl group is then selectively removed and the next amino acid in the sequence having the complementary group (amino or carboxyl) suitably protected, is mixed and reacted with the residue which is already bound to the solid support. The protecting group of the amino or carboxyl group is then removed from this amino acid residue that was recently added, and then the next amino acid (adequately protected) is added, and so on. After all the desired amino acids have been linked in the proper sequence, any terminal and side group protection groups (and the solid support) are removed sequentially or concurrently, to provide the final peptide. The peptide of the invention is * preferably devoid of benzylated or methylbenzylated amino acids. These fractions of the protecting groups can be used in the course of the synthesis, but are removed before the peptides are used. Additional reactions, as described elsewhere, may be necessary to form intramolecular bonds to restrict conformation. In some embodiments, proteins can be produced in transgenic animals. The present invention relates to a transgenic non-human mammal comprising the recombinant expression vector comprising a 10 nucleic acid sequence encoding a CD80? C mutant protein or the CD80 C region protein. Transgenic non-human mammals useful for producing recombinant proteins are well known as well as the necessary expression vectors and techniques for generating animals. 15 transgenic. In general, the transgenic animal comprises a recombinant expression vector in which the nucleotide sequence encoding the mutant CD80 [beta] C protein or the CD80 C region protein is operably linked to a mammary cell-specific promoter whereby the The decoding sequence is expressed only in the mammary cells and the recombinant protein that is expressed in that way is recovered from the milk of the animal. Someone who has ordinary experience in the art that uses standard techniques, such as those taught in the 25 Patent of the United States of North America Number ^ g ^ g§ ^ g ** 4,873,191, issued October 10, 1989 to Wagner, and United States Patent No. 4,736,866, issued April 12, 1998 to Leder, which are incorporated herein by reference. as a reference, they can produce a CD80? C mutant protein or the CD80 C region protein. The preferred animals are goats and rodents, particularly rats and mice. Conservative substitutions of the amino acid sequences of the proteins of the invention are contemplated. As used herein, the term "conservative substitutions" is intended to refer to amino acid substitutions of CD80 residues with other residues that share similar structural and / or charge characteristics. Those of ordinary skill in the art can readily design the proteins of the invention with conservative amino acid substitutions, based on well-known conservative groups. The pharmaceutical compositions of the present invention can be administered by any means that enables the active agent to reach the site of action of the agent in the body of a mammal. The pharmaceutical compositions of the present invention can be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Because the peptides are subject to being digested when administered orally, the oral formulations are formulated to enterically coat the active agent or to otherwise protect it from degradation in the stomach (such as pre-neutralization). . Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration, for example, by inhalation or insufflation, or intrathecal or intraventricular administration. In preferred embodiments, parenteral, i.e., intravenous, subcutaneous, transdermal, intramuscular administration, is ordinarily used to optimize absorption. Intravenous administration can be achieved with the help of an infusion pump. The pharmaceutical compositions of the present invention can be formulated as an emulsion. One skilled in the art will readily understand the multitude of pharmaceutically acceptable media that can be used in the present invention. In Remington's Pharmaceutical Sciences, A. Osol, a standard reference text in this field, which is incorporated herein by reference, suitable pharmaceutical carriers are described. Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like, may be necessary or desirable. Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sacks or tablets. Thickeners, flavoring agents, thinners, emulsifiers, dispersion aids or binders, may be desirable. Compositions for parenteral, intravenous, intrathecal, or intraventricular administration may include sterile aqueous solutions which may also contain pH regulators, diluents, and other suitable additives and are preferably sterile and pyrogen-free. The pharmaceutical compositions which are suitable for intravenous administration according to the invention, are sterile and free of pyrogens. For parenteral administration, the peptides of the invention can be formulated, for example, as a solution, suspension, emulsion or lyophilized powder in association with a pharmaceutically acceptable parenteral vehicle. The examples of these vehicles are water, saline solution, Ringer's solution, dextrose solution, and 5 percent human serum albumin. Liposomes and non-aqueous vehicles, such as fixed oils, can also be used. The vehicle or lyophilized powder may contain additives that maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability (e.g., pH regulators and preservatives). The formulation is sterilized by the techniques that are commonly used. For example, a parenteral composition suitable for administration by injection, is prepared by dissolving 1.5 weight percent of the active ingredient in 0.9 percent sodium chloride solution. The pharmaceutical compositions according to the present invention can be administered as a single dose or in multiple doses. The pharmaceutical compositions of the present invention can be administered either as individual therapeutic agents or in combination with other therapeutic agents. The treatments of the present invention can be combined with conventional therapies, which can be administered sequentially or simultaneously. The dose varies depending on known factors, such as the pharmacodynamic characteristics of the particular agent, and its mode and route of administration.; age, health, and weight of the recipient; nature and extent of symptoms, type of concurrent treatment, frequency of treatment, and the desired effect. It is believed that the formulation of the therapeutic compositions and their subsequent administration is well within the experience of those in the art. Usually, the dose of the peptide can be about , .z 1 to 3000 milligrams per 50 kilograms of body weight; preferably 10 to 1000 milligrams per 50 kilograms of body weight; more preferably from 25 to 800 milligrams per 50 kilograms of body weight. Ordinarily, 8 to 800 milligrams are administered to an individual per day in divided doses, from 1 to 6 times per day or in sustained release form is effective to obtain the desired results. Depending on the method for which the protein or proteins are being administered, the pharmaceutical compositions of the present invention can be formulated and administered in the most efficient manner. The modes of administration will be apparent to one skilled in the art, in view of the present disclosure. The methods of the present invention are useful in the fields of both human and veterinary medicine. In accordance with the foregoing, the present invention relates to the genetic immunization of mammals, birds and fish. The methods of the present invention may be particularly useful for mammalian species that include the human, bovine, ovine, porcine, equine, canine and feline species. The Examples shown below include representative examples of aspects of the present invention. It is not desired that the examples limit the scope of the invention, but rather that they serve exemplary purposes. In addition, different aspects of the invention can be summarized by the following description. However, this description is not intended to limit the scope of the invention, but rather to highlight different aspects of the invention. One of ordinary skill in the art can readily appreciate the additional aspects and embodiments of the invention.

EXAMPLE In an effort to determine why the CD86, but not CD80, for the increase of T-cell responses, and to further study the function analysis of the structure of CD80 and CD86, which has revealed several critical areas included in the binding to CD28 and the CTLA-4, including the residues that are found in both the V- and C- domains of CD80, examined the role of different regions of the CD80 and CD86 molecules in T cell activation using coinmunization of mice with immunogen of DNA and chimeric or truncated forms of DNA coding of the CD80 and CD86 molecules. Methods: Preparation of the constructions: A DNA vaccine construct encoding the HIV-IMN envelope protein (pcEnv) was prepared as described in U.S. Patent No. 5,593,972. Human CD80 and CD86 genes were cloned from the B-cell cDNA library (Clontech, Palo Alto, CA) and placed into pSRaneol +, an expression vector. More specifically, the CD80 and CD86 genes were amplified by polymerase chain reaction, as described in Kim et al. (1997) Nature Biot. 15: 641-645, which is incorporated herein by reference, and ligated into the pSRaneol + downstream of the SRa promoter to make the expression vectors pCD80 and pCD86. The chimeric and truncated variants of these two genes were generated by amplification by polymerase chain reaction using the Expand Hi-Fi Polymerase system (Boehringer-Mannheim, Germany) .For the construction of all these forms of costimulatory molecules, used pCD80 or pCD86 as templates for the polymerase chain reaction The following primers have been used in these reactions: A: CTGCTTGCTCAACTCTACGTC - SEQ ID NO: 1 (forward, vector) B: CTGAAGTTAGCTTTGACTGATAACG - SEQ ID NO: 2 (reverse, CD80) C: GCAATAGCATCACAAATTTCA - SEQ ID NO: 3 (reverse, vector) D: CAGTCAAAGCTAACTTCAGTCAACC - SEQ ID NO: 4 (forward, CD86) E: GGGAAGTCAGCAAGCACTGACAGTTC - SEQ ID NO: 5 (reverse, CD86) F: TCAGTGCTTGCTGACTTCCCTACACC - SEQ ID NO: 6 (forward, CD80) G: TCTTGCTTGGCTTTGACTGATAACGTCAC- SEQ ID NO: 7 (reverse, CD80) H: TCAGTCAAAGCCAAGCAAGAGCATTTTCC-SEQ ID NO: 8 (forward, CD80) ....

