AU7826301A - Effector proteins of rapamycin - Google Patents

Description

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: The Trustees of Columbia University in the City of New York and American Home Products Corporation Actual Inventor(s): Katherine Molnar-Kimber, Amedeo Failli, Thomas Joseph Caggiano, KOJI NAKANISHI, YANQIU CHEN Address for Service: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: EFFECTOR PROTEINS OF RAPAMYCIN Our Ref: 654213 POF Code: 794/1481, 64292 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1- 2 EFFECTOR PROTEINS OF RAPAMYCIN This application is a divisional application of Australian Patent Application 17390/99, which in turn is a divisional of Australian Patent Application 13670/95, the entire contents of both of which are herein incorporated by reference.

This invention concerns effector proteins of Rapamycin. More particularly, this invention concerns novel Rapamycin-FKBP12 binding proteins of mammalian origin for identification, design and synthesis of immunomodulatory, anti-restenosis or anti-tumor agents.

BACKGROUND OF THE INVENTION Rapamycin is a macrolide antibiotic produced by Streptomyces hygroscopicus which was first characterized via its properties as an antifungal agent. It adversely affects the growth of fungi such as Candida albicans and Microsporum gypseum. Rapamycin, its preparation and its antibiotic activity were described in U.S. Patent No. 3,929,992, issued December 30, 1975 to Surendra Sehgal et al. In 1977 Martel, R. R. et al. reported on immunosuppressive properties of rapamycin against experimental allergic encephalitis and adjuvant arthritis in the Canadian Journal of Physiological Pharmacology, 55, 48-51 (1977). In 1989, Calne, R. Y. et al., in Lancet, 1989, no. 2, p. 227 and Morris, R. E. and Meiser, B. M. in Medicinal Science Research, 1989, No. 17, P. 609-10, separately reported on the effectiveness of rapamycin in inhibiting rejection in vivo in allograft transplantation. Numerous articles have followed describing the immunosuppressive and rejection inhibiting properties of rapamycin, and clinical investigation has begun for the use of rapamycin in inhibiting rejection in transplantation in man.

Rapamycin alone Patent 4,885,171) or in combination with picibanil Patent 4,401,653) has been shown to have antitumor activity. R. R. Martel et al. [Can. J. Physiol. Pharmacol. 55, 48 (1977)] disclosed that W:\~~skank[\speies)div 17390-99.doc -3rapamycin is effective in the experimental allergic encephalomyelitis model, a model for multiple sclerosis; in the adjuvant arthritis model, a model for rheumatoid arthritis; and effectively inhibited the formation of IgE-like antibodies.

The immunosuppressive effects of rapamycin have been disclosed in FASEB 3, 3411 (1989). Cyclosporin A and FK-506, other macrocyclic molecules, also have been shown to be effective as immunosuppressive agents, therefore useful in preventing transplant rejection [FASEB 3, 3411 (1989); FASEB 3, 5256 (1989); R. Y. Calne et al., Lancet 1183 (1978); and U.S. Patent 5,100,899].

Rapamycin has also been shown to be useful in preventing or treating systemic lupus erythematosus Patent 5,078,999], pulmonary inflammation Patent 5,080,899], insulin dependent diabetes mellitus [Fifth Int. Conf.

Inflamm. Res. Assoc. 121 (Abstract), (1990)], and smooth muscle cell proliferation and intimal thickening following vascular injury [Morris, R. J. Heart Lung Transplant 11 (pt. 197 (1992)].

20 Mono- and diacylated derivatives of rapamycin (esterified at the 28 and 43 positions) have been shown to be useful as antifungal agents Patent 4,316,885) and used to make water soluble prodrugs of rapamycin Patent 4,650,803). Recently, the numbering convention for rapamycin has been changed; therefore according to Chemical Abstracts nomenclature, the esters 25 described above would be at the 31- and 42- positions. U.S. Patent 5,118,678 discloses carbamates of rapamycin that are useful as immunosuppressive, antiinflammatory, antifungal, and antitumor agents. U.S. Patent 5,100,883 discloses fluorinated esters of rapamycin. U.S. Patent 5,118,677 discloses amide esters of rapamycin. U.S. Patent 5,130,307 discloses aminoesters of 30 rapamycin. U.S. Patent 5,117,203 discloses sulfonates and sulfamates of rapamycin. U.S. Patent 5,194,447 discloses sulfonylcarbamates of rapamycin.

C:,WINVWORDENNYWMSPECNKAi13670DIV.DOC U.S. Patent No. 5,100,899 (Calne) discloses methods of inhibiting transplant rejection in mammals using rapamycin and derivatives and prodrugs thereof. Other chemotherapeutic agents listed for use with rapamycin are azathioprine, corticosteroids, cyclosporin (and cyclosporin and FK-506, or any combination thereof.

Rapamycin produces immunosuppressive effects by blocking intracellular signal transduction. Rapamycin appears to interfere with a calcium independent signalling cascade in T cells and mast cells [Schreiber et al. (1992) Tetrahedron 48:2545-2558]. Rapamycin has been shown to bind to certain immunophilins which are members of the FK-506 binding proteins (FKBP) family. In particular, Rapamycin has been shown to bind to the binding proteins, FKBP12, FKBP13, FKBP25 [Galat A. et al., (1992) Biochemistry 31(8);2427-2437 and Ferrera A, et al., (1992) Gene 113(1):125-127; Armistead and Harding, Ann. Reports in Med. Chem. 28:207-215, 1993], and FKBP52 [WO 93/07269].

Rapamycin is able to inhibit mitogen-induced T cell and B cell proliferation as well as proliferation induced by several cytokines, including IL-2, 20 IL-3, IL-4 and IL-6 (reviewed by Sehgal et al., Med. Research Rev. 14: 1-22, 1994). It can also inhibit antibody production. Rapamycin has been shown to °i block the cytokine-induced activation of p70S6 kinase which appears to correlate with Rapamycin's ability to decrease protein synthesis accompanying cell cycle progression (Calvo et al., Proc. Natl. Acad. Sci. USA, 89:7571-7575, 25 1992; Chung et al., Cell 69:1227-1236, 1992; Kuo et al., Nature 358:70-73, 1992; Price et al., Science 257:973-977, 1992). It also inhibits the activation of cdk2/cyclin E complex (Flanagan et al., Ann. N.Y. Acad. Sci, in press; Flanagan et al. Mol. Cell Biol., in press; Flanagan et al., J.Cell Biochem. 17A:292, 1993).

Rapamycin's effects are not mediated by direct binding to p70s 6 kinase and 30 cdk2/cyclin E, but by action of the Rapamycin-FKBP complex on upstream component(s) which regulate the activation status of the kinases.

C-:WINWORDLUENNYMSPECNKI\13670ODV.DOC It is generally accepted that the action of immunosuppressive drugs, such as Rapamycin, cyclosporine and FK506, is dependent upon the formation of a complex with their respective intracellular receptor proteins called immunophilins. While the binding of these immunosuppressants with their respective immunophilins inhibits the cis-trans peptidyl prolyl isomerase (PPIase) activity of immunophilins, PPIase inhibition is not sufficient to mediate the immunosuppressive activity (reviewed in Armistead and Harding, Annual Reports in Med. Chem, 28:207-215:1993). Two rapamycin analogs which are Diels Alder adducts, one with 4-phenyl-1,2,4-triazoline-3,5-dione, and the second with 4-methyl-1,2,4-triazoline-3,5-dione, bind to FKBP, inhibited its PPIase activity, yet they did not exhibit any detectable immunosuppressive activity. The phenyl-triazolinedione Diels Alder adduct at high molar excess has been shown to competitively inhibit rapamycin's effect on DNA synthesis in mitogen-stimulated murine thymocyte proliferation (Ocain et al., Biochem.

Biophys. Res. Commun. 192:1340, 1993). Recent evidence suggests that the binary immunophilin-drug complex such as cyclophilin-cyclosporin A and FKBP- FK506 gains a new function that enables it to block signal transduction by acting on specific target proteins. The molecular target of both cyclophilincyclosporin A and FKBP-FK506 complexes such as has been identified as the 20 Ca+2/calmodulin dependent serine/threonine phosphatase calcineurin Liu et al, Cell 66, 807, 1991; J. Liu et al, Biochemistry 31, 3896, 1992; W.M.

Flanagan, et al., Nature 352, 803, 1992; McCaffrey et al., J. Biol. Chem. 268, 3747, 1993; McCaffrey et al., Science 262:750, 1993).

25 Rapamycin's antifungal and immunosuppressive activities are mediated via a complex consisting of Rapamycin, a member of the FK506 binding protein (FKBP) family and at least one additional third protein, called the target of Rapamycin (TOR). The family of FKBPs is reviewed by Armistead and Harding (Annual Reports in Med. Chem, 28:207-215:1993). The relevant FKBP 30 molecule in Rapamycin's antifungal activity has been shown to be FKBP12 (Heitman et al., Science 253:905-909:1993). In mammalian cells, the relevant FKBPs are being investigated. Although two TOR proteins (TOR1 and TOR2) C:\WINWOROUENNYMSPECNK\13 7001V.OOC -6have been identified in yeast (Kunz et al., Cell 73:585-596:1993), the target of Rapamycin in human cells remains elusive. The carboxy terminus of yeast TOR2 has been shown to exhibit 20% identity with two proteins, the p110 subunit of phosphatidylinositol 3-kinase and VPS34, a yeast vacuolar sorting protein also shown to have PI 3K activity. However, J. Blenis et al. (AAI meeting, May, 1993) have reported that Rapamycin-FKBP12 complex does not directly mediate its effects on PDGF stimulated cells via the p110, p85 PI 3K complex.

Throughout the description and claims of the specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps.

DESCRIPTION OF THE INVENTION In one aspect this invention provides a protein of mammalian origin having a molecular weight of from about 50 kDa to 800 kDa which binds to a GST-FKBP-Rapamycin complex, or a fragment of such a protein.

In a further aspect this invention provides isolated, cloned and expressed 20 proteins which bind to a complex of GST-FKBP12-Rapamycin (GST denotes glutathione-s-transferase). These proteins are isolated from membrane preparations of Molt 4 T cell leukemia. The sizes of the four novel proteins are estimated by PAGE migration to be 125±12 kilodaltons (kDa), 148±14 kDa, 208±15 kDa and 210±20 kDa and will be referred to herein and in the claims that follow, as 25 the 125 kDa, 148 kDa, 208 kDa, and 210 kDa, respectively. The four proteins may also be referred to herein as effector proteins.

The proteins of this invention can be used in screening assays, such as enzyme inhibitor assays and binding assays, to identify endogenous complexes 30 and ligands and novel exogenous compounds (like Rapamycin) which modulate their functions. They can also be used in assays to identify compounds with therapeutic benefit for C:,WNWORDIDENNYM\SPECNKI\1367001V.DOC restenosis, immunomodulation and as antitumor agents. Cloning the proteins of this invention does not only allow the production of large quantities of the proteins, it also provides a basis for the development of related anti-sense therapeutics. The use of cDNA clones to generate anti-sense therapeutics with immunomodulatory activity (for use against transplantation rejection, graft versus host disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, rheumatoid arthritis, type I diabetes, and diseases of inflammation such as psoriasis,dermatitis, eczema, seborrhea, inflammatory bowel disease, pulmonary inflammation, asthma, and eye uveitis), antirestenosis and anti-tumor activity is included within the scope of this invention.

The proteins of the present invention can be isolated from mammalian cells, such as cells of the T cell leukemia cell line, Molt 4 (ATCC 1582, American Type Cell Culture, 12301 Parklawn Drive, Rockville, MD, USA, 20852), the B cell lymphoma, BJAB, or normal human T cells. These mammalian cells can be lysed in a buffer containing protease inhibitors and reducing agent such as hypotonic buffer A (100 mM HEPES, pH 7.5, 20 mM KC1, 1 mM EDTA, 0.4 mM PMSF and 2 mM beta mercaptoethanol The cell nuclei and unbroken cells are cleared by centrifugation at a temperature which minimizes protein degradation. The membrane fraction of the cells can then be concentrated or pelleted by ultracentrifugation at 20 100,000 g. Detergent solubilization of the membrane pellet is carried out in a detergent containing buffer such as buffer B (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 0.2 mM-PMSF, 1 mM 2-ME, 2 mM CaCl 2 2 mM MgCI 2 5 gg/ml aprotinin, leupeptin, pepstatin A and antipain), containing CHAPSO (3-[(3-cholamidopropyl)dimethylammonio]- -propane sulfonate; 12 mM) or Triton X100 (polyethylene 25 glycol 4-isooctylphenyl ether). The solubilized membrane proteins can then be separated from the debris by 100,000g ultracentrifugation at a temperature which minimizes protein degradation. The supernatant containing solubilized membrane proteins is then preabsorbed with an affinity resin, such as glutathione resin, in the presence of protease inhibitors at a temperature which minimizes protein degradation..

30 After centrifugation to remove the resin from the supernatant, the supernatant is then incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST- FKBP12--Rapamycin at a temperature which minimizes protein degradation. The mixture of solubilized membrane proteins, incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST-FKBPl2--Rapamycin, can then be -8incubated with the affinity resin to bind the complexes of rapamycin or rapamycin analog, FKBP fusion protein and binding proteins at a temperature which minimizes protein degradation. After most non-specific proteins are rinsed away using a detergent containing buffer, such as Buffer C (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 0.2 mM PMSF, 1 mM 2-ME or 10 mM dithiothreitol, 0-5 mM CaCI2, 0-5 mM MgCI 2 5 ,gg/ml aprotinin, leupeptin, pepstatin A and antipain and 0.1% Triton X100) (Polyethylene glycol 4-isooctyl phenyl ether), the proteins are eluted from the resin under denaturing conditions, such as a buffer containing sufficient detergent to dissociate it from resin Laemli buffer with or without glycerol or dye, as described by Laemli, Nature 227:680, 1970), or non-denaturing conditions such as a buffer containing an appropriate eluting compound for the affinity column, such as mM glutathione. The proteins can then be separated by size using SDS polyacrylamide gel electrophoresis (SDS-PAGE).

The present invention also includes the genomic DNA sequences for the abovementioned proteins, as well as the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the abovementioned proteins. The present invention further includes the proteins of other mammalian species which are homologous or equivalent at least in function to the abovementioned proteins, as well 20 as the DNA gene sequences for the homologous or equivalent proteins and the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the "homologous or equivalent proteins.

For the purposes of this disclosure and the claims that follow, equivalents of the S 25 proteins of this invention are considered to be proteins, protein fragments and/or truncated forms with substantially similar, but not identical, amino acid sequences to the proteins mentioned above, the equivalents exhibiting rapamycin-FKBP complex binding characteristics and function similar to the proteins mentioned above.

Therefore, in this specification and the claims below, references to the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins of this invention are also to be understood to indicate and encompass homologous or equivalent proteins, as well as fragmented and/or truncated forms with substantially similar, but not identical, amino acid sequences of the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins mentioned above.

-9- These proteins or protein homologues or equivalents can be generated by similar isolation procedures from different cell types and/or by recombinant DNA methods and may be modified by techniques including site directed mutagenesis. For example, the genes of this invention can be engineered to express one or all of the proteins as a fusion protein with the fusion partner giving an advantage in isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, FLAG etc).

Mutations or truncations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.

This invention further includes oligopeptide fragments, truncated forms and protein fragments that retain binding affinity yet have less than the active protein's amino acid sequences. This invention also includes monoclonal and polyclonal antibodies specific for the proteins and their uses. Such uses include methods for screening for novel agents for immunomodulation and/or anti-tumor activity and methods of measuring the parent compound and/or nietabolites in biological samples obtained from individuals taking immunosuppressive drugs. The use of the cDNA clone to generate anti-sense therapeutics (Milligan et al, J. Med. Chem. 36:1923-1936, 1993) with immunomodulatory activity (transplantation rejection, graft versus host disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, 20 rheumatoid arthritis, type I diabetes, and diseases of inflammmation such as psoriasis, dermatLtisczema, seborrhea, inflammatory bowel disease, pulmonary inflammation, asthma..and eye uveitis), and anti-tumor activity is also included in the present invention.

