JP2003533176A - Resolvese-catalyzed sequence-specific recombination of DNA in eukaryotic cells - Google Patents

Abstract

  (57) [Summary] The present invention comprises the steps of introducing a first DNA sequence containing a res sequence into a cell, introducing a copy of the first DNA sequence, and performing sequence-specific recombination by the action of a resolvase or a derivative thereof. And a sequence-specific recombination method for DNA in eukaryotic cells. The present invention relates to a step of introducing a first DNA sequence of SEQ ID NO: 1 into a cell, a step of introducing a copy of the first DNA sequence of SEQ ID NO: 1 into a cell in a tandem direction, and a step of introducing a wild-type resolvase. And a step of adding a topoisomerase inhibitor to be tested, to a method for testing a topoisomerase inhibitor in a eukaryotic cell.

Description

Detailed Description of the Invention

The present invention relates to the step of introducing a first DNA sequence containing a res sequence into a cell, introducing a copy of the first DNA sequence, and a resolvase (reso).
lvase) or a derivative thereof to carry out sequence-specific recombination. The invention further comprises the step of introducing into the cell the first DNA sequence of SEQ ID NO: 1.
Topoisomerase in eukaryotic cells comprising the steps of introducing a copy of the first DNA sequence of SEQ ID NO: 1 into cells in a tandem direction, introducing wild-type resolvase, and adding a topoisomerase inhibitor to be tested. It relates to a method for testing inhibitors.

The controlled manipulation of the eukaryotic genome is an important method for investigating the function of certain genes in living organisms. It also plays a role in medical gene therapy approaches. The generation of transgenic animal strains, modification of genes and gene segments (ie, "gene targeting") and targeted introduction of heterologous DNA into the genome of higher eukaryotes is of particular importance in this context. By characterizing and using sequence-specific recombination systems, it has recently become possible to significantly improve these techniques.

Conservative and sequence-specific DNA recombinases are divided into two families. Members of the first family, the "Integrase" family, are:
It catalyzes the cleavage and recombination of DNA strands between two defined nucleotide sequences, referred to below as recombinant sequences. These may be present in two different DNA molecules or in one DNA molecule. Intermolecular recombination or intramolecular recombination then occurs, respectively. In the latter case, the outcome of the reaction depends on the arrangement of each of the corresponding recombinant sequences. If the recombination sequences are opposite to each other, ie in the opposite orientation, reversal of the DNA segment between them will occur. Deletions occur when the recombination sequences are tandem, that is, present on the DNA substrate as duplicates in the same orientation. In the case of intermolecular recombination, ie where the two recombination sequences are located on two different DNA molecules, a fusion of the two DNA molecules may occur. Members of the integrase family normally catalyze both intramolecular and intermolecular recombination, whereas the second family of recombinases, or "invertases / resolvases", are only capable of intramolecular recombination. “Invertase / resolvase” is a replica of an inverted sequence of recombinant sequences (
Intramolecular recombination can only be carried out if it is present as an invertase) or as a direct replication (resolvase). Due to the action of invertase, the DNA segment present between the recombination sequences is always inverted, whereas the resolvase always causes a deletion.

The recombinases currently used mainly for manipulating the eukaryotic genome belong to the integrase family. These are Cre- of bacteriophage P1
Recombinase and Flp recombinase from yeast. Muller,
U. (1999) Mech. Development. , 82, pp. See 3. Cre
-The recombinant sequence to which the recombinase binds is indicated by loxP. loxP is a 34 bp long nucleotide consisting of two inverted nucleotide sequences, each 13 bp long with an 8 bp long spacer between them. Hoess, R.A.
et al. (1985) J. Mol. Biol. , 181, pp. See 351. The binding sequence of Flp represented by FRT has the same composition but is different from loxP. Kilby, J .; et al. (1993) Trends Genet.
, 9, pp. 413. See. Therefore, the recombinant sequences are not interchangeable with each other. That is, Cre cannot recombine the FRT sequence and FLP cannot recombine the loxP sequence. Both recombination systems are active at long distances. That is, the DNA segment to be inverted or deleted, which is flanked by two loxP or FRT sequences, may have a base pair length of several 10,000 (kb).

These two systems carry out, for example, tissue-specific recombination in mouse models, chromosomal translocation in plants and animals and controlled induction of gene expression. Muller, U.S.A. (1999) Mech. Development. , 8
2, pp. See review article by 3. In this way, the gene for DNA polymerase β was deleted in specific mouse tissues. Gu, H .; et al. (1994) S
science, 265, pp. See 103. Yet another example is the specific activation in these tissues of the DNA oncovirus SV40 oncogene, which primarily forms tumors in the mouse lens. The Cre-loxP method is also used in connection with inducible promoters. For example, the expression of recombinases by the interferon-inducible promoter is regulated thereby and specific genes are deleted in the liver, but not or only to a small extent in other tissues. Kuhn, R .; et
al. (1995) Science, 269, pp. See 1427.

Two members of the invertase / resolvase family have previously been used to engineer the eukaryotic genome. Mutants of the bacteriophage Mu invertase Gin are able to catalyze the inversion of DNA fragments in plant protoplasts without the use of cofactors. However, this mutant is in a state of undergoing excessive recombination, ie DN of a recombinant sequence other than the natural recombinant sequence.
It also catalyzes A chain scission. Maeser, S .; & Kahmann, R .; (1991)
Mol. Gen. Genet. , 230, pp. See 170. This may result in unintended lethal recombination events in the plant protoplast genome. A β-recombinase encoded by a plasmid from Streptococcus pyogens catalyzes recombination between two tandem repeat recombination sequences in mouse cell culture, which excises the segment. However, in addition to the deletion, inversions were also detected. Diaz, V .; et al. (1999)
J. Biol. Chem. , 274, pp. See 6634. As a result, the controlled use of these members of the invertase / resolvase family under control of the eukaryotic genome is largely limited or unsuitable.

Γδ-resolvase is a prototype of the resolvase family and is encoded by the bacterial transposon γδ (also designated transposon 1000). γδ-Resolvase is phylogenetically closely related to Tn3 Resolvase.
Indeed, in the bacterial Escherichia coli, the γδ-transposon behaves episomally as a component of the F factor. The biological function of transposons encoded resolvases is generally to catalyze the separation of so-called fusions by sequence-specific DNA recombination. The fusion consists of two tandemly repeated copies of the transposon, transiently formed by the process of transposition within the bacterial cell ("jumping" of the mobile genetic element to another locus). Resolvase catalyzes recombination between two identical recombination sequences, commonly designated res. res contains 145 nucleotides and, like the resolvase gene, is a natural component of transposons. Generally, class II transposons are re
s, the tnpA gene encoding transposase and the tnpR gene encoding resolvase. In forming the fusion, the transposon
Two copies of the transposon carrying the es sequence, the tnpA gene and the tnpR gene are replicated such that they exist as tandemly directed replicas. Grindle
y, N.N. D. F. (1994) Nucl. Acids and Mol. Bio
l. , 8, pp. See review article by 236. Resolvase has a total of 6 binding sites within res. That is, individual resolvase molecules are bound to each binding site. Since wild-type resolver exists as a homodimer in a solubilized state (and therefore also in cells), a total of 3 dimers bind to res. As a result, res consists of three dimer binding sites designated I, II and III.
Two of the three binding sites (II and III) are called auxiliary sequences. Occupation of these sequences by two resolver dimers is a prerequisite for the activation of the actual recombination reaction that ultimately leads to DNA strand exchange. This occurs in the center of the binding site I, the so-called "crossover" region, by the incomplete palindromic sequence of res, catalyzed by the resolver dimer that binds to it.

