AU8752898A

AU8752898A - Vectors and methods for providing cells with additional nucleic acid materi al integrated in the genome of said cells

Info

Publication number: AU8752898A
Application number: AU87528/98A
Authority: AU
Inventors: Ronald Hans Anton Plasterk; Govert Johan Schouten; Domenico Valerio; Hendricus Gerhard Adrianus Maria Van Luenen
Original assignee: Introgene BV; Het Nederlands Kanker Instituut
Current assignee: Introgene BV; Het Nederlands Kanker Instituut
Priority date: 1997-08-12
Filing date: 1998-08-11
Publication date: 1999-03-01
Also published as: CA2301198A1; EP1003899A1; WO1999007871A1; JP2001512690A

Description

WO99/07871 PCT/NL98/00456 Title: Vectors and methods for providing cells with additional nucleic acid material integrated in the genome of said cells. The present invention relates to the field of genetic engineering, in particular to the field of methods for making recombinant vectors containing nucleic acids of interest, methods for making recombinant cells, preferably 5 expressing recombinant products, and/or production of nucleic acids of interest. In a further embodiment the invention relates to transgenesis of animals, plants or other organisms of medical, scientific or economic interest. In yet another 10 embodiment the invention relates to tools for mutagenesis as well as to tools and means for localization and/or identification of nucleic acid sequences of interest (such as genes) in the genome of a host. Many ways of providing cells with additional nucleic 15 acids are now known in the field. Many proteins have been expressed in many kinds of cells, ranging from prokaryotic bacteria and bacilli, via yeast and fungi to plant cells, insect cells an mammalian cells. Often expression of proteins as discussed above has 20 met with success, there are however, certain areas in the field of recombinant technology where, because of safety issues or technical problems, such as stability of the additional nucleic acid material introduced, success has not been easy to achieve. Also, in the application of 25 genetic engineering where the product is not a protein, but for instance a nucleic acid of interest (such as DNA, RNA or an antisense construct), the same or similar problems have been encountered. It is in these areas particularly that the present invention finds its use. 30 One of the problems encountered in recombinant technology is that it is often desirable to have the WO99/07871 PCT/NL98/00456 2 additional nucleic acid material, which is introduced into a host cell, integrate in the genome of said host cell. Once the additional nucleic acid material is integrated in the genome its stability is much less an issue. Moreover, 5 the integrated material is replicated together with the genome and thus will be present in the offspring of the recombinant cell as well. Vectors which are capable of providing for integration of additional nucleic acid material into a host cell are known, but they do suffer 10 from some drawbacks which will be discussed below. The present invention now provides a way in which a wide variety of vectors can be altered to integrate the desired additional nucleic acid in the genome of the host cell. 15 This means that vectors which did not (efficiently) integrate the desired additional nucleic acid material in the genome of the host cell, can now be provided with said ability. One of the drawbacks of the integrating vectors of the 20 prior art is that they are often not capable of transducing a host cell efficiently. Techniques such as electroporation and the like are then necessary for achieving transduction. In some areas such treatments of cells may be unwanted or impossible. One such an area is for instance gene 25 therapy. In such cases vectors which can efficiently transduce host cells on their own, or which can be packaged into recombinant viral particles and so infect host cells are often employed. However, many of these vectors are then incapable of 30 (efficient) integration of the desired additional nucleic acid material in the genome of the host. The present invention thus offers the best of both worlds in that it enables to prepare vectors capable of efficiently transducing and efficiently integrating desired additional 35 nucleic acid material in a host cell. The inventions solves this problem in that the nucleic acid to be integrated into a host cell genome is provided within a functional WO99/07871 PCT/NL98/00456 3 transposon. Exogenous DNA has been introduced into the genome of a host using a transposon, however since transposons were, until the present invention, thought to be rather species specific, the applicability of such a 5 system was thought to be very limited. At best, it was shown that a transposon functional in one fruit fly could also be used to integrate DNA into the genome of another species of fruit fly (Loutheris et al., 1995). The present inventors have found that, at least for a certain class of 10 transposons, it is possible to use these transposons across wide phylogenetic barriers, which allows for wide application of these transposons as integration means for DNA into a wide variety of host genomes. The invention thus provides a vector for providing a cell 15 of a certain genus with additional nucleic acid material integrated in its genome, whereby said vector comprises two transposase binding sites, whereby said transposase binding sites may be the same or different and are derived from a transposon found in another genus, each in close proximity 20 to a cut site for said transposase, whereby said additional nucleic acid material is located between said two transposase binding sites. It is of course clear that it is highly preferred to be able to use transposons over even wider phylogenetic barriers. The present invention thus 25 provides a transposon-based integration system with a wide applicability. Clear advantages of this system are for instance that: using a transposon will often lead to a more efficient integration into the host cell genome; using a transposon 30 gives complete control of the integrating sequence (the termini of the integrating element are known); in the embodiment where gene (or DNA) localization is desired it will be an advantage that a transposon can integrate anywhere in the genome (especially useful in so-called 35 mutagenesis experiments aimed at gene function, or in "gene-trap" experiments directed at tracing genes of interesting expression patterns). For expression purposes WO99/07871 PCT/NL98/00456 4 it may be desirable to develop transposons with a more specific integration site in the genome, or to develop methods of integration which lead to a more specific integration site. 5 Preferably, said transposase binding sites and said cut sites are based on the corresponding sites in transposons from the Tcl/mariner superfamily of transposons, more preferably they are based on Tcl-like transposons. A very useful set of transposon elements is 10 the minimum set required by the Tcl transposon i.e. comprising the terminal 26 basepairs of Tcl and in close proximity the cut site (TA) for Tcl transposase. An important advantage of the transposons according to the invention is that they are self-sufficient. All that is 15 needed is a functional transposase binding site, a transposase cut site and transposase activity functional for those sites. Transposase activity needed should be as limited as possible. The preferred class of transposons only needs a single transposase. A reason for the species 20 specificity of transposons reported until to date may be that transposons have been used that require host proteins in order to be able to jump. The host proteins may then be responsible for the species-specificity of for instance the transposons of bacterial origin, or the P-element. The 25 class provided with the present invention needs no host elements and has modest cis-trans requirements. Therefore these transposons are far more suitable for integrating nucleic acids of interest into the genome of a wide variety of hosts. 30 In a preferred embodiment where,elements based on Tcl are used such a transposon binding site seems to be at least the 26 terminal basepairs. Probably not all of these basepairs are essential for the function of this binding site. Some (conservative) changes in such a binding site 35 may therefore be allowed. It seems that sequences of around 100 bp are most efficient as transposase recognition sites.