I: TCCTCAAGCTCAAGCACTGACAGTTC - SEQ ID NO: 9 (reverse, CD86) J: TCAGTGCTTGAGCTTGAGGACCC - SEQ ID O: 10 (forward, CDd6) K: TCTGGATCCTCATCTTGGGGCA - SEQ ID NO: 11 (reverse, CDdO) L: TCTGGATCCTCATTTCCATAG - SEQ ID NO: 12 (reverse, CD86) The V80 domain of CD80 was amplified using primers A and B, the C domain, the transmembrane (TM) and the cytoplasmic tail (T) of CDd6 were amplified using primers C and D. They were then purified These fragments were combined and used as templates in the polymerase chain reaction of the second step, using the forward primers (CTGCTTGCTCAACTCTACGTC-SEQ ID NO: 1) and reverse (GCAATAGCATCACAAATTTCA-SEQ ID NO: 3). The product of the polymerase chain reaction was ligated into the pSRaneol + vector and the resulting plasmid (pV80C86T86) encodes a chimeric co-stimulatory molecule that expresses the CD80 domain V and the C-, TM- and T- regions of CD66. The chimeric crossing point is in the conserved alanine 106 in the CDdO and the alanine 111 in the CD86 position and respects the limits of the exon. The following plasmid pV86C80T80, which encoded the V86 day domain CD86 and the C-, TM- and T-day CDdO regions, was constructed by amplification of the CD86 day V region, using primers A and E. The fragment of the Polymerase chain reaction encoding the C-, TM- and * T day CDdO domains, was amplified using primers C and F. The polymerase chain reaction of the second step and the cloning were performed as mentioned above. The truncated forms of costimulatory molecules without the C domain (pV80C? T80, pV86 C? T86) were also prepared by the two-step polymerase chain reaction technique. In the case of pV80 C? T8, domain V was amplified using primers A and G, whereas in the case of pV86C (T86, domain V was amplified using primers A and I. The TM / T fragments of the Truncated C domain molecules were amplified using the C / H primers in the case of pV80C (T80 and C / J in the case of pV86CDT86) The resulting constructs were prepared by amplification and cloning of the polymerase chain reaction products within of the pSRaneol + expression vector All constructs were verified by sequence to be loyal to the original wild-type templates CDdO and CDd6 The resulting nulling mutants lacked aspartate 107 to threonine 200 of the amino acid in CDdO and alanine 111 up to isoleucine 211 in CDd6 If noted, the two molecules were constructed to retain 6 to 7 proximal amino acids from the respective C domain Finally, the deletion of the T region from pCDdO (pVdOCdOTO and pCD86 (pV86Cd6T?) were generated by the one-step polymerase chain reaction, using in both cases A as the forward primer and K and L as the reverse primers, respectively. The polymerase chain reaction products were cloned into the vector pSR (neol +.) The encoded CD80 protein then ends up with the cytoplasmic tail amino acid residue, arginine.The resulting gene for the CD66 molecule ended after nucleotide 942 which preserves the first lysine in the cytoplasmic tail, all the chimeric and truncated constructions, 10 as the wild-type molecules were cloned into the SRaneol + vector. The expression of the gene is under the control of the SRa promoter, which is composed of the simian virus early promoter 40 (SV40) and the R segment and part of the U5 (R-U5 ') sequence of the long terminal repeat of the virus. 15 type 1 T cell leukemia viruses. All constructs were verified by sequencing to be true to the original day wild type CD60 and CDd6 templates. Expression of plasmids: The expression of these constructs was analyzed by immunofluorescence and flow cytometry (FACS) assays, using human rhabdomyosarcoma (RD) cells that were transfected with experimental or control plasmids. The cells were transfected using 25 electroporation using 500μF of capacitance and 0.25 of - ** --- *** - > - - - »" voltage, using Gene Pulse (Bio-Rad, Hercules, CA) .For the immunofluorescence assay, the transfected cells were incubated for 2 days and then transferred to Falcon® culture slides (Becton Dickinson, Bedford, MA The cells were washed the next day, fixed with methanol (30 ', RT), and incubated with anti-CDdO (Coulter, Miami, FL) or CD86 monoclonal antibodies (Pharmingen, San Diego, CA) (1.5 hours). , 37 ° C.) The slides were washed and stained with goat anti-mouse IgG (Boehringer-Mannheim, Indianapolis, IN) for 1.5 hours at 37 ° C. The slides were observed with a Nikon OPTIPHOT fluorescence microscope ( Nikon Inc., Tokyo, JAPAN) and photographs were obtained.FACS analysis, RD cells were transfected with the mixture of constructs encoding CD80 or CD66 molecules (2μg) and the green fluorescent protein expression vector. 10 μg (pcGFP from Clontech, Palo Alto, CA). The latter was used as a control plasmid for the calculation of transfection efficiency. The expression of the experimental plasmids was confirmed using monoclonal antibodies for the V domain of the CDdO or CD66 molecules (the two from Pharmingen, San Diego, CA) that were combined with PE. Briefly, 1 μg of any of the anti-B7 antibodies was added to the transfected or control cells (lOxlO5). Data were analyzed by FACScan with the acquisition of CELLQuest data and software (Becton Dickinson Immunocytometry Systems, San Jose, CA) The transfection efficiency (fluorescence intensity) of the cells expressing different B7 molecules in the cell was measured. population of cells expressing GFP Immunization of Animals: Each Balb / c mouse received three intramuscular injections (two weeks apart) with 50 μg of each DNA construct resuspended in 100 μl of phosphate buffered serum (PBS) and 0.25 percent bupivacaine-HCl (Sigma, St. Louis, MO) This dose was selected to maximize the improvement of antiviral immune responses provided by the simultaneous administration of different molecular adjuvants (i.e., mutated, truncated co-stimulatory genes). or wild-type) 50 μg of plasmid, which encodes HIV-1 gpl60 coverage (pcEnv) alone or as a mixture of pcEnv and 50 μg, was injected. g of the different constructions of CD80 / 66 (molecular adjuvant). As a control, mice and natural animals that were injected with control vectors were used. In several experiments, the animals were injected three times with the mixture of two molecular adjuvants (total of lOOμg) plus pcEnv (50μg). Two weeks after the last injection, splenocytes were isolated from all experimental and control animals and used for the detection of T cell responses and cytokine production. Immunohistochemical tests on muscle cells: The immunized leg muscle was examined immunohistochemically for the detection of infiltration (presence of lymphocytes in the muscle). Briefly, the mouse quadriceps muscle was inoculated with 5Oμg of pcEnv mixed with 50μg of experimental or control plasmids. Seven days after the inoculation, the mice were sacrificed and the quadriceps muscles were removed. The fresh muscle tissue was then frozen in O.C.T.