Members of the resolvase family require a negative (-) DNA supercoiled DNA substrate to be able to catalyze recombination between two res. No additional protein cofactors are required for this reaction. In addition to the (-) DNA supercoiled state, yet another prerequisite for this recombination is the presence of both res as tandem repeats on the DNA molecule. As a result, the resolverase has two r
It only catalyzes intramolecular deletions of DNA segments that are localized between es sequences. res
The reason for these constraints on the localization and orientation of the protein is the formation of a specific synaptic complex, the so-called synaptosome, between at least 6 resolver dimers and two here base-paired res copies. Is Rukoto. The formation of synaptosomes is in any case a prerequisite for the activation of the recombination reaction by resolvase. A comprehensive review of resolvase catalyzed recombination reactions can be found, for example, in Grindley (1994).

Independent of the presence of the (−) supercoil of the DNA substrate molecule, two complete r
There are resolver mutants such as Tn3-resolvase and γδ-resolvase (γδ-resolvase ^E124Q ) that can catalyze recombination between es. The molecular basis of this phenotype has so far not been fully explained. Apparently, the improved dimer properties of this mutant resolvase monomer play an important role here. Arnold et al. (1999) EMBO J. ，
18, pp. See 1407. In this case, a deletion of the DNA segment between the res sequences occurs, as observed in the wild-type resolvase reaction.

Yet another special feature of mutant resolvases in the presence of the (−) supercoil is that these mutant resolvases contain two accessory sequences I of res.
It means that the recombination can be carried out using only the binding site I with the palindromic sequence, without using I and III. As a result, recombination may also occur between two DNA segments that are substantially shorter than the full res, as they contain mostly binding site I. Recombination occurs independent of the localization and orientation of the recombination sequences. That is, the two partner sequences may be on one DNA molecule, or on two different DNA molecules, and may exist as tandem or inverted replicas. As a result, intermolecular recombination occurs, which results in the fusion of two different DNA molecules, in the case of an intramolecular reaction, depending on the respective orientations of binding site I with respect to each other, ie in tandem or reverse orientation. As a replica, a deletion or inversion of the DNA segment occurs between binding sites I.

The known properties of the described resolvase mutants and wild-type enzymes form an important context in the context of the present invention: (1) the unmodified resolvase is strictly dependent on the unrelaxed DNA substrate, The two complete res sequences must be retained as tandem replicas. Only intramolecular recombination occurs, resulting in the deletion of the DNA segment. (2) On the other hand, mutants such as γδ-resolvase ^E124Q or γδ-resolvase ^{E102Y, E124Q} can catalyze the recombination reaction of relaxed states, eg, chain substrate molecules, but with complete res Sequences (I, II and III) are the same D
It must be present in the NA molecule in the tandem direction. In the case of mutant resolvases too, only intramolecular recombination and the resulting deletion of the DNA segment occurs in the complete res sequence. (3) However, the mutant resolvase, regardless of the supercoiled DNA, when the res sequence with binding site I is only present, ie (
-) Recombination can also be carried out with or without the presence of supercoil. The localization and orientation of the res sequence on the DNA molecule is not important.
Thus, the resolvase mutant can carry out intramolecular and intermolecular recombination.

The intracellular genomic and episomal DNA in higher eukaryotic cells is topologically relaxed, apart from several regions. Thus, for example, DNA has few free (−) supercoils that wild-type resolvers use to catalyze recombination. Therefore, resolvase has not previously been used for recombination of eukaryotic cells.

The topological state of genomic DNA is regulated intracellularly by a specific class of enzymes called topoisomerases. For example, in the event of loss of enzymatic activity of these proteins by the action of mutations or inhibitors, topological stress accumulates in genomic DNA as a result of other DNA interactions such as transcription. Wang, J .; C. (1996), Annu. Rev. Biochem. ，
65, see the review article pp 635. There are numerous substances that can selectively inhibit intracellular topoisomerase activity. Certain classes of these substances are
For example, it is represented by camptothecin and its derivatives, which are already used therapeutically as anticancer agents and selectively inhibit type I topoisomerase. Chen an
d Liu (1994), Annu. Rev. Pharmacol. Toxic
ol. , 34, pp. See the review article by 191. However, a major problem in developing new, more effective topoisomerase inhibitors is now the requirement of cell culture or, for example, mouse to determine the extent of inhibition and / or tissue specificity of such agents. There is no simple test system in living organisms such as.

Therefore, it is an object of the present invention to provide a simple, regulatable recombinant system and the effective materials required for it. Furthermore, it is an object of the present invention to provide a simple and reliable test system for eukaryotic topoisomerase inhibitors.

The objects of the invention are achieved by the objects defined in the claims.

As used herein, the expression “resolvase” refers to an enzyme that is encoded by a transposon and that catalyzes the separation of the fusion structure of the transposon by sequence-specific recombination, and derivatives thereof, such as, for example, mutant resolvase. Show.

As used herein, the expression “derivative” refers to one or more deletions, substitutions,
Denotes nucleic acid or amino acid sequences with additions, insertions and / or inversions. In this context, the expression "derivative" refers to the 3'side and / or the SEQ ID NO: 1 or 2
Or 5'-truncated form of the sequence, slight mutations (base exchanges) in the res sequence of SEQ ID NO: 1 or 2 and insertions, additions or deletions of SEQ ID NO: 1 or 2
All of these variants have the same activity as the original res sequence. Therefore, "derivative"
The expression also refers to a nucleic acid which encodes a polypeptide having one or more of the described mutations and having resolvase activity. In this context, the expression "derivative" also refers to a polypeptide having one or more of the described modifications, the polypeptide having resolvase activity.

The expression “basic amino acid” as used herein refers to amino acid residues having positively charged side chains such as lysine, arginine and histidine.
The expression "acidic amino acid" as used herein refers to amino acid residues having negatively charged side chains such as aspartic acid and glutamic acid.

The expression “serial direction” or “duplication in serial direction” as used herein means that the sequences are in each case in the 5′-3 ′ direction.

As used herein, the expression “transformation” or “transformant” refers to
Introduces the nucleic acid sequence into the cell. The introduction may be, for example, transfection or lipofection and may be performed by the calcium phosphate method, the electroshock method or the oocyte injection.

As used herein, the expression “vector” refers to a natural form or a plasmid, phagemid, cosmid, synthetic chromosome, bacteriophage, virus or retrovirus that is naturally occurring or carries out the incorporation, replication, expression or transfer of a nucleic acid. The artificially produced construct is shown.