The proteins of this invention can also be made by recombinant DNA Stechniques familiar to those skilled in the art. That is, the gene of the protein in question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with a protease, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical Guide to Protein and Peptide Purification for Microsequencing, Academic Press (San Diego, CA, 1989)). The determined sequence can then be used to make oligonucleotide probes which can be used to screen a human cDNA library directly or generate probes by polymerase chain reaction. The library can be generated from human T cells or the cell lines, Molt 4, Jurkat, or other etc. to obtain clones. These clones can be used to identify additional clones containing additional sequences until the protein's full gene, i.e. complete open reading frame, is cloned.

It is known in the art that some proteins can be encoded by an open reading frame which is longer than initially predicted by the size of the protein. These proteins may represent cleavage products of the precursor protein translated from the complete open reading frame (eg. IL-1 beta) or proteins translated using a downstream start codon (eg. HepatitisB surface antigen). In view of this knowledge, it is understood that the term cDNA as used herein and in the claims below refers to cDNA for the gene's complete open reading frame or any portions thereof which may code for a protein of this invention or the protein's fragments, together or separate, or truncated forms, as previously discussed.

In a complementary strategy, the gene(s) for the proteins of this invention may be identified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning. These strategies can also be combined to quicken the identification of the clones.

The relevant cDNA clone encoding the gene for any of the four proteins can 20 also be expressed in E. coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion partner giving an advantage in ~isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc).

Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.

The uses of such cDNA clones include production of recombinant proteins.

Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers) are useful in generation of antibodies to these proteins. Briefly, monoclonal or polyclonal antibodies are induced by immunization with recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers conjugated to a carrier protein keyhole limpet hemocyanin or bovine serum albumin)) of animals using state of the art techniques. The antibodies can be -11used in the purification process of the natural proteins isolated from mammalian cells or recombinant proteins from E. coli, yeast, or baculovirus infected cells or mammalian cells, or cell products.

The uses of such cDNA clones include production of recombinant proteins.

Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, are useful in methods of screening for novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates for immunomodulation and/or antitumor activity. The natural products which may be screened may include, but are not limited to, cell lysates, cell supernatants, plant extracts and the natural broths of fungi or bacteria. As an example of a competitive binding assay, one of these proteins attached to a matrix (either covalently or noncovalently) can be incubated with a buffer containing the compounds, natural products, cell lysates or cell superatants and a labeled rapamycin:FKBP complex. The ability of the compound, natural products, exogenous or endogenous substrates to competitively inhibit the binding of the complex or specific antibody can be assessed.

Examples of methods for labeling the complex include radiolabeling, fluorescent or chemiluminescent tags, fusion proteins with FKBP such as luciferase, and conjugation to enzymes such as horse radish peroxidase, alkaline phosphatase, acetylcholine 20 esterase (ACHE), etc. As an example of an enzymatic assay, the proteins are incubated in the presence or absence of novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates with substrate and the enzymatic activity of the protein can be assessed. Methods of measuring the parent compound and/or metabolites in biological samples obtained from individuals taking immunosuppressive drugs can also be assessed using these proteins.

This invention includes a method for identifying substances which may be useful as immunomodulatory agents or anti-tumor agents, the method utilizing the following steps: a) combining the substance to be tested with one of the four mammalian proteins (125 kDa, 148kDa, 208 kDa or 210 kDa) of this invention, with the protein being bound to a solid support: -12b) maintaining the substance to b t tested and the protein bound to the solid support of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether binding of the substance to be tested occurred in step This invention also includes a method for identifying substances which may be useful as immunomodulatory or anti-tumor agents which involves the following steps: a) combining a substance to be tested with one of the mammalian proteins of this invention, the protein being bound to a solid support: b) maintaining the substance to be tested and the protein bound to the solid support of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether the presence of the substance to be tested modulated the activity of the mammalian protein.

This invention further includes a method for detecting, in a biological sample, rapamycin, rapamycin analogs or rapamycin metabolites which, when complexed with a FKBP, bind to one of the four listed proteins of this invention, the meth-od comprising the steps of: a) combining the biological sample with a FKBP to form a first mixture containing, if rapamycin, rapamycin analogs or rapamycin metabolites are present in the biological sample, a rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes; b) creating a second mixture by adding the first mixture to one of the proteins of this invention, the protein bound to a solid support -13c) maintaining the second mixture of step under conditions appropriate for binding the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, orriapamycin metabolite:FKBP complexes, if present, to the protein of this invention; and d) determining whether binding of the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes and the protein occurred in step Also included in this invention is the use of the cDNA clones to generate antisense therapeutics. This can be accomplished by using state of the art techniques, such as those described in Milligan et al, J. Med. Chem. 36:14:1924-1936. For the purposes of this disclosure and the claims that follow, antisense RNA and DNA are understood to include those RNA and DNA strands derived from a cDNA clone which encodes for one of the four proteins (125 kDa, 148 kDa, 208 kDa or 210 kDa) of the present invention which have a native backbone or those which utilize a modified backbone. Such modifications of the RNA and DNA backbones are described in Milligan et al, J. Med. Chem. 36:14:1924-1936. The antisense compounds created by the state of the art techniques recently described (Milligan et al, J. Med. Chem.

20 36:14:1924-1936) can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as luptis, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and 25 diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis. The antisense molecules of this invention can have antitumor, antifungal activities, and antiproliferative activities. The compounds of this invention therefore can be also useful in treating solid tumors, adult 4 T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases such as restenosis and atherosclerosis. Thus, the present invention also comprises methods for treating the abovementioned maladies and conditions in mammals, preferably in humans. The method comprises administering to a mammal in need thereof an effective amount of the relevant antisense therapeutic agent of this invention.

-14- When administered for the treatment or inhibition of the above disease states, the antisense molecules of this invention can be administered to a mammal orally, parenterally, intranasally, intrabronchially, transdermally, topically, intravaginally, or rectally.

It is contemplated that when the antisense molecules of this invention are used as an immunosuppressive or antiinflammatory agent, they can be administered in conjunction with one or more other immunoregulatory agents. Such other immunoregulatory agents include, but are not limited to azathioprine, corticosteroids, such as prednisone and methylprednisolone, cyclophosphamide, rapamycin, cyclosporin A, FK-506, OKT-3, and ATG. By combining the complexes of this invention with such other drugs or agents for inducing immunosuppression or treating inflammatory conditions, the lesser amounts of each of the agents are required to achieve the desired effect. The basis for such combination therapy was established by Stepkowski whose results showed that the use of a combination of rapamycin and cyclosporin A at subtherapeutic doses significantly prolonged heart allograft survival time. [Transplantation Proc. 23: 507 (1991)].

Treatment with these antisense compounds will generally be initiated with small 20 dosages less than the optimum dose of the compound. Thereafter the dosage is increased until the optimum effect under the circumstances is reached. Precise dosages will be determined by the administering physician based on experience with the individual subject treated. In general, the antisense compounds of this invention are most desirably administered at a concentration that will afford effective results without 25 causing any harmful or deleterious side effects.

In light of the therapeutic value of the abovementioned antisense compounds, this invention also includes pharmaceutical compositions containing the antisense RNA and antisense DNA compounds derived from cDNA clones which encode for the 125 kDa, 148 kDa, 208 kDa and 210 kDa proteins of this invention.

This invention also comprises the following process for isolating the proteins of this invention, as well as the proteins isolated therefrom: A process for isolating proteins from mammalian cells, the process comprising the steps of: 1. The mammalian cells of interest are grown and harvested. As mentioned previously, the cells may be of T cell origin T cell lymphomas, leukemias, normal human T cells), B cell origin EBV transformed B cells, normal human B cells), mast cells, or other cell sources sensitive to rapamycin. The cells may be processed shortly after harvesting or may be stored frozen, such as in pellets, prior to processing. The cells which are kept frozen may be stored in a dry ice and ethanol bath, stored frozen at -70-80' C until use. This step of growing and harvesting the cells of interest may be seen as the first step of this process or as merely preparatory for the present process.

2. Cells are lysed in a buffer containing a buffering agent (e.g.HEPES, Tris, pH low salt (e.g.10 -50 mM NaCI or KCI), chelating agent 1-2 mM EDTA), protease inhibitors (e.g.0.4 mM PMSF) and a reducing agent 2 mM 2-ME or 1-20 mM Dithiothreitol) at a temperature which minimizes protein degradation 4 It should be understood that the mammalian cells may be treated in any manner capable of producing cell lysis, including sonic lysis and 20 douncing.

3. Unbroken cells and cell nuclei are precleared from lysates by centrifugation at a temperature which minimizes protein degradation 4 Centrifugation at, for example, 1600g for 10 minutes has been found sufficient to 25 preclear the unbroken cells and cell nuclei from the lysates. This step, while not mandatory, provides a clearer preparation for the steps that follow.

4. The membrane fraction in the precleared lysate is then S concentrated, such as by ultracentrifugation. An example of this concentration would be ultracentrifugation at 100,000 g for 1-1.5 hours.

The membrane proteins transmembrane, integral and membrane associated proteins) are then solubilized. This may be accomplished by incubating the pellet of Step 4 in a buffer containing a detergent which solubilizes the -16proteins without detrimentally denaturing them, a buffering agent 20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI 20 mM KC1), reducing agent 1-2 mM 2-ME or 1 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 gg/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations 0- 5 mM CaCl 2 0-5 mM MgC1 2 at a temperature which minimizes protein degradation 4* C) Examples of detergents useful in this step are CHAPSO cholamidopropyl)dimethylammonio]-l-propane sulfonate) or Triton X 00 (polyethylene glycol 4-isooctylphenyl ether). After this step, the mixture contains solubilized membrane proteins and non-solubilized cellular debris.

6. The solubilized membrane proteins are separated from the nonsolubilized cellular debris, such as by ultracentrifugation (eg 100,000g for 1-1.5 hours) at a temperature which minimizes protein degradation 4 7. The supernatant containing solubilized membrane proteins is incubated with an affinity resin in a buffer containing a buffering agent (e.g.20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI 20 mM KCI), reducing agent 1-2 mM 2-ME or 10 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 pg/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations 20 0-5 mM CaCI 2 0-5 mM MgCI 2 at a temperature and time which allows the absorption of the proteins which bind to affinity resin directly, and minimizes protein degradation 4 8. The resin is then removed from the supernatant by centrifigation 25 at a temperature which minimizes protein degradation 4 9. The supernatant is then incubated with Rapamycin or Rapamycin analog (IC50 in LAF 500nM) complexed to fusion protein of FKBP12 +protein which enhances the isolation of the desired effector protein and through which the fusion protein binds to an affinity resin or affinity column, such as GST-FKBP12, Histidine oligomer -FKBP12, biotin-FKBP12, etc., in a buffer containing a buffering agent 20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI mM KCI), reducing agent 1-2 mM 2-ME or I 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 tg/ml aprotinin, leupeptin, pepstatin A and antipain), -17divalent cations 0-5 mM CaCI 2 0-5 mM MgCI 2 at a temperature and for a time which allows binding of the effector proteins to the fusion FKBP protein:Rapamycin or analog complexes and minimizes protein degradation 4 'C and 1-2 hours).

10. The mixture of Step 9 containing the effector proteins and fusion FKBP protein:Rapamycin complexes is incubated with an affinity resin at a temperature and for a time which allows binding of the complexes of the effector proteins and fusion FKBP protein:Rapamycin or analog to the affinity resin and minimizes protein degradation 4 'C and 0.5-2 hours).

11. Most non-specific proteins are rinsed away from the resin using a buffer which dissociates binding of non-specific proteins but not the complex between the desired proteins and RAPA-FKBP, such as a buffer containing a buffering agent (e.g.20-50 mM Tris or HEPES, pH salts 100 1000 mM NaCI, KCI), reducing agent 1-2 mM 2-ME or 10 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 gg/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations 0-5 mM CaCI 2 0-5 mM MgCI 2 and detergent which dissociates binding :of non-specific proteins but not the complex between the four proteins and RAPAfusion FKBP protein such as Triton X100 (Polyethylene glycol 4-isooctyl phenyl 20 ether).

12. The effector proteins and the fusion FKBP protein:Rapamycin complexes are eluted from the resin using an appropriate buffer, such as a buffer containing sufficient detergent to dissociate it from resin Laemli buffer with or 25 without glycerol or dye, Laemli, Nature 227:680, 1970), or an appropriate eluting compound for the affinity column, such as glutathione, histidine.

13. The effector proteins can then be separated by size. This may be accomplished in any manner which separates the proteins by size, including, but not limited to, polyacrylamide gel electrophoresis and size exclusion column chromatography.

It might also be useful to compare the proteins isolated by a control procedure, that is a procedure which substitutes buffer for the rapamycin or rapamycin analog with -18an IC50 in LAF 500 nM in step 8, can be used to more easily distinguish proteins which bind to the rapamycin:FKBP complex.

The proteins of this invention can also be made by recombinant

DNA

techniques familiar to those skilled in the art. That is, the gene of the protein in question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with an appropriate endopeptidase, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical Guide to Protein and Peptide Purification for Microsequencing, Academic Press, San Diego, CA 1989). The determined sequence can then be used to make oligonucleotide probes which can be used to screen a human cDNA library, such as those for human T cells, Molt 4, Jurkat, etc, to obtain clones.(Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989) These clones can be used to identify additional clones containing additional sequences until the protein's full gene is cloned (Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989). In a complementary strategy, the gene(s) may be identified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning (Chien et al., Proc. Natl. Acad. Sci. 88: 9578-9582, 1991). These strategies 20 can also be combined to quicken the identification of the clones.

The relevant cDNA clone can also be expressed in E.coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion 25 partner giving an advantage in isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc). Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.

Homologs in the mouse, rat, monkey, dog and other mammalian species can be obtained using similar procedures. In addition, upon isolation of the human clone of the proteins, the clone can be used to screen for homologs in other mammalian species.

These homologs can also be used to develop binding assays and to set up high through put screening assays for compounds, endogenous ligands, exogenous ligands with immunomodulatory activity.

-19- Compounds, endogenous ligands and exogenous ligands having such immunomodulatory activity would can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as lupus, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis.

The compounds, endogenous ligands and exogenous ligands mentioned above can also have antitumor, antifungal activities, and antiproliferative activities. The compounds of this invention therefore can be also useful in treating solid tumors, adult T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases such as restenosis and atherosclerosis.

EXAMPLE 1 The proteins of the present invention were isolated utilizing a fusion protein of 20 glutathione S-transferase--FK506 binding proteinl2 (GST-FKBP). GST-FKBP is produced by a recombinant E. coli containing the plasmid, pGEX-FKBP. The cells were grown, induced with IPTG and the fusion protein was isolated using standard technology described in D.B. Smith and K.S. Johnson, Gene 67, 31, 1988 and K.L.

Guan and J.E. Dixon, Anal. Biochem. 192, 262, 1991. The solution containing glutathione and GST-FKBP12 was exchanged 5x using a Centricon 10 filtration unit (Amicon) to remove the glutathione and exchange the buffer.

SMolt 4 cells (Ix10 9 were grown in standard media (RPMI 1640 containing 100 U/ml pennicillin, 100 ug/ml L-glutamine, 10% FCS). The cells were harvested and rinsed 3x with PBS (50mM phosphate buffer, pH 7.0, 150 mM NaCI), flash frozen in dry-ice ethanol bath and stored at -80'C. On ice, the cells were thawed and lysed using a dounce homogenizer with B pestle in 5 ml of buffer A (10 mM Hepes, pH 7.5, mM KCI, I mM EDTA, 0.4 mM PMSF and 2 mM 2-ME). After the debris was cleared by centrifugation at 1 6 00g for 10 min. and the membrane fraction was concentrated by 100,000g centrifugation (1 hour), the 100,000 g pellet was incubated in 3 ml buffer B (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 0.2 mM PMSF, 1 mM 2-ME, 2 mM CaCI 2 2 mM MgCI 2 5 pg/ml aprotinin, leupeptin, pepstatin A and antipain), containing 12 mM CHAPSO for two hours at 4°C. The solubilized membrane proteins were separated from the debris by a 100,000 g centrifugation. After preabsorption of the supernatant for 3-18 hours with 0.4 ml glutathione sepharose resin swollen in buffer B, the supernatant was incubated with complexed Rapamycin-GST-FKBP12 (preformed by incubation of 660 ug GST- FKBP 60 ug RAPA in buffer B for 1-2 hours, 4°C) for two hours at 4°C. The supernatant was then incubated for 2 hours at 4°C with 100 ul glutathione resin (1:1 Buffer Nonspecific proteins were rinsed 5x with buffer C (buffer B 0.1% Triton x 100) and the proteins eluted from the resin in Laemli buffer by incubation at 95 0

C

for 3 minutes and microcentrifugation. The proteins were separated by size using a 7% SDS-PAGE followed by silver stain. Four bands corresponding to proteins of molecular weights of 210kDa, 208 kDa, 148 kDa, and 125 kDa were present in higher concentrations in the sample containing RAPA GST-FKBP12 vs GST- FKBP alone.