WO99/07871 PCTINL98/00456 5 For the invention, the transposase recognition sites must be functional for the corresponding transposase activity, which transposase of course may also be modified, mutated, shortened or lengthened when compared with the 5 original transposase, as long as it has relevant transposase-activity. The transposase-activity may be encoded on the same vector as the other transposon elements, even as part of the transposon together with the desired additional nucleic acid material (in cis), but it 10 may very suitably be provided to the cell to be transduced by another vector according to the invention or by another vector (in trans). When the transposase-activity is provided in trans and is preferably encoded by a sequence under control of an 15 inducable and/or repressible promoter, "jumping" of the transposon can be switched on and off. Once integration into the host genome has taken place this may be very useful. A vector for the purposes of this invention is any 20 nucleic acid vehicle which is capable of carrying the desired additional nucleic acid material and preferably capable of transduction of host cells and/or replication. The desired additional nucleic acid material may be encoding a protein and thus comprise a gene and regulatory 25 elements for expression. Proteins to be expressed will depend on the purpose of the transduction. Many useful proteins for many applications have been identified as good candidates for recombinant expression. All these may be expressed using the present invention. 30 Also, the additional nucleic acid material (DNA) may be transcribed (once transduced) into RNA molecules blocking transcription or translation of host cell (or viral) nucleic acids. Such additional nucleic acid material may for instance be an antisense RNA molecule. 35 Use of the invention in the field of gene therapy is particularly advantageous, as will be clear from the above. Viral vectors often contemplated for gene therapy (such as WO99/07871 PCT/NL98/00456 6 adenovirus, retrovirus or adenoassociated virus) which are not capable of efficiently integrating the desired nucleic acid material into the genome of the infected cell, may now be provided with such capability. Other vectors not based 5 on a virus, but provided with a means to deliver them to a target cell population can of course also be advantageously provided with an integration system according to the invention. Particularly the use of liposomes or polymers as a targetting system is contemplated. 10 As stated, the present invention provides an efficient means by which a variety of vectors may be used to integrate exogenous nucleic acid material in the genome of a host cell. Because the exogenous nucleic acid material is integrated into the host cell's genome the progeny of the 15 recombinant host cell produced will possess the same recombinant capabilities as their parent. Thus, when stemcells are produced according to the invention, this will lead to very efficient gene therapy regimes. The vectors (or the integration system) of the invention can of 20 course also be used to produce transgenic animals, plants or other organisms of scientific, economic or medical interest. Useful applications for transgenesis are well known in the art. Thus methods using the vectors according to the 25 invention to transduce cells or animals, plants, etc. are also disclosed and part of the invention, as are cells, animals or plants, etc. obtainable by such methods. Use of the invention in mutagenesis studies and the like is another preferred embodiment, as discussed hereinbefore. 30 The invention will now be explained in more detail using Tcl as a non-limitative example. Detailed description 35 Tcl belongs to the Tcl/mariner superfamily of transposons found in nematodes, arthropods and chordates WO99/07871 PCTINL98/00456 7 (Henikoff 1992; Raddice et al. 1994; Robertson 1995; Plasterk 1995). Both vertical and horizontal transfer have contributed to the spread of these elements throughout the animal kingdom (Robertson 1993; Radice et al. 1994; 5 Robertson and Lampe 1995). The widespread occurrence of the Tcl/mariner family of transposons can be taken as an indication for the absence of species-specific host factors which limit the transfer between different species. Therefore, Tcl/mariner elements are attractive candidates 10 for the development of gene delivery vectors. Tcl-like elements are close to 1.7 kb in length, have short inverted terminal repeats flanking a transposase gene and have the conserved sequence CAGT at their termini, flanked by TA representing the target site, which is 15 duplicated upon integration (Van Luenen et al. 1994). The element-encoded proteins share a homologous catalytic domain with bacterial transposases and retroviral integrases (Doak et al. 1994). Tcl from C. elegans is a 1612 bp long transposon which has 54 bp inverted repeats 20 flanking a gene encoding a 343 amino acid transposase (Emmons et al. 1983; Rosenzweig et al. 1983; Vos et al. 1993), that binds to the inverted repeats (Vos et al. 1993; Vos and Plasterk 1994). The conserved hexanucleotide sequence, TACAGT (SEQ ID NO: -), at the extreme termini of 25 the element is not part of the transposase binding site, but is thought to play a role in catalysis of the transposition reaction (Vos and Plasterk 1994). Here, we describe in vitro excision and transposition of Tcl using an extract prapared from transgenic nematodes. 30 The minimal cis-requirements for transposition are defined and the target site choice in vitro is compared with that in vivo. Furthermore, we demonstrate that recombinant transposase purified from E. coli is capable of supporting transposition, showing that no other factors are essential 35 for Tcl transpostion in vitro.

WO99/07871 PCTINL98/00456 8 Moreover, we show that Tcl-transposase supports jumping of Tcl-derived transposons carrying a neomycin resistance gene into the genome of human cells. This demonstrates that it is possible to construct transposon 5 derived vectors that are capable of providing for integration of additional nucleic acid material into host cells across large phylogenetic barriers, which makes such vectors suitable as integrating gene delivery vehicles for a wide variety of host genomes, including that of humans. 10 Results Transposition of Tcl in vitro We generated a transgenic worm with the Tcl transposase gene under the control of a heat shock 15 promoter. This allowed the preparation of a nuclear extract with elevated levels of transposase, which proved to be highly important to detect activity. The extract was incubated with a plasmid containing a Tcl element. Excision was studied in a physical assay. Southern blot analysis of 20 reaction products shows the appearance of excised Tcl elements (fig. 1, lane 1). Furthermore, cleavage at either the left or the right end of Tcl is detected when the products are digested with Scal within the plasmid backbone prior to electrophoresis 25 (lane 2). Cleavage may require a divalent cation (Mg 2 + or Mn 2 + ) and is stimulated by the presence of ethylene glycol or 5% DMSO (data not shown). The efficiency of cleavage at a single end of the transposon is not decreased if the substrate is linear (compare lanes 2 and 5). Also, deletion 30 of either end of the transposon does not abolish cleavage at the remaining end (lanes 6 and 11), which suggests that cleavage does not require interaction between the two ends. In contrast to single end cleavage, excision of the complete element is reduced about 2-fold when the substrate 35 is linear, suggesting that coordinated cutting at both ends is stimulated by supercoiling of the substrate. The WO99/07871 PCT/NL98/00456 9 majority of complete excision products observed with a linear substrate can be explained by non-coordinated cleavages at both ends. To determine the positions of the double strand 5 cleavages at the nucleotide level, a PCR based primer extension was performed using end-labeled oligonucleotides specific for each strand (Fig. 2). The 5' cut is 2 bp within the transposon, whereas the 3' cut maps to the end of the transposon, as based on the largest observed PCR 10 product. This confirms the model based on in vivo studies of the related C. elegans transposon Tc3, for which it was shown that excision results in a 2 bp staggered 3' overhang (Van Luenen et al. 1994). The complete excision of Tcl shows that transposition occurs via a cut-and-paste 15 process, a result consistent with genetic data on double strand break repair of the donor DNA molecule upon Tcl excision (Plasterk 1991). We devised a sensitive assay to detect integration events. We selected for jumping of a transposon-borne 20 antibiotic resistance gene from a supercoiled donor plasmid to a target plasmid in a genetic assay (Fig. 3). Electroporation of reaction products into the appropriate E. coli strain resulted in the detection of many transposition events (Table 1). Extracts prepared from non 25 transgenic N2 worms or from the so-called high-hopper strain, TR679 (Collins et al. 1987), which has a high frequencey of germline transposition, do not generate a detectable level of transposition products in this assay. Linearization of the donor plasmid resulted in an 30 approximately 20-fold reduced efficiency of transposition. Transposition requires two inverted repeat sequences, because no integrations were obtained upon deletion of one transposon end. Furthermore, the addition of ATP, GTP or dNTPs does not increase the level of transposition (data 35 not shown), which indicates that the process is neutral in energy-consumption and independent of a cofactor. About 90 WO99/07871 PCT/NL98/00456 10 independent in vitro Tcl integrations were analyzed by sequencing and found at TA dinucleotides, which had been duplicated in the process. Two odd integration events were detected, where Tcl had integrated in the sequence TTG (SEQ 5 ID NO: -) or CCT (SEQ ID NO:-). In both cases, we found a 3 bp target site duplication. Target site choice Previously, several hundreds of in vivo Tcl and Tc3 10 integrations in a 1 kb region of the gpa-2 gene have been analyzed (Van Luenen and Plasterk 1994). This showed the selective use of a limited set of TA dinucleotides as targets of integration, with a striking difference in preference between Tcl and Tc3. To investigate whether the 15 chromatin structure played a role in the choice of integration sites, we determined the pattern of integrations into naked DNA in vitro, using the same target region previously assayed in vivo. Therefore, we included the gpa-2 region in our target plasmid. It is apparent that 20 the same overall pattern of integration is seen (Fig. 4). Hot sites in vivo appear to be hot in vitro and cold sites in vitro are also cold in vivo. This indicates that, at least in this region of the genome, the genome, the chromatin structure or the transcriptional status of the 25 DNA in vivo is not the major determinant of target choice. Transposition by recombinant transposase The nematode is not a convenient source of protein for an extensive purification of transposase. Therefore, we 30 expressed the protein in a heterologous system. Both expression using Baculovirus and Sf9 cells (data not shown) or expression in E. coli yielded transposase capable of supporting Tcl transposition. Recombinant transposase was purified from inclusion bodies to near homogeneity (Fig. 35 5). Table 1 shows the frequency of transposition when comparable amounts of transposase were used for both the WO99/07871 PCT/NL98/00456 11 worm extract and the purified protein. Sequence analysis of 9 independent integrations in case of the recombinant protein showed that transposition into TA target sequences that were duplicated, from which it can be concluded that 5 bona fide transposition had occurred. Therefore, we conclude that Tcl transposase is the only protein required for Tcl transposition. The difference in efficiency between nematode derived and bacterial transposase needs further studies. It could reflect a folding problem of the 10 bacterial transposase, which was denatured and refolded during the purification procedure, or the stimulatory role of host factors present in the nematode extract. Minimal cis-requirements 15 We investigated the possibility that the terminal 26 bp of Tcl which constitute a full transposase binding site, flanked by the TA target site, are sufficient to form an artificial transposon. An element consisting of only these Tcl-specific sequences is still able to transpose in vitro, 20 albeit at a lower frequency (Table 1). We sequenced several integrations and found them to be correct. Furthermore, we investigated the importance of the conserved hexanucleotide sequence TACAGT (SEQ ID NO.: -). Mutations were introduced at one of the ends of a mini-Tcl 25 which contains only the terminal 26 bp as well as the flanking TA dinucleotide. Whereas excision of the element with 2 wild-type ends is easily detected in a physical assay, mutation of the transposase binding site, the flanking TA sequence of the termini, resulted in the 30 inability of the element to excise (Fig. 6). Double strand cleavage at the wild-type end was not affected by mutation at the other transposon end. Analysis of cleavage by PCR based primer extension revealed that, for the CA to TG mutation only, single stranded breaks at the 5' end of the 35 transposon had occurred (data not shown).