One aspect of the invention is the step of introducing two copies of the first DNA sequence containing the res sequence into a cell, simultaneously or sequentially, and performing sequence-specific recombination by the action of resolvase. And a method of sequence-specific recombination of DNA in eukaryotic cells. Preferred is the method in which a copy of the first DNA sequence is introduced in tandem into the same DNA molecule as the other copies. Particularly preferred is the method in which the first DNA sequence contains the res sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

In order to carry out the method according to the invention, the first DNA sequence is, in addition to the recombination sequence, a further DN which allows integration into the desired target location of the genome of the eukaryotic cell.
It may contain an A sequence. This integration occurs by homologous recombination internally mediated by intracellular recombination mechanisms. For this purpose, the additional DNA sequence must be homologous to the DNA at the target position and must be 3'and 5'to the two res sequences present as tandem replicas. The degree of homology necessary for homologous recombination to occur with sufficient probability and the required 3'side and 5'respectively.
The length of the side sequences is well known to those of skill in the art. Capecchi, M .; (1989) Sc
See the review article in Ience, 244, pp 1288.

The method according to the invention can be used, for example, in intramolecular recombination in eukaryotic cells to delete a DNA segment located between recombinational sequences in tandem. Recombinant sequences present are in tandem if the sequences are integrated in each case in the 5'-3 'direction. For example, a recombinant sequence such as res with binding sites I, II and III (SEQ ID NO: 1) or res with binding site I (SEQ ID NO: 2) is in each case 5 ′ of the exon of the same DNA molecule and It is placed in the intron sequence on the 3'side by homologous recombination.
An exon is deleted when carried out by the action of a resolvase such as -resolvase ^E124Q or γδ-resolvase ^{E102Y, E124Q} . As a result of this, for example, the polypeptide encoded by the corresponding gene may lose activity or function, or transcription may be abolished by the deletion, resulting in no (complete) transcription. For example, the biological function of the encoded polypeptide can be examined in this way. Resolvase or a derivative thereof may carry at the C-terminus a nuclear localization sequence which ensures good intracellular transport of recombinase into the nucleus of the cell.

Furthermore, the method according to the invention can be used in intramolecular recombination in eukaryotic cells to reverse the DNA segments which are localized between recombination sequences which are not in tandem. To this end, the recombinant sequence res having the binding site I has the same D
It must be oriented in the opposite direction on the NA molecule.

The method according to the invention can further be used to carry out intermolecular recombination in eukaryotic cells. To this end, the recombinant sequence res having the binding site I
Are placed on two different DNA molecules regardless of orientation. Recombination then fuses the two DNA molecules at binding site I.

However, the first DNA sequence may also contain additional nucleic acid sequences that encode one or more polypeptides of interest. For example, a recombination sequence can introduce into the genome a structural protein, enzyme or regulatory protein that is eliminated at the end of intramolecular recombination, resulting in a lack of expression and activation of the polypeptide. Subsequent expression and activation of the polypeptide may occur if the polypeptide of interest is reversed rather than deleted by intramolecular recombination. The introduced polypeptide may be endogenous or exogenous. A marker protein may be introduced. The person skilled in the art recognizes that such listings of application of the method according to the invention are exemplary only and not limiting. Examples of applications according to the present invention carried out using the Cre and Flp recombinases used hitherto are described, for example, in Kilby, N .; et al
． , (1993), Trends Genet. , 9, pp. 413 in the review article.

In order to carry out the method according to the invention, the resolvase must act on the recombinant sequence. The resolvase or the resolvase gene may already be present in the eukaryotic cell prior to introducing the first DNA sequence containing the res sequence and / or a copy of the first DNA sequence, or the first DNA sequence and / Or first
It may be introduced after the introduction of a copy of the DNA sequence of The resolvase used for sequence-specific recombination is preferably expressed in the cells in which the reaction is carried out. For this purpose, a second DNA sequence containing the resolvase gene is introduced into the cell. Modified γ
Nucleic acid encoding δ-resolvase is preferably used, the resolvase preferably being based on the number of wild type resolvase shown in SEQ ID NO: 4, 80-140.
The amino acid residue, preferably the 90th to 110th amino acid segment, has been modified to have at least one, and preferably at least two of the following mutations: (i) the acidic amino acid residue is aromatic, hydrophilic A basic or basic amino acid residue, (ii) a neutral amino acid residue is replaced by a hydrophilic amino acid residue, and (iii) a hydrophilic amino acid residue is a neutral or acidic amino acid residue Has been replaced by. A particularly preferred nucleic acid encodes a modified γδ-resolvase, in which Glu is replaced by Gln or Tyr, Asp is replaced by Ser, Ser is replaced by Asp, Gly is replaced by Ser, Asp is Ala
And / or Glu is replaced with Arg. Particularly preferred resolvase genes are shown in SEQ ID NOs: 3, 5 and 7 and also contain their derivatives. The γδ-resolvase gene, in which the encoded polypeptide has two mutations, is very particularly preferred, and the resolvase gene of SEQ ID NO: 5 is particularly preferred due to its high efficiency compared to one mutant. Particularly preferred is the method of introducing the second DNA sequence into the genome of a eukaryotic cell by homologous recombination or indiscriminately. Second D
Further preferred is a method wherein the NA sequence contains a regulatory DNA sequence which influences the location-dependent and / or time-dependent expression of the resolvase gene.

In this case, location-dependent expression can be achieved, for example, by recombinase
It is meant to be expressed only in specific cell types such as kidney cells, nerve cells or cells of the immune system and to catalyze recombination only in these cells. Time-dependent expression in the case of regulating the expression of resolvase can be performed by a promoter at a specific stage of development or a promoter that becomes active at a specific time in the adult living body. Furthermore, spatial function and / or time-dependent expression can be performed by using inducible promoters such as interferon- or tetracycline-dependent promoters. Mulle
r, U. (1999) Mech. Development. , 82, pp3 for a review article. However, spatial function and / or time-dependent activation of recombination, in the case of constitutive expression of wild-type resolvase, should be performed not only by regulation of resolvase expression but also by the action of topoisomerase inhibitors. You can

The resolvase used in the method according to the invention may be wild type or modified resolvase. The use of modified resolvase is preferred. Resolvases preferably used in the method according to the invention contain the amino acid sequences set forth in SEQ ID NOs: 4, 6 and 8. The modified resolvase is modified so that the recombination reaction can be carried out without using the (−) DNA supercoil, that is, on a relaxed substrate molecule, preferably a relaxed chain substrate molecule. Preparation of modified polypeptides and screening for desired activity is part of the prior art and is simple to carry out. Erlich, H .; (1989) PCR Technology. Sto
See ckton Press. It is preferred to use the γδ-resolvase of SEQ ID NO: 4. Modified resolvases are particularly preferred, wherein the resolvases are preferably at least one of the following mutations in the segment of amino acids 80-140, preferably 90-110, based on the number of wild-type resolvase shown in SEQ ID NO: 4. Modified to have one, preferably at least two,
(I) an acidic amino acid residue is replaced with an aromatic, hydrophilic or basic amino acid residue, (ii) a neutral amino acid residue is replaced with a hydrophilic amino acid residue, and (iii) hydrophilic Neutral amino acid residues are replaced with neutral or acidic amino acid residues. A modified γδ-resolvase is particularly preferred, where in the segment Glu is replaced by Gln or Tyr, Asp is replaced by Ser, Ser is replaced by Asp, Gly is replaced by Ser, Asp is replaced by Ala. And /
Alternatively, Glu is replaced with Arg. γδ-resolvase ^E124Q (SEQ ID NO: 8
) And the two γδ-resolvase mutants represented by γδ-resolvase ^{E102Y, E124Q} (SEQ ID NO: 6). Arnold et al. (1999
) See above. γδ-Resolvase ^E124Q contains a glutamine residue in place of the glutamic acid residue at position 124. γδ-resolvase ^{E102Y, E124Q} also contains a tyrosine residue instead of the glutamic acid residue at position 102, in addition to the substitution of mutant 124, unlike wild type γδ-resolvase. Both γδ-resolvase mutants were made by PCR mutagenesis of the γδ-resolvase gene. These mutants can carry out recombination between two tandemly replicated complete res sequences without the need for a cofactor (-) supercoil.