The mitogen-stimulated thymocyte proliferation assay called the LAF 20 (Lymphocyte Activation Factor assay, also known as the comotigen-induced lymphocyte proliferation procedure), can be inhibited by rapamycin or analogs such as demethoxyrapamycin and indicates relative activity of rapamycin analogs in immunosuppression. The same proteins were isolated using GST-FKBP complexed with the immunosuppressive analog, demethoxyrapamycin (Table 1).

The Diels Alder adducts bound to FKBP12 and inhibited PPlase activity of FKBP12 but did not exhibit detectable immunosuppressive activity and thus do not bind to the target of rapamycin. The use of these two compounds complexed with GST- FKBP12 in the analogous isolation procedure (ie. replacing rapamycin:GST- FKBP12) yielded background levels of the 210kDa proteins (no rapamycin)(Table S 30 FK506, is an immunosuppressive compound which binds to FKBP and mediates at least some of its effects through the binding of the FK506-FKBP complex with calcineurin. FK506 when complexed with GST-FKBP in an analogous procedure yielded only background levels of the 210 kDa protein (Table 1).

C:WINWORDUENNYMSPECNKI13S7001V.DOC -21- TABLE 1 Comparison of Binding of Rapamvcin Analog--FKBP12 complexes to 210 kDa Protein Compound 210 kDa LAF PFlase(Ki) RAPA 6 nM 0.12nM demethoxyrapamycin 58nM 4.4 nM Diels Alder adduct (phenyl) >1000nM 12 nM Diels Alder adduct (methyl) >1000nM 12 nM FK506 3nM* 0.4 nM none (FKBP) mechanism of action is different) It is known that rapamycin must bind to a member of the FKBP family in order to mediate its effects. To verify that the proteins of this invention bind to the complex RAPA-GST-FKBP and not individually to rapamycin or FKBPI2, a modified isolation 20 procedure was employed. The modification consists of using a rapamycin-42biotin glycinate ester in place of rapamycin (both exhibit equivalent immunosuppressive activity in the LAF assay), no exogenous FKBP and a strepatavidin-conjugated resin in place of glutathione-resin. Only background levels of the 210 kDa protein was isolated using this modified isolation procedure.

The 210 kDa protein was isolated using the GST--FKBP12--rapamycin complex from BJAB cells (B cell lymphoma) and normal human T lymphocytes purified by Ficoll-Hypaque and T cell columns.

The results of the partial amino acid composition analysis are set forth in Table 2, below. It should be noted that the percentage of the basic amino acids was not determined.

-22- TABLE 2 Peak Component Number Name Retention Peak Response Time Area Factor Peak Concentration Heig2ht 9.38 11.09 12.06 12.47076 0.02344 0.05 142 0.30

I

2 3 4 5 6 2)0 7 8 9 Asp/Asn Thr Ser GluIGln Prp Gly Ala Val Met le Leu nLeu 9, 9* 13.05 13.78 15.68 16.87 18.24 '22.35 22.90 23.73 26.06 28.81 29.39 32.28 34.10 35.09 36.27 2.92898 6.43968 0.00000 0.00000 0.00985 0.0 1995 25 .47273 0.00000 21.50384 0.00000 0.05285 0.59 0.14 0.04645 -0.44 0.068 0.15 16.69160 0.00000 0.03113 0.36 4.83 196 3.00560 5.73202 20.48232 0.00000 0.00605 0.11 0.2326 0.02331 0.02 174 0.00782 0.0 1372 0.04286 0.0699 0. 1383 0.4453' 9 9***99 9

C.

9 9 9# 9**9 9.

-23- TABLE 2 (Cont'd) Peak Component Retention Peak Response Peak Concentration Number Name Time Area Factor Height 11 Tyr 38.33 1.44792 0.02618 0.00226 0.0379 12 Phe 40.05 1.25017 0.02703 0.00187 0.0338 13 His 47.79 1.50905 0.02553 0.00580 0.0385 14 51.80 12.66136 0.00000 0.01960 0.0000 15 Lys 53.34 9.90767 0.02283 0.02274 0.2262 Totals 146.53645 0.33436 Not Determined 144.29 EXAMPLE 2 The 210 kDa (210±20 kDa) protein of this invention was isolated from 4 x 1011 Molt 4 cells using the affinity matrix protocol as described previously. Bound proteins were eluted from the affinity matrix with Ix Laemli buffer without glycerol and dye (0.0625 M Tris-HCI, ph6.8, 2% SDS, 0.37M b-mercaptoethanol) and were concentrated 3 consecutive times by centrifugation using centricon 100 (Amicon, Beverly, MA) at 4 "C the first two times and at 18 'C the third time. The concentrated sample was eluted from the centricon 100 filter by incubating 2 hours at room temperature with an equal volume of 2 x laemli buffer without glycerol and dye the first 2 x and 2 x laemli buffer the third time. The proteins in the sample were separated by PAGE on a 1.5mm thick 7% polyacrylamide gel The proteins were transferred to polyvinylidine difluoride, PVDF, (Biorad, Hercules, CA) in 10 x Tris/glycine buffer (Biorad) containing 0.037% SDS at 50 mAmps at 4 °C overnight. The proteins on the PVDF were stained with amido black (Biorad) in 10% ethanol, 2% acetic acid and the appropriate band was excised, rinsed with PBS and water and stored frozen.

-24- Sequencing The protein (approx. 3 ug) on the PVDF membrane was digested in situ with trypsin using a modification described by J. Fernandez et al, (Anal.Biochem. 201: 255- 64, 1992 Briefly, the PVDF was cut into 1 mm 2 pieces, prewet, and the protein digested in a 100mM Tris-HCl, pH buffer containing 10% acetonitrile, and 1% reduced triton (CalBiochem) with 0.2ug trypsin at 37 "C for 6 hours followed by addition of 0.2 ug trypsin and incubation overnight. The fragments were eluted from the membrane by sonication and the buffer containing the fragments were separated by microfuge centifugation. The membranes were backextracted 2x 50 ul buffer was added to membranes, sonicated, and centrifuged in a microfuge and solution pooled with the original buffer containing the eluted fragments.) The sample (140-145 ul) was separated by narrow bore high performance liquid chromatography using a Vydac C18 2.1mm x 150 mm reverse phase column on a Hewlett Packard HPLC 1090 with a 40 diode array detector as described previously by W.Lane et al, (J.Protein Chem., 10(2): 151-60, 1991). Multiple fractions were collected and measured for absorption at multiple wavelengths (210, 277 and 292 nm). Optimal fractions were chosen for sequencing based on resolution, symmetry, and ultraviolet absorption and spectra (210 nm, 277 nm and 292 An aliquot of the optimal fractions was analyzed for 20 homogeneity and length of fragment by matrix assisted laser desorption time of flight mass spectrometry, MALDE-TOF-MS, on a Finnigan lasermat. Selected optimal fractions were sequenced by automated Edman degradation on an Applied Biosystems 477A protein sequencer using microcartridge and manufacturer's recommended chemistry cycle.

Sequence comparison 30 Comparison was performed using the Intelligenetics suite (Intelligenetics, CA).

C* 30 Sequences Utilizing the methods mentioned above, it was determined that the 210 kDa (210±20 kDa) protein of this invention contains peptide fragments, four of which have amino acid sequences as shown below: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) Those skilled in the art will recognize the one-letter symbols for the amino acids in question (the definitions for which can also be seen at page 21 of the text Biochemistry, Third Edition, W.H. Freeman and Company, 1988 by Lubert Stryer).

Those so skilled will also understand that the X in sequence c) indicates an as yet unidentified amino acid and the parentheses in sequence d) indicates that the amino acid in the position in question is possibly lysine.

As mentioned previously, the present invention includes fragmented or truncated forms of the proteins mentioned herein. This includes proteins which have as part or all of their amino acid sequence one or more of the four sequences listed as a)above. For the purposes of the claims, below, the proteins referred to as including 20 one or more of the "internal amino acid sequences" are understood to be any protein which contains one of the sequences listed above, whether the protein is comprised wholly of one or more of the sequences or whether one or more of the sequences mentioned above form any portion of the protein. This is understood to include all locations on the protein's amino acid sequence including, but not limited to, those 25 sections of the protein which initiate and terminate the protein's amino acid chain.

These partial amino acid sequences were compared with sequences in the Genbank database. There was identity with the sequence, accession number L34075 (Brown et al., Nature 369, 756-758 (1994)). The cDNA of the SEP gene was cloned 30 as follows: Two micrograms of Molt 4 cDNA (Clontech, Palo Alto,CA) in 1 x PCR buffer (10 mM Tris-HC1, pH 8.3, 50 mM KCI, 1 mM MgCI, 200 gM dATP, 200 .M dTTP, 200 .M dCTP, 200 .M dGTP; Perkin Elmer, with 1 unit Taq polymerase (Perkin Elmer),was amplified by Polymerase chain reaction (PCR) at 94 C for 30 sec., 66"C for 4 min for 30 cycles, 72 C for 10 min by three separate reactions containing one of the following pairs of oligomers: -26- CGATCGGTCGACTGCAGCACTTTGGGGATTGTGCTCTC and GCGGCCGCAGCITTCTfCATGCATGACAACAGCCCAGGC; or GCGGCCGCAAGCTTCAAGTATGCAAGCCGTGCGGCAAGA and CGATCGGTCGACACCTTCTGCATCAGAGTCAAGTGGTCA; or GCGGCCGCAAGCTTCCTCAGCTCACATCCTAGAGCTGCA and

CGATCGGTCGACTTATTACCAGAAAGGGCACCAGCCAATATA

The oligonucleotides were synthesized and isolated by methods previously described and known in the art (Chemical and Enzymatic Synthesis of Gene Fragments, ed. by H.G.Gassin and Anne Lang, Verlag Chemie, FLA, 1982). The resulting PCR products named SEP3, SEP4, and SEP5, respectively, were incubated at 15 C overnight in buffer containing T4 DNA ligase (1 unit) and 50 ng pcII which was modified to efficiently ligate PCR products (TA cloning kit, Invitrogen, San Diego, CA) to yield PCR-pcII ligated products. The PCR-pcII products were transformed into competent E. coli INValphaF cells obtained commercially from Invitrogen. Miniprep DNA was prepared using the Quiagen miniprep kits (Quiagen, Chatsworth, CA) and the clones containing the appropriate sized PCR product were identified by restriction enzyme digestion with commercially available HindIll or Sal I, electrophoresis, and comparison to standards. Sep2 and Sepl cDNA was made using the TimeSaver cDNA synthesis Kit (Pharmacia, Piscataway, NJ) with the first strand synthesis reaction containing oligodT (0.13 gg) and 250 pmoles of CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA or

CGATCGGTCGACAAATTCAAAGCTGCCAAGCGTTCGGAG,

***respectively. Sep2 and Sepl second strand synthesis was performed using the TimeSaver cDNA synthesis kit with the addition of 250 pmoles of 0 GCGGCCGCAAGCTTTGGCTCGAGCAATGGGGCCAGGCA or

GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG,

respectively. The Sep2 and Sep1 cDNA was then amplified by PCR using -27- CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA and GCGGCCGCAAGCTTTGGCTCGAGCAATGGGGCCAGGCA or GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG and

CGATCGGTCGACAAATTCAAAGCTGCCAAGCGTTCGGAG,

respectively as described above. The Sep2 PCR products were cloned into pcII using the TA cloning kit (Invitrogen). The Sep 1 PCR products were digested with Hind I and Sal I, separated from the pcII vector by agarose electrophoresis. The Sepi (HindEil-Sall) fragment was isolated using the Sephaglas bandprep kit from Pharmacia and cloned into the HindIII and Sal I sites of pUC19 as described (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). Ligation of the isolated Sep2(Hindm, AspI) and Sep3(AspI, Sall) fragments or Sep4(HindIII, AccIII/MroI) and Sal I) fragments into pUC18(HindIII, Sail) vector and transformation of competent E. coli INValphaF cells (Invitrogen) was performed by techniques known to those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain pUC18-Sep 23 and pUC18-Sep45 which contain V* o nucleotides 1468- 5326 and 4964 7653, respectively, of the full length clone shown in the attached Sequence No. 1. Ligation of the pUC19-Sepl (EcoRV, SalI), Sep23 (EcoRV, BstEII) and Sep45 (BstEII, Sail) fragments and transformation of competent 20 E. coli INValphaF cells (Invitrogen) can be performed by techniques known to those skilled in the art (as described by Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain the full length clone. The nucleic acid sequence coding for this protein is shown in Sequence No. 1.

25 A fusion protein, called glutathione S transferase-sirolimus effector protein, GST-SEP, was engineered by subcloning the Sep4 and Sep5 fragments into the plasmid, pGEX-KG (Guan, K. and Dixon, J.E. (1991) Anal. Biochem. 192, 262-267) as follows. Briefly, Sep4 was digested with commercially available HindIII restriction enzyme, the restriction site was filled in with the Klenow fragment of DNA polymerase (Gibco), and the DNA was extracted with phenol-chloroform and ethanol precipitated using techniques known by those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). The SEP4 (HindIII-Klenow) was further digested with Mrol restriction enzyme, separated from the pcII vector by agarose electrophoresis and isolated as the fragment SEP4-HindlII-Klenow-MroI. Sep5 fragment was prepared by -28digestion with Sall and Mrol, separated from the pcII vector by agarose electrophoresis and isolated as the fragment SEP5-SalI-MroI. pGEX-KG (Guan, K. and Dixon, J.E.

(1991) Anal. Biochem. 192, 262-267) was digested with Nco I, filled in with the Klenow fragment of DNA polymerase and the DNA was extracted with phenolchloroform and ethanol precipitated, using techniques of those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). pGEX-KG (Ncol, Klenow) was further digested with Sal I, separated from the undigested vector by agarose electrophoresis and isolated as the vector pGEX-KG-NcoI-Klenow-SalI, using techniques of those skilled in the art. Ligation of the vector, pGEX-KG-NcoI-Klenow- Sall and Sep 4 (HindIII, MroI) and Sep5 (Mrol, Sail) fragments and transformation into E. coli strain INValphaF cells (Invitrogen) using techniques of those skilled in. the art yielded the plasmid, pGEX-Sep45. The DNA and protein sequence of this fusion protein is shown in Sequence No. 2.

Flag sequences can be added at the amino terminal end, within SEP or at the carboxy terminus of SEP, SEP4,5 or other fragments using an oligonucleotide which includes the coding sequence for Asp Tyr Lys Asp Asp Asp Asp Lys. The fusion protein can be isolated by affinity chromatography with anti-flag specific antibodies using the commercially available kits from IBI, New Haven, Conn.