WO99/07871 PCT/NL98/00456 12 We have developed a cell-free Tcl transposition system. Excision occcurs by double strand breaks at the transposon ends resulting in 2 bp staggered 3' overhangs. A cut-and-paste mechanism of transposition appears to apply 5 for Tcl (Fig. 7). This mechanism was already proposed on the basis of genetic data (Plasterk 1991) as well as the analysis of in vivo transposition products (Van Luenen et al. 1994). Nonreplicative transposition is shared with the bacterial transposons Tn7 (Bainton et al. 1991, 1993) and 10 TnlO (Bender and Kleckner 1986) as well as the Drosophila P element (Kaufman and Rio 1992). In contrast, the Mu and Tn3 transposable elements transpose via a replicative mechanism (Grindley and Sherratt 1978; Shapiro 1979; Mizuuchi 1992). Tcl transposition appears to be independent of addition of 15 a nucleotide cofactor, whereas P elements use GTP (Kaufman and Rio 1992) and Tn7 uses ATP as cofactor (Bainton et al. 1993). A striking feature of the Tcl/mariner family is the use of a TA dinucleotide as target site. An extensive study 20 of target site choice in vivo had revealed the usage of only a subset of the available TA dinucleotides and a marked difference in target choice between the two related transposons Tcl and Tc3 in C elegans (Van Luenen and Plasterk 1994). We find the same overall integration 25 pattern in vitro as had been observed in vivo. This suggests that the chromosomal context of the DNA does not affect target choice, at least in the region of the genome analyzed. Therefore, we favor the idea that the transposition complex primarily selects its target site on 30 the basis of the primary DNA sequence flanking the TA, although a strong consensus sequence could not be identified (Van Luenen and Plasterk 1994). A clear influence of the chromatin structure has been demonstrated for retroviral integrations (Pryciak and Varmus 1992; 35 MUller and Varmus 1994). These studies showed a preference for regions within nucleosomal DNA, probably due to the WO99/07871 PCT/NL98/00456 13 bending of the DNA. We cannot exclude that DNA binding proteins can affect regional preferences for Tcl integration. Because nothing is known about the chromosomal organization of the gpa-2 gene, it will be of interest to 5 compare integration sites using reconsituted nucleosomal DNA in vitro. Transposition in vitro requres the extreme termini of the transposon containing the transposase binding site and the conserved hexanucleotide sequence, which is important 10 for excision. We observe a decrease in transposition efficiency between transposition of a full-length transposon and the Tcl element with only 26 bp terminal inverted repeats, which suggests that additional sequences can contribute to transposition efficiency. We have no 15 indications for additional transposase binding sites, but perhaps small basic proteins like high mobility group proteins (Grosschedl et al. 1994) may bind and stimulate transposition. Alternatively, unique A-T-rich sequences found at the transposon ends may add a helping bend to the 20 DNA. The conserved hexanucleotide sequence at the extreme termini of the transposon are shown to be important at least for the cleavage step. The 5' end single strand cleavage seen for one of the mutations (CA to TG) is perhaps an indication for a specific order of single strand 25 cleavages, i.e. first the non-transferred strand, which would be the opposite of what has been reported for TclO (Bolland and Kleckner 1995). Transposase purified from E. coli to near homogeneity is able to execute jumping of Tcl, which indicates that 30 transposase is the only protein required for excision and integration of Tcl. The higher efficiency obtained with the nematode extract suggests that host factors may enhance the frequency of the reaction. It has for instance been shown that the mammalian proteins HMG1 and HMG2 can stimulate 35 prokaryotic recombinations (Paull et al. 1993). The independence of species-specific factors might be the WO99/07871 PCT/NL98/00456 14 explanation why members of the Tcl/mariner family are dispersed over so many different phyla, possibly by means of horizontal transfer (Robertson and Lampe 1995). This is in contrast to P elements which are restricted to 5 Drosophila species. Transposition of P elements in other species has not been observed (Rio et al. 1988). A possible candidate for a species-specific host factor in P transposition is the inverted repeat binding protein, IRBP (Beall et al. 1994). The simple cis- and trans 10 requirements for Tcl transposition in vitro shows that this transposable element will be a good vector for gene delivery in a wide variety of animals. In order to determine the feasibility of the use of Tcl transposons in human cells, we first tested whether the Tcl-transposase is 15 toxic for human cells. The Tcl-transposase expression vector pRc/CMV.TclA or the empty vector pRc/CMV (Invitrogen) was transfected into 911 cells, a human embryo retina cell line transformed by early region I of adenovirus type 5. Approximately 48 hours post 20 transfection, the cells were put on G418 selection medium. Stable cell lines derived from single colonies were established and screened for Tcl-transposase protein on a western blot (figure 8). All pRc/CMV.TclA transfected cell lines expressed Tcl-transposase, demonstrating that 25 expression of Tcl-transposase is not toxic for human cells. Next, we examined whether Tcl-transposase supports transposition of a Tcl-derived transposon in human cells. To that end, the plasmid pRP466.SV-neol.PGK-tk2 was constructed. This plasmid contains a neomycin resistance 30 gene expression cassette under control of the SV40 promoter (SV-neo) flanked by the inverted repeats of Tcland an expression cassette for the Herpes Simplex Virus thymidin kinase under control of the phospho-glyceraldehyde kinase promoter (PGK-tk) outside of the Tcl inverted repeats. 35 Excision of the SV-neo transposon from pRP466.SV-neol.PGK tk2 was tested in an in vitro excision assay using WO99/07871 PCT/NL98/00456 15 transposase purified from E.coli.. Southern blot analysis of the reaction products shows the appearance of excised 2.9 kb Tcl.SV-neo elements (figure 9). Thus, pRP466.SV neol.PGK-tk2 can serve as a Tcl.SV-neo transposon donor 5 plasmid. To determine whether transposition of Tcl transposon derived vectors occurs in human cells, the cell line 911 was transfected with the plasmid pRP466.SV-neol.PGK-tk2, together with the Tcl-transposase expression vector 10 pcDNA1/TclA or with the empty vector pcDNAl/amp (Invitrogen). Fourty eight hours post-transfection, the cells were put on G418 selection. After 18 days, G418 resistant colonies were counted (table 2). Co-transfection of pcDNA1/TclA yielded approximately 40% more G418 15 resistant colonies, suggesting that , in addition to random integration, G418 resistant colonies were formed due to jumping of the Tcl-neo transposon into the cellular genome. The presence of the PGK-tk expression cassette on the plasmid pRP466.SV-neol.PGK-tk2 outside of the Tcl inverted 20 repeats allowed us to discriminate between plasmid integration and transposition of the Tcl.SV-neo transposon. Thymidin kinase phosphorylates the anti-viral prodrug Ganciclovir (GCV), after which it acts as a chain terminator of DNA synthesis, thereby killing the tk 25 expressing cells. When plasmid integration occurs, in most cases both the SV-neo and PGK-tk expression cassettes are integrated into the 911 genome, rendering the cell lines G418 resistant and GCV sensitive. When transposition of the SV-neo transposon takes place, however, the cell lines will 30 be G418 resistant and GCV insensitive, because the PGK-tk expression cassette is not integrated into the host cell genome. In total, 73 independent G418 resistant cell lines were established from the above mentioned transfection, and screened for to GCV. Table 3 shows that co-transfection of 35 pRP466.SV-neol.PGK-tk2 with pcDNA1/TclA resulted in the WO99/07871 PCT/NL98/00456 16 formation of more tk-negative cell lines (64-77%) than co transfection with pcDNA1/amp (32-44%). Random integration of circular plasmid DNA first requires linearization of the DNA due to a double strand 5 DNA break before integration into the host genome can occur. The PGK-tk expression cassette covers approximately 1/3 of the total of the plasmid DNA (excluding the neomycin SV-neo expression cassette for which the cell lines were selected). If this process is assumed random and if a 10 single copy of the plasmid integrates, one would expect around 33% of the DNA breaks to occur in the PGK-tk expression cassette, thereby abolishing tk expression. Therefore, the percentage tk negative cell lines that were generated by co-transfection of pRP466.SV-neol.PGK-tk2 and 15 pcDNAl/amp was within expectation. The higher incidence of GCV resistant clones after co-transfection of pRP466.SV neol.PGK-TK2 with pcDNA1/TclA again strongly suggests that the Tcl.SV-neo transposon jumped from the pRP466.SV neol.PGK-TK2 into the human genome. 20 The most direct way to discriminate between plasmid integration- and transposition events is sequencing the DNA that flanks the transposon that is integrated into the host cell genome. After plasmid integration, the surrounding DNA sequences will be identical to the sequences flanking the 25 transposon in the plasmid pRP466.SV-neol.PGK-tk2. After transposition, the surrounding sequences will be of human genomic origin, and thus be different from those in the plasmid pRP466.SV-neol.PGK-tk2. Genomic DNA from independent tk-minus/G418-resistant colonies was isolated 30 and digested with Sau3A. To the genomic fragments, an oligo-cassette ("vectorette") was ligated. The vectorette consists of two oligonucleotides which have complementary sequences at their ends but are not complementary in the middle. Fragments that contain transposon and flanking 35 sequences are amplified in a PCR using an oligo complementary to the transposon end and pointing to the flanking sequence in combination with an oligo that is WO99/07871 PCT/NL98/00456 17 complementary to middle of the vectorette sequence. PCR products were analysed on an agarose gel and the amplified DNA fragments were sequenced. Thus far, in two out of five cases we found that the transposon was present, flanked by 5 a TA dinucleotide and followed by a new sequence. These integrations represent genuine transposition events showing that Tcl can jump in human cells when Tcl-transposase is provided. 10 Materials and methods Plasmid constructions pRP466 contains a Tcl element with 0.4 kb flanking sequences derived from plM40 (Mori 1988) cloned as a BamHI XbaI fragment into pUC19, pRP467 and pRP468 are derivatives 15 of pRP466 in which either a ClaI-Asp718 or PstI-ApaI fragment is deleted. pRP472 is a pACB104 (Boyd and Sherratt 1995) derivative which contains Tcl with the Aval-HindIII fragment of pBR322 inserted between the ClaI and ApaI sites. Cloning of the XbaI-BamHI fragment of pRP466 with 20 the HindII KanR-cassette of pUC4K (Pharmacia) between the XhoI-sites into pACB104 resulted in pRP490. pRP491 is comparable to pRP490; all the internal Tcl sequences have been replaced except the terminal 26 bp. The plasmid pRP466.SV-neol.PGK-tk2 was constructed as 25 follows: pRP466 was digested with XhoI and blunted with Klenow and dNTPs. The plasmid pRc/CMV (Invitrogen) was digested with BamHI and EcoRI and blunted with Klenow and dNTPs. Subsequently, the BamHI/EcoRI SV-neo fragment was cloned into XhoI digested pRP466, giving rise to pRP466.SV 30 neol. The plasmid pRP466.SV-neol was digested with EcoRI and blunted with Klenow and dNTPs. The plasmid pPGK-tk (PCT/NL/00195) was digested with PvuII. The PvuII PGK-tk fragment was cloned into EcoRI digested pRP466.SV-neol, giving rise to pRP466.SV-neol.PGK-tk2.