The method according to the invention can be carried out in all eukaryotic cells. Cells
For example, it may be present as a cell culture and may include animal cells such as vegetables of all kinds or vertebrates such as fish, frogs or mammals or invertebrates such as insects such as earthworms or flies. For example, the cells may be oocytes, embryonic stem cells, hematopoietic stem cells or differentiated cells of any type. Eukaryotic cells are zebrafish cells, Cenorhabditis elegans (Caenorhabditis el
Preferred are methods which are non-mammalian cells such as egans) or Drosophila melanogaster cells. Further preferred is the method wherein the eukaryotic cell is a human cell or a non-human cell, eg a monkey, mouse, rat, rabbit, hamster, goat, cow, sheep or pig cell. Therefore, the method according to the invention comprises at least one copy of SEQ ID NO: 1 or 2, preferably 2
It also relates to a eukaryotic cell containing a copy of res and / or the resolvase gene of SEQ ID NO: 3, 5 or 7 or a polypeptide encoded by this gene, or a derivative of each.

The present invention relates to the use of res of SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence-specific recombination of eukaryotic DNA. Eukaryotic cells are derived from vegetables or fish, frogs or non-human mammals or vertebrates such as humans (if conferrable in the patent requirements of their respective patent systems) or invertebrates such as insects such as earthworms or flies. It may exist in the state of cell aggregates of such an animal body. This creature is
The cells can be crossed with other organisms containing the resolvase and used to generate progeny in the sequence of which sequence-specific recombination is performed by the action of the resolvase. Therefore, the invention also relates to the use of the resolvase or the resolvase gene in the sequence-specific recombination of eukaryotic cells. In particular, the invention relates to the resolvase gene of SEQ ID NO: 3, the resolverase ^{E102Y, E124Q} of SEQ ID NO: 5 and SEQ ID NO: 7.
^Regarding the use of Resolvase ^E124Q .

The invention further relates to transgenic organisms such as plants or animals such as vertebrates such as fish, frogs or mammals or invertebrates such as insects such as earthworms or flies. The present invention preferably comprises res of SEQ ID NO: 1 or SEQ ID NO: 2.
Is incorporated into one or two copies and / or the resolvase gene of SEQ ID NO: 3, 5 or 7 or a derivative thereof is incorporated into a cell,
Zebrafish, Caenorhabditis elegans
It also relates to transgenic organisms other than mammals such as Drosophila melanogaster, and transgenic mammals such as transgenic monkeys, mice, rats, rabbits, hamsters, goats, cows, sheep or pigs.

The method according to the invention further comprises the steps of a) introducing the first DNA sequence of SEQ ID NO: 1 into the cell, and b) introducing a copy of the first DNA sequence of SEQ ID NO: 1 in the tandem direction. And c) introducing wild-type resolvase, d)
Adding a topoisomerase inhibitor to be tested, can be used to test a topoisomerase inhibitor in eukaryotic cells.

Eukaryotic cells can be used in culture (ex vivo) or in vivo (in vivo) for the method according to the invention. In vivo use is preferred here, since the cell- and tissue-specific physiological effects on the possible degradation or modification of topoisomerase inhibitors and the resulting effects with respect to these effects can be examined here. Topoisomerase inhibitors can activate recombination and act on cells before or after expression of, for example, resolvase, which can be readily detected by enzymes or marker proteins. The efficiency of each substance with respect to its inhibitory effect on topoisomerase is related to the activation of recombination.

Location-dependent and / or time-dependent activation of recombination can be performed by modulating resolvase expression. Location-dependent and / or time-dependent activation can also be performed by modulating the action of topoisomerase inhibitors on constitutive expression of wild-type resolvase.

A method in which a second DNA containing a wild-type resolvase gene is further introduced into cells is preferable. Particularly preferred is the method wherein the wild type resolvase is a wild type γδ-resolvase. The invention further relates to a eukaryotic cell containing two DNA sequences of SEQ ID NO: 1. Eukaryotic cells which additionally contain the wild-type resolvase gene, especially the wild-type γδ-resolvase, are preferred. The invention further relates to transgenic organisms such as plants or animals such as vertebrates such as fish, frogs or mammals or invertebrates such as insects such as earthworms or flies. The present invention further provides a zebrafish, wherein two tandem copies of res of SEQ ID NO: 1 and the resolvase gene, in particular the γδ-resolvase gene of SEQ ID NO: 3, have been incorporated into cells.
Transgenic organisms other than mammals, such as Caenorhabditis elegans or Drosophila melanogaster, and transgenic mammals such as transgenic monkeys, mice, rats, rabbits, hamsters, goats, cows, sheep or pigs. Regarding

Example 1. Expression and Preparation of Substrate Vector 1.1 Expression Vector γδ-Resolvase (pPGKγδ / pPGKγδ ^NLS ) and γδ- ^Resolvase Mutant γδ ^E124Q (pPGKγδ124 / pPGKγδ124NLS)
) And γδ ^{E102Y, E124Q} (pPGKγδ102 / pPGKγδ102NLS)
Is a derivative of pPGKcrebpa (K. Fel).
Lenberg, University of Cologne). The vector contains the phosphoglycerate kinase promoter (P-PGK) and the polyadenylation signal sequence of the small simian virus 40 (SV40) tumor antigen. PC
The γδ-resolvase gene cloned by R was ligated between these elements of the vector. The following primers were used for cloning of the resolvase gene: P-γδA: 5 ′ GATACTGCAGCATGCGACTTTTTGGTTACGCACGGGTATCA 3 ′ P-γδB: 5 ′ GATATCTAGATTAGTTGCTTTCATTTATTACTTTATA 3 ′ P-γδ124Q: 5 ′ CGACAGAGAATACTACAGCGanti-CTGA5CTGA5CTGA5CATGACTACGA5CATGACATACACTGAQCATCAATGAACT γδ 102Y: 5 ′ AGTACCGATGGGTATATGGGTAAAATGGTT 3 ′ P-γδ 102Y anti: 5 ′ AACCATTTTACCCATATACCCATCGGTACT 3 ′ P2972: 5 ′ CATATCTAGACTATTAAACCTTCCTCTTCTTCTTAGGGTTGCTTTCATT TATTACTTTATA 3 ′

Amplification of the wild-type resolvase gene in the absence and presence of the nuclear localization sequence (NLS) was determined by the first 94 ° C. (5 min) denaturation step and denaturation (9
5 ° C, 30 seconds), primer binding (56 ° C, 30 seconds) and DNA synthesis (72 ° C)
, 45 seconds) as one cycle for 28 cycles, and then the final synthesis step (72 ° C., 4
Min) for primers P-γδA and P-γδB and P297, respectively.
2 was used. Wrestling with PstI and XbaI (restri
The resulting PCR fragment was cleaved with the same enzyme, pPGKcre
The Cre gene of bpa was replaced.