(Sakura Finetek USA, Inc., Torrance, CA) and frozen sections of four microns were made. The degree of inflammation was determined by examining sections of muscle stained with hematoxylin and eosin (HyE). Cytotoxic T lymphocyte assay: A five hour 51 Cr CTL release assay was performed. Briefly, the effectors were stimulated six days in the presence of stimulator cells and 10% RAT-T-STIM, without Con A (Becton Dickinson Labware, Bedford, MA). For antigenic stimulation, P-615 cells fixed with glutaraldehyde infected with the recombinant vaccinia virus, which expresses the envelope protein HIV-1 (vMN462) (NIH AIDS Research and Reference Reagent Program) were used. As target cells, P-815 cells infected with recombinant vaccinia virus (vMN462, specific) or wild type (WR, non-specific) were used. The two target cells were labeled with 100 (Ci / milliliter Na251Cr04 and mixed with effector cells in effector: target ratios (E: 0) ranging from 100: 1 to 125: 1. The percent dissolution of cells per action was determined. of the specific lysines, as described in Kim, 1997. The maximum and minimum release were determined by cell dissolution by the lysines of the target cells in Triton X-100 at 10 percent and a half, respectively. an assay was considered valid if the value for the 'spontaneous release' counts were in excess of 20 percent of the 'maximum release.' To calculate the cell dissolution by the lysine-specific targets, the percentage of dissolution of cells by the action of the lysins of non-specific targets, the percentage of dissolution of cells by the action of the lysins of specific targets. After coughing, CD8 + T cells were removed from the splenocyte culture by treatment with anti-CDd monoclonal antibodies (53-6.7, ATCC), followed by incubation with non-toxic rabbit complement (Sigma) Cytokine production: The level of Different cytokines released by immune cells reflects the direction and magnitude of the immune response. Therefore, the supernatant was harvested and tested from the effector cells that were stimulated in vi tro for the CTL assay, by the release of? LFN, IL-4, and IL-2, using the available ELISA kits (Biosource, Camarillo, CA). Results Expression of Plasmids, which Encode Wild and Mutated Forms of CDdO and CDd6: First, the expression of different forms of the CDdO or CDd6 constructs was analyzed within RD muscle tumor cells that were transfected temporally with the plasmids of control or experimental. Using an immunofluorescence technique, it was observed that the experimental cells, but not the control cells (which were transfected with the vector alone), produced the wild type as well as all the different forms of mutant costimulatory molecules. The efficiencies of transfection of these molecules were studied by the FACS assay. In these experiments, a mixture of control plasmid, GFP coding and experimental constructs, which encode different forms of costimulatory molecules, was transfected. The fluorescence intensity of the cells expressing the B7 molecules was detected only in the population of cells expressing GFP. The results showed that most of the chimeric and truncated forms of CDd6 and wild type molecules CD86 and CD86 had been expressed in a similar manner (Table 3). Only two constructs, which encode the wild type CDdO (pCD80) and the CDd6 deleted from the cytoplasmic tail (pV86Cd6T?), Were expressed on the surface of the transfected cells relatively higher than other plasmids. The two V domains of CD86 and CDdO are important for the activation of the virus-specific CTL response and the production of the Thl cytokine. B7 molecules play a critical role in inducing the activation of antigen-specific T cells by means of shoot the appropriate ligands that are expressed in these cells. Previously, it was reported that co-administration of wild-type CDd6 day, but not the CDdO cDNA together with the DNA immunogen, improved the responses of antigen-specific T cells (Kim et al., 1997 supra). To determine the role of the Vd CDd6 region in this activation, these domains of CDdO and CD66 (Table 3) were exchanged and mice were co-immunized with constructs coding for these molecules, together with the plasmid encoding the viral proteins. As a positive control, constructs expressing the wild type CDdO and CD66 were injected together with the DNA immunogen, and the negative control mice received only the vector. Two weeks after the last immunization, anti-virus CTL responses were analyzed in the splenocyte cultures. A specific elimination background level was observed in the splenocytes that were obtained from the control animals and a low level of elimination was observed in the animals that were co-immunized with pcEnv or pcEnv plus pCDdO. However, mice that were co-immunized with pcEnv and pCDd6 resulted in a high level of envelope-specific CTL (Table 4). Therefore, using the CDdO and CD66 genes that were inserted into the pSRaneol + vector, instead of the pCDNA3 vector previously used, it was confirmed that CDdO and CD66 play differential roles in the modulation of cellular immune responses after vaccine with DNA. The antiviral CTL responses were then analyzed in the mice that were immunized with the chimeric molecules. Co-immunization of the mice with pV86C60TdO and pcEnv did not generate virus-specific cytotoxic cells, but immunization of the mice with the mixture of pV80Cd6T86 and pcEnv induced more than 40 percent of anti-HIV-1 CTL activity at an E: T of 1: 100. This response was similar to the antiviral CTL activity in mice that were coinjected with pcEnv plus pCD86 (Table 4). Thus, the CD80 day V region was as important for the activation of antigen-specific T cells as the V region of the CD66 molecule, if expressed with the C domain and the cytoplasmic tail of the CDd6 molecule. However, domain V of CD86 was functionally silent when expressed with domain C and the cytoplasmic tail of CDdO. These results were supported by the cytokine production data. 5 The supernatant from the splenocytes that were obtained from the mice that were injected with pcEnv and pcEnv plus pCDdO that induced the low level of IL12, but no production of either lFN or IL4 (Table 4). In contrast, co-immunization with pCEnv + pCD66 and pcEnv + pV80C86T86 induced 10 the specific antigen enhancement of both? LFN and IL12 (Table 4), but not the production of IL4. These results would suggest that the C domain and / or the cytoplasmic tail of CD86 are important in positive signaling for T cells, while the same domains 15 of CDdO are not. Alternatively, the C domain and / or the cytoplasmic tail of CDdO could be included to provide the negative signals for T cells. The cytoplasmic tail of CD66 is crucial for the activation of the antigen-specific T cell. It has been shown that the cytoplasmic tail of B7 is required for co-stimulation of the T cell in vi tro by allowing the ligand to be grouped on the surface of the cell. In this way, to demonstrate the role of the cytoplasmic tails of B7 in the 25 co-stimulation of the T cell, the deleted mutants of Cytoplasmic tail of B7 were constructed and mice were coinjected with these plasmids (pVdOCdOT? or pV66C66T?) and pcEnv. The two constructs encoded truncated forms of CDdO or CD66 molecules that induced the elimination of lower levels, while animals that were coinmunized with a mixture of pcEnv and pCD86 demonstrated strong antiviral CTL responses (Table 4). The support data was generated by analyzing the production of the Thl cytokine. The CD80 and CD66 constructs without cytoplasmic tails did not improve the production of LFN after coinjection with the DNA vaccine. Co-immunization of mice with pV66Cd6T? induced a similar increase in IL12 production compared to mice that were injected with pcEnv or pcEnv plus pVdOCdOT ?. Importantly, the control animals that were immunized with pcEnv plus the DNA encoding the wild type of CD66, induced a significant improvement in the production of both? LFN, and the cytokine IL12 (Table 4). In this way, the