WO99/07871 PCT/NL98/00456 18 The plasmid pRc/CMV.TclA contains the Tcl-transposase cDNA, which was amplified from pRP470 (Vos et al., 1993) with the primers 5'CCCCAAGCTTGCCACCATGGTAAAATCTGTTGGGTGTAAAAATC (SEQ ID 5 NO.:-) and 5'GCTCTAGATGCTTAATACTTTGTCGCGTATCC (SEQ ID NO:-) using eLONGase according to standard protocol of the supplier (Gibco BRL). PCR was performed on a Biometra Trio Thermoblock, Amplification program: 94 0 C for 1 minute, 1 cycle; 94 oC for 30 seconds + -52 oC for 30 10 seconds + 68 oC for 1 minute , 35 cycles; 68 oC for 1 minute. The PCR fragment was digested with HindIII/XbaI and cloned into HindIII/XbaI digested pRc/CMV, giving rise to pRc/CMV.TclA. The integrety of the TclA cDNA was confirmed by sequencing. The pRc/CMV plasmid contains a neomycin 15 resistance gene expression cassette. The plasmid pcDNA1/TclA contains the HindIII/XbaI TclA fragment of pRc/CMV.TclA cloned into HindIII/XbaI digested pcDNA1/amp (Invitrogen). The pcDNAl/amp plasmid does not contain a neomycin resistance gene expression cassette. All 20 restriction enzymes, primers, Klenow and dNTPs were purchased from Gibco BRL. Southern blotting For figure 9: The product of the in vitro excision 25 reaction was separated on a 0.8% agarose 0.5 x TBE gel by electrophoresis for 5 hours at 70 Volts. Subsequently the gel was rinsed in Southern blot buffer (0.4 M NaOH, 0.6 M NaCl) for 30 minutes and the DNA was blotted overnight onto Hybond-N' (Amersham). After blotting, the gel was rinsed 30 in 5xSSPE and pre-hybridised for 3 hours in 50% formamide, 5xDenhardts, 5xSSPE, 5% dextrane sulphate, 1% SDS and 200 tg/ml haring sperm DNA and overnight hybridised with a randomly primed 1 2 P-labelled (RTS radprime DNA labeling system, Gibco BRL) neo probe (NcoI fragment of pPGK-tk) at 35 42 0 C. Subsequently the blot was extensively washed in WO99/07871 PCTINL98/00456 19 5xSSPE/0.1% SDS at 650C. The blot was exposed to HyperFilm (Amersham) at room temperature. Western blotting 5 Cells were washed twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates 10 were cleared by centrifugation.Protein concentrations were determined by the Bio-Rad protein assay, according to standard procedures of the supplier (BioRad). Whole-cell extracts were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes 15 (Millipore) and incubated with an cTc1 transposase antibody (Schukkink et al., 1990). The secondary antibody is a horseradish-peroxidase conjugated goat anti rabbit antiboby (BioRad). The antibody complexes were visualized with the ECL detection system according to the manufacturer's 20 protocol (Amersham). Cell culture and Transfection The cell line 911 (Fallaux et al., 1996) was cultured in Dulbecco's modified Eagles medium (Gibco BRL) 25 supplemented with 10% FBS (Gibco BRL) at 370C and 5% CO 2 . Selection of the transfected cells with G418 (Gibco BRL) was performed at a concentration of 500 pg/ml. Selection with Ganciclovir (Roche) was performed at a concentration of 10 g/ml. DNA was transfected into 911 cells using the 30 Calcium Phosphate Transfection System, according to the manufacturer's protocol (Gibco BRL). Briefly, 1 day prior to transfection, 911 cells were plated at 30% density on 5 cm tissue culture dishes (Greiner). The next day, cells were incubated with calcium phosphate precipitated DNA for 35 15 hours. Subsequently, the cells were washed twice with PBS and frsh medium was added. Approximately 48 hours post- WO99/07871 PCT/NL98/00456 20 transfection cells were put on G418 selection medium. G418 resistant colonies appeared around day 6. Single colonies were picked and cell lines were established. 5 Sequencing of the transposon flanks 100 ng genomic DNA was digested in 20 pl using 4 units Sau3A (Boehringer Mannheim) according to instructions of the supplier. After 2 hours at 370C the enzyme was inactivated by incubating 15 minutes at 650C. Equimolar 10 amounts of the vectorette oligo's (503: 5'GATCCAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGGAGA and 504 5'TCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG) were mixed in the presence of 10 mM Tris-HCl pH7.5 and 1mM 15 EDTA. The mixture was heated to 80 0 C and allowed to cool down to 400C. The final concentration of the vectorette oligo-cassette is 10 pmol/gl. 15 pmoles of the vectorette were overnight ligated at 160C to the digested DNA in a 100 gl volume using 5 units ligase (Boehringer Mannheim) 20 according to the instructions of the supplier. In the first PCR, 3 pl of the DNA is used in a volume of 25 pl using 1 unit Taq polymerase (Gibco BRL) according to the instructions of the supplier. The final concentration of the oligo's is 0.4 pmoles. The PCR consisted of 30 cycles 25 with 1 minute at 950C, 1 minute at 580C and 1 minute at 720C. To increase the specificity and the sensitivity a second PCR with nested primers was performed using 0.01 pl template from the first PCR. The conditions of the PCR were identical to the first PCR. The oligo's used are TclL2 (5' 30 TCAAGTCAAATGGATGCTTGAG) (SEQ ID NO:5) or TclR2 (5'- GATTTTGTGAACACTGTGGTGAAG) (SEQ ID NO:6) and 337new (5'-GTACGAGAATCGCTGTCCTC) (SEQ ID NO:7). The PCR products were analysed on a 1 % agarose gel. Amplified DNA fragments were excised from gel and DNA was extracted using the QIAEX 35 II gel extraction kit (Qiagen). The DNA was taken up in 20 p1l water after isolation from gel. The transposon primer WO99/07871 PCT/NL98/00456 21 TclL2 or TclR2 was radiolabeled using 32 P-ATP and polynucleotide kinase (Boehringer Mannheim) according to the instructions of the supplier. Using 0.25 pmoles of radiolabeled primer and the isolated DNA a PCR was 5 performed using 0.5 units Taq polymerase (Gibco BRL) and one of the ddNTP mixtures (containing either ddATP (160 iM ddATP and 5 pM of each dNTP in 10 mM Tris-HCl pH 8, 1 mM EDTA), ddTTP (250 pM ddTTP and 5 pM of each dNTP in 10 mM Tris-HCl pH 8, 1 mM EDTA), ddGTP (32 pM ddGTP and 5 pM of 10 each dNTP in 10 mM Tris-HCl pH 8, 1 mM EDTA) or ddCTP (160 iM ddCTP and 5 pM of each dNTP in 10 mM Tris-HCl pH 8, 1 mM EDTA)). The final volume was 20 4l. 20 cycles were performed with 1 minute at 95 0 C; 1 minute 58 0 C; 1 minute 72 0 C. The samples were analysed on a 6 % denaturing 15 polyacrylamide gel in 1 x TBE. Transgenesis of C. elegans A transgenic Bristol line was obtained after microinjection (Mello et al. 1991) of 150 mg/ml pRP469 and 20 5 mg/ml pRP465 (Vos et al. 1993), 50 mg/ml pRF4 (Kramer et al. 1990) in strain CB1392 (nuc-1 9e1392)). A stable line, NL818(pkls221), was generated by X-ray irradiation (Way et al. 1991). 25 Extract preparation Stable line NL818 was grown in liquid culture at 18 0 C and heat shocked for 3 hours at 33 0 C to induce transposase expression. After 2 hours of further growth at 18 0 C, nuclear extracts were prepared as described (Vos et al. 30 1993) with differences in the buffers. NIB: 25 mM Tris pH 7.5, 20 mM KC1, 0.5 M sucrose, 0.5 mM EDTA, 5 mM b-mercaptoethanol, 0.1 mM PMSF, NEB: 25 mM Tris pH 7.5, 0.1 mM EDTA, 500 mM NaCl, 15% glycerol, 0.25% Tween-20, 0.1 mM PMSF, 1 mM DTT. Nuclear extract contains 2.5 mg/ml protein; 35 concentration of TclA is about 10 mg/ml.