Transformed host cells containing the pUC 19-Sepl (EcoRV, SalI), Sep23 *(EcoRV, BstEII) and Sep45 (BstEII, Sail) fragments as shown in Sequence No. 1 were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, USA, on 2 March 1995 25 and were assigned the following accession numbers: *S -29- Sample (all in INV alpha ATCC Accession Number pucl8-Sep 23 69753 pucl8-Sep 45 69754 pGEX-Sep 45 69755 puc-19-Sep 1 69756 EXAMPLE 3 The 210 kDa protein of this invention was also isolated by the techniques described in Example 1 utilizing the following rapamycin analogs: a) 42-Deoxy-42-[1-(1,1-dimethylethoxy)-2-oxoethoxy] rapamycin (which is described in U.S. Patent. No. 5,233,036); b) 42-[O-[(1,1-Dimethylethyl)dimethylsilyl]] rapamycin (described in U.S. Patent. No. 5,120,842); c) Rapamycin 42-ester with N-[1,1-dimethylethoxy)carbonyl]-Nmethylglycine (described in U.S. Patent. No. 5,130,307); S: d) Rapamycin 42-ester with 5-(1,1-dimethylethoxy)-2-[[(1,1dimethylethoxy)carbonyl]amino]-5-oxopentanoic acid ethyl acetate solvate three 20 quarter hydrate (see U.S. Patent. No. 5,130,307); e) Rapamycin 42-ester with dimethylethoxy)carbonyl]glycylglycine hydrate (see U.S. Patent. No.

5,130,307); and f) Rapamycin 42-ester with N2, N6-bis[(1,1- 25 dimethylethoxy)carbonyl]-L-lysine (see U.S. Patent. No. 5,130,307).

ooo0 *°oo*o* C: vvN DOC)uENSPECNM13870M DOC Page(s) S .'60 are claims pages they appear after the sequence listing SEQUENCE LISTING GENERAL INFORMATION: INVENTORS: Molnar-Kimber, Katherine L.

Failli,Amedeo F.

Caggiano,Thomas J.

Nakanishi, Koji Chen, Yanqiu (ii) TITLE OF INVENTION: Effector Rapamycin (iii) NUMBER OF SEQUENCES: 2 Proteins of COMPUTER READABLE FORM: MEDIUM TYPE: Diskette, 3.50 inch, 1.4 Mb storage

(V

COMPUTER: Apple Macintosh OPERATING SYSTEM: Macintosh 7.1 SOFTWARE: Microsoft Word i) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSIFICATION:

ii) PRIOR APPLICATION DATA: APPLICATION NUMBER: US 08/312,023 FILING DATE: 26-SEPTEMBER-1994 APPLICATION NO: US 08/207,975 FILING DATE: 08-MARCH-1994

(V:

-31- INFORMATION FOR SEQ. ID NO: 1: SEQUENCE CHARACTERISTICS: LENGTH: amino acids TYPE: nucleic acid STRANDEDNESS: sense orientation of the double-stranded DNA strand TOPOLOGY: linear (ii) MOLECULE TYPE: sense orientation of doublestranded cDNA to mRNA (iii) HYPOTHETICAL: no (iv) ANTISENSE: no (vi) ORIGINAL SOURCE: ORGANISM: Molt 4 human T-cell leukemia cells .r -u STRAIN: ATCC (xi) SEQUENCE DESCRIPTION: AAG ATG CTT GGA ACC GGA CCT GCC 25 Met Leu Gly Thr Gly Pro Ala 1 5 AAT GTG AGC GTC CTG CAG CAG TTT 30 Asn Val Ser Val Gl', G 01- GCC GCC ACC 27 Ala Ala Thr 10 GCC AGT GGC 81 1 ACC GCT GCC ACC ACA TCT AGC 54 Thr Ala Ala Thr Thr Ser Ser Strain CRL 1582 SEQ. ID NO: 1 CTA AAG AGC Leu Lys Ser 20 ACC AGG GCC AAA Thr Arg Ala Lys GAG ATG Glu MET 55 TTT GAA 45 Phe Glu AGT CAA Ser Gin TTG GTT Leu Val 25 GCC GCC AAG GAG CTC 135 Ala Ala Lys Glu Leu GAG GAG TCT ACT CGC 189 Glu Glu Ser Thr Arg 60 TCC AGC TCA GAT GCC 243 Ser Ser Ser Asp Ala

CAG

Gin 45

TTC

Phe

AAT

Asn CAC TAT His Tyr 30 GTC ACC Val Thr Ser iGly TAT GAC CAA Tyr Asp Gin 65 GAG AGG AAA Glu Arg Lys

CTG

Leu

GGT

Gly

CGA

CGG AAT GAG GAA 108 Arg Asn Glu Glu ATG GAA CTC CGA 162 MET Glu Leu Arg AAC CAT CAC ATT 216 Asn His His Ile GGC ATC TTG GCC 270 Gly Ile Leu Ala ATT GGC AGA TTT 324 ATA GCT AGC CTC ATA GGA GTG GAA GGT GGG AAT GCC ACC -Ile Ala Ser Leu 297 Ile Gly Val Glu Gly Gly Asn Ala Thr 95 100 Arg Ile Gly Arg Phe 105 -32- GCC AAC TAT CTT CGG AAC CTC CTC CCC TCC A.AT GAC CCA GTT GTC ATG GAA' ATG Ala Asri Tyr Leu 110 Arg Asn Leu Leu Pro 115 Ser Asn GCA TCC Ala Ser TAC GTG Tr Val 145 AAG GCC ATT GGC CGT Lys Ala Ile Gly Arg 130 GAA TTT GAG GTG AAG Glu'Phe Glu Val Lys Asp Pro 120 GGG GAC Gly Asp CTT GCC ATG 405 Leu Ala MET 135 CGA GCC CTG 459 Arg Ala Leu

GCA

Ala Val Val MET Glu ACT TTT ACC GCT Thr Phe Thr Ala 140 GGT GCT GAC CGC Gly Ala Asp Arg 378

MET

125

GAG

432 Giu

AAT

486

GAG

Glu GGC CGG AGA CAT Gly Arg Arg His 165 ACC TTC TTC TTC Thr Phe Phe Phe

OCA

Ala

CAG

150 GAA TGG CTG Glu Trp Leu 155 CTC CGT GAG Leu Arg Glu GCT GTC CTG GTT 513 Ala Val Leu Val 170 CAA GTG CAA CCC 567 Gln Val Gin Pro

CTG

160 GCC ATC AGC GTC 540 Ala Ile Ser Val 175

CCT

Pro 180 0 GTG TGG Val Trp TOT CTG Cys Leu

GAC

Asp 200 Gln 185 CCC AAA CAG Pro Lys Gin TTC TTT Phe Phe 190 GCC ATC Ala Ile 205

GAC

Asp CGT GAG 621 Arg Giu GAG CCG 675 Glu Pro 225 AAC ATT TTT GTG GCC 594 Asn Ile Phe Val Ala 195 GCC GCC CTT CGT GCC 648 Ala Ala Leu Arn Al GGA GCT GTA Gly Ala Val 210 AAG GAG ATG Lys Glu MET ATT CTC ACA ACC CAG Ile Leu Thr Thr Gln 220 CAC ACA TTT GAA GAA His Thr Phe Glu Glu

CGT

Arg

GCA

Ala CAG AAG Gin Lys 230 215 CCT CAG TGG 702 Pro Gin Trp TAC AGG Tyr Arg 235 GAG AAG Glu Lys

GAG

729 Giu

AAG

Lys GGC ATG Gly MET 255 AAT CGG Asn Arg 240 GGA TTT Gly Phe 245 CAT GGA His Gly

GAT

Asp

GAG

Glu ACC TTG GCC AAA -756 Thr Leu Ai& Lys 250 TTG ATC CTT AAC 810 Leu Ile Leu Asn GAG CTG Giu Leu 270 GAA ATC Giu Ile c$.iC Val1

ACA

Thr 290 CGA ATC AGC Arg Ilie Ser 275 CAG CAG CAG Gin Gin Gin GAT GAT CGG ATC 783 Asp Asp Arg Ile 260 AGC ATG GAG GGA 837 Ser MET Giu Gly CTG GTA CAC GAC 891 Leu Val His Asp 295 GCC TTG Ala Leu 265 GAG CGT CTG Giu Arg Leu 280 AAG TAC TGC Lys Tyr Cys 300 AGA GAA GAA ATG GAA 864 Arg Giu Giu MET Giu 285 AAA GAT CTC ATG GGC 918 Lys Asp Leu MET Gly 305 -33- TTC GGA ACA AA.A CCT CGT CAC ATT ACC CCC TTC ACC AGT TTC CAG GCT GTA CAG Phe Gly CCC CAG Pro Gin 325 Thr Lys CAG TCA Gin Ser Pro 310 Arg His AAT GCC Asn Ala GGG ACC Gly Thr

TTG

Leu 330 Ile Thr Pro 315 GTG GGG CTG 999 Val Gly Leu Phe Thr Ser Phe CTG GGG TAC AGC Leu Gly Tyr Ser 335 Gin 320 972 Ala Vai Gin TCT CAC CA.A GGC 1026 Ser His Gin Gly 340 CTG GTG GAG AGC 1080 Leu Val Giu Ser

CTC

Leu

CGG

Arg 360 ATG GGA TTT MET Gly Phe 345 TGT TGC AGA Cys Cys Arg TCC CCC AGT 1053 Ser Pro Ser 350 ATG GAG GAG 1107 MET Giu Giu

CCA

Pro

GCT

Ala GAC TTG Asp Leu 365 A.AA TTT Lys Phe 370 A-AG TCC ACC Lys Ser Thr 355 GAT CAG GTG Asp Gin Val CA: ATG ACA Gin MET Thr 390 TTC ACA GAT Phe Thr Asp TGC CAG Cys Gin 375 TGG GTG 1134 Trp Val CTG AAkA TGC AGG Leu Lys Cys Arg 380 TTG CCC CGC TTG Leu Pro Arg Leu

AAT

As n AGC AAG AAC TCG CTG 1161 Ser Lys Asn Ser Leu 385 GCA TTC CGA CCT TCT 1215 Ala Phe Arg Pro Ser

ATC

Ile

GCC

ATC

Ile

ACC

0* 0*

GCT

CAA GAT ACC Gin Asp Thr 415

ATG

MET

400 AAC CAT GCC Asn His Ala 420 CTA AGC 1269 Leu Ser 405

TGT

Cy s GTC AAG Val Lys 425 Thr 410 AAG GAG AAG Lys Glu Lys CTT A.AT TTG 1188 Leu Asn Leu 395 CAG TAT CTC 1242 Gin Tyr Leu GAA CGT ACA 1296 Glu Arg Thr 430 GAG TTT. ALAG f350 Glu Phe'Lys Ala

S

40

GTC

Val 45 450 GCC TTC CAA GCC Ala Phe Gin Ala 435 TAT TTG CCT CGC Tyr Leu Pro Arg

CTG

Leu

GTG

GGG CTA CTT TCT 1323 Gly Leu Leu Ser 440 CTG GAC ATC ATC 1377 Leu Asp Ile Ilie

GTG

Val1 GCT GTG AGG Ala Val Arg 445 GCG GCC CTG Ala Ala Leu

TCT

Ser

CGA

TTC GCC CAT AAG Phe Ala His Lys 470 ATC AGC ATG CTG 455 AGO CAG Arg Gin AA-G GCA ATG 1431 Lys Ala MET 475 460 CAG GTG Gin Val CCC CCA Pro Pro 465 AAG GAC 1404 Lys Asp GAC GCC Asp Ala 480

ACA

Thr

GTC

Val1 TTC ACT TGC 1458 Phe Thr Cys 485 ATC AAG GAG 1512 Ile Lys Giu GCT CGA OCA ATG

GG

1485 Ile Ser MET Leu Ala Arq Ala MET Gly 490 CCA GGC ATC Pro Gly Ile 495

CAG

Gin CAG GAT Gin Asp 500 -34- CTG CTG GAG CCC ATG CTG GCA GTG GGA CTA AGC CCT GCC CTC ACT GCA GTG CTC Leu

TAC

Tyr

CTG

Leu 540

CCC

Pro Leu Glu 505 Pro MET Leu CGT CAG Arg Gin Ala 510 1539 Val Gly GAC CTG AGC Asp Leu Ser 525 -AA ATG CTG Lys MET Leu Leu Ser CTA AAG Leu Lys Pro 515 Ala Leu Thr ATT CCA CAG 1593 Ile Pro Gin 530 GTC CTT ATG 1647 Val Leu MET TCC CTG Ser Leu 545 CAC AAA His Lys 550 AAG GAC ATT Lys Asp Ile 535 CCC CTT CGC Pro Leu Arg

CAA

Gin

CAC

His

ACC

Thr 1566 Ala Val Leu 520 GAT GGG CTA 1620 Asp Gly Leu CCA GGC ATG 1674 Pro Gly MET 555 CTC CCT GAG 1728 Leu Pro Glu 575 AGC TTT GAA 1782 Ser Phe Glu AAG GGC Lys Gly

CTG

Leu

GCC

Ala GCC AGC Ala Ser TTT GAA Phe Glu 595 560 CAT CAG CTG GCC TCT 1701 His Gin Leu Ala Ser 565 AGC ATC ACT CTT GCC 1755 Ser Ile Thr Leu Ala GAT GTG GGC Asp Val Gly 580 GGC CAC TCT Gly His Ser CCT GGC CTC Pro Gly Leu 570 CTC CGA ACG Leu Arg Thr

ACG

Thr 4 *4 *4

*.C

CTG ACC Leu Thr 585 CTT GGC Leu Gly 590 CAA TTT 1809 Gin Phe

AAC

Asn AGT GAG CAC Ser Glu His 615 AAG GAG Lys Glu 600 GTT CGC CAC TGT Val Arg His Cys 605 GAG GCT GCC CGC Glu Ala Ala Arg

GCG

Ala GAT CAT TTC CTG 1836 Asp His Phe Leu 610 TGC TCC CGC CTG 1890 Cys Ser Arg Leu

ATC

Ile CGC ATG 1863 Arg MET 620 ATC AGT 1917 Ile Ser

ACC

Thr CTC ACA Leu Thr 630 GCA GTG Ala Val

CCC

Pro

CAA

Gin TCC ATC CAC CTC Ser Ile His Leu 635 GGC CAT Gly His 640 625 GCT CAT GTG Ala His Val GTT AGC Val Ser 645 CAG ACC 1944 Gln-Thr GTG GTG Val Val 4 4 GAT CCT Asp Pro GAT GCA Asp Ala 685 650 GAC CCT GAC Asp Pro Asp 670 CAC CTG GCC His Leu Ala GCA GAT GTG CTT AGC 1971 Ala Asp Val Leu Ser 655 ATT CGC TAC TGT GTC 2025 Ile Arg Tyr Cys Val 675 CAG GCG GAG AAC TTG 2079 Gin Ala Glu Asn Leu 690 AAA CTG CTC Lys Leu Leu 660 TTG GCG TCC Leu Ala Ser

GTA

Val

GTT

Val CAG GCC Gin Ala 695

TTG

Leu CTG GAC Leu Asp 680 TTT GTG Phe Val GGG ATA ACA 1998 Gly Ile Thr 665 GAG CGC TTT 2052 Glu Arg Phe GCT CTG AAT 2106 Ala Leu Asn 700 GAG CAG GTG TTT GAG ATC CGG GAG CTG GCC ATC TGC ACT GTG GGC CGA CTC AGT Asp Gin Vai AGC ATG AAC Ser MET Asn 720 TTG ACA GAG Leu Thr Glu Phe 705 Glu Ile 2133 Arg Giu Leu 710 GTC ATG CCT 2187 Vai MET Pro CCT GCC Pro Ala TTG GAG Leu Glu

TTT

Phe 725 Ala Ile Cys Thr TTC CTG GGC AAG Phe Leu Arg Lys 730 GGA AGA ATC kAA Gly Arg Ile Lys Va1 715 2160 Gly Arg Leu Ser ATG CTG MET Leu GAG CAG Glu Gin

ATC

Ile 735 CAG ATT 2214 Gin Ile ATG CTG MET Leu CCT ATT Pro Ile 775 740 GGG CAC CTG Gly His Leu 760 CTG AAG GCA Leu Lys Aia CAC AGT GGG ATT 2241 His Ser Gly Ile 745 GTC TCC AAT GCC 2295 Val Ser Asn Ala

CCC

Pro 765 CGA CTC Arg Leu 750 ATC CGC Ile Arg GCA GAG Pro Asp AGT GCG CGC 2268 Ser Ala Arg 755 TAG ATG GAG 2322 Tyr MET Glu

CCC

Pro 770 TTA ATT Leu Ile 780 TTG AAA 2349 Leu Lys CTG AA GAT Leu Lys Asp 785 ACA ATA GGA Thr Ile Gly CCT GAT CCA A.AC 2376 Pro Asp Pro Asn 790 GCA GAG OTT AGT 2430 Ala Gin Val Ser

GCA

Pro

GGC

Gly 810 GGT GTG ATC AAT Gly Val Ile Asn 795 CTG GAA ATG AGG Leu Giu MET Arg

A.AT

Asn GTC CTG GCA 2403 Val Leu Ala 800 TGG GTT GAT 2457 Trp Val Asp

AAA

Lys GAA CTT Glu Leu 820

TTT

Phe GAA TTG Glu Leu 805 ATT ATC Ile Ile ATC ATG Ile MET 825 GAG ATG 2484 Asp MET

S

*5

S

S.