cytoplasmic tail of the CD66 molecule was important for the activation of the T cell. However, the mice that were coinmunized with pcEnv plus pVdOCdOT? did not induce the activation of the T cell. Therefore, the inclusion of the C domain and / or the cytoplasmic tail of CDdO in the negative signaling remained undetermined. To resolve this question, mutants were then constructed to suppress the C domain of CDdO and CDd6. Domain C, but not the cytoplasmic tail of CDdO, is included in the provision of a negative signal for T cells In the following set of experiments, mice were coinmunized with the pcEnv immunogen and plasmids, which encode only the V domain and the cytoplasmic tail of the CDdO (pVdOC? TdO) or CD66 (pV66C? Td6) molecules. As controls, the mice were injected only with pcEnv or with pcEnv plus either pCDdO or pCDd6. Figure 1 shows antigen-specific antigenic CTL responses from these experiments. The adjuvant effect of CD86 was dramatic and retained to a lesser degree in the CD86 domain C deletion molecule. In sharp contrast to the very poor effect on the activation of the T cell that induced the wild type and the suppressed forms of the cytoplasmic tail of CDdO (Figure 1, Table 4), the pVdOC? TdO was very effective in the co-stimulation of the CTL response to anti-Env (Figure 1), demonstrating gain of function through loss of the C domain. To further investigate the improvement of cellular immunity, the production of Thl cytokines was investigated, using the splenocytes of mice that were immunized with pcEnv and plasmids, which encode the CDdO or CDd6 molecules deleted from the C domain. As controls, the mice were coinmunized with pcEnv plus either CDdO or CD66. The two chimeric genes pVd6C? T66 and pVdOC? TdO, as well as wild-type CD66 encoded with DNA, were co-injected together with pcEnv induced the production of Thl lymphokine equally well (Figures 2A and 2B). These results demonstrate that the cytoplasmic tail of CDdO is functional and is important for the activation of the T cell in vivo. More importantly, the data support the conclusion that the C domain of CDdO, but not of CDd6, can provide a "negative" signal to T cells. Afterwards, the inhibitory role of the C domain of CDdO in the activation of the T cell was analyzed. The C domain of CDdO inhibits the activation of the T cell by the CD66 molecules To demonstrate the inclusion of the C domain of CDdO in the provision of a negative signal for the antigen-specific T cells, animals were immunized with the immunogen of DNA and a combination of molecular adjuvants. Experimental mice were co-immunized with the DNA immunogen and a mixture of pCDd6 with pCDdO or pCDd6 with pVdOCDTdO. The control animals were injected only with pcEnv or coinjected with pcEnv plus pCD86, pCD80 or pVdOC (TdO) The antiviral assays were performed with splenocytes that were obtained from experimental or control mice. mice with the DNA immunogen and pCD66 or pVdOC (T60 induced a significant improvement in CTL activity (Figure 3).) However, mice coinmunized with pcEnv and the combination of wild-type molecular adjuvants (pCD86 + pCD80) , the CTL response did not improve (the dissolution of cells by the lysines was not greater than in the control group with pcEnv.) Importantly, the combination of pCDd6 and pVdOCDTdO still induced an adjuvant effect in the animals that were killed. vaccinated and this effect was similar to the effect that was induced in the animals that were immunized with pCDd6 plus the DNA immunogen, therefore, the wild type CDdO, but not the CDdO m Deleted delegate of domain C, inhibited the enhancement of antiviral CTL responses when co-administered with the DNA immunogen. To verify the role of CD6 T cells in the observed cytotoxic activity, CTL activity was measured after removal of this population of cells.Splenocytes were treated with anti-CD8 monoclonal antibodies and non-rabbit complement. The removal of the CD8 T cells "resulted in the suppression of antiviral CTL activity in the mice that were coinjected with the DNA immunogen and pCDd6. Again, no anti-HIV-1 CTL activity was observed in the mice that were co-immunized with pcEnv + pCDdO + pCDd6 (Figure 4). The expression of CDdO deleted from domain C induced a greater infiltration of the lymphocytes into the muscle of the immunized animals than the day expression of wild-type CDdO. A markedly greater infiltration of lymphocytes has been reported within the muscle of mice immunized with pCEnv + pCDd6 than in the control animals or immunized with pCEnv + pCDdO. The infiltration cells included the two CD4"and CDd" cells. In this way, to further determine the ability of the deleted CDdO molecules of the C domain to interact with the T cells, infiltration of the cells into the muscle tissue was investigated, after co-injection of the mice with pcEnv plus pVdOC? TdO. As a control, the animals that were injected with the vector alone or with a mixture of pcEnv plus pCDdO or pCDd6 were used. Co-injection of mice with pCEnv + pCDd6, but not with pcEnv + pCDdO, induced a dramatic infiltration of lymphocytes into muscle tissue (Figure 5). Normal animals developed virtually no infiltration. More importantly, the infiltration was much greater in the muscle of mice that were immunized with the DNA immunogen and pVdOC? TdO. Therefore, deletion of domain C changed the CDdO day costimulatory properties to reassemble those of a wild type of CD86. Deleted mutants of domain C, CD80 and CD6, had different binding affinity to CTLA-4. As demonstrated above, coinmunization of mice with the DNA immunogen and pCDd6 or pVdOCΔT80, improved CTL activity, production of the Thl cytokine, and the infiltration of cells within the injection site. In contrast, immunization with the immunogen of 10 DNA and pCD80, did not have a similar effect. We hypothesized that the deletion of the CDdO C day domain results in a molecule with decreased affinity for CTLA-4. This results in the ability to provide a powerful negative signal to the T cells. We use the resonance of 15 surface plasmon to compare the differences in binding affinity of CTLA-4 between CDdO and the deletion mutant of the C domain of CDdO. Typically, receptor molecules (counter-receptors) are immobilized on the surface of the detector and different concentrations of the 20 counter-receiver (receiver) flows continuously through this detector. Using this methodology, it was shown that human soluble CTLA-4 was fixed to soluble CDdO with the KD solution of 0.2-0.4 μM. The cells that expressed the ligand of interest, were immobilized on the surface. The 25 cell immobilization allows maximum access of the epitopes of CD-dO from the cell surface to the soluble CTLA-4-Ig day volume with the least distortion of conformation of the ligands. The lateral diffusion within the double layer of the membrane allows the physiological oligomerization of the CDdO ligands after the binding to CTLA-4. Using this approach, it was demonstrated that CTLA-4-Ig binds specifically to RD cells, which were transfected with both the wild type of CD80, and with the CD80 domain C deletion molecules. Importantly, this fixation was dependent on concentration. After subtraction of the non-specific signal from the binding of the monoclonal antibodies, the affinities were calculated. The association of CTLA-4-Ig with the wild type CDdO receptor is 5 times faster than with the mutant CD80 (kencendido parameter), while the dissociation of the CTLA-4 / CDd0 complex is 2.6 slower for the wild-type receptor (kapagado parameter) • Due to these differences in kinetics, the wild-type interaction of CTLA-4-Ig / CD80 is 14 times stronger than with the CDdO mutant, as reflected in KD. By definition, the ignition and kapagado parameters that were measured by Biacore do not depend on the number of receptors, which are expressed on the surface of the cell. In this way, the suppression of the constant region of the CDdO receptor has a profound effect on the interaction of CDdO-CTLa-4 itself.