WO99/07871 PCT/NL98/00456 22 Recombinant transposase expression and prurification E. coli strain BL21 pLysS was transformed with pRP470 containing the Tcl transposase gene under the control of a T7 promoter (Vos et al. 1993), grown in 2xYT medium and 5 induced at an OD of 0.6 at 600 nm with 0.5 mM IPTG for 3 hours at 37 0 C. Inclusion bodies were purified as described by Nagai and Thogersen (1978). Inclusion bodies were dissolved in 8 M urea, 20 mM Na-phosphate pH 6.0 and loaded on a CM cellulose CL-6B column (Pharmacia). The 10 protein was eluted with a linear gradient from 0 to 500 mM NaCl. The transposase containing fraction was loaded on a Sephacryl S400 HR gel filtration column equilibrated in 6 M guanidiumhydrochloride, 50 MM Tris pH 8.0. Transposase fractions were dialysed against 8 M urea, 50 mM Tris pH 15 8.0, 1 mM DTT. The protein was loaded on a S Sepharose FF column and eluted with 500 mM NaCl in the same buffer. All steps were performed at room temperature. The protein was renatured by a 100xdilution into ice-cold buffer: 50 mM Tris pH 8.0, 100 mM NaCl, 5 mM DTT, 5 mM MgC12. After 20 30 minutes, insoluble protein was removed by centrifugation for 15 minutes in an Eppendorf centrifuge. Transposase concentration was 200 mg/ml and estimated to be more than 90% pure. 25 In vitro transposition reactions Standard reaction conditions: 25 mM Tris pH 8.0, 25 mM NaCl, 1 mM DTT, 10% ethylene glycol, 5 mM MgC12 (or 2.5 mM EDTA), 4 mM spermidine, 0.05 mg/ml BSA. 200 ng of donor plasmid was preincubated with 2.5 ml worm extract or 30 0.25 ml of purified protein for 5 minutes on ice before addition of 2.5 mg target DNA in a total volume of 50 ml. Incubation was for 1 hour at 30 0 C. Reactions were stopped by addition of 5.5 ml of 250 mM Tris pH 8.0, 50 mM EDTA, 5% SDS, 2 mg/ml proteinase K. After 1 hour at 37 0 C, the DNA 35 was precipitated and resuspended in 50 ml water.