055.

CTC GAG GAT Leu Gin Asp 830 GAG TTG GTG Gin Leu Val TCC TCT Ser Ser GCC AGC Ala Ser 850 815 TTG TTG GCC AAA 2511 Leu Leu Ala Lys 835 ACT GGC TAT GTA 2565 Thr Gly Tyr Val

AGG

Arg

GTA

Val 855 GAG GTG GCT Gin Val Ala 840 GAG CCC TAG Glu Pro Tyr

CTG

Leu

TGG

Trp ACC CTG GGA 2538 Thr -Le& Gly 845 TAG CCT ACT 2592 Tyr Pro Thr AGG AAG Arg Lys 860 TTG CTT Leu Leu 865 AGA GAG Arg Glu

GAG

Glu

GTG

Val CTA CTG AAT Leu Leu Asn 870 CGT GTG TTA Arg Val Leu TTT CTG 2619 Phe Leu GGG CTT 2673 Giy Leu 890 AAG ACT GAG Lys Thr Glu 875 TTA GGG GCT Leu Gly Ala

GAG

Gin

AAC

Asn GAG GGT ACA CGC 2646 Gin Gly Thr Arg 880 CCT TAG AAG CAC 2700 Pro Tyr Lys His GCC ATC Ala Ile 885 TTG GAT Leu Asp 895 -36- AAA GTG AAC ATT GGC ATG ATA GAC CAG TCC CGG GAT GCC TCT GCT GTC Lys 900 Val Asn Ile Gly MET Ile 905 GAA TCC AAG TCA AGT CAG Glu Ser Lys Ser Ser Gin 2727 Asp Gin GAT TCC 2781 AsD Ser Ser Arg Asp Ala Ser Ala Val 915 AGC CTG 2754 Ser Leu

TCA

Ser GTC AAC Val Asn GCC CTG Ala Leu 955 920 ATG GGA AAC MET Gly Asn 940 ATG CGG ATC MET Arg Ile 925 TTG CCT CTG GAT 2835 Leu Pro Leu Asp TCT GAC TAT AGC ACT Ser Asp Tyr Ser Thr 930 GAG TTC TAC CCA GCT Glu Phe Tyr Pro Ala

AGT

Ser

GTG

Val GAA ATG CTG 2808 Glu MET Leu 935 TCC ATG GTG 2862 Ser MET Val TTC CGA Phe Arg 960 GAC CAG 2889 Asp Gin 945

TCA

Ser CTC TCT Leu Ser 965 CAT CAT His His 950

GTC

Val

S

S

S.

S S

*SC

25

CTG

Leu 990 30 CAG GCC ATC ACC Gin Ala Ile Thr 975 CCC CAG GTC ATG Pro Gin Val MET

TTC

Phe

CCC

Pro ATC TTC AAG 2943 Ile Phe Lys 980 ACG TTC CTT 2997 Thr Phe Leu TCC CTG GGA CTC AAA Ser Leu Gly Leu Lys 985 AAT GTC ATT CGA GTC Asn Val Ile Arg Val 1000 GGA ATG TTG GTG TCC Gly MET Leu Val Ser ATC CGG GAA TTT Ile Arg Glu Phe 1010 CAC ATC AGA CCT His Ile Arg Pro

TTG

Leu

TAT

Tyr 995

S.

S.

ATG AAC ACC MET Asn Thr 1045 GCT CTT GGG 1030 TCA ATT Ser Ile GGT GAA TTC CAG CAG CTG 3051 Phe Gin Gin Leu 1015 ATG GAT GAA ATA 3105 MET Asp Glu Ile CAG AGC ACG ATC 3159 Gin Ser Thr Ile 1050 TTT AAG CTC TAC CAC ACC ATG GTT 2916 His Thr MET Val 970 TGT GTG CAG TTC 2970 Cys Val Gin Phe TGT GAT GGG GCC 3024 Cys Asp Gly Ala 1005 TTT GTG AAG AGC 3078 Phe Val Lys Ser 1025 GAA TTC TGG GTC 3132 Glu Phe Trp-Val 1040 CAA ATT GTG GTA 3186 Gin Ile Val Val 1060 CCA CAC ATG CTG 3240

GTC

Val 1035 1020 ACC CTC ATG AGA Thr Leu MET Arg ATT CTT CTC ATT GAG Ile Leu Leu Ile Glu 1055 CTG CCC CAG CTG ATC Ala Leu Gly Gly Glu Phe Lys Leu 3213 Tyr 1070 Leu Pro Gin Leu Ile Pro His MET Leu 1065 I 1075 CGT GTC TTC ATG CAT GAC AAC AGC CCA GGC CGC ATT GTC TCT ATC AAG TTA CTG 3267 3294 Arg Val Phe MET His Asp 1080 108a Asn Ser Pro Gly Arg Ile Val Ser Ile Lys Leu Leu 1090 1095 5 -37- GCT GCA 'ATC CAC CTG TTT CCC GCC AAC CTG GAT GAC TAC CTG CAT TTA Ala Ala Ile Gin Leu CCT CCT Pro Pro CCA GCG Ala Ala 1135 1100 Phe 3321 GlY Ala Asn 1105 TTT GAT GCC 3375 Phe Asp Ala Leu Asp Asp Tyr Leu His Leu 1110 CTC CTG 3348 Leu Leu 1115 CCA AAG 3402 Arg Lys ATT CTT AAG TTG Ile Val Lys Leu 1120 CTA GAG ACT GTG Leu Giu Thr Val CCT GAA Pro Giu 1125 ACG GAG Thr Giu CCT CCA CTG CCA TCT Ala Pro Leu Pro Ser 1130 TCC CTC CAT TTC ACT Ser Leu Asp Phe Thr GAC CCC CTC 3429 Arg Leu CAC TAT 3456

GCC

Ala

TCC

Ser CCC ATC Arg Ile 115~ ACA GCC Thr Ala ATT CAC Ile His 1140 1145 CCT ATT GTT CGA ACA 3483 Pro Ile Val Arg Thr 1160 ACG CTG TCT WCA CTT 3537 Thr Leu Ser Ser Leu CTG CAC CAC AGC Leu Asp Gin Ser 1165 GTT TTT CAG CTG 1150 CCA GAA CTC 3510 Pro Ciu Leu CCC TCC Arg Ser 1170 25 ATG GAC MET Asp 1175 a.

a.

TAC CAA ATT TTC Tyr Gin Ile Phe 1190 CAT CAG CCC TAT His Gin Arg Tyr

ATT

Ile

CAT

Asp 1210 CCA ATC CTG AAT 3591 Pro MET Val Asn 1195 CTC CTC ATC TC 3645 Val Leu Ile Cys Ly s

AGA

Arg 1180 CTT CTC CTC CCA CAC Val Leu Val Arg His 1200 ATT CTC AAG CGA TAC Ile Val Lys Cly Tyr

CCC

Cly

CGA

Arg A-AG AAG 3564 Lys Lys ATC AAT 3618 Ile Asn 1205 CTT CCT 3672 Leu Ala

ACA

Thr 1215 CAT CAA Asp Ciu 122~ CCC CAT Cly Asp 5 GAG GAG GAT CCT TTC ATT TAC CAC 3699 Ciu Giu Asp Pro Leu Ile Tyr Gin 1230 GCA TTC GCT ACT CGA CCA CTG CAA 3753 Ala Leu Ala Ser Cly Pro Val Clu 1245 1250 ACC ATC AAC CTC CAA AAC CCC TCC 3807 rhr Ile Asn Leu Gin Lys Ala Trp CAT CCC His Arg 123~ ACA CCA Thr Cly

ATC

MET

122C CTT ACC Leu Arg a.

a. 45 CTC AC Val Ser 1260 CAT CAC CCC ATC AAC Pro MET Lys 1255 CCC ACC ACC Ala Arg Arg ACT CCC CAA 3726 Ser Gilb Gin 1240 AAA CTC CAC 3780 Lys Leu His CTC TCC AAA 3834 Val Ser Lys 1275 CCC CCT 1265 TCC CTC AGA 1270 CCC CTC ACC CTC TCC CTC GAA CAG CTC CTC AAC CAC TCA Asp Asp Trp Leu Glu Trp Leu Arg Arg Leu 1280 1285 Ser Leu Ciu Leu Leu Lys Asp Ser 1290 1295 -38- TCA TCG CCC TCC CTG CGC Ser Ser Pro Ser Leu Arg TCC TGC TGG GCC CTG 3915 Ser Cys Trp Ala Leu 1305 GCA CAG Ala Gin GCC TAC AAC Ala Tyr Asn 1310 CCG ATG 3942 Pro

MET

GCC

Ala

GAT

Asp

ATC

le 1350

GAC

AspI 1300 AGG GAT Arg Asp 1315 CAA CAG Gin Gin CTC TTC AAT GCT Leu Phe Asn Ala 1320 GAT GAG CTC ATC Asp Giu Leu Ile GCA TTT GTG 3969 Ala Phe Val AGA AGC ATC 4023 A~rg Ser Ile 1340 TCC TGC TGG Ser Cys Trp 1325 TCT GAA Ser Giu CTG AAT GAALZ 3996 Leu Asn Giu 1330 TCA C.AA GAC 4050 Ser Gin Asp

GAG

Giu TTG GCC CTC Leu Ala Leu 134~ GCT GA.A Ala Giu kAG GGC Gly 1335 GTC ACA CAG ACC Val Thr Gin Thr 1355 CCC CTG CCA CTG Pro Leu Pro Leu

ACC

Thr :CT TTA 4077 eu Leu AGA GCT Arg Ala 1370 GCC AAG TGC CGA GCA Ala Lys Cys Ara Ala 1390 AGA GAT 4131 Arg Asp 1375 TAT GCC 4185 Tyr Ala GCC ATT 4239 Ala Ile AAC TTG GCT Asn Leu Ala 1360 GAC AAT GGC Asp Asn Gly AAA GCA CTA Lys Ala Leu 1395 CTA GAA TCT Leu Giu Ser

GAA

Giu ATT (.iTI CTG Val Leu 1380 TTC ATG GASA Phe MET Giu 1365

CTG

Leu CAC AGT 4104 His Ser CAC TAC AA.A GAA His Tyr Lys Giu 1400 CTC ATC AGC ATT GGT GA-' G 4158 Gly Glu 1385 CTG GAG 4212 Leu Giu AAT AAT 4266 TTC CAG Phe Gin 140~ .kAG CTA Lys Leu 5 AAA GGC CCC Lys Gly Pro

S

S.

*5

S

40 TTT GGA Phe Gly 1440 45 GAT GCC CAG CAG CCG Gln Gin Pro 1425 GAG CTG GAG Glu Leu Gia CTT GTG GCC ACC CCT Thr Pro 1410 GAG GCA Giu Ala ATC CAG C Ile Gin 1445 TAT GAC Tyr Asp L GCG GCC GGA 4293 kla Ala Gly 1430 ~CT ACC TGG 4347 lia Thr Trp AG AAS ATG 4401 ~ys Lys MET .465 GC CTC GAG 1415 GTG TTA GAA Val Leu Glu TAT GAG AAA Tyr Glu Lys 14150 GAC ACC AAC TAT GCC Tyr Ala 1435 1420 ATG A.AA CAC 4320 MET Lys -His

CTG

Leu CAC GAG TGG GAG 4374 His Giu Trp Giu 1455 Asp Ala Leu Val Ala 4428 Asp Thr Asn Lys Asp Asp Pro Giu 1460 CTG ATG CTG GGC Leu MET Leu Gly 1470 GGG

GA

CGC ATO CGC GCC TTG 1475 TGG GGT CAA CTC 4482 Trp Gly Gin Leu 1490 Arg 1480 MET Arg Cys Leu Giu Ala Leu Gly Giu 1485 -39- CAC CAG CAG TGC TGT GAA A.AC TGG ACC CTC GTT AAT CAT GAG ACC 4509 His Gin Gin 1495 Cys Cys Glu Lys Trp Thr Leu Val Asn Asp Giu Thr 1500 1505 CAA GCC AAC 4536 Gin Ala Lys 1510 GAC ACC ATC 4590 Aso Ser MET

ATGZ

MET

CAA

Ciu 1530 GCC CCC ATC CCT Ala Arg MET Ala 1515 CAA TAC ACC TCT Ciu Tyr Thr Cys CCT CCA CCT CCA TCC CCT TTA CCT CAG TCC 4563 Ala Ala Ala Ala Trp 1520 ATC ATC CCT CCC CAC 4617 MET Ile Pro Arg Asp Gly Leu ACC CAT Thr His 1540 Cly Gin Trp 1525

CAT

Asp GCT GTC CTG Ala Val Leu 155( AAG CCC AGG Lys Ala Arg ACT CCC GCA Ser Arg Ala 1585 GTT ATC CAC Val Ilie Gin GCA CTC Ala Leu CAC CTG Asp Leu 1570 TAT GCC Ty r Gly 1535 CAT CAC GAC CTC 4671 His Gin Asp Leu 1555 CTC CAT GCT G.k.A 4725 Leu Aso Ala Ciu

TTC

Phe

TCC

Ser TTG GCA Leu Ala 1560 CCC GCA TTT Cly Ala Phe 1545 CAA CAG TGC Gin Gin Cys TAT ACA 4644 Tyr Arg ATT CAC 4698 le Asp 1565 ACT TAC 4752 Ser Tyr TTA ACT Leu Thr 1575

GCA

Ala

ATG

MET

0 0* *0 0* .0* 0 *000 *0**00 *0 0 00 0

CC

Ala GCA CGA GAG Aia Gly Giu 1580 TCC GAG CTG Ser Giu Leu 30 ATG CTT TCT 4779 MET Val Ser 1590 CTC CCC GAG 4833 Val Pro Glu TOC CAC ATG CTC Cys His MET Leu 1595 CCA CGA GAG ATC Arg A-rg Clu Ile TAC AAA CTT Tyr Lys Leu GAG GAG 4806 ATC CC Ile Arg Glu Glu 1600 CAC ATC TGC 4860 Gin Ile Trp 35

TGG

Trp 1620 40 1605 GaAG AGA Giu Arg CTG CAG CCC TGC Leu Gin Gly Cys 1625 1610 CAG CGT 4887 Gin Arg ATC GTA ie Val 1630 CAT GA His Giu ACC CTG GAG GAC Ciu Asp GAC ATG Asp MET 1650 GCT CTT ATG CTG CCC TCC MET Val Arg Ser 1640 TAT GCA AGC CTC Tyr Ala Ser Leu CTT GTC Leu Va TGC GCC Cys Cly 1660 GGA GTT CTC AGC CCT 4941 Val Ser Pro 1645 .AAG ACT GC 4995 Lys Ser Cly CAT CCC TCT 5049 1615 TGC CAG AAA Trp Gin Lys 1635 ACA ACC TGG Arg Thr Trp CCT CAT AAA Ala His Lys 1670 CAT CCT CTC ALTC CTT 4914 Ii&- Leu CTC AAG 4968 Leu Lys 1655 ACT TTA 5022 rhr Leu :CA ACA Arg Leu 1665 CCC CAA Ala Leu CTT GAC