Resolvase mutants were generated by assembly PCR. Here, in the first step of the assembly PCR, two γδ-resolvase gene fragments containing the desired mutation in the overlapping region were added in two separate PCR procedures,
Primers P-γδA and P-γδ124Qanti or P-γδ124Q
Alternatively, it was amplified with P-γδB and in the second stage of assembly PCR the fragment was used in equimolar amounts as template for the subsequent third PCR with primers P-γδA and P-γδB. Amplification consists in each case of the first 94 ° C (5 minutes) denaturation step and denaturation (95 ° C, 45 seconds), primer binding (60 ° C, 45 seconds) and DNA synthesis (72 ° C, 45 seconds) for one cycle. 30 cycles, followed by the final synthetic step (72 ° C., 6 minutes). In a similar manner, the second mutant E102Y was treated with the oligonucleotides P-γδA, P-γδ102Y, P-γδ1.
It was introduced into the gene together with 02Yanti and P-γδB. The mutant was then subjected to P with primers P-γδA and P2972 under the same reaction conditions.
CR provided NLS at the C-terminus of the protein.

1.2 Substrate vector The substrate vector is a derivative of pCH110 (Pharmacia). Here, the recombination cassette is under the control of the SV40 promoter, which ensures strong constitutive expression. In addition, the plasmid carries the polyadenylation signal sequence of the SV40 tumor antigen. Primers P-lacZ1 and P-lacZan
After PCR amplification with ti1, without a prokaryotic promoter, the β-galactosidase gene (lacZ) contained with the prokaryotic promoter in the starting vector was first cut with HindIII and BamHI for reinsertion. The first denaturation step (94 ° C, 5 min) was performed, followed by denaturation (94 ° C, 1 min), primer binding (56 ° C, 1 min) and DNA synthesis (72 ° C, 4 min) as one cycle. Thirty cycles, the last synthetic step (72 ° C., 10 minutes) was performed.

Then, the neomycin resistance gene was added to the vector pSV2Neo (Souther
n, P. J. Berg, P .; (1982) J. Am. Mol. Appl. Genet
． 1, pp. 327) and digested with restriction enzymes SmaI and Bg1II, and PCR
Flanked by the γδ-resolvase detection sequences produced by. These recombination sequences (res) are arranged in the same orientation in the construct.

Amplification of res was performed using primers P-RES1 and P-RESanti1 or P-RESanti2. It is the first denaturation step (94 ℃,
Starting from 5 minutes, denaturation (94 ° C., 30 seconds), primer binding (56 ° C., 30 seconds) and DNA synthesis (72 ° C., 30 seconds) were performed as 30 cycles, each of which was carried out for 30 cycles. This was followed by the final synthetic step (72 ° C., 4 minutes). The res located at the 5'end of the neomycin gene was ligated to the neomycin gene with BglII and the second res was connected to the 3'end of the gene by blunt end ligation. The obtained recombination cassette res-Neo-res was replaced with S
It was cloned into the substrate plasmid by the HindIII interface between the V40 promoter and the lacZ gene. The plasmid is designated pCH-RNRZ. The above oligonucleotides are listed below: P-lacZ1: 5 ′ GATAAAGCTTGCCGTAGATAAACAGGCTG 3 ′ P-lacZanti1: 5 ′ GATAGGATCCAGACATGATAAGATA 3 ′ P-RES1: 5 ′ GATAAAGCTTGGGCCCAAAAAGTCGCATAAAAATGTATCC 3 ′ P-RESanti1: 5 ′ GATAAGCAPTCACATT. 5 'GATAAAGCTTAACAATTTTGCAACCGTCCGA 3'

The plasmid pCH-RNRZ was transformed into Escherichia coli (Escheric) in vitro.
(Hia coli) strain DH5α cells (Hanahan, D.
1983) J. Mol. Biol. 166, pp. 557). Bacteria of this strain are distinguished by the fact that they carry an F'plasmid encoding a wild type γδ-resolvase. The formed recombinant plasmid pCH-RZ was used as a positive control in further experiments.

The plasmid pCH-RLNRLZ is a derivative of PCH-RNRZ, and was prepared by PCR with the following oligonucleotides: P-loxneo: 5 ′ TTGTTAGATCTATAACTTCGTATAGCATACATTATACGAAGTT ATAGCATGATTGAACAAGATGGATTG 3 ′ P-reslox: 5 ′ CGGCAAGCGTATAATACTACTAATAATCTAGTACATATGACATACATACATCATA.

The plasmid pCH-RNRZ (100 ng) was used as a template for PCR of these two oligonucleotides. The PCR conditions are 1.2. The same as described in the first paragraph of (Substrate vector). The PCR fragment was isolated by agarose gel electrophoresis and re-listed with the restriction enzymes HindIII and Bg1II (
resthed), pCH-RN cleaved with HindIII / Bg1II
Ligated to the RZ vector residue (Neo gene and second (3 ') r
pCH-RNRZ if the es sequence is not present). This allows SV40 and l
A recombination cassette resloxneoreslox (RLNR between the acZ genes
L) is obtained. Plasmid pCH-RLZ was generated by the in vivo recombination described for pCH-RZ.

The expression plasmid DNAs and pCH-RZ were subjected to E. coli (Escherich) by affinity chromatography (Qiagen, Germany).
ia coli) strain DH5α. The substrate plasmid pCH-RNRZ was transformed into Escherichia coli strain JC5547 (Willets).
, N .; S. Clark, A .; J. (1969) J. Bacteriol. , 1
00, pp. 231). Sequence control of all expression and substrate vectors and all PCR-generated products was performed by a fluorescence-based 373A DNA sequencing system (Applied Biosystems). The PCR reaction was performed using "Master Mix Q-kit" (Qiagen, G.
ermany). All DNAs were analyzed by agarose gel electrophoresis (0.8% -1.5% w / v) in TBE buffer.

2. Cell Culture and Construction of Reporter Cell Lines Transient expression and recombination analysis was performed using the hamster ovary cell line CHO (Puck).
, T. T. (1958) J. Exp. Med. , 108, pp. 945) and the human cervical cancer epithelial cell line HeLa (Geye, GO, et al. (19).
52) Cancer Res. , 12, pp 264). 10
% -Fetal bovine serum was added and α-containing streptomycin (0.1 mg / ml), penicillin (100 units / ml) and sodium pyruvate (1 mM).
HeLa cells were cultured in MEM (Life Technologies, Inc.). CHO cells were cultured in DMEM with the same additives but without sodium pyruvate.

A HeLa cell line incorporating pCH-RNRZ in its genome in a stable manner was constructed as follows: Approximately 20 μg of plasmid DNA was chained with BamHI, purified by phenol / chloroform extraction and precipitated with ethanol. Lipofect (
30 μl registered trademark Fugene 6, Boehringer Mannhei
m) was used to transfect approximately 5 × 10 ⁶ cells. 5 stable cell lines
00 μg / ml G418 / Geneticin (Life Technologies)
Screened and then characterized by PCR, DNA sequencing and Southern analysis.