Discussion Current evidence indicates that one of the most important co-stimulatory pathways for T cell activation includes the expression of CDdO and CDd6 on APC. These molecules interact with receptors on the surface of the T cell (CD28 or CTLA-4) and provide important secondary signals for the proliferation and secretion of cytokine. The costimulatory signal critical for the activation of the T cell is provided through CD28, after binding to the B7 ligands. In contrast, CTLA-4 mainly induces an inhibitory signal. The evidence that defines the functional roles of the CDdO and CDd6 molecules is more complicated. It was demonstrated in different models mainly in vi tro, that both CDdO and CD66, have critical roles in the activation of T cells. However, the expression of CD86 earlier than CD80 strongly suggests that CD66 plays a role more significant in the initiation of the immune responses of the T cell. The differences between CDdO and CD66 can be inferred by the binding kinetics data of costimulatory molecules with CD28 and CTLa-4. Recently, functional differences between the CDdO and CDd6 molecules have also been documented in many model systems that include immunization with DNA. The CD86 molecule, but not the CDdO, is more important L in the provision of digital signals to T cells after vaccination with DNA in mice. However, it has been reported that CD80 as well as CD66 improve CTL responses when expressed in conjunction with the DNA of the plasmid encoding a minigene. This result is different from the other reported results that suggest that free epitopes rather than natural antigens, they can behave in a unique way. The similarity of the results from different groups is instructive, suggesting that the expression of CD86 may be more important than that of CD86 in the initiation and expansion of cellular immune responses in vivo. To further investigate the role of the CDdO and Cdd6 molecules in T cell activation, several chimeric mutant and deletion forms of CDdO and CD66 were constructed (Table 3). These plasmids were co-injected into mice with an immunogen of Adn HIV-1 / Env and the activity of CTL was determined, as well as the production of Thl lymphokine. Chimeric pVdOCd6Td6, as well as pCD66, but not pCDd6, supported the activation of T cells (Table 4). This is significant because the C domains of CDdO and CD66 can activate T cells. These results also suggest that the C domain and cytoplasmic tail of CDd6 can support T cell activation. Of note, the opposite chimeric construct ( pVd6CdOT60) did not enable the costimulatory signal necessary for the stimulation of the specific T cell. This raised the possibility that the C domain and / or the cytoplasmic tail of CDdO, may play an important inhibitory role in the activation of the T cell. Then, the deletion mutants of the B7 molecules that lacked the tail were used. cytoplasmic or C. domains. This allowed the direct assessment of the role of these molecular regions in the activation or inhibition of the T cell. It was observed in vivo that the cytoplasmic tail of CDd6 is absolutely necessary for antiviral CTL responses and for production of Thl cytokine (Table 4) However, the failure of the cytoplasmic tail suppression molecule of CDdO (pV80C80T?) to induce T cell activation, did not allow the mapping of the inhibitory region of this molecule to the C domain of CDdO or the cytoplasmic tail. This issue was solved by co-immunization of mice with the genes encoding the immunogen and the deleted CDdO molecule of domain C (Figures 1, 2A and 2B). A dramatic improvement in T cell activation was observed in mice that were coinjected with pVdOC? TdO and pCEnv. It appears that both the cytoplasmic tail of CDdO and the cytoplasmic tail of CD66 were involved in the activation of the T cell and were not involved in the inhibition of T cell activation. The cytoplasmic tail played an important role in both the redistribution as in the oligomerization of this molecule on the surface of the professional APC. Importantly, it has also been demonstrated that activation of the transfected CDdO cells with ionomycin and / or PMA resulted in the association of a 30 kDa phosphoprotein with the cytoplasmic tail of CDdO. The similar size of the protein that was inducibly phosphorylated on tyrosine after the cross-linking of the CDdO has been reported. Finally, it was reported that the firing of CD66 molecules activates the expression of new immunoglobulin genes in B cells. These results strongly indicate that B7 molecules can provide a direct signal to APC. Based on these results, as well as our data presented above, we hypothesized that B7 could provide a direct signal to APC and, in turn, induce the secretion / expression of certain molecules (cytokines, lymphokines, chemokines, etc.), which are important for the activation or inhibition of cellular immune responses. Examples of these molecules may include IL-la, IL-β, IL-12, and TNF cytokines, which are produced by professional APC and play an important role in immune activation. In fact recently, it was shown directly that these cytokines modulate humoral and cellular antiviral immune responses during the co-immunization of DNA. Another important observation was that the C domain of CDdO, but not that of CD66, in some way inhibited the co-stimulation of T cells. At least the suppressed C domain mutants could significantly increase T cell activation in our experiments (Figures 1, 2A and 2B), while that the wild type molecule could not do it (Table 4). Recent studies have shown that a mechanism of T-cell deactivation is mediated by the interactions of CTLA-4 with a TCR chain. In accordance with the above, our experiments suggest that the domains V- and C- of CDdO, may be essential for the binding of CTLA-4 and the subsequent inhibitory signal that is sent by means of TCR cancels the activation signals of CD26 that It was transmitted simultaneously. To test this hypothesis directly, animals were coinmunized with a DNA immunogen and a combination of CDdO and CDd6 molecules. Co-injection of pCDdO with pCDd6, together with the DNA immunogen, eliminated the strong CTL response of CDd "antiviral that is normally seen after the co-stimulation of pCD66 (Figures 3, 4): Importantly, the deleted form of the C domain of the CDdO molecule did not generate this inhibitory signal (Figure 3) .Therefore, the molecules expressing both the V- and C- domains of CDdO, not only prevented the activation of the T cell, probably through preferential fixation. to CTLA-4, but could also overcome the positive signal that was provided by the activation of CD2d ligand by the V domains of the two molecules CDdO and CD66. In fact, there has been a demonstrated predominance of CTLA-4 signaling over CD26, in which the CD2d activation pathway is inhibited directly as a result of the simultaneous cross-linking of CTLA-4, because the CDdO molecule can bind to both CD2d and CTLA-4, there are important structural differences that change the equilibrium in favor of the path of inhibition of CTLA-4, on the trajectory of activation of CD2d. Surface plasmon resonance analysis measured a fourteenfold increase in binding between CTLA4 and CDdO when the C domain. This difference is more likely to be actually greater, because the multivalent interaction of CTLA- is likely to occur. 4 and B7. The rate of dissociation of the individual component of CTLA-4 with CDdO is similar to monomeric dissociation. However, because the CDdO will still be maintained by the second CTLA-4 interaction, the observed rate of dissociation must be much slower, thus forming a more stable CTLA-4 / CD80 complex. In accordance with the above, if the difference in binding avidity of the CTLA-4 membrane with the CDdO of the membrane or the deleted mutants of the C domain of CDdO is calculated, it will be a multiple of 14. The data clearly indicate that the CDdO domain C not only prevents T cell activation, but also alters the function relationships of the structure of this molecule with CTLA-4. The expression of the genes encoding the Cd domain deletion mutant of CDdO induced not only the T cell activation, but also the enormous infiltration within the muscle of the experimental animals. This infiltration was even greater than the infiltration that was observed after the coexpression of pCD66 and pCEnv (Figure 5). Recently, APC activity of human muscle cells in vi tro was reported. After activation with cytokines, human myoblasts can express costimulatory molecules and can function as a restricted class II APC from the professional MHC. In addition, the in vivo effect of muscle cells on T cell activation was demonstrated. Mouse muscle cells have been converted to MHC class I restricted APC by expressing CD86, but not CD80 molecules. The data reported here can be interpreted as showing that DNA immunization with pcEnv, induces a small infiltration of the immunocompetent cells within the site of the injection. These infiltrating T cells can be activated by the transfected muscle cells expressing the class I molecules of MHC and the foreign peptide, as well as the CD66 molecules. Activated T cells, in turn, can produce chemokines and attract more T cells to the site of inflammation. In accordance with the above, a huge infiltration was observed in muscle tissue, in the case of co-immunization with pcEnv plus pCDd6 (Figure 5). The same mechanism will apply after coinmunization with the DNA immunogen and pVdOC? TdO. However, coadministration of pCDdO and pcEnv induced only a small infiltration in the muscle tissue of experimental animals. If one remembers that the CDdO molecule can bind to both CD2d and CTLA-4, there must be forces that change the equilibrium in favor of the path of inhibition of CTLA-4 on the trajectory of activation of CD2d. It appears that the presence of the C domain of the CDdO muscle cells that were transfected with the wild-type CDdO has a very early inhibitory effect on the infiltration and / or proliferation of the activated lymphocytes in this tissue and may reflect a fixation preferential, and signage through CTLA-4. Therefore, the T cells at the injection site will not produce chemokines and will not induce the migration of other lymphocytes in the immunization area (Figure 6). Importantly, it has not been evaluated whether one of the costimulatory molecules works or not preferably by interacting with CTLA-4 as opposed to CD26, and the structural basis for this interaction is not yet clear. Previously, a number of studies have reported the results of site-directed mutagenesis experiments that investigated the structure function relationships of the B7 and CD2d / CTLA-4 molecules. Collectively, these studies involved more than 20 residues on the V- and C- domains of the critical CDdO for CTLA-4 fixation. However, the exact region important for the interaction of the CDdO molecule with CTLA-4 and CD2d is not defined. Spleen nodules and lymphatics of mice have been shown to have an alternative binding form of CDdO lacking the C domain. This naturally synthesized IgV molecule was set very well to CD2d = Ig (comparable to CDdO) ), although its fixation to CTLA-4 was significantly suppressed. At least one group also demonstrated that suppression of the C domain of the CDdO molecule had a greater effect on binding to CTLA-4 = Ig, than CD26 = Ig. Importantly, the Igd-like region of CDdO could activate the proliferation of activated T cells in vi tro. The in vivo data showing the effective costimulation provided by the Cd domain deletion molecule of CDdO supports these results. Any explanations for the inhibitory nature of the molecules expressing the C domain of CDdO should consider the increased avidity of CDdO binding by CTLA-4, compared to CD2d. Recent measurements indicate that the binding avidity of CDdO to dimeric CTLA-4 is much higher than to dimeric CD26. Importantly, the dimeric CTLA-4 binds to the CDdO with greater avidity than to the CDd6. This resistance to major fixation may explain why the inhibitory signal induced by CTLA-4 predominates in this experimental system. In order to further reveal the important differences in the CTd-4 and CDdd6 CTLA-4 binding region, we constructed three-dimensional models of the C domains. The correlation of the mutational studies with three-dimensional models of the Cd domain of the CDdO provides some insight about the fixation of the receiver. Both the CDdO and the CD66 display sequence homology with the folds - Ig, suggesting that the two adopt similar conformations (Table 6). Consequently, most mutational analyzes have focused on the conserved shifting residues between the human and mouse CDdO and those that are conserved between CDdO and Cd86. It appears that several residues conserved in the C domain of CDdO are critical for binding to CTLA-4 = Ig (Table 6). One model has established that Q157, D15d, E162 and L163 are grouped spatially in accessible surface positions near the amino terminal end of the domain in the cycle between chains D and E and at the beginning of chain E. Other residues ( FlOd, Pili, e 1113) are mapped for the A chain (see Table 6). The second model that was constructed on the basis of mutational analysis also demonstrates a critical role for P135 and P137 in the B-C cycle, as well as Q157, D15d and P159 in the D-E cycle for the CTLA-4 binding. Collectively, residues important for receptor binding are mapped to the ABCED face of the IgC domain. Figure 6 shows traces of Ca of the CDdO molecule with the residues of the CTLA-4 binding region that are represented as CPK products, wherein amino acids P136 and P136 of cycle BC and residues Q157, D15d are shown, P159 of the DE cycle. In the corresponding model of CDd6 there is an insertion of 4 residues 144-147 (KKMS) which is shown in italics in Table 6 and in Figure 6. This insertion in CDd6 changes the conformation of the BC cycle in this molecule, in comparison with the CDdO, so that the fixation region becomes significantly smaller. Due to that insertion, the distance between P159 and P135 decreases from 16 Á in CDdO to 12 Á for the corresponding residues of CDd6. In addition, the distance between Q157 and P137 decreases from 13 Á in the CDdO to 10 Á for the corresponding residues of the CDd6. Therefore, this insertion changes the conformation of the BC cycle of the CD66 molecule, as compared to the CDdO, so that the total surface area of the CTLA-4 binding in the CD66 molecule is significantly smaller than the same region in the CDdO (compare with Figure 6). In this way, the molding of CDdO and Cd86 suggests that the conformation of the BP cycle is different in these molecules and that the KKMS insert in CD86 may play an important role in decreasing the avidity of binding to CTLA-4 and, consequently, the inhibitory signal that is being targeted for T cells may decrease. In summary, the discrepancies with respect to the binding / functional sites of the V- and C- domains of the CDdO and to a minor degree of the CDd6 molecules with the ligands of CTLA-4 and / or CD2d, can be explained by different antigens and experimental systems that are used in different laboratories. For example, many results were obtained with the co-stimulation of the T cell with the anti-CD3 monoclonal antibodies (the signal) and the soluble forms of B7 molecules (CDdO = Ig, CD86 = Ig) (2 * signal). This model generated very important data. However, the recently published results showed that only cells that express oligomeric forms of costimulatory molecules can impel the activation of the A in the treatment of autoimmune diseases. Conversely, a more effective tumor vaccine could be the result of co-immunization that is provided through the CD80 domain V, with a decreased ability to inhibit T cell activation. Additionally, vaccines that can be direct toward improved cellular immunity, using the molecular adjuvants described herein.