CTG

Val TTC CTC CTC Leu Leu Leu Gly Val Asp Pro Ser Arg Gin Leu Asp His Pro Leu Pro Thr 1675 1680 1685 1690 GTT CAC CCT CAG CTG Val His Pro Gin Val 1695 AAG ATC GAT GCC TTC Lys Ile Asp Ala Phe ACC TAT GCC TAC ATG 5103 Thr Tyr Ala Tyr MET 1700 AAkA AAZC Lys Asn ATG TGG AAG MET Trp Lys 1705 AGT1 GCC CGC 5130 Ser Ala Arg

CAG

Gin 1710 GCC CAG CAT GCC Ala Gin His Ala 1730 CTC ATG GCC CGA Leu MET Ala Arg 171c- ATC GCT Ile Ala CAC ATG CAG 5157 His MET Gin ACT GAG GAC 5211 Thr Giu Asp 1735 CTG AAA CTT 5265 Leu Lys Leu CAT TTT GTC His Phe Val 1720 CAG CAG CAT Gin Gin His GGA GAG TGG Gly Giu Trp 1755 CTG CAG TAC Leu Gln Tyr CAG ACC ATG CAG CAA CAG 5184 Gin Thr MET Gin Gin Gin 1725 AAG CAG GAA CTG CAC A.AG 5238 Lys Gin Giu Leu His Lys 1740 1745 CAG CTG A.AT CTA CAG GGC 5292 Gin Leu Asn Leu Gin Gly 1760 TAC AGC GCC GCC ACA GAG 5346 Tyr Ser Ala Ala Thr Glu TGC TTC Cys Phe ATC AAT GAG le Asn Glu 1765 CAC GAC CGC His Asp Arg 1750C AGC ACA Ser Thr AGC TGG Ser Trp 1785 ATC CCC AAA GTG 5319 Ile Pro Lys Val 1770 TAC A-AG GCC TGG 5373 Tyr Lys Ala Trp 0* 0*

CAT

His

GCG

Al a 1775

TGG

Trp GCA GTG Ala Val 1795 1780 ATG AAC TTC GAA 5400 MET Asn Phe Glu 30 GCT GTG CTA Ala Val Leu 1800 CGT CAT GCC Arg His Ala CAC TAC AAA CAT His Tyr Lys His 1805 AGC CGG GCC AAC Ser Gly Ala Asn 1790 CAG AAC 5427 Gin Asn ATC ACC 5481 Ile Thr CAA GCC CGC Gin Ala Arg 1810

GAT

Asp GAG AAG AAG Giu Lys Lys 1815 AAA CTG 5454 Lys Leu

AAC

As n 182( CCC ACT GCC Ala Thr Ala GAG AGC ACC Clu Ser Thr 1855 CAT CTC TCC ACC ACC Thr Thr 184C GAG AAC Clu Asn 1825 ACT GCC AGC ACC 5535 Thr Ala Ser Thr GCC ACC ACT Ala Thr Thr 1830 CCC AGC AAC Gly Ser Asn

GAG

Ciu 184

TCG

Se r GCC GCC Ala Ala ACT GAG Ser Giu 1850 AAG AAG Lys Lys ACC CCC Ser Pro 1860 ACC CCA 5589 Thr Pro

CCC

Pro CTC CAG Leu Gin 1865 CCT GCC ACC ACG GCC 5508 Thr *Thi- Ala 1835 AGC GAG CC 5562 Ser Giu Ala GTC ACT GAG 5616 Val Thr Glu 1870 CCC TTC TTC AAA ACC CTC CTC ATC TAC ACG CTC 5643 GTC CAG Asp Leu Ser Lys Thr Leu Leu MET Tyr Thr Val Pro Ala Val Gin Gly Phe Phe 1875 1n ioo1 ac -41- GGT TCC Arg Ser 1890 ACC TTA Thr Leu ATC TCC Ile Ser TGG TTT Trp Phe 1910 AAA GCG Lys Ala TTG TCA Leu Ser 189~ GAT TAT Asp Tyr ATC CAG Ile Gin 1930

CGA

Arg GGC AAC 5697 Gly Asn GGT GAG TGG 5751 Gly His Trp 1915 ATT GAT ACC 5805 Ile Asp Thr AAC CTC CAG GAT ACA Asn Leu Gin Asp Thr 1900 CCA GAT GTC AAT GAG Pro Asp Val Asn. Giu 1920 TGG GTA CAG GTT ATA Trp Leu Gin Vai Ile GGG GTG Gly Val CTC AGA GTT CTG 5724 Leu Arg Val Leu 1905 GGG TTA GTG GAG 5778 Ala Leu Val Giu 1925 GGT GAG GTC ATT 5832 Pro Gin Leu Ile 1940 GAG GAG GTT GTG 5886 His Gin Leu Leu 1960 CTG ACA GTG GCT 5940 Leu Thr Vai Ala GGA AGA ATT Ala Arg Ile 1945

GAT

Asp 1935

AG

Thr

ACA

Thr

S.

S

S

*5

S

*5

S.

.5*S

S

S

*5 25

TCT

S er 1980 30 GAG ATT GGT CGG Asp Ile Gly Arg 1965 AAG TGT AGG AG Lys Ser Thr Thr GGG AGA GGG TTG 5859 Pro Arg Pro Leu 1950 TAG GAG GGG GAG 5913 Tyr His Pro Gin 1970 ACA GGG GGG GAG 5967 Thr Ala Arg His GTG GGA Val Gly GGG GTG Ala Leu A.AT GGA Asn Ala 1990 ATC TAG GGA Ile Tyr Pro 1975

GGT

Arg 1955 GTG ATT Leu Ile GCC AAC Ala Asn 1985 ATG TGT GAG GAG MET Gys Giu His 2000 GTG ATC GCGA GTG Leu Ile Arg Val

AGG

Ser

GGG

Ala AAG AGG GTG GTG 6021 Asn Thr Leu Val 2005 ATG GTG TGG GAT 6075 Ile Leu Trp His TTT GGG GAA AGG 6129 Phe Gly Giu Arg 2040 CAG GAG GGG ATG Gin Ala MET 2010 ATG TGG GAT MET Trp His AAG ATT GTG AAG AAG 5994 Lys Ile Leu Lys Asn 1995 ATG GTG AGG GAG GAG 6048 MET Val Ser Giu Glu 2015 GAA GGG GTG GAA GAG -6102 Giu Gly Leu.G16.- Giu

GAG

Glu GGA TGT Ala Ser 2035 2020 GGT TTG TAG Arg Leu Tyr 2025 AAG GTG Asn Val

AA

Lys5 2045 2030 GGG ATG TTT Gly MET Phe GAG GTG GTG 6156 Giu Val Leu 2050 GAG GGG TTG GAT GGT ATG ATG GAA CGG GGC GGG GAG AGT GTG AAG GAA AGA TGG 6183 6210 Glu Pro Leu His Ala MET MET Giu Arg Gly Pro Gin Thr Leu Lys Giu Thr Ser 2055 2060 2065 TTT AAT GAG GGG TAT GGT GGA GAT TTA ATO GAG GGG CAA GAG TGG TGG AGG AAG 6237 .6264 Phe Asn Gin Ala Tyr Gly Arg Asp Leu MET Glu Ala Gin Giu Trp Gys Arg Lys 2070 2075 2080 2085 -42- TAC ATG AAA TCA GGG AAT GTC AAG GAC CTC ACC CAA GCC TGG GAC

CTC

Tyr MET Lys Ser 2090 Gly Asn 6291 Val Lys Asp 2095 TCA AAG CAG 6345 Ser Lys Gin CAT GTG His Val CAA TAT Gin Tyr 2125 TTC CGA CGA Phe Arg Arg 211 GTT TCC CCA Val Ser Pro

ATC

Ile 0 Leu Thr Gin CTG CCT CAG Leu Pro Gin 2115 Ala Trp Asp Leu 2100

GGA

G iy ACA TAT GAC CCC Thr Tyr Asp Pro 2145 CAA GTC ATC ACA Gin Vai Ile Thr AAA CTT CTG ATG TGC 6399 Lys Leu Leu MET Cys 2130 AAC CAG CCA ATC ATT 6453 Asn Gin Pro Ilie Ile 2150 TCC AAG CAG AGG CCC 6507 Ser Lys Gin Arg Pro CGG GAC Arg Asp 2135 CTC ACA TCC TTA Leu Thr Ser Leu 2120 CTT GAA TTG GCT Leu Giu Leu Aia TAT TAT 6318 Tvr Tyr 2105 GAG CTG 6372 Giu Leu GTG CCA 6426 Val Pro 2140 CCG TCT 6480 Pro Ser

CC

Arg

CGG

Arg ATT CAG TCC ATA Ile Gin Ser Ile 2155

GCA

Ala

TTG

Leu 2160 25 AAA TTG Lys Leu 2165 0* 00 0 0 00 0 0 ~0 0 0* 0* *000 0 0**0 0 00* 0 *00* *000 0 *0 00 0 00 000.

0 *000 AAC GGA CAT GAG Asn. Gly His Giu 2180 GAG CGT GTG ATG Glu Arg Val MET

TTT

Phe

CAG

Gin GTT TTC CTT CTA 6561 Val Phe Leu Leu 2185 CTC TTC GGC CTG 6615 Leu Phe Giy Leu

AAA

Ly s

GTT

Vali 2170 GGC CAT GAA Giy His Giu 2190 AAC ACC CTT Asn Thr Leu ACA CTT ATO GGC AGC 6534 Thr Leu MET Gly Ser 2175 GAT CTG CGC CAG GAT 6588 Asp Leu Arg Gin Asp 2195 CTG GCC A.AT GAC CCA 6642 Leu Aia Asn Asp Pro ACA TCT CTT Thr Ser Leu 2215

CGG

Arg 2200 2205 2210

AAA

Ly s 40

ACC

Thr 45

ATC

Ile 2250

ATG

AAC TCG GGC CTC Asn Ser Giy Leu 2235 CGG GAC TAC AGG Arg Asp Tyr Arg TTG CGG ATG GCT AAC CTC Asn Leu 2220 ATT GGC Ile Clv GAG A-AG Giu Lys 2255 CCC GAC AGC ATC 6669 Ser Ile CAG AGA TAC GCT GTC Gin Arg Tyr Ala Val 2225 CCC CAC TGT GAC ACA Pro His Cys Asp Thr TGG GTT 6723 Trp Vai 2240 AAG AAG ATC 6777 Lys Lys Ile TAT GAC CAC 6831 CTT CTC Leu Leu 2260 TTG ACT 2245 AAC ATC Asn Ile CTG ATG ATC CCT TTA TCG ;696 Ile Pro Leu.- Ser 2230 CTG CAC GCC CTC 6750 Leu His Aia Leu GAG CAT CGC ATC 6804 Glu His Arg Ile 2265 CAG AAG GTG GAG MET Leu Arg MET Aia Pro Asp Tyr Asp His Leu Thr Leu MET Gin Lys Val Giu 2270 2275 2260 2285 -43- GTG TTT GAG CAT GCC GTC AAT AAT ACA GCT GGG GAC GAC CTG GCC AAG 6885 CTG CTG 6912 Leu Leu Val Phe Glu His Ala Val 2290 AGC CCC AGC Ser Pro Ser TGG CTG AAA Trp Leu Lys 2305 Asn Asn Thr TCC GAG GTG 6939 Ser Glu Val 2310 Ala Gly 2295 TGG TTT Trp Phe Asp Asp GAC CGA Asp Arg 2315 Leu Ala 230( AGA ACC Arg Thr Lys 0 CGT TCT Arg Ser CAC CCA His Pro 2340 TTT GGG Phe Gly TTA GCG GTC Leu Ala Val 2325 AAT TAT ACC 6966 Asn Tyr Thr 2320 GGA CAT AGA 7020 Cly Asp Arg ATG TCA ATG GTT GGG 6993 MET Ser MET Val Gly 2330 ATG CTG GAC CGT CTG 7047 MET Leu Asp Arg Leu TAT ATT TTA GGC CTC Tyr Ile Leu Gly Leu 2335

TCC

Ser

GAC

Aso AAC CTG Asn Leu AGT GGG AAG Ser Gly Lys 234E TGC TTT GAG Cys Phe Glu 0b Se *5 S S

SS

5O

S.

S S .4 0 4855

C

0605 CCA TTT Pro Phe 236(

AGA

Arg 0 CTA ACA AGA Leu Thr Arg 2380 AGA ATC ACA Arg Ile Thr 5 GTT GCT ATG 7101 Val Ala MET 2365 ATG TTG ACC 7155 MET Leu Thr

ACC

Thr 235

CGA

Arg 3 GAG AAG Clu Lys 2370 ATG GAG MET Glu ATC CTG CAC ATT CAC 7074 Ile Leu His Ile Asp 2355 TTT CCA GAG AAC ATT 7128 Phe Pro Glu Lys Ile 2375 GTT ACA GGC CTG GAT 7182 Val Thr Gly Leu Asp AAT GCT Asn Ala 2385 2390 GGC AAC TAC Cly Asn Tyr 2395 GAC ACT GTC Asp Ser Val

TGC

Cys 2400 CAC ACA 7209 His Thr GTG ATC GAG GTC Val MET Glu Val 2405

CTG

Leu

ATG

MET

AGC CTC Arg Leu 2430 45 TCC TAC Ser Tyr

ATC

MET

2415

GAC

Asp GCC CTG CTC GA GCC TTT 7263 Ala Val Leu Clu Ala Phe 2420 ACA AAT ACC AAA GGC ALAC 7317 Thr Asn Thr Lys Cly Asn

GTC

Va1 Ly s Lys TAT GAC CCC Tyr Asp Pro 2425 CGA TCC CGA Arg Ser Arg CGA GAG CAC AAG 7236 Arg Glu His Lys 2410 TTC CTG AAC TGG ?290 Leu Leu Asri-Trp 65 0 55 0 243 j TCT CCT GGC CAC TCA Ser Ala Cly Gin Ser 2450 CAT AAG AAA ACG GGG His Lys Lys Thr Gly 2470 2440 TTC GAC CGT CTG ACG AGC Thr Arg 244E GAA CTT ACC GAT 7344 Thr Asp GGA GAG 7398 GTC CAA ATT 7371 Val Clu le 2455 ACC ACA CTG Leu Asp Gly Val Glu Leu Cly Clu 2460 2465 CCA GCC Pro Ala 7425 CCA CAA TCT ATT CAT TCT TTC ATT 7452 Thr Thr Val Pro Glu Ser Ile His Ser Phe Ile 2475 2480 -44- GGA GAC GGT Gly Asp Gly 2485 TTG GTG AAA CCA GAG GCC 7479 Leu Val Lys Pro Glu Ala 2490

CTA

Leu

AAC

Asn AGG GTT Arg Val CGA GAT AAG Arg Asp Lys 2505 GAT GTT Asp Val 2520 CTC TGC Leu Cys CCA ACG CAA GTT Pro Thr Gin Val 2525 CAG TGC TAT ATT Gin Cys Tyr Ile 2540 CTC ACT GGT CGG 7533 Leu Thr Gly Arg 2510 GAG CTG CTC ATC 7587 Glu Leu Leu Ile GGC TGG TAC CCT 7641 Gly Trp Tyr Pro 2545 AAT AAG AAA Asn Lys Lys 2495 GAC TTC TCT Asp Phe Ser GCT ATC Ala Ile CAT GAT His Asp 2515 ACA TCC Thr Ser CAG ATT ATT 7506 Gin Ile Ile 2500 GAC ACT TTG 7560 Asp Thr Leu CAT GAA AAC 7614 His Glu Asn 2535 AAA CAA GCG Lys Gin Ala 2530 TTC TGG TAA Phe Trp *c C INFORMATION FOR SEQ. ID NO: 2: SEQUENCE CHARACTERISTICS: LENGTH: 1140 amino acids TYPE: nucleic acid 25 STRANDEDNESS: sense orientation of the doublestranded DNA strand TOPOLOGY: linear (ii) MOLECULE TYPE: sense orientation of double-stranded cDNA to mRNA DESCRIPTION: Sequence No. 2 illustrates a portion of the GST-SEP fusion protein beginning at the linker sequence between the GST and portions of the protein.