3. In Vivo Recombination Assay To perform intramolecular recombination in vivo, approximately 1 × 10 ⁵ cells were treated with 3.5.
It was sown on a cm flat plate. After 24 hours, co-transfection of circular expression vector with helically coiled circular substrate plasmid in a 3: 1 ratio was performed according to the manufacturer's data (2 μg DNA; 3 μl Fugene) according to Lipofect® F
It was carried out using a Ugene 6 (Boehringer Mannheim). Β-Gal staining or β-Gal assay was performed after 24 hours to detect the resulting recombination. The reason is that in the recombinant state, the lacZ gene is SV4.
This is because it is directly transcribed and expressed by the 0 promoter and does not function with the first substrate due to the recombination cassette existing between them. After fixing the cells with 0.5% glutaraldehyde, a staining solution (5 mM K ₄ Fe (Cn ₆ ) / 3H ₂ O, 5 mM K ₃ Fe (Cn ₆ ), 2 mM MgCl ₂ , 4 mg / ml X-Gal was used. PBS
(In addition to the above) and then incubated at 37 ° C. for 7 to 8 hours to perform β-Gal staining. The number of blue-stained cells was determined under a microscope. The β-Gal assay reduced the amount to 33%, and according to the manufacturer's data, "
Galacto Light Kit "(Tropix, Perkin Elm
er). Lumat LB9 Relative Optical Units (RLUs)
Normalized to RLU / μg protein in cell lysates as measured by a 501 luminometer (Berthold, Germany).

To analyze the recombination of wild type γδ-resolvase after inhibition of topoisomerase I, the first 1 × 10 ⁵ cells were plated on 3.5 cm plates and transfected with 2 μg of the expression vector (pPGKγδNLS). To ensure full expression of the recombinase, cells were incubated for 72 hours before the addition of the topoisomerase inhibitor camptothecin (50 μg / ml). After incubation for 3 hours and medium exchange, co-transfection of pCH-RNRZ and expression vector at a 1: 1 ratio was performed. After a further 72 hours, β-Gal staining was performed as described above.

Recombinant analysis in the stable HeLa cell line (H5) was performed directly at the DNA level. For this, 5 × 10 ⁶ cells were plated on a 10 cm plate and after 24 hours 1
4 μg of the circular expression vector and 21 μl of the registered trademark Fugene 6 were transfected. 72 hours later, affinity chromatography (QIaam)
Cells were harvested for genomic DNA isolation according to the manufacturer's data by p Blood Kit; Qiqgen, Germany). Approximately 100-400 ng of genomic DNA was amplified by PCR in order to detect the neomycin resistance gene and complete res deletion caused by the segregation. 50 pmol of the following oligonucleotides were used for this purpose: P-SV40pra2: 5'ATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCAT 3'P-pCH-Seqanti: 5 'CAGAAGGCATCAGTCGGCTTGCG 3'

Amplification consisted of an initial denaturation step of 94 ° C. (5 min) and denaturation (94 ° C., 1 min), primer binding (63 ° C., 1 min) and DNA synthesis (72 ° C., 2 min) as one cycle. 34 cycles followed by a final synthesis step of 72 ° C. for 4 minutes. The amplified PCR products were separated by agarose gel electrophoresis and the recombinant products were eluted (
QIAquick Gel Extraction kit, Qiagen, G
), followed by sequencing. PC to verify the purity of the negative control
The R product was transferred to a nylon membrane by Southern hybridization, and ³² P-dA
Hybridized to the PCR product after recombination as a TP and ³² P-dCTP (Amersham) radiolabeled probe. Primer P-SVNeo1
And further PCR with P-SVNeo2 provided evidence of possible reversal products.

4. Western analysis Transiently transfected cell lysates (1) cells in sample buffer.
5 minutes) Prepared by boiling. Separated by molecular weight on a 12.5% SDS polyacrylamide gel and applied to a nitrocellulose membrane (Immobiligen P,
Moved to Millipore) overnight. 1% blocking solution (BM Chem
iluminescence Western Blotting Kit; B
Oehringer Mannheim, Germany) and incubated with a 1: 3000 dilution of mouse polyclonal antibody against γδ-resolvase (antibodies from N. Grindley, USA). The position of the resolvase on the membrane is determined by the secondary antibody (BM Chemilumine) conjugated to peroxidase.
science Western Blotting Kit; Boehring
er Mannheim, Germany). Purified γδ-resolvase was used as a control. kD marker (wide area marker, New Eng
land Biolabs) were used for size comparison.

5. Results 5.1 Synthesis of wild type and mutant γδ-resolvases in CHO cells To test whether γδ-resolvase or one of the mutants is able to catalyze the recombination of eukaryotic cells It is first necessary to prove that it can be synthesized by. The eukaryotic expression vector, pPGKγδ and its derivatives, containing the gene for the resolvase gene or its derivatives under the control of the PGK promoter, was used for this purpose. 72 hours after introducing the expression vector into CHO cells by lipofection, cell lysates were prepared and examined by Western analysis. Recombinase was detected by a mouse polyclonal antibody against wild type γδ-resolvase. PPGKCre expressing the Cre recombinase of phage P1 was introduced into cells as a control.

The results show that in the cells treated with the resolvase expression vector by lipofection, there is a protein with the expected molecular weight in each case. This protein was undetectable using the control vector pPGKCre.

5.2 Resolvase-Catalyzed Intramolecular Recombination in CHO and HeLa Cells Western analysis showed that the resolvase protein or its respective derivative was C
It is shown that each is synthesized from each expression vector in HO cells. CH
In order to test in O cells which of the various resolvase proteins can catalyze the recombination between two res sequences, the expression vector was transiently in each case together with the recombination substrate pCH-RNRZ. Inserted. SV4 by recombination
The DNA segment in front of the β-galactosidase gene expressed by the 0 promoter was deleted. Therefore, the success of the recombination event can be detected by measuring the enzymatic activity. In such co-transfection experiments, the C-terminal N
It was found that all mutated resolvase proteins, with or without LS, were able to carry out recombination with high efficiency. on the other hand,
Wild-type resolvase with or without NLS is inactive, ie recombination by this pathway is undetectable.

In yet another experiment, was the mutant γδ-resolvase ^{E102Y, E124Q} able to catalyze the recombination of a chain episomal substrate containing two complete res as tandem replicas? Was tested. The results show that this resolvase mutant catalyzes this reaction with high efficiency, exactly the same as that catalyzed by the recombinase Cre. However, these results indicate that the resolvase mutant is able to recombine with high efficiency a circular or morphologically chained episomal substrate containing two copies of the complete res sequence as tandem replicas, Finally, it means that the DNA segment localized between the res sequences is deleted.

A human reporter cell line (H5) was constructed to test whether the recombination substrate is recombined by resolvase or its derivatives as a stable component of the eukaryotic genome. This cell line contains a copy of the substrate vector (pCH-RNRZ) randomly integrated into the genome by non-homologous recombination. This has been previously proven by Southern analysis. About 72 hours after the introduction of each expression vector into the cell line H5, genomic DNA was isolated and the primer P-SV40 was isolated.
Attempts were made to detect recombination by PCR with pra and P-CHSeqanti followed by Southern analysis. PCR obtained with non-recombinant substrate
The two products can be separated from each other by agarose gel electrophoresis since the products are longer than those formed by the deletion of the neo gene by recombination. The results show that recombination occurs in the presence of the two resolvase mutants ^γδE124Q and ^{γδE102Y, E124Q} , and that wild-type γδ-resolvase (NLS is absent) -probably very low-activity is measured. Is shown.