Table 1 Family Picornavirus Genus: Rhinovirus: (Physician) responsible for ~ 50% common cold. Eterovirus (Medical) includes poliovirus, coxsackievirus, ecovirus, and human enterovirus such as hepatitis A virus. Aftovirus: (Veterniary) These are viruses of diseases of the feet and mouth. Target antigens: VP1, VP2, VP3, VP4, VPG Calevirus Family Genus: Norwalk Virus Group: (Medical) These viruses are a major causative agent of epidemic gastroenteritis.

Family Togavirus Genus: Alphavirus: (Medical and Veterinary) examples include Senilis virus, RossRiver virus and Equine encephalitis Eastern and Western. Reovirus: (Medical) Rubella virus.

T cell. On the other hand, even the use of the transfected CDdO and CD86 cells for the co-stimulation of the T cell can not be considered as an optimal model. It was reported that CTLA-4 interacts with the TCR? after firing with anti-CD3 and CD80 molecules fixed to the membrane. These results suggest that the appropriate model should include the interaction of APC, which expresses the MHC class I / II, and CD80 / Cdd6 with T cells, which express the TCR and CD / 2d / CTLA-4. In accordance with the above, the physiological conditions for the interaction of APC and the T cell may be more appropriate to discover the mechanism (s) of T cell co-stimulation. Using this model system, the differences have been demonstrated functionalities between the CDdO and the CD86, as well as between the V- and C- domains of the CDdO molecule. Current studies provide important information for the development of new approaches for the regulation of T cell immune responses. Specifically, a form of B7 ligand can be provided to, for example, include the V- and C-domains they could deactivate a progressive human immune response probably by preferentially firing CTLA-4 molecules, which are expressed on antigen-specific T cells. This construction may have important applications for tolerance to transplantation or Family Flariviridue Examples include: (Medical) dengue virus, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick-borne encephalitis.

Hepatitis C Virus: (Medical) These viruses are not placed in a family, but are believed to be either a togavirus or a flavivirus. The greatest similarity is with the family of togaviruses.

Family Coronavirus: (Physician and Veterinarian) Infectious bronchitis virus (poultry) Porcine transmissible gastroenteric virus (pig) Porcine haemagglutinin euenfalomyinitis virus (pig) Feline infectious peritonitis virus (cats) Feline enteric coronavirus (cats) Canine coronavirus (dogs) ) The human respiratory coronavirus causes ~ 40 cases of common cold. EX.224E, 0C43 Note: Coronaviruses can cause non-A, B or C hepatitis. Target Antigens: El - also called M protein or E2 matrix - also called S protein or Spike E3 - also called HE glycoprotein or hemagglutin-elterose ( not present in all coronaviruses) N - nucleocapsid Family Rabdovirus Genus: Vesiliovirus Lyssavirus: (medical and venous) rabies Target antigen: Protein G Protein N Family Filoviridue: (Medical) Hemorrhagic fever virus such as Marburg and Ebola viruses.

Family Paramyxovirus: Genus: Paramyxovirus: (Medical and Veterinary) mumps virus, New Castle disease virus (important pathogen in chickens) Morbillivirus: (Medical and Veterinary) Measles, canine distemper Pneuminvirus: (Medical and Veterinary) Respiratory syncytial virus Family Ortomixovirus (Medical) The influenza virus Family Bungavirus Genus: Bungavirus: (Medical) California encephalitis, LA Crosse Flebovirus: (Medical) Rift Valley fever Hantavirus: Puremala is a fever virus hemahagina Nairvirus: (Veterinarian) Nairobi sheep disease Also many bungaviruses do not assigned Arenavirus family (Medical) LCM, Lassa fever virus Reovirus family Genus: Reovirus a possible human pathogen Rotavirus: acute gastroenteritis in children Orbivirus: (Physician and Veterinarian) Colorado Mountain Fever, Lebombo (human) equine encephalosis, blue tongue Family Retrovirus Subfamilies: Oncorrivirinal (Veterinarian) (Medical) feline leukemia virus, HTLVI and HTLVII Lentivirinal: (Medical and Veterinary) HIV, feline immunodeficiency virus, equine infections, Spumavirinal anemia virus.

Family Papovavirus Poliomavirus Subfamilies: (Medical) BKU and JCU viruses Subfamily: Papilomavirus: (Medical) many types of viruses associated with cancers or malignant papilloma progression. Adenovirus (Medical) EX, AD7, ARD, O.B. - cause respiratory diseases - some adenovirus, such as 275, cause enteritis Family Parvovirus (Veterinary) Feline parvovirus: causes feline enteritis Feline panleucopeniavirus Parvovirus canine Parvovirus porcine Family Herpesvirus Subfamily: alfaherpesviridue Genus: Simplexvirus (Medical) HSVI, HSVII Varicelovirus: (Medical - Veterinarian) pseudorabies - varicella zoster Subfamily: betaherpesviridue Genus: Cytomegalovirus (Medical) HCMV Muromegalovirus Subfamily: Gamaherpesviridue Genus: Lymphoprotovirus (Medical) EBV - (lymphocytic) Burkitts) Radinovirus Poxvirus Family Subfamily: Cordopoxviridue (Medical - Veterinary) Genus: Variola (smallpox) Vaccinia (vaccine) Parapoxivirus - Veterinarian Auipoxvirus - Veterinarian Capripoxvirus Leporipoxvirus Suipoxvirus Subfamily: Entemopoxviridue Family Hepadnavirus Hepatitis B virus Not Classified Delta Hepatitis Virus Table 2 Bacterial pathogens: Gram-positive pathogenic coccid bacteria include: pneumococcal; staphylococcal; and streptococcal. Gram-negative pathogenic coccid bacteria include: meningococcal; and gonococcal.

The pathogenic enteric gram-negative bacilli include: enterobacteriaceae; pseudomonas; acineto-bacteria and eikenella; melioidosis, salmonella, shigellosis; hemophilus; chancroid; brucellosis; tularemia; yersinia (pasteurella); streptobacillus monoliforme and spirillum; monocytogenes of listeria; erisipelotrix rhusiopathiae; diphtheria; anger; anthrax; donovanosis (granuloma inguinale); and bartonellosis.

Pathogenic anaerobic bacteria include: tetanus, botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include: syphilis; treponematoses; jaw, pinta and endemic syphilis and leptospirosis. Other infections caused by higher pathogenic bacteria and pathogenic fungi include: actinomycosis; nocardios; cryptococcosis; blastomycosis; histoplas-mosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichis; paracoccidioidomycosis, petrielidiosis, torulopsosis; mycetoma and chromomycosis; and dermatophytosis.

Rickettsial infections include rickettsial and rickettsial infections.

Examples of mycoplasma and chlamydia infections L. include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydia infections.

Pathogenic Eukaryotes: Pathogenic protozoa and helminths and infections therein include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; pneumocystis carinii; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematoids or pain; and cestode infections (solitary). Table 3 Expression Efficiency of the constructs encoding the wild type, chimeric, or truncated forms of the CDdO and CD86 molecules that were detected by the FACS Plasmid Assay Schematic Representation of Fl *. Domains Ig * Protein encoded Vector Control Without Insert 2.S Pcd80 CD 80 Wild Type 8.S PV80C? T80 CD80 Truncated, Deletion of the 6.3.3 domain C PV80C86T86 7th "Chimeric m, domain V of CD86 S.9 substituted for the V domain of CD80 PV80C80T? CD80 Truncated, deletion of the 5.8 Cytoplasmic domain (T) PCD86 ivicp CD86 of Wild Type 5.99 PV86C? T86 H ^ l CD86 Truncated, Deletion of the 7.1 domain C Chimeric PV86C80T80, domain V of CD80 7.4 replaced by the V domain of CD86 PV86C86T? i "i c i CD86 Truncated, deletion of 11.16 Cytoplasmic domain (T) L.

* The tables represent the domains V, C, and T (cytoplasmic tail) of the CDdO (shaded) and CDdβ (open) molecules (the transmembrane sequence was not removed).

** Rhabdomyosarcoma cells were co-transfected with experimental or control plasmids, and a construct encoding the green fluorescence protein (GFP). The Fluorescence Intensity (Fl) of the cells expressing B7 molecules (average red channel) was detected in the population of cells expressing GFP.

Table 4 Cellular immune responses (CTL and cytokine production Thl) in mice co-immunized with plasmids, which encode the viral antigen and different forms of B7 molecules 1.