(iii) HYPOTHETICAL: no (iv) ANTISENSE: no (vi) ORIGINAL SOURCE: ORGANISM: Molt 4 human T-cell leukemia cells 40 STRAIN: ATCC Strain CRL 1582 (xi) SEQUENCE DESCRIPTION: SEQ. ID NO: 2 ATG TCC CCT ATA CTA GGT TAT TGG AAA ATT AAG GGC CTT GTG CAA CCC ACT CGA 27 54 MET Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gin Pro Thr Arg 1 5 10 CTT CTT TTG GAA TAT CTT GAA GAA AAA TAT GAA GAG CAT TTG TAT GAG CGC GAT 81 108 Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp 25 30 GAA GGT GAT AAA TGG CGA AAC AAA AAG TTT GAPA TTG GGT TTG GAG TTT CCC A-AT Giu Gly Asp CTT CCT TAT Leu Pro Tyr CGT TAT ATA Arg Tyr Ile Ly s Trp Arg Asn Lys GGT GAT Giy Asp Ly s 45 Phe Giu Leu TAT ATT Tyr Ile GCT GAC Ala Asp

GAT

Asp 60 Gly Leu CAG TCT Gin Ser GTT AAA TTA ACA 189 Vai Lys Leu Thr 65 AAG CAC AAC Lys His Asn 80 GA.A GGA GCG Giu Giy Aia

GAG

Glu

ATT

Ile TCA ATG CTT Ser MET Leu ATG TTG 243 MET Leu GTT TTG 297 Vai Leu 100 GGT GGT TGT CCA Giy Giy Cys Pro 85 GAT ATT AGA TAC Asp Ile Arg Tyr Giu Phe Pro Asn ATG 0CC ATC ATA 216 MET Ala Ile le AAA GAG CGT

GCA

270 Lys Giu Arg Ala GGT OTT TCG AGA 324 Gly Vai Ser Arg ATT GCA TAT Ile Aia Tyr 110 25

CCT

Pro 30

GGT

Gly 145 35

TTA

Leu

AGT

Ser

CTG

Leu i30 AAA GAC Lys Asp AA-A ATG Lys MET

TTT

Phe 115 GAA2 Giu

ACT

351 Thr CTC AAA GTT Leu Lys Val 120 CGT TTA TGT Arg Leu Cys GAT TTT Asp Phe CAT A-N His Lys 140 105 CTT AGC AAG CTA 378 Leu Ser Lys Leu 125 ACA TAT TTA AAT 432 Thr Tyr Leu Asn GAA ATG Glu MET GAT CAT Asp His TTC GAA GAT 405 Phe Glu Asp 135 GTA ACC CAT CCT Val Thr His Pro i50 GAC CCA ATG TGC Asp Pro MET Cys

GAC

Aso

CTG

Leu TTC ATG TTG 459 Phe MET Leu i55 GAT GCG TTC 513 Asp Ala Phe

TAT

Tyr

GAC

Asp GCT CTT Aia Leu TTA GTT Leu Val

GAT

Asp 160 GTT GTT 486 Val Val TAC ATG Tyr MET A-AA CGT Lys Arg ATA GCA Ile Ala 200 CCA AAA 165 CCA AAA Pro Lys 175 170 ATT GAA GCT ATC Ile Giu Ala Ile 185 TGG CCT TTG CAG Trp Pro Leu Gin TCG GAT CTG GTT

CCA

Pro CAA ATT GAT 567 Gin Ile Asp 190 TGG CAA GCC 621 Trp Gin Ala CGT GGT GGA 675

AAG

Lys

TAC

Ty r ACG TTT Thr Phe 210 TCC CCG TTG AAA TCC Leu Lys Ser 195 GGT GGT GGC Gly Gly Gly GGA ATT TCC TGT TTT AAA 540 Cys.Phe- Lys 180 AGC AAG TAT 594 Ser Lys Tyr GAC CAT CCT 648 Asp His Pro 215 GGT GGT GGT Pro Lys Ser Asp Leu Val Pro Arg Gly Gly Ser Pro Gly Ile Ser Gly Gly Gly 220

I

-46- GGT GGT GGA ATT CTA GAC GAC TCC ATG AGC TTC AAG TAT GCA AGC CTG TGC GGC Gly 235 Gly Gly Ile Leu Asp 240 Asp Ser AAG AGT GGC AGG CTG Lys Ser Gly Arg Leu 255 GAT CCG TCT CGG CAA Asp Pro Ser Arg Gin GCT CTT GCT Ala Leu Ala 260 CTT GAC CAT Leu Asp His MET Ser CAT AAA 783 His Lys CCT CTG 837 Pro Leu 280 Phe 245 Lys Tyr Ala Ser Leu Cys Gly 250 TTG CTC CTG GGA GTT 810 Leu Leu Leu Gly Val ACT TTA GTG Thr Leu Val 265 CCA ACA GTT Pro Thr Val CAC CCT His Pro 285 270 CAG GTG ACC 864 Gin Val Thr TAT GCC Tyr Ala 290 TAC ATG Tyr MET 275 AAA AAC Lys Asn TTT GTC Phe Val

ATG

MET

295

TGG

Trp

AAG

891 Lys

CAC

His 9 4'

ACT

Thr 325 ATG CAG CAT MET Gin His 310 GAG GAC CAG Glu Asp Gin CAG ACC ATG 945 Gin Thr MET 315 AAG CAG GAA 999 Lys Gin Glu AGT GCC Ser Ala CAG CAA Gin Gin CTG CAC Leu His 335

CGC

Arg 300

AAG

Lys CAG GCC CAG Gin Ala Gin 320 AAG CTC ATG Lys Leu MET

ATC

Ile GAT GCC TTC CAG 918 Asp Ala Phe Gin 305 CAT GCC ATC GCT 972 His Ala Ile Ala CAG CAT Gin His 330 GCC CGA Ala Arg 340 TGC TTC 1026 Cys Phe CTG AAA CTT Leu Lys Leu 345 CCC AAA GTG Pro Lys Val

GGA

Gly

GAG

Glu TGG CAG CTG AAT 1053 Trp Gin Leu Asn 350 TAC TAC AGC GCC 1107 Tyr Tyr Ser Ala

CTA

Leu

GCC

Ala 370 CAG GGC ATC Gin Gly Ile 355 ACA GAG CAC Thr Glu His

AAT

Asn

GAG

Glu AGC ACA ATC 1080 Ser Thr Ile 360 AGC TGG TAC 1134 Ser Trp-Tyr CTG CAG Leu Gin 365 GAC CGC Asp Arg 375 AAG GCC Lys Ala 330

TGG

Trp

CAT

His

CAT

His

AAC

Asn 415 CAG AAC CAA Gin Asn Gin 400 ATC ACC AAC Ile Thr Asn GCG TGG Ala Trp GCC CGC Ala Arg GCC ACC Ala Thr 420

GCA

Ala 385 GTG ATG 1161 Val MET AAC TTC GAA Asn Phe Glu 390 AAG AAA CTG Lys Lys Leu

GCT

Ala

GTG

Val CTA CAC TAC AAA 1188 Leu His Tyr Lys 395 GCC AGC GGG GCC 1242 Ala Ser Gly Ala GAT GAG AAG 1215 Asp Glu Lys 405 ACT GCC GCC 1269 Thr Ala Ala ACC ACG Thr Thr 425

GCC

Ala CGT CAT Arg His 410 GCC ACT Ala Thr GCC ACC Ala Thr 430 ACC ACT 1296 Thr Thr -47- GCC AGC ACC GAG GGC AGC AAC AGT GAG AGC GAG GCC GAG AGC ACC 1323 Ala Ser Thr Glu 435-.

CCC ACC CCA TCG Pro Thr Pro Ser G ly

CCG

Pro Ser- Asn Ser Glu 440 CTG CAG AAG AAG 1377 Leu Gin Lys Lys Ser

GTC

Va 1 460 Glu Ala Giu Ser 445 ACT GAG GAT CTG Thr Giu Asp Leu Thr

TCC

GAG AAC AGC 1350 Glu Asn Ser 450 AAA ACC CTC 1404 Lys Thr Leu CTG ATG Leu MET 470 TAC ACG Tyr Thr 455 GTG CCT GCC Val Pro Ala 475 GTC CAG 1431 Val Gin GGC TTC TTC CGT Gly Phe Phe Arg 480 AGA GTT CTC ACC Arg Val Leu Thr

TCC

Ser

TTA

Leu 500 465 ATC TCC TTG TCA 1458 Ile Ser Leu Ser 485 TGG TTT GAT TAT 1512 Trp Phe Asp Tyr

CGA

Arg GGC AAC AAC CTC Gly Asn Asn Leu 490 CAC TGG CCA GAT His Trp Pro Asp

CAG

Gin

GTC

Val1 GAT ACA CTC 1485 Asp Thr Leu 495 AAT GAG GCC 1539 Asn Glu Ala

GGT

G ly 505 25 TTA GTG Leu Val 515 GAG GGG Giu Gly ATT GAT Ile Asp AGA CCC Arg Pro

ACC

Thr 525 TGG CTA Trp Leu 510 CAG GTT ATA CCT 1593 Gin Val Ile Pro 1530 CGT CTC ATT CAC 1647 Arg Leu ile His GTG A.A Val Lys AGA ATT Arg Ile

GCC

Ala 520 ATC CAG 1566 Ile Gin

CAG

Gin CTC ATT Leu Ile CTT CTC Leu Leu

GCA

Ala 535 GAT ACG CCC 1620 Asp Thr Pro 540 GGT CGG TAC 1674 Gly Arg Tyr TTG GTG GGA Leu Val Gly 545 CAG GCC CTC Gin Ala Leu

CAG

Gin 550 ACA GAC ATT Thr Asp Ile 555 CAC CCC His Pro 560 ATC TAC Ile Tvr CCA CTG 1701 Pro Leu

GCC

Ala

CGG

Arg ACC CTG Thr Leu 595 CTC TGG Leu Tro CAC AAT His Asn 580 GTC CAG Val Gin CAT GAG His Giu 615 GCA GCC Ala Ala CAG GCC Gin Ala 600 ATG TGG MET Trp 565 ACA GTG GCT TCT Thr Vai Ala Ser 570 CTG AAG AAC ATG Leu Lys Asn MET

AAG

Lys

TGT

AAC AAG ATT 1755 Asn Lys Ile 585 ATG ATG GTG 1809 MET MET Val CAT GAA GGC 1863 His Glu Gly 620 AGC GAG Ser Glu 605 CTG GAA Leu Giu GAG CTG Giu Leu GAG GCA Giu Ala 625 TCT ACC ACG ACA '1728 Ser Thr .Thi Thr 575 GAG CAC AGC AAC 1782 Giu His Ser Asn 590 ATC CGA GTG Ile Arg Val 610 TCT CGT TTG Ser Arg Leu GCC ATC 1836 Ala Ile TAC TTT 1890 Tyr Phe 630 -48- GGG GAA AGG A-C GTG AA GGC ATG TTT GAG GTG CTG GAG CCC TTG CAT GCT ATG Gly Giu ATG GAA MET Glu 650 Arg Asn Val Lys 635 Gly MET Phe Giu Val 640 Leu Giu Pro 1944 His Ala MET Leu 645 CGG GGC Arg Gly CCC CAG ACT CTG AAG 1971 Pro Gin Thr Leu Lys 655 GAG GCC CAA GAG TGG 2025 Giu Ala Gin Giu Trn

GAA

Giu

TGC

Cy s ACA TCC TTT Thr Ser Phe 660

AAT

Asn CAG GCC TAT GGT 1998 Gin Ala Tyr Gly 665 AAA TCA GGG AAT 2052 Lys Ser Gly Asn

CGA

Arg

GTC

Val1 685 GAT TTA ATG Asp Leu MET 670 AAG GAC CTC Lys Asp Leu ACC CAA Thn Gin 690 675 GCC TGG GAC 2079 Ala Trp Asp

AGG

Arg TCA AAG CAG CTG Ser Lys Gin Leu 705 CTT CTG ATG TGC Leu Leu MET Cys

CCT

Pro CAG CTC ACA TCC 2133 Gin Leu Thr Ser 710 GAC CTT GAA TTG 2187 Aso Leu Giu Leu CTC TAT Leu Tyr 695 TTA GAG Leu Giu GCT GTG Ala Val 730 GCA CCG Ala Pro AAG TAC ATG Lys Tyr MET 680 TAT CAT GTG Tyr His Val TTC CGA Phe Aing 700 GTT TCC Val Ser CTG CA TAT Leu Gin Tyr 715 CGA ATC 2106 Arg Ile CCA A.AA- 2160 Pro Lys 720 CCC AAC 2214 Pro Asn

CGG

Arg CAG CCA Gin Pro 740 ATC ATT Ile Ile

AAG

Ly s

CAG

Gin 4.

TTC CTT Phe Leu 775 45 TTC GGC Phe Gly AGG CCC Aing Pro 760 CTA AAA Leu Lys CTG GTT Leu Vai 795 725 CGC ATT CAG Arg Ile Gin 745 CGG AAA TTG Arg Lys Leu GGC CAT GAA Gly His Glu 780 AAC ACC CTT Asn Thr Leu

CCA

Pro

TCT

ACA CTT ATG 2295 Thin Leu MET 765 GAT CTG CGC 2349 Asp Leu Arg CTG GCC AAT 2403 Leu Ala Asn GGA ACA TAT Gly Thr Tyr 735

GAC

Asp TCC ATA 2241 Ser Ile 750 GGC AGC Gly Ser

CAG

Gin 785

GAC

Asp

GAT

Asp TTG CAA Leu Gin AAC GGA Asn Gly 770 GAG CGT Giu Arg GTC ATC ACA TCC 2268 Val Ile Thr Ser 755 CAT GAG TTT GTT -2322 His Giu .Ph6- Val1 GTG ATG CAG CTC 2376 Val MET Gin Leu 790 CTT CGG AAA AAC 2430 Leu Arg Lys Asn 810 TCG GGC CTC ATT 2484 Ser Gly Leu Ile 825

CCA

Pro ACA TCT Thr Ser 805 ACC

AAC

CTC AGC ATC CAG AGA TAC GCT GTC ATC CCT TTA TCG 2457 Leu Ser Ilie Gin Arg Tyr Ala Val Ile Pro Leu 815 820 Ser Thr Asn -49- GGC TGG Gly Trp 830 A.AG AAG Lys Lys GTT CCC CAC TGT GAC Val Pro His Cys Asp 835 ACA CTG 2511 Thr Leu CAC GCC CTC His Ala Leu 840 CAT CGC ATC His Arg Ile ATC CGG GAC TAC AGO GAG 2538 Ile Arg Asp Tyr Arg Giu 845 ATG TTG CGG ATG GCT CCG 2592 MET Leu Arg MET Ala Pro A-AG ATC OTT Lys Ile Leu GAC TAT Asp Tyr 865 850 GAO CAC Asp His AAT AAT ACA OCT Asn Asn Thr Ala 885 TOC GAO OTG TG Ser Olu Val Trp

TTO

Leu 000 G ly

TTT

Phe 905 CTC AkC ATC GAO 2565 Leu Asn Ile Giu 855 ACT OTO ATO CAG 2619 Thr Leu MET Gin 870 GAC GAC CTG GCC 2673 Asp Asp Leu Ala 890 GAC CGA AGA ACC 2727 Aso Arg Arg Thr A.AG GTG Lys Val 875

GAG

Glu

GTG

Val1 TTT GAG Phe Oiu CTO A-AA Leu Lys

CAT

His 880 0CC GTC 2646 Ala Val 860

AAO

Ly s

AAT

Asn CTO CTG TOO Leu Leu Trp 895 TAT ACC COT Tyr Thr Arg AOC CCC AGO 2700 Ser Pro Ser 900 OCO OTC ATG 2754 Ala Val MET TCT TTA Ser Leu 915

C

TCA ATO Ser MET 920 OTT GGG Val Gly TAT ATT Tyr Ile AGT 000 Ser Gly

TTA

Leu 925 GOC CTO 2781 Gly Leu 910 OGA OAT AGA Gly Asp Arg 930 CAC ATT GAC His Ile Asp