The results to date show that both γδ-resolvase mutants are able to recombine both episomal and genomic substrates. No significant effect on the efficiency of recombination with NLS attached to the C-terminus was seen here. The very low activity of wild type γδ-resolvase is only detectable in cell line H5, but not in transient co-transfection experiments. This indicates that the morphological state of genomic or episomal intracellular DNA is predominantly relaxed or that wild-type γδ-resolvase is not activated.

5.3 Activation of Wild-type γδ-Resolvase by Topoisomerase Inhibitor Camptothecin Wild-type γδ-resolvase is activated by the action of the topoisomerase inhibitor camptothecin (CPT) that indirectly changes the morphological state of intracellular DNA. Expression vector pPG by lipofection in order to test whether it can be cloned
Kγδ was first introduced alone into HeLa cells. After 72 hours the cells were treated with CPT and after a further 3 hours the expression vector was introduced by lipofection with the substrate pCH-RNRZ into the cells pretreated in this way. 72 hours later, X-
Cells were stained by treatment with Gal. Blue cells indicate that the enzyme β-galactosidase is expressed intracellularly, indicating a successful recombination event. The results show that in the absence of CPT, recombination with wild-type γδ-resolvase does not occur in HeLa cells, but blue cells can be detected in all experiments by the action of CPT. In a control experiment, it was further established (not shown) that this effect was not solely due to CPT treatment of the cells per se (hence not shown), and therefore, as a result of the action of topoisomerase inhibitors on the morphological status of intracellular DNA, it was observed that wild type γδ-resolvase It can be proved that the recombination is activated.

[Brief description of drawings]

  The method of the present invention is illustrated by the following figures.

1A shows a schematic representation of the recombination reaction catalyzed by γδ-resolvase, and FIG. 1B shows γ.
6 shows a schematic of δ-res. (A) Circular, topologically relaxed DNA (black arrow) carrying two res as tandem replicas. By binding the resolvase dimer to each res, a synapse complex and a synaptosome are formed, and a DNA chain fragment is catalyzed (indicated by the tip of an open arrow). Both synapse formation and DNA strand exchange require negative supercoil stress of the DNA substrate. Strand exchange is followed by religation to release the recombinant product, the dimer once linked dimer of DNA. (B) shows the structure of res. It consists of three separate binding sites for each one of the resolvese dimers (illustrated by the opposite black arrows as the sequences of the respective halves and marked I-III). The distance between the centers of the three binding sites is given in base pairs (bp) and marked with a thin arrow at the bottom of res. The actual DNA strand exchange occurs during recombination in the center of binding site I (indicated by the tip of the open arrow).

FIG. 2A shows a schematic representation of the γδ-resolvase expression vector, and FIG. 2B shows a schematic representation of the product vector produced by recombination with the substrate vector. (A) Wild type γδ-resolvase (pPGKγδ) and its mutant γδ ^{E102Y, E124Q} (pPGK
2 shows eukaryotic expression vectors for γδ102) and γδ ^E124Q (pPGKγδ124). Mark the position and nature of each mutation in the resolvase gene. The wild type and the two mutants γδ ^{E102Y, E124Q} and γδ ^E124Q exist with and without the nuclear localization sequence (NLS) at the C-terminus of the gene, respectively. The gene is a phosphoglycerate kinase promoter (P-PG
K). This promoter is active in all eukaryotic cells examined so far. (B) shows a schematic of a substrate vector testing recombination in eukaryotic cells. pCH-RNRZ indicates a non-recombinant vector. In addition to the ampicillin resistance gene for amplification in Escherichia coli, it is an early S carrying recombination cassette consisting of res.
It contains the V40 promoter, the neomycin (Neo) resistance gene, res and the lacZ gene, which encodes β-galactosidase. The localization and orientation of each of the two PCR primers, P-SV40pra and P-Seqanti, are indicated by small arrows above and below the vector, respectively. Due to recombination between the two res, the Neo gene between them was deleted, the res copy was simultaneously deleted, and la
The cZ gene is expressed. The vector resulting from recombination is designated pCH-RZ. In addition, the recognition sites of the restriction enzyme BamHI related to both vectors are shown.

FIG. 3 shows a schematic of Western analysis. After introducing each of the indicated vectors into CHO cells, cell lysates are prepared and proteins are separated by molecular weight in SDS polyacrylamide gel electrophoresis. The presence of γδ-resolvase and its derivatives is
Visualization was performed with a mouse polyclonal antibody against wild type γδ-resolvase. The position of γδ-resolvase in the gel is indicated by an arrow. Lane 1, Cre vector control, Lane 2, purified resolvase control.

FIG. 4 Quantitative evaluation of transient co-transfection experiments in CHO cells. Separately from the substrate pCH-RNRZ, each γδ expression vector
It was introduced into O cells by lipofection. After 72 hours, the enzymatic activity of β-galactosidase was measured by photochemical reaction in cell lysates, normalized to the protein content of lysates and evaluated statistically. Each standard deviation of the mean is shown in the bar graph.

FIG. 5 schematically shows the deletions in the reporter cell line H5 revealed by Southern hybridization after performing a PCR and then separating the DNA molecules on an agarose gel (1.2% w / v). The Southern blot analysis of the PCR product obtained by each expression vector is shown. Display unrec. And rec. Is a non-recombinant vector (pCH-RNRZ) and a vector after recombination (pCH-RNR).
The position on the gel of the PCR product formed by Z) is indicated.

FIG. 6 shows a diagram of a quantitative evaluation of the effect of the topoisomerase inhibitor camptothecin on recombination by wild type γδ-resolvase. The term "transposon" as used herein refers to a mobile genetic element containing at least one recombinant sequence, a transposase and a resolvase, and of bacterial origin.

FIG. 7 shows a diagram of the quantitative evaluation of transient co-transfection experiments of CHO cells with a chain substrate vector in vitro. A bar graph with each standard deviation of the mean is shown. The substrate vector pCH-RLNRL, which is a derivative of pCH-RNRZ, which further contains two loxP sequences for recombination with Cre as tandem copies of the expression vectors of Cre and γδ-resolvase ^E102Y, E124Q.
CHO cells with Z were separately introduced by lipofection. Before lipofection, pCH-RLNRLZ is a restriction enzyme X that cuts the entire vector only once.
Chained with mnI. This was checked by agarose gel electrophoresis.
The enzymatic activity of β-galactosidase was measured photochemically in cell lysates after 72 hours, normalized to the protein content of the lysates and assessed statistically. As a negative control, a lambda integrase expression vector (pPGK
ssInth) was co-transfected (bars 3 and 6 from left). Recombinant in Escherichia coli, Cre (pPGK
Cre) or γδ-resolvase ^{102Y, E124Q} (pPGKγδNLS) expression vector co-transfected pCH-RLNRLZ (pCH
-RLZ) vector (bars 1 and 4) served as a positive control. pCH-R
Recombination between the loxP sequences of LNRLZ reveals β-galactosidase levels of approximately 65% of the positive control (see bars 1 and 2). Considerable recombination activity was observed between the res sequences when using γδ-resolvase ^{102Y, E124Q} (see bars 4 and 5).