* Two weeks after the last immunization, the spleens were collected and CTL and Thl cytokine assays were performed, as described in Materials and Methods. These experiments have been repeated three (for the detection of CTL) and two (for the detection of cytokines) times, with similar results.

Table 5 Fixation parameters for CTLA-4 / CD80 interaction calculated from attacks on a Langmuir model Table 6 Sequence alignment of the human CDdO and Cd86 C domains * Alignments were made using CLUSTALW (Thompson, 1994) and then adjusted manually. The residues at the end of each row were numbered from their respective N terminus. The CDdO residues critical for the fixation of the CTLA-4 cell surface receptor according to the literature (Ellis, 1996, Fargeas, 1995, Guo, 1995, Guo, 1996, Peach, 1995) are shown in bold type. The two presumed variants of four amino acid inserts in CD66 are shown in italics and could very likely disrupt the binding to CTLA-4 (see details in the discussion). The beta chains highlighted in CD80 and Cdd6 are based on the crystal structure of sB7-l (Ikemizu, 2000).

LIST OF SEQUENCES < 110 > The Trustees of the University of Pennsylvania Sekaly, Rafick P Holterman, Mark < 120 > Human Mutant CDdO and Compositions and Methods to Make and Use the Same < 130 > UPAP0377 < 140 > < 141 > < 160 > twenty < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > 10 < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 1 ctgcttgctc aactctacgt c 21 15 < 210 > 2 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence 20 < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 25 -? WT ~ - or - "* - * - * • •» • ..., -.. Atat ^ s 1 ctgaagttag ctttgactga taacg 25 < 210 > 3 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 3 gcaatagcat cacaaatttc to 21 < 210 > 4 < 211 > 25 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 4 cagtcaaagc taacttcagt caacc 25 1 < 210 > 5 < 211 > 26 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 5 gggaagtcag caagcactga cagttc 26 < 210 > 6 < 211 > 26 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 6 tcagtgcttg ctgacttccc tacacc 26 < 210 > 7 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 7 tcttgcttgg ctttgactga taacgtcac 29 < 210 > d < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > d tcagtcaaag ccaagcaaga gcattttcc 29 < 210 > 9 < 211 > 26 < 212 > DNA < 213 > Artificial Sequence 5 < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 9 10 tcctcaagct caagcactga cagttc 26 < 210 > 10 < 211 > 23 < 212 > DNA 15 < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence 20 < 400 > 10 tcagtgcttg agcttgagga ccc 23 < 210 > 11 25 < 211 > 22 ^ j & * ^ jjtt ^^ ftfi ^ aj ^^ jj¡ ^ * ^ & < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 11 tctggatcct catcttgggg ca 22 < 210 > 12 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of the Artificial Sequence: Novel Sequence < 400 > 12 tctggatcct catttccata g 21 < 210 > 13 < 211 > 33 < 212 > PRT < 213 > Homo sapiens < 400 > 13 Lys Wing Asp Phe Pro Thr Pro Ser lie Ser Asp Phe Glu lie Pro Thr 1 5 10 15 Be Asn Lie Arg Arg Lie Lie Cys Ser Thr Be Gly Gly Phe Pro Glu 20 25 30 Pro < 210 > 14 < 211 > 34 < 212 > PRT < 213 > Homo Sapiens < 400 > 14 Leu Ala Asn Phe Ser Gln Pro Glu lie Val Pro lie Ser Asn lie Thr 1 5 10 15 Glu Asn Val Tyr lie Asn Leu Thr Cys Ser Ser lie His Gly Tyr Pro 20 25 30 Glu Pro < 210 > 15 < 211 > 6 < 212 > PRT < 213 > Homo Sapiens < 400 > 15 His Leu Ser Trp Leu Glu 1 5 < 210 > 16 < 211 > 10 < 212 > PRT < 213 > Homo Sapiens < 400 > 16 Lys Lys Met Ser Val Leu Leu Arg Thr Lys 1 5 10 < 210 > 17 < 211 > 33 < 212 > PRT < 213 > Homo Sapiens < 400 > 17 Asn Gly Glu Glu Leu Asn wing lie Asn Thr Thr Val SerGln Asp Pro 1 5 10 15 Glu Thr Glu Leu Tyr Wing Val Ser Ser Lys Leu Asp Phe Asn Met Thr 20 25 30 Thr < 210 > 18 < 211 > 36 < 212 > PRT < 213 > Homo Sapiens i < 400 > 14 Asn Ser Thr lie Glu Tyr Asp Gly lie Met Gln Lys Ser Gln Asp Asn 1 5 10 15 Val Thr Glu Leu Tyr Asp Val Ser lie Ser Leu Ser Val Ser Phe Pro 20 25 30 Asp Val Thr Ser 35 < 210 > 19 < 211 > 24 < 212 > PRT < 213 > Homo Sapiens < 400 > 19 Asn His Ser Phe Met Cys Leu lie Lys Tyr Gly His Leu Arg Val Asn 1 5 10 15 Gln Thr Phe Asn Trp Asn Thr Thr 20 < 210 > 20 < 211 > 24 < 212 > PRT < 213 > Homo Sapiens < 400 > 14 Asn Met Thr lie Phe Cys lie Leu Glu Thr Asp Lys Thr Arg Leu Leu 1 5 10 15 Ser Ser Pro Phe Ser lie Glu Leu 20

Claims (1)