CAC

His

CCA

Pro TCC A.AC OTO ATO 2808 Ser Asn Leu MET 935 GAC TOO TTT GAO 2862 Asp Cys Phe Giu

CTO

Leu

OTT

Va 1 955 GAC COT CTO Asp Arg Leu 940 OCT ATO ACC Ala MET Thr ATO TTO ACC MET Leu Thr 975 TOC CAC ACA Cys His Thr CTG GAA 0CC

AAT

Asn CGA GAG Arg Oiu 960 OCT ATO Ala MET AAG ATC CTG 2835 Lys Ile Leu 945 AAO TTT CCA 2889 Lys Phe Pro GAO OTT ACA 2943 Oiu Val Thr 980 G AG AAZG Oiu Lys 965 GOC CTO Oly Leu GAO CAC O).u His 1000 CTG AAC

ATT

Ile

CCA

Pro TTT 000 Phe Oly 950 TTT AGA CTA Phe Arg Leu 970 AAC TAC AGA Asn Tyr Arg ACA AGA 2916 Thr- Arg ATC ACA 2970 Ile Thr 990 GTO ATO Va 1 MET 995 TTT OTC GAG OTO OTO COA 2997 Giu Val Leu Arg TAT GAC CCC TTO 3051 OAT GOC Asp Oly 985 AAO GAC Lys Asp TOO AGO AGT OTC ATO 0CC OTO 3024 Ser Val MET Ala Val 1005 CTO ATO GAC ACA AAT 3078 Leu Giu Ala Phe Vai Tyr Asp Pro Leu Leu Asn Trp Arg Leu MET Asp Thr Asn 1010 11 1020102 ACC AA Thr Lys TCA GTC Ser Val 1045 GGG ACC Gly Thr GGC AAC AAG Gly Asn Lys '103 0 CGA TCC Arg Ser CGA ACG 3105 Arg Thr 103~ GTG GAA 3159 Val Glu

AGG

Arg ACG GAT Thr Asp

GAA

Glu

ACA

Thr ATT TTG GAC GGT Ile Leu Asp Gly 1050 GTG CCA GAA TCT Val Pro Glu Ser CTT GGA GAG Leu Giy Glu 1055 TCC TAC TCT Ser Tyr Ser 1040 CCA GCC CAT Pro Ala His GCT GGC CAG 3132 Ala Gly Gin AAG AAA ACG 3186 Lys Lys Thr 1060 TTG GTG AAAk 3240 Leu Val Lys 1080 CGA GAT AAG 3294 Arg Asp Lys CCA GAG Pro Glu CTC ACT Leu Thr h1oO GAG CTG Glu Leu GGC TGG 1065 ATT CAT 3213 Ile His 1070 GCT ATC 3267 Ala Ile

TCT

Ser

CAG

Gin TTC ATT GGA GAC Phe Ile Gly Asp 1075 ATT ATT AAC AGG Ile Ile Asn Arg

GGT

G ly

GTT

Val GCC CTA AAT AAG AAA Ala Leu Asn Lys Lys 1085 GGT CGG GAC TTC TCT Gly Arg Asp Phe Ser 110 CTC ATC AAA CAA GCG Leu Ile Lys Gin Ala 1120 TAC CCT TTC TGG TA 1090 CAT GAT GAC ACT 3321 His Asp Asp Thr 5 ACA TCC CAT GAA 3375 TTG GAT GTT Leu Asp Val 1110 AAC CTC TGC 1095 CCA ACG Pro Thr CAG TGC CA.A GTT 3348 Gin Val 1115 TAT NTT 0*

C

C

S

C C

C.

C.

Thr Ser His Giu Asn Leu Cys Gin Cys Tyr Ile 1125 1130 Gly Trp Tyr Pro Phe Trp 1135 1140

Claims (24)

1. A protein of mammalian origin having a molecular weight of from about kDa to 800 kDa which binds to a GST-FKBP-Rapamycin complex, or a fragment of such a protein.

2. A protein as claimed in Claim 1 having a molecular weight of from about kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa. about 148 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP- Rapamycin complex.

3. A protein as claimed in Claim I or Claim 2 which is of human origin.

4. A recombinantly produced protein comprising at least part of the amino acid sequence of a protein of mammalian origin having a molecular weight of from about kDa to 800 kDa which binds to a GST-FKBP-Rapamycin complex.

5. A recombinantly produced protein as claimed in Claim 4 comprising at least part of the amino acid sequence of a protein of mammalian origin having a molecular weight of from about 50 kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa, about 148 kDa, about 208 kDa or about 210 which binds to a GST-FKBP-Rapamycin complex.

6. A recombinantly produced protein as claimed in Claim 4 or Claim which has at least a segment which has at least 20 (preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least preferably at least 80%, preferably at least 90%, preferably at least 95%) amino acid sequence homology with the protein of mammalian origin which binds to a GST-FKBP- Rapamycin complex.

7. A protein as claimed in any one of Claims 1 to 6 which includ s one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; -52- c) DXM.EAQE; and d) QLDHPLPTVHPQVTYAYM(K)

8. "cDNA which encodes at least part of the sequence of a protein of mammalian origin having a molecular weight of from about 50 kDa to 800 kDa which binds to a GST-FKBP-Raparnycin c-omplex-

9. cDNA as claimed in Claim 8 which encodcs at least part of the sequence of a protein of mammalian origin having a molecular wcight of from about 50 kDa to 500 kDa, suitably from about 100 kDa to 300 kDa., suitably about 125 kDa, about 148 kDa, about 208 kDa or about 2 10 kDa, which binds to a GST-FKB P-Rapamycin complex. A cDNA as claimed in Claim 8 or Claim 9 which encodcs at !east part of a 2 10 kDa protein including one or more of the following internal am-ino, acid sequences: a) ILLNIEHR; b) LTRPYMEP]LK; c) DXMEAQE; and d) QLD)HPLPTVHPQVTYAYM(K)

11. DNA encoding for at least part of the amino acid sequence of a protein of mammalian, origin having a molecular weight of from about 50 kDa to 800 kDa-which binds to a GST-FKBP-Raparnycin complex.

12. DNA as claimed in Claim I1I encoding for at least part of the: :mino acid sequence of a protein of mammalian origin having a molecular weight of froi about kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 12:5 kDa, about 148 kDa, about 208 kDa or about 2 10 kDa, which binds to a GST-FKBP-Raparnycin complex.

13. A DNA as claimed in Claim 11I or Claim 12 in which the protein of mammalian origin includes one or more of the following internal amino acid 'icquences: -53- a) ILLNIEHR; b) LrRPYMEPILK; c) DXvMAQE; and d) QLDHPLPTIVHPQVTYA YM(K)

14. Antisense RNA derived from a cDNA clone, the cDNA clo. e encoding for at least part of the amino acid sequence of a protein of mammalian orit in having a molecular weight of from about 50 kDa to 800 kDa which binds to a (.ST-FKBP- Rapamycin complex. Antisensc RNA as claimed in Claim 14, wherein the cDNA clone encodes for at least part of the amino acid sequence of a protein of mammalian origin having a molecular weight of from about 50 kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa, about 148 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex. *16. An antisense RNA as claimed in Claim 14 or Claim 15 derived from a cDNA clone encoding for at least part of a protein of mammalian origin including one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYNMPILK; c) DX'CvIBAQE; and d) QLDHPLPTVHPQVTYAYMK)

17. Antisense DNA derived from a cDNA clone, the cDNA clone encoding for aL least part of the amino acid sequence of a protein of mammalian origin having a molecular weight of from about 50 kDa to 800 kDa which binds to a GST-FKBP- Rapamnycin complex

18. Antisense DNA as claimed in Claim 17 wherein the cDNA clone encodes for at least part of the amino acid sequence of a protein of marmmalian origin having a molecular weight of from about 50 kDa to 500 kDa, suitably from about 100 kDa to 300 -54- kDa, suitably about 125 kDa, about 148 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex.

19. An antisense DNA as claimed in Claim 17 or Claim 18 derived from a cDNA clone encoding for at least part of the amino acid sequence of a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) A process for isolating a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP- Rapamycin complex from mammalian cells, the process comprising: a) lysing the mammalian cells in the presence of a buffering agent, a chelating agent, a protease inhibitor, and a reducing agent and preferably a low salt at a temperature which minimizes protein degradation, the lysing creating unbroken cells, cell nuclei, and lysatcs, the lysates including cellular membrane fractions and cellular debris; b) preclearing unbroken cells and cell nuclei from the lysates at a temperature which minimizes protein degradation to create a precleared lysate;. c) concentrating the cellular membrane fractions of the mammalian cells from the precleared lysate, the membrane fractions containing membrane proteins: d) solubilizing the membrane proteins in a buffer containing a detergent which solubilizes the proteins, without detrimentally denaturing the proteins, at a temperature which minimizes protein degradation, resulting in solubilized proteins and mammalian cellular debris; e) separating the solubilized proteins from the mammalian cellular debris; f) incubating a solution containing the solubilized proteins in a buffer, the buffer containing a buffering agent, a reducing agent, one or more protease inhibitor(s), divalent cations and preferably a salt, with an affinity matrix to absorb to the affinity matrix those proteins which have an binding affinity to the affinity matrix at a temperature which allows binding to the affinity matrix and minimizes protein degradation; g) separating the affinity matrix from the solution of step at a temperature which minimizes protein degradation, yielding a solution containing solubolized proteins which do not bind to the affinity matrix in step h) incubating the solution with Rapamycin or a Rapamycin analog (IC50 in LAF 500nM) complexcd to a fusion protein of FKBPl2+protein, the fusion protein enhancing the isolation of the desired about 125 kDa protein, about 148 kDa. about 208 kDa, or about 210 kDa yielding a mixture containing the desired proteins having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa. or S' about 210 kDa bound to a fusion FKBP protein :Rapamycin complexes or fusion FKBP S protein :Rapamycin analog complexes; i) incubating the mixture containing the desired proteins having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa bound to fusion FKBP protein :Rapamycin complexes or fusion FKBP protein :Rapamycin analog complexes with an affinity matrix which binds to the fusion protein at a temperature and for a time which allows the binding to the affinity matri-x and minimizes protein degradation, bound to a fusion FKBP protein :Rapamycin complexes or fusion FKBP protein :Rapamycin analog complexes; j) rinsing the affinity matrix containing the bound complexes with S* a buffer which dissociates binding of proteins other than the desired about 125 kDa. about 148 kDa, about 208 kDa, or about 210 kDa proteins; k) eluting the about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa protein: fusion FKBP protein:rapamycin complexes fusion or the 125 kDa protein:FKBP protein:rapamycin analog complexes from the affinity matrix with a buffer; -56- I) separating the proteins cluted in step by size.

21. A method for identifying an immunomodulatory or anti-tumor agent, comprising the steps of: a) combining a substance to be tested with a protein as claimed in any one of Claims 1 to 5 which binds to an FKBP-Rapamycin complex, the protein preferably being bound to a solid support: b) maintaining the substance to be tested and the protein (preferably bound to a solid support) of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether binding of the substance to be tested occurred in step

22. A method of Claim 21 in which the mammalian protein includes one or more of the following internal amino acid sequences: a) LLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K)

23. A method for identifying an immunomodulatory or anti-tumor agent, comprising the steps of: a) combining a substance to be tested with a protein as claimed in any one of Claimns 1 to 5 which binds to an FKBP-Rapamycin complex, the protein preferably being bound to a solid support: b) maintaining the substance to be tested and the protein (preferably bound to a solid support) of step under conditions appropriate for binding of the substance to be tested with the protein, and -57- C) dcterminina whether the presence of the substance to be tested modulated the activity of the protein which binds to an FKBP-Raipamnycin complex.

24. A method of Claim 23 in which the protein includes one or more of the following internal amnino acid sequences: a) lLLNrIEHR; b) LIRPYIMPILK; c) DXLMBAQE; and d) QLDHPLPTVHQVTYAYM(K) A method for detecting, in a biological sample, rapamycin, rapamycin analogs or raparnycin metabolites which, when coxnplexed with a FKBP, bind to a mammalian protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa. or about 210 kDa which binds to a GST-FKBP-Rapamycin complex. the method comprising the steps of: mxtre a) combining the biological sample with a FKBP to form a first mxueconraining, if rapamnycin, rapamycin analogs or rapamycin mnetabolites are present in the biological sample, a rapamycin:FKBP complexes, rapamnycin analog:FKBP complexes, or rapamycin metabolite-:FK<BP complexes; b) creating a second mixture by adding the first mixture to ai protein as claimed in any one of Claims 1 to 5 which binds to a GST-FKBP-Rapamycin complex, the protein preferably being bound to a solid support; OVO:c) maintaining the second mixture of step under conditions appropriate for binding the rapamycin:FKBP complexes, rapamycin aD;4og:FKBP complexes, or rapamycin metabolite:EKBP complcxes, if present, to the prctein which binds, to a GST-FKBP-Rapamycin complex; and d) determining whether binding of the rapamycin:FKBP :-ornplexes, rapamycin analog:FKBP complexes. or rapamycin mctabolite:FKB3P complexes and the protein occurred in step -58- 16. A method of Claim 25 in which the protEin includes one or more of the following internal amino acid sequences: a) TLLNIEHR; b) LTRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVI{PQVTYAYM(K)

27. A method for modulating the immune system of a marmmal in need thereof, the method comprising administering to the -mammral an inimunomodulatory amount of anrisense RNA derived from a cDNA clone which encodes for at least part of the amino acid sequence of a protein having a molecular weight of from about 50 kDa to 1000 kDa (preferably about 125 kDa, about 148 kDa, about 208 kDa, or about 2 10 kDa) which binds- to an FKBP-Rapamycin complex.

28. A method of Claim 27 in which the protein includes one or m-ore, of the following internal amino acid sequences: a) ILNIEHR; b) LIRPYMEPILK; c) DXM.EAQE; and d) QLD.HPIYTVHPQVTYAYM(K)

29. A method for modulating thc immune System of a mammal inf need rthcreof. the method comiprising administering to the mammal an ixnmunomnodulatory amount of antisense DNA derived from a cDNA clone which encodes for at least part of the amino acid sequence of a protein having a molccular weight of from about 50 kDa to '*~.1000 kDa (preferably about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa. )which binds to an FKBP-Rapamycin complex. A method of Claim 29 in which the protein includes one or more of the following internal amino acid sequences: a) ULLNEH; b) LIR.PYMIEPILK; -59- c) DXME-AQE; and d) QLDHPLPTVHPQVTYAYM(K)

331. protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ]LLNIEIHR, b) LIRPYMEPULK. c) DXIMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) 32. A recombinandy produced protein which includes one or more of the following internal amino acid sequences: a) ILLNTEH-R; b) L1RPYMEPmLK; c) DXMvEAQE; and d) QLDHPLPTVHPQVTYAYM(K) 33. A cDNA which encodes a protein which includes one or more of the following internal amino acid sequences: a) ILLNIERR; b) LIRPYM.iPILK; DXMEfAQE; and d) QLDHP>LPTVHPQVTYAYM(K) 34. A DNA encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILL-NIEHR; b) LIRPYMEPILK; c) DXMEAQE: and t, d) QLDHPLPTVHPQVTYAYM(K) An antisense RNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) 36. An antisense DNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) 37. A composition comprising a protein as claimed in any one of Claims 1 to 7 in substantially pure form, optionally in combination with a non- proteinous diluent or carrier. 38. A protein according to any one of claims 1 to 7 when isolated by a 20 process according to claim 39. A process according to claim 20 substantially as hereinbefore described with reference to the examples. A protein according to claim 1 substantially as hereinbefore described with reference to the examples. DATED: 5 October, 2001 PHILLIPS ORMONDE FITZPATRICK Attorneys for: THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK AND AMERICAN HOME PRODUCTS CORPORATION S. Se 6 Oe S 0 *SS. @6 0 *6 60 S S 6 6* 6 0 0 06 0 00 00 CS S @5 W:\ciska\nki\speces)div 17390-99.doc