[Sequence list]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 1/19 C12N 9/10 5/10 C12Q 1/02 9/10 C12N 15/00 ZNAA C12Q 1/02 5/00 B A F Term (Reference) 2B030 CA15 CA17 CA19 4B024 AA11 AA20 BA10 CA04 DA02 EA04 GA11 HA01 HA19 4B050 CC03 CC04 DD11 LL01 LL03 4B063 QA18 QQ08 QQ42 QR06 QR33 QS03 QS31 QX02 4B049 CA02A29AA90X AA90X AA90X

Claims (34)

[Claims] 1. A) introducing a first DNA sequence containing a res sequence into a cell, b) introducing a copy of the first DNA sequence into a cell, and c) sequence specific by the action of a resolvase. Sequence-specific recombination in eukaryotic cells, which comprises carrying out dynamic recombination. 2. The method of claim 1, wherein a copy of the first DNA sequence is introduced in tandem into the same DNA molecule. 3. The first DNA sequence contains the res sequence of SEQ ID NO: 1 or a derivative thereof or the res sequence of SEQ ID NO: 2 or a derivative thereof.
Or the method described in 2. 4. The method according to claim 1, wherein a second DNA sequence containing a resolvase gene is further introduced into the cell. 5. The method of claim 4, wherein the second DNA sequence further comprises a regulatory DNA sequence that affects location-dependent and / or time-dependent expression of the resolvase gene and the production of resolvase. Method. 6. The resolvase according to any one of claims 1 to 5, wherein the resolvase is a modified resolvase, preferably a relaxed substrate molecule, preferably a relaxed chain substrate molecule, capable of carrying out a resolvase recombination reaction. Method. 7. The resolvase is γδ-resolvase, preferably modified γδ.
Method according to any of claims 1 to 5, which is a resolvase, particularly preferably a modified γδ-resolvase capable of carrying out a resolvase recombination reaction on a relaxed substrate molecule. 8. The modified γδ-resolvase is the 80th to 140th amino acids, preferably 90 to 110, based on the number of the wild-type resolvase shown in SEQ ID NO: 4.
The following mutations are made in the segment of the th amino acid: (i) an acidic amino acid residue is replaced with an aromatic, hydrophilic or basic amino acid residue, (ii) a neutral amino acid residue is a hydrophilic amino acid residue Substituted with groups, and (iii) hydrophilic amino acid residues with neutral or acidic amino acid residues. 8. The method according to claim 7, having at least one, and preferably at least 2. 9. In the segment, Glu is replaced by Gln or Tyr, Asp is replaced by Ser, Ser is replaced by Asp, Gly is S.
er, Asp is replaced with Ala, and / or Glu is replaced with A
9. The method of claim 8, wherein the method is replaced with rg. 10. The method of claim 8 or 9, wherein the modified γδ-resolvase has at least two mutations in the segment. 11. The method according to claim 7, wherein the modified γδ-resolvase is γδ-resolvase ^E124Q or γδ-resolvase ^{E102Y, E124Q} . 12. Integration of a first DNA sequence and / or a copy of the first DNA sequence into the genome of a eukaryotic cell by homologous recombination by integration of the first DNA sequence and / or a copy of the first DNA sequence. The method according to any one of claims 1 to 11, further comprising a res sequence that further contains a DNA sequence that affects A. 13. A method according to any one of claims 1 to 12, wherein the first DNA sequence and / or a copy of the first DNA sequence contains a res sequence which further contains a nucleic acid sequence encoding a polypeptide of interest. The method described in. 14. The method of claim 13, wherein the polypeptide of interest is a structural protein, an endogenous or exogenous enzyme, a regulatory protein or a marker protein. 15. The method according to claim 1, wherein the eukaryotic cell is a zebrafish cell, Caenorhabditis elegans, Drosophila melanogaster, or a mammalian cell. 16. The mammalian cell is a human cell or monkey, mouse, rat,
A rabbit, hamster, goat, cow, sheep or pig cell.
The method according to 5. 17. Use of the res sequence of SEQ ID NO: 1 or a derivative thereof or the res sequence of SEQ ID NO: 2 or a derivative thereof in sequence-specific recombination of DNA in eukaryotic cells. 18. Based on the number of wild-type resolverase shown in SEQ ID NO: 4, 8
The following mutations in the segment of amino acids 0 to 140, preferably 90 to 110, (i) acidic amino acid residues are replaced with aromatic, hydrophilic or basic amino acid residues, (ii) ) At least one neutral amino acid residue is replaced by a hydrophilic amino acid residue, and (iii) at least one hydrophilic amino acid residue is replaced by a neutral or acidic amino acid residue, preferably at least 2 Modified γδ-resolvase in which Glu at position 124 based on the number of the wild-type resolvase shown in SEQ ID NO: 4 is not replaced with Gln when only one is modified. 19. In the segment, Glu is replaced by Gln or Tyr, Asp is replaced by Ser, Ser is replaced by Asp, Gly is replaced by Ser, Asp is replaced by Ala. And / or Glu is replaced by Arg. The modified γδ-resolvase of claim 18. 20. The modified γδ-resolvase according to claim 18 or 19, which has the amino acid sequence of SEQ ID NO: 6 or a derivative thereof. 21. Modified γδ defined in any one of claims 18 to 20.
A nucleic acid sequence encoding a resolvase or a derivative thereof. 22. The nucleic acid sequence of claim 21, which is the nucleic acid sequence of SEQ ID NO: 5. 23. Use of the nucleic acid sequence according to claim 21 or 22 and / or the resolvase according to any of claims 18 to 20 in sequence-specific recombination of DNA in eukaryotic cells. 24. A method of testing a topoisomerase inhibitor in a eukaryotic cell, comprising the steps of: a) introducing a first DNA sequence of SEQ ID NO: 1 into the cell; and b) a first DNA sequence of SEQ ID NO: 1. A method comprising the steps of: introducing tandem copies into cells in a tandem direction; c) introducing wild-type resolvase; and d) adding a topoisomerase inhibitor to be tested. 25. The method of claim 24, wherein a second DNA sequence containing the wild-type resolvase gene is further introduced into the cell. 26. The method of claim 25, wherein the second DNA sequence further comprises a regulatory DNA sequence that affects location-dependent and / or time-dependent expression of the resolvase gene. 27. The first DNA sequence and / or a copy of the first DNA sequence is recombined into the genome of a eukaryotic cell by recombination.
27. The method of any of claims 24-26, further comprising a DNA sequence that affects the integration of a copy of the DNA sequence of. 28. The method according to any of claims 24-27, wherein the first DNA sequence and / or a copy of the first DNA sequence further comprises a nucleic acid sequence encoding a polypeptide of interest. 29. The polypeptide of interest is a structural protein, an endogenous or exogenous enzyme, a regulatory protein or a marker protein.
The method according to 8. 30. A eukaryotic cell containing two DNA sequences of SEQ ID NO: 1 or SEQ ID NO: 2 and optionally a resolvase gene. 31. The resolvase gene is a wild-type resolvase, γδ-
The eukaryotic cell according to claim 30, which is resolvase, γδ-resolvase ^E124Q or γδ-resolvase ^{E102Y, E124Q} . 32. A kit for testing a topoisomerase inhibitor in a eukaryotic cell, which comprises the eukaryotic cell according to claim 30 or 31. 33. A transgenic organism containing the res sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and / or the resolvase gene of SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 or a derivative thereof. 34. Claims 1, 12, 15 to 17, 23 to 25, 27 and 3
A eukaryotic cell obtainable by carrying out the method according to any one of claims 1 to 16 or claims 24 to 29 on the eukaryotic cell according to 0 and 31.