1. CLAIMS 1. An isolated protein comprising at least one of dOV, dOtm, and dOct, and is free of dOC; wherein said protein comprises either dOV or 66V or both, and optionally comprises one or more of d6C, dOtm d6tm, dOct and d6ct, wherein: dOV is the variable domain of CDdO or a functional fragment thereof; 86V is the variable domain of CDd6 or a functional fragment thereof; d6C is the C domain of CDd6 or a functional fragment thereof; dOtm is the CDβO transmembrane region or a functional fragment thereof; d6tm is the transmembrane region of CD86 or a functional fragment thereof; dOct is the cytoplasmic tail of CDdO or a functional fragment thereof; and 86ct is the cytoplasmic tail of CD86 or a functional fragment thereof. 2. The isolated protein of claim 1, wherein: ßOV is the variable domain of CD80; d6V is the variable domain of CD86; 86C is the C domain of CD86; dOtm is the transmembrane region of CDdO; d6tm is the transmembrane region of CD66; dOct is the cytoplasmic tail of CDdO; and 66ct is the cytoplasmic tail of CD66. 3. The isolated protein of claim 1, having the formula: R1-R-R3-R4-R5-R6-R7-Rβ-R9 wherein R1 is 0-50 amino acids; R2 is dOV u 66V; R3 is 0-50 amino acids; R4 is d6C or 0 amino acids; R5 is 0-50 amino acids; Re is dOtm u d6tm; R7 is 0-50 amino acids; R8 is dOct u 86ct; and R9 is 0-50 amino acids. 4. The isolated protein of claim 3, wherein: R1 is 0-25 amino acids; R3 is 0-25 amino acids; R5 is 0-25 amino acids; R7 is 0-25 amino acids; and R9 is 0-25 amino acids. 5. The isolated protein of claim 3, wherein: R1 is 0-10 amino acids; R3 is 0-10 amino acids; R5 is 0-10 amino acids; R7 is 0-10 amino acids; and R9 is 0-10 amino acids. 6. The protein of the claim selected from the group consisting of: dOV / dele / dOtm / dOct d0V / dele / d0tm / d6ct dOV / dele / d6tm / 60ct d6V / dele / d0tm / d0ct d6V / dele / d0tm / d6ct d6V / dele / d6tm / d0ct dOV / dele / 86tm / 86ct d0V / d6C / d0tm / d0ct d0V / d6C / d0tm / d6ct 60V / d6C / d6tm / d0ct; 66V / 86C / 80tm / d0ct; d6V / d6C / d0tm / 66ct 86V / 86C / 86tm / 80ct; d0V / d6C / 86tm / d6ct; dOV / dele / dOtm / dele d6V / dele / d0tm / dele; d0V / 86C / 80tm / dele; dOV / d6C / d6tm / dele d6V / 86C / 80tm / dele; d6V / 66C / d0tm / dele; 66V / d6C / dele / d0ct d0V / d6C / dele / d0ct; 80V / dele / dele / 80ct; 66V / dele / dele / d0ct dOV / d6C / dele / dele; and dOV. 7. A chimeric protein comprising a protein portion of any of claims 1-6 and an immunogenic portion. d. A composition comprising a protein of any of claims 1-7, and an immunogenic protein or a nucleic acid molecule comprising a coding sequence encoding an immunogen, said coding sequence operably linked to elements TO. regulators. 9. A nucleic acid molecule comprising a coding sequence that encodes the protein of any of claims 1-7, the sequence 5 encoder operably linked to regulatory elements. 10. A plasmid comprising a nucleic acid molecule of claim 9. 11. A plasmid of claim 10, which also comprises a coding sequence that encodes a 10 immunogen, that coding sequence operably linked to regulatory elements. 12. A composition comprising a plasmid of claims 10 or 11, which also comprises an immunogenic protein or a plasmid, comprising a A nucleic acid sequence comprising a coding sequence encoding an immunogen, the coding sequence operably linked to regulatory elements. 13. A recombinant vaccine or attenuated vaccine comprising the composition comprising an acid molecule The nucleic of claim 9. 14. A recombinant vaccine composition or attenuated vaccine composition comprising the subject matter of any of claims 1-13. 15. A pharmaceutical composition comprising the subject matter of any of claims 1-14. M - ^^ - ^ ¿jgg¡¡ ^ ¡^ »^^ Xf em 16. A method of immunizing an individual against an immunogen, comprising a composition comprising the compositions according to any of claims 1-15. 17. The method of claim 16, wherein the immunization is prophylactic. ld. The method of claim 16, wherein the immunization is therapeutic. 19. The method of claim 16, wherein the immunogen is an allergen. The method of claim 16, wherein the immunogen is a pathogenic antigen. The method of claim 16, wherein the immunogen is an antigen associated with an autoimmune disease. 22. The method of claim 16, wherein said immunogen is an antigen associated with a hyperproliferative disease. 23. An isolated non-CDdO protein comprising at least the C domain of CDdO or a functional fragment thereof. 24. The isolated non-CDdO protein of claim 23, comprising at least the C domain of CD80. 25. The isolated non-CDdO protein of claim 23, having the formula: R1-R2-R3-R4-R5-R6-R7-R8-R9 wherein R1 is 0-50 amino acids; R2 is 80V or 66V; R3 is 0-50 amino acids; R4 is dOC; R5 is 0-50 amino acids; R6 is dOtm u d6tm; R7 is 0-50 amino acids; R8 is dOct u d6ct; and R9 is 0-50 amino acids, wherein dOV is the variable domain of CDdO or a functional fragment thereof; d6V is the variable domain of CDd6 or a functional fragment thereof; dOC is the C domain of CDdO or a functional fragment thereof; dOtm is the transmembrane region of CDdO or a functional fragment thereof; d6tm is the transmembrane region of CD66 or a functional fragment thereof; dOct is the cytoplasmic tail of CDdO or a functional fragment thereof; and 66ct is the cytoplasmic tail of CDd6 or a functional fragment thereof. 26. The isolated protein of claim 25, wherein: R1 is 0-25 amino acids; R3 is 0-25 amino acids; R5 is 0-25 amino acids; R7 is 0-25 amino acids; and R9 is 0-25 amino acids. 27. The isolated protein of claim 3, wherein: R1 is 0-10 amino acids; R3 is 0-10 amino acids; R5 is 0-10 amino acids; R7 is 0-10 amino acids; and R9 is 0-10 amino acids. 2d. The isolated non-CDdO protein of claim 23, having the formula selected from the group consisting of: R-dele-R-80C-R-80tm-R-d0ct-R; R-dele-R-d0C-R-80tm-R-dele-R; R-dOV-R-dOC-R-dOtm-R-dele-R; R-d0V-R-d0C-R-dele-R-dele-R R-66V-R-dC-R-60tm-R-d0ct-R R-d6V-R-dC-R-d0tm-R-dele R R-d6V-R-dOC-R-dele-R-dele-R; R-60V-R-dC-R-66tm-R-d0ct-R; R-dele-R-80C-R-86tm-R-80ct-R; R-dele-R-60C-R-66tm-R-dele-R; 5 R-dOV-R-dOC-R-d6tm-R-dele-R; R-dOV-R-80C-R-80tm-R-d6ct-R; R-dele-R-d0C-R-d0tm-R-d6ct-R; R-d6V-R-d0C-R-d6tm-R-d0ct-R; R-d6V-R-d0C-R-d0tm-R-d6ct-Rj 10 R-d6V-R-dOC-R-d6tm-R-dele-Rj R-dele-R-dOC-R-d6tm-R-d6ct -R; and R-66V-R-dOC-R-d6tm-R-86ct-R; wherein 80V is the variable domain of CDdO or a functional fragment thereof; d6V is the variable domain of CDd6 or a functional fragment thereof; dOC is the C domain of CD80 or a functional fragment thereof; 20 80tm is the transmembrane region of CD80 or a functional fragment thereof; 86tm is the transmembrane region of CD86 or a functional fragment thereof; dOct is the cytoplasmic tail of CDdO or a functional fragment thereof; The cyclasmic tail of CD66 or a functional fragment thereof; del is 0 amino acids; and R are each independently 0-100 amino acids. 29. The isolated non-CDdO protein of claim 2d, wherein each R is independently 0-50 amino acids. 30. The isolated non-CDdO protein of claim 26, wherein each R is independently 0-30 amino acids. 31. The isolated non-CDdO protein of claim 2d, wherein each R is independently 0-20 amino acids. 32. The isolated non-CDdO protein of claim 23, selected from the group consisting of: a mutant CDdO with the deleted variable domain, a mutant CDdO with the deleted variable domain and the suppressed cytoplasmic tail, a mutant CDdO with the tail deleted cytoplasm, a mutant CDdO with the suppressed transmembrane region and the suppressed cytoplasmic tail, a mutant CDdO with a variable domain of CD86 substituted in place of the variable domain of CDdO, i ... . . . i.1 ... * »*«,. j a mutant CDdO with a variable domain of CDd6 substituted in place of the variable domain of CDdO, and the suppressed cytoplasmic tail, a mutant CDdO with a variable domain of CDd6 5 substituted in place of the variable domain of CDdO, and the deleted transmembrane region, and the suppressed cytoplasmic tail, a mutant CDdO with a substituted transmembrane region in place of the transmembrane region of CDdO, a mutant CDdO with the deleted variable region and a region of CDd6 transmembrane substituted in place of the transmembrane region of CDdO, a mutant CDdO with the variable region deleted, the cytoplasmic tail suppressed, and a transmembrane region of CDd6 substituted in place of the transmembrane region of 5 CD80, a CD80 mutant with the suppressed cytoplasmic tail, and a transmembrane region of substituted CD86 in place of the transmembrane region of CDdO, a mutant CDdO with a cytoplasmic tail of CDd6 or substituted in place r of the cytoplasmic tail of CD80, a mutant CDdO with the deleted variable region, and a substituted cytoplasmic tail of CDd6 in place of the cytoplasmic tail of CDdO, a mutant CDdO with a variable domain of substituted CDd6 in place of the variable domain of CDdO, and a A transmembrane region of substituted CDd6 in place of the CDβO transmembrane region, a mutant CD80 with a variable domain of CDd6 substituted in place of the variable domain of CDdO, and a cytoplasmic tail of substituted CD66 instead of the tail cytoplasmic CDdO, a mutant CDdO with a variable domain of CDd6 substituted in place of the variable domain of CDdO, and a transmembrane region of substituted CDd6 in place of the transmembrane region of CDdO, and the suppressed cytoplasmic tail, a mutant CDdO with the deleted variable domain, and a transmembrane region of substituted CD66 in place of the transmembrane region of CDdO, and a cytoplasmic tail of substituted CD66 in place of the cytoplasmic tail of CDdO, and a mutant CDdO with a variable domain of CDd6 substituted instead of the variable domain of CDdO, and a transmembrane region of substituted CDd6 in place of the transmembrane region of CDdO, and the cytoplasmic tail of substituted CD66 instead of the CDβO cytoplasmic tail. 33. A nucleic acid molecule comprising a coding sequence encoding the protein of any one of claims 23 to 32, the coding sequence operably linked to regulatory elements. 34. A plasmid comprising a nucleic acid molecule of claim 33. 35. A composition comprising a plasmid of claim 34 and / or a protein of any of claims 23 to 32 36. A recombinant vector comprising the composition comprising a nucleic acid molecule of claim 33. 37. A pharmaceutical composition comprising the subject matter of any of claims 23-36. 3d An immunosuppression method of an individual, comprising administering a composition comprising the compositions according to any of claims 23-37. 39. The method of claim 3d, wherein the individual has an autoimmune disease. 40. The method of claim 3d, wherein said individual has had, is suffering, or is about to undergo a transplant procedure.