WO 99/07871 PCT/NL98/00456 23 Mapping of in vitro cleavage sites Linear PCR amplicifation was in 20 ml using 5 ml template and 0.5 pmol primer for 20 cycles; 1' at 940C, 1' at 600C, 1' at 720C, essentially as described (Craxton 5 1991). Sequence primers: BIGR = 5'AGATTTCCACTTATATCATGTTTTATGTTTTGC (SEQ ID NO:8) , R2 (Van Luenen and Plasterk 1994). Genetic assay 10 Electrocompetent DS941 lambda lysogen (Flinn et al. 1989) bacteria were prepared and used as described (Zabarovsky and Winberg 1990). The donor plasmid contains a lambda origin of replication and can not replicate in the DS941 lambda lysogen; the target plasmid has Col El origin 15 of replication. One to 5 ml of DNA was used per electrophoration and 5% of the bacteria were, after dilution, plated on ampicillin. The remaining bacteria were plated on double selection. This yielded, depending on the efficiency upto 200 transformants.

WO99/07871 PCT/NL98/00456 24 References Bainton, R.J., P. Gamas, and N.L. Craig, 1991. Tn7 transposition in vitro proceeds through an excised transposon intermediate generated by staggered breaks in DdNA. Cell 65: 805-816. 5 Bainton, R.J., K.M. kubo, J.-n. Feng, and N.L. Craig, 1993.Tn7 transposition: target DNA recognition is mediated by multiple Tn7-encoded proteins in a purified in vitro system. Cell 72: 931-943. Beall, E.L., A. Admon, and D.C. Rio, 1994. A Drosophila 10 protein homologous to the human p70 Ku autoimmune antigen interacts with the P transposable element inverted repeats. Proc.Natl.Acad.Sci. USA 91: 12681-12685. Bender, J. and N. Kleckner, 1986. Genetic evidence that Tn10 transposes by a nonreplicative mechanism. Cell 45: 15 801-815. Bolland, S. and N. Kleckner, 1995. The two single-strand cleavages at each end of Tnl0 occur in a specific order during transposition. Proc.Natl.Acad.Sci. USA 92: 7814 7818. 20 Boyd, A./C. and D.J. Sherratt, 1995. The pCLIP plasmids:versatile cloning vectors based on the bacteriophage lambda origin of replication. Gene 153: 57 62. Clar, J.M. 1988. Novel non-templated nucleotide addition 25 catalyzed by procaryotic and eukaryotic DNA polymerases. Nucleic Acids Res. 16: 9677-9686. Collins, J., B. Saari, and P. Anderson, 1987. Activation of a transposable element in the germ line but not the soma of Caenorhabditis elegans. Nature 328: 726-728. 30 Craxton, M, 1991. Linear amplification sequencing, a powerful method for sequencing DNA. METHODS: A companion to Meth. Enzymol. 3: 20-26.

WO99/07871 PCT/NL98/00456 25 Doak, T.G., F.P. Doerder, C.L. Jahn, and G. Herrick, 1994. A proposed superfamily of transposase-related genes: new members in transposon-like elements of ciliated protzoa and a common "D35E" motif. Proc.Natl.Acad.Sci. USA 91: 942-946. 5 Emmons, S.W., L. Yesner, K.-s. Ruan, and D. Katzenberg, 1983. Evidence for a transposon in Caenorhabditis elegans. Cell 32: 55-65. Fallaux, F.J., Kranenburg, 0., Cramer, S.J., Houweling, A., van Ormondt, H., Hoeben, R.C. and van der Eb, A.J. 1996. 10 Characterization of 911: A new helper cell line for the titration and propagation of early region-i deleted adenoviral vectors. Human Gene Therapy 7: 215-222. Flinn, H.L., M. Burke, C.J. Stirling, and D.J. Sherratt, 1989. Use of gene replacement to construct Escherichia coli 15 strains carrying mutations in 2 genes required for stability of multicopy plasmids. J.Bacteriol. 171: 2241 2243. Grindley, N.D.F. and D.J. Sherratt, 1978. Sequence analysis of IS1 insertion sites: models for transposition. Cold 20 Spring Harbor Symp. Quant. Biol. 45: 125-133. Grosschedl, R., K. Giese, and J. Pagel, 1994. HMG domain proteins: architectural elements in the assembly of nucleoprotein structures. Trends Genet. 10: 94-100. Henikoff, S, 1992. Detection of Caenorhabditis transposon 25 homologs in diverse organism. New Biol. 4: 382-388. Kaufman, P.D., and D.C. Rio, 1992. P element transposition in vitro proceeds by a cut-and-paste mechanism and uses GTP as cofactor. Cell 69: 27-39. Kramer, J.M., R.P. French, E. Park, and J.J. Johnson, 1990. 30 The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology encodes a collagen, Moll.Cel. Biol. 10: 2081-2089. Loukeris, T.G., Livadaras, I., Arca, B., Zabalou, S., Savakis, C., 1995. Gene transfer into the medfly, Ceratitis WO 99/07871 PCT/NL98/00456 26 capitata, with a Drosophila hydei transposable element. Science, 270(5244): 2002-5 Mello, C.C., J.M. Kramer, D. Stinchcomb, and V. Ambros, 1991. Efficient gene transfer in C. elegans: 5 extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-3970. Mizuuchi, K. 1992. Transpositional recombination: mechanistic insights from studies of Mu and other elements. Annu. Rev. Biochem.61: 1011-1051. 10 Mori, I. 1988. "Analysis of germline transposition and excision of Tcl transposable elements in Caenorhabditis elegans". Ph. D. thesis. Washington University, St. Louis, MO. MUller, H.-P. and H.E. Varmus, 1994. DNA bending create 15 favored sites for retroviral integration: an explanation for preferred insertion sites in nucleosomes. EMBO J. 13: 4704-4714. Nagai, K. and H.C. Thogersen, 1987. Synthesis and sequence specific proteolysis of hybrid proteins produced in 20 Escherichia coli. Methods Enzymol. 153: 461-481. Paull, T.T., M.J. Haykinson, and R.C. Johnson, 1993. The nonspecific DNA-binding and -bending proteins HMG1 and HMG2 promote the assembly of complex nucleoprotein structures. Genes & Dev. 7: 1521-1534. 25 Plasterk, R.H.A. 1991. The origin of footprints of the Tcl transposon of Caenorhabditis elegans, EMBO J. 10: 1919 1925. Plasterk, R.H.A., 1995. The Tcl/mariner transposon family. In Transposable Elements (eds. H. Seadler and A. Gierl), 30 Springer Verlag, Heidelberg. Pryciak, P.M. and H.E. Varmus, 1992. Nucleosomes, DNA binding proteins, and DNA sequence modulate retroviral integration target site selection. Cell 69: 769-780. Radice, A.D., B. Bugaj, D.H.A. Fitch, and S.W. Emmons, 35 1994. Widespread occurrence of the Tcl transposon family: WO99/07871 PCTINL98/00456 27 Tcl-like transposons from teleost fish. Mol. Gen. Genet. 244: 606-612. Rio, D.C., G. Barnes, F.A. Laski, J. Rine, and G.M. Rubin, 1988. Evidence for Drosophila P element transposase 5 activity in mamalian cells and yeast. J. Mol. Biol. 200: 411-415. Robertson, H.M. 1995. The Tcl-mariner superfamily of transposons in animals. J.Insect. Physiol. 41: 99-105. Robertson, H.M. 1993. The mariner transposable element is 10 widespread in insects. Natrure 362: 241-245. Robertson, H.M. and D.J. Lmape, 1995. Recent horizontal transfer of a mariner transposable element among and between Diptera and Neuroptera. Mol. Biol. Evol. 12: 850 862. 15 Rosenzweig, B., L.W. Liao, and D. Hirsch, 1983. Sequence of the C. elegans transposable element Tcl. Nucleic Acids Res. 12: 4201-4209. Schukkink, R.F. and Plasterk, R.H.A. 1990. TcA, the putative transposase of the C.elegans Tcl transposon, has 20 an N-terminal DNA binding domain. Nucleic Acids Research 18: 895-900. Shapiro, J.A, 1979. Molecular model for the transposition and replication of bacteriophage Mu and other transposable elements. Proc. Natl. Acad. Sci. USA 76: 1933-1937. 25 Van Luenen, H.G.A.M. and R.H.A. Plasterk, 1994. Target site choice of the related transposable elements Tcl and Tc3 of Caenorhabditis elegans. Nucleic Acids Res. 22: 262-269. Van Luenen, H.G.A.M. van Luenen, and R.H.A. Palasterk, 1993. CharActerization of the Caenorhabditis elegans Tcl 30 transposase in vivo and in vitro. Genes & Dev. 7: 1244 1253. Vos, J.C. and R.H.A. Plasterk, 1994. Tcl transposase of Caenorhabditis elegans is an endonuclease with a bipartite DNA binding domain. EMBO J. 13: 6125-6132.

WO99/07871 PCT/NL98/00456 28 Way, J.C., L. Wang, J.-O. Run, and A. Wang, 1991. The mec-3 gene contains cis-acting elements mediating positive and negative regulation in cells produced by asymmetric cell division in Caenorhabditis elegans. Genes & Dev. 5: 2199 5 2211. Zabarosky, E.R. and G. Winberg, 1990. High efficiency electrophoration of ligated DNA into bacteria. Nucleic Acids Res. 18: 5912.

WO99/07871 PCT/NL98/00456 29 Legend Figure 1. Southern blot analysis of in vitro Tcl transposition reaction products. Products of in vitro transposition reactions were separated on a 1% agarose gel, 5 transferred to nitrocellulose and probed with radiolabeled Tcl. Standard reactions contained Mgcl2 (lanes 1 to 3 and 5 to 11) or EDTA (lane 4). Products were digested with ScaI in vector DNA (lane 2, 7, 10) or ApaI in Tcl DNA (lane 3) prior to electrophoresis. Lanes 5, 8 and 11 show reaction 10 products when the substrate is lenearized with ScaI prior to in vitro cleavage. Lanes 1 to 5 show reaction products using pRP466 as substrate which carries a complete Tcl element (see Figure 4). Lanes 6 to 8 use pRP467 as substrate which has a deleted left end of Tcl, whereas 15 lanes 9 to 11 show pRP4678 as substrate, which has the right end of Tcl deleted. REC and LEC stands for Right and Left End Cleavage, respectively. RH and LH indicate the positions of the Right and Left Half of Tcl. A schematic of ScaI-linearized pRP466 is shown at the bottom of the 20 figure. Figure 2. Mapping of the in vitro cleavage sites at the nucleotide level. A PCR based primer extension was performed on reaction products obtained in the presence of Mgcl2 (+) or EDTRA(-) using pRP466 as donor. A control 25 reaction was performed with pRP466 digested with EcoRV (RV lanes) to demonstrate the addition of one extra nucleotide at the end of the PCR product by Taq polymerase (see Clark 1988). Products were analyzed on a sequencing gel. Sequence reactions (GATC) were loaded as markers. PCR was with 30 primer R2 (right panel) or primer BIGR (left panel). The relevant sequence is indicated with the EcoRV site boxed and the TA target site underlined. The cleavage sites are shown by arrows. Identical results were obtained when the positions of cleavage at the other transposon end was 35 determined.

WO99/07871 PCT/NL98/00456 30 Figure 3. Schematic representation of the genetic transposition assay. The donor plasmid, a pACB104 derivative (Boyd and Sherratt 1995) with a lambda origin of replication, contains a Tcl element carrying an antibiotic 5 resistance gene. The target plasmid, pRP475, carries a 1,4 kb hindII gpa-2 fragment and a Col El origin of replication (pSP72, Promega). Reaction products were electroporated into a lambda lysogen. E. coli strain to counterselect against the donor. Integration events were selected on 10 double antibiotics. Figure 4. Target site selection. Comparison of the distribution of in vitro (black bars) and in vivo (open bars) Tcl insertions. pRP472 as donor and pRP475 as target were used in standard in vitro transposition reactions 15 using C. elegans extract. Every mark on the X-axis represents a TA dinucleotide in the gpa-2 fragment as described in detail elsewhere (Van Luenen and Plasterk 1994). Figure 5. Purification of Tcl transposase from E. coli. 20 Analysis of transposase purified from inclusion bodies on a 12% SDS-polyacrylamide gel. Lane M: molecular weight markers (indicated in KDa); lane 1: bacterial lysate before induction; lane 2: bacterial lysate after induction: lane 3: purified inclusion bodies; lane 4: purified transposase 25 after refolding. Figure 6. Mutations at the extreme termini of Tcl affect excision. In vitro reaction products w3ere obtained using C. elegans extract in the presence of Mgcl2 (+) or EDTE (-) using as donor pRP480 (wt), pRP481 (TA), pRP482 (CA), 30 pRP483 (GT) or pRP484 (BS), as indicated at the top. Products were separated on a 1% agarose gel, transferred to nitrocellulose and probed with radiolabeled KanR-gene fragment.The donor plasmids contain 28-mers cloned into the SmaI-site (wt sequence) and the HindII-site (wt or 35 mutant sequence) of pUC19 with the KanR-cassette of pUC4K WO99/07871 PCT/NL98/00456 31 in between. TA was mutated to CG, CA to TG and GT to AC, respectively. In the transposase binding site mutation the BalI and EcoRV sites are mutated to TCCCA and GGGCCC, respectively (see Vos and Plasterk 1994). 5 Figure 7. Model for Tcl transposition. A model for non replicative Tcl transposition showing the excised, linear element with a 2 bp 3' staggered overhang. Integration results in a duplication of the TA target site. Repair of the double strand break leads to the generation of 10 characteristic footprints (see also Van Luenen et al. 1994). Figure 8: Tcl-transposase is not toxic for human cells. The cell line 911 was transfected with 2 pg pRc/CMV.TclA or 2 [ig pRc/CMV per 5 cm, and monoclonal cell lines were 15 established from G418 resistant colonies. From each cell line, 50 pg whole cell extract was separated on a 10% PAA gel and subsequently analysed for Tcl-transposase. Tcl transposase was detected in the cell lines transfected with pRc/CMV.TclA (lanes 1-5), whereas no Tcl-transposase could 20 be detected in the negative control cell lines transfected with pRc/CMV (lanes 6-8). Figure 9: Southern blot of in vitro excision reaction products of pRP466.SV-neol.PGK-tk2, catalysed by Tcl transposase purified from E.coli.. Incubation of the donor 25 plasmid pRP466.SV-neol.PGK-tk2 with purified Tcl transposase (lane 1), but not with NEB (lane 2) results in excision of the Tcl.SV-neo transposon (lane 1). Thus, the plasmid pRP466.SV-neol.PGK-tk2 can serve as a Tcl.SV-neo transposon donor plasmid. 30 Table 1. Transposition frequencies. In vitro Tcl transposition reactions were carried out with supercoiled (SC) or linear donor plasmids and with protein sources as indicated and the ratios of ampR-kanR to ampR colonies 35 (*106) are shown for two independent experiments. No WO99/07871 PCT/NL98/00456 32 integration products were recovered when reactions were performed in the presence of EDTA. Table 2: Formation of G418 resistant colonies after co transfection of pRP466.SV-neol.PGK-tk2 with pcDNA1/TclA or 5 pcDNAl/amp. The cell line 911 was co-transfected with pRP466.SV-neol.PGK-tk2 and pcDNA1/TclA or pcDNAl/amp. For a period of 18 days, the transfected cells were put on G418 selection medium . Subsequently, the G418 resistant colonies were stained with methylene blue and counted. Co 10 transfection of pRP466.SV-neol.PGK-tk2 with pcDNA1/TclA yielded approximately 40% more G418 resistant colonies than co-transfection with pcDNAl/amp. This indicates that , in addition to random integration, G418 resistant colonies were formed due to jumping of the Tcl-neo transposon into 15 the cellular genome. Table 3: Expression of HSV-tk in G418 resistant cell lines co-transfected with pRP466.sv-neol.PGK-tk2 with pcDNA1/TclA or pcDNA1/amp. Co-transfection of pRP466.sv-neol.PGK-tk2 with pcDNA1/TclA yielded more HSV-tk negative (Ganciclovir 20 resistant) colonies than co-transfection with pcDNA1/amp. Table 1 25 Donor source exp.1 exp.2 pRP490, SC C. elegans 21 22 30 pRP490, linear C. elegans 0.5 1.0 pRP491, SC C. elegans 3.7 1.6 35 pRP490, SC E. coli 3.0 3.2 WO99/07871 PCT/NL98/00456 33 Table 2 Transtected DNA/5 cm n= mean number of dish colonies 2 ptg pcDNA1/TclA + 3 51 0.1 gg pRP466.SV neol.PGK-tk2 2 jg pcDNAl/amp + 3 37 0.1 jg pRP466.SV neol.PGK-tk2 2 jg pcDNA1/TclA + 2 206 0.5 jg pRP466.SV neol.PGK-tk2 2 jg pcDNAl/amp + 2 144 0.5 ig pRP466.SV neol.PGK-tk2 2 jg pcDNA1/TclA + 2 342 2 jg pRP466.SV-neol.PGK tk2 2 jg pcDNAl/amp + 2 251 2 jg pRP466.SV-neol.PGK tk2 no DNA 2 0 WO99/07871 PCT/NL98/00456 34 Table 3 Transtected DNA n= % HSV-tk negative 2 tg pcDNA1/TclA + 16 77 0.1 tg pRP466.SV neol. PGK-tk2 2 pg pcDNA1/TclA + 19 64 0.5 ig pRP466.SV neol.PGK-tk2 2 pg pcDNA1/amp + 19 32 0.1 jg pRP466.SV neol.PGK-tk2 2 [ig pcDNAl/amp + 18 44 0.5 jg pRP4GG66.SV neol .PGK-tk2 WO 99/07871 35 PCT/NL98/00456 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: Valerio, Domenico (B) STREET: Gerbrandylaan 12 (C) CITY: Leiden (D) STATE: Zuid-Holland (E) COUNTRY: the Netherlands (F) POSTAL CODE (ZIP): 2314 EZ (A) NAME: Schouten, Govert Jan (B) STREET: Da Costastraat 82 (C) CITY: Leiden (D) STATE: Zuid-Holland (E) COUNTRY: the Netherlands (F) POSTAL CODE (ZIP): 2321 AR (A) NAME: Plasterk, Ronald Hans Anton (B) STREET: Zwarteweg 5 (C) CITY: Bussum (D) STATE: Noord-Holland (E) COUNTRY: the Netherlands (F) POSTAL CODE (ZIP): 1405 AA (A) NAME: van Luenen, Hendricus Gerhard Adrianus Maria (B) STREET: Leerdamhof 143 (C) CITY: Amsterdam (D) STATE: Noord-Holland (E) COUNTRY: the Netherlands (F) POSTAL CODE (ZIP): 1108 BM (ii) TITLE OF INVENTION: Vectors and methods for providing cells with additional nucleic acid material integrated in the genome of said cells. (iii) NUMBER OF SEQUENCES: 12 (iv) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO) (v) CURRENT APPLICATION DATA: APPLICATION NUMBER: US 08/909,786 WO 99/07871 36 PCTINL98/00456 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CCCCAAGCTT GCCACCATGG TAAAATCTGT TGGGTGTAAA AATC 44 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GCTCTAGATG CTTAATACTT TGTCGCGTAT CC 32 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 56 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid WO 99/07871 37 PCTINL98/00456 (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GATCCAAGGA GAGGACGCTG TCTGTCGAAG GTAAGGAACG GACGAGAGAA GGGAGA 56 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 52 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: TCTCCCTTCT CGAATCGTAA CCGTTCGTAC GAGAATCGCT GTCCTCTCCT TG 52 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: TCAAGTCAAA TGGATGCTTG AG 22 WO 99/07871 38 PCT/NL98/00456 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: GATTTTGTGA ACACTGTGGT GAAG 24 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B3) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GTACGAGAAT CGCTGTCCTC 20 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL:

NO

WO 99/07871 39 PCT/NL98/00456 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: AGATTTCCAC TTATATCATG TTTTATGTTT TGC 33 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: TCCCA 5 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: GGGCCC 6 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE

CHARACTERISTICS:

WO 99/07871 40 PCT/NL98/00456 (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: CTCTGCTCAT ATGTCACGAC CGGTTTTTCT ATAGGTG 37 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: CACCTATAGA AAAACCGGTC GTGACATATG AGCAGAG 37

Claims

1. A vector for integrating additional nucleic acid material into a cell of a certain genome of a first genus, said vector comprising: two transposase binding sites and 5 a cut site corresponding to each of said transposase binding sites, wherein said transposase binding sites are derived from a transposon found in a second genus; wherein each of said transposase binding sites are in close proximity to said corresponding cut site; and 10 wherein the additional nucleic acid material is integrated between said two transposase binding sites of the vector.

2. A vector according to claim 1, whereby the transposase binding sites and cut sites are based on the corresponding 15 sites in transposons from the Tcl/mariner superfamily of transposons.

3. A vector according to claim 1 or 2, whereby the transposase binding sites and cut sites are based on Tcl like transposons. 20

4. A vector according to claim 3, comprising at least the terminal 26 basepairs of Tcl as a transposase binding site and a cut site for the Tcl transposase.

5. A vector according to anyone of the aforegoing claims, further comprising a means for transducing a target cell. 25

6. A vector according to anyone of the aforegoing claims further comprising a nucleic acid sequence encoding transposase activity, functional for the transposase binding sites and cut sites present in said vector.

7. A vector according to anyone of the aforegoing claims, 30 whereby the additional nucleic acid material encodes a protein.

8. A vector according to anyone of claims 1-7, whereby the additional nucleic acid material provides a blocking nucleic acid, such as an antisense RNA. WO99/07871 42 PCTINL98/00456

9. A vector according to anyone of the aforegoing claims, whereby said vector is derived from a viral vector, preferably an adenoviral, retroviral, or adeno associated viral vector. 5

10. A method for providing a target cell with additional nucleic acid material integrated into its genome, comprising transducing said cell with a vector according to anyone of the aforegoing claims and providing said target cell with transposase activity functional for the 10 transposase binding sites and cut sites present on said vector.

11. A method according to claim 10, whereby the transduction is carried out through infectious particles comprising the vector. 15

12. A recombined target cell obtainable by a method according to claim 10 or 11.

13. Use of a functional transposon found in a certain genus in integrating a nucleic acid of interest into the genome of a cell of a different genus. 20

14. Use according to claim 13, in a gene therapy regime.

15. Use according to claim 13 for producing transgenic animals.