EP1073677A1 - STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES - Google Patents

STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES

Info

Publication number
EP1073677A1
EP1073677A1 EP99918764A EP99918764A EP1073677A1 EP 1073677 A1 EP1073677 A1 EP 1073677A1 EP 99918764 A EP99918764 A EP 99918764A EP 99918764 A EP99918764 A EP 99918764A EP 1073677 A1 EP1073677 A1 EP 1073677A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
sequence
polynucleotide
seq
identity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99918764A
Other languages
German (de)
French (fr)
Other versions
EP1073677A4 (en
Inventor
Chantal Myriam Petit
Richard L. Warren
Christopher M. Traini
Min Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SmithKline Beecham Corp
Original Assignee
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SmithKline Beecham Corp filed Critical SmithKline Beecham Corp
Publication of EP1073677A1 publication Critical patent/EP1073677A1/en
Publication of EP1073677A4 publication Critical patent/EP1073677A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/56938—Staphylococcus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/94—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
    • G01N33/9446—Antibacterials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides and polypeptides. and their production and uses, as well as their variants, agonists and antagonists, and their uses
  • the invention relates to polynucleotides and polypeptides of the Undine monophosphate (UMP) kinase family, as well as their variants, hereinafter referred to as "pyrH.”
  • UMP Undine monophosphate
  • pyrH polynucleot ⁇ de(s) and "pyrH polypept ⁇ de(s) "
  • Staphylococcal genes and gene products are particularly preferred to employ Staphylococcal genes and gene products as targets for the development of antibiotics
  • the Staphylococci make up a medically unportant genera of microbes They are known to produce two types of disease, invasive and toxigemc hwasive infections are characterized generally by abscess formation effecting both skin surfaces and deep tissues S aureus is the second leading cause of bacteremia in cancer patients Osteomyelitis, septic arthritis, septic thrombophlebitis and acute bacterial endocarditis are also relatively common
  • Osteomyelitis, septic arthritis, septic thrombophlebitis and acute bacterial endocarditis are also relatively common
  • There are at least three clinical conditions resulting from the toxigemc properties of Staphylococci The manifestation of these diseases result from the actions of exotoxins as opposed to tissue invasion and bacteremia These conditions include Staphylococcal food poisoning, scalded skin
  • Staphylococcus aureus infections has risen dramatically in the past few decades This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune systems It is no longer uncommon to isolate Staphylococcus aureus strains which are resistant to some or all of the standard antibiotics This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism
  • UMP kinase is involved in the biosynthesis of pv ⁇ midine t ⁇ phosphate nucleosides from glucose metabolism intermediates via the de novo pathway or from exogenous uracil and undine
  • the pynmidine tnphosphate nucleotides are precursors in the biosynthesis of macromolecules such as RNA, DNA, phospho pids and peptidoglycan
  • the essential nature of the gene product of pyrH in Eschenchia co has been demonstrated by the construction of temperature sensitive mutants (Yamanaka, K . Ogura, T . Niki. H . and Hiraga. S 1992 J Bactenol 174.
  • polypeptides of the invention possess significant amino acid sequence homology to a known Bacillus subti s smbA, Synechocystis sp pyrH. Mycobactenum leprae pyrH. Mycobactenum tuberculosis pyrH. Eschenchia coh smbA, Haemophilus influenzae pyrH. Hehcobacter pylon pyrH. Mycoplasma pneumoniae pyrH, Chlamydia trachomatis pyrH.
  • Mycoplasma gemtahum smbA Thermus aquaticus pyrH, Archaeoglobus fulgidus pyrH, Methanococcus jannaschii pyrH, Pyrococcus honkoshn pyrH and Bonelia burgdorfen smbA protein (smbA (pyrH) in Bacillus subtihs GeneBank Z99112, pyrH in Synechocystis sp GeneBank D90915. pyrH in Mycobactenum leprae GeneBank Z97369, pyrH in Mycobactenum tuberculosis GeneBank Z74024, smbA (pyrH) in Eschenchia coh GeneBank D26562 and X78809.
  • the present invention relates to pyrH, in particular pyrH polypeptides and pyrH polynucleotides. recombinant matenals and methods for their production
  • the invention relates to methods for using such polypeptides and polynucleotides. including the treatment of microbial diseases, amongst others
  • the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified compounds
  • the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting pyrH expression or activity
  • the invention relates to pyrH polypeptides and polynucleotides as descnbed in greater detail be m
  • the invention relates to polypeptides and polynucleotides of a pyrH of Staphylococcus aureus. which is related by ammo acid sequence homology to Bacillus subtihs smbA. Synechocystis sp pyrH, Mycobactenum leprae pyrH, Mycobactenum tuberculosis pyrH. Eschenchia co smbA. Haemophilus influenzae pyrH. Hehcobacter pylon pyrH. Mycoplasma pneumoniae pyrH.
  • the invention relates especially to pyrH having the nucleotide and ammo acid sequences set out in Table 1 as SEQ ID NO 1 and SEQ ID NO 2 respectively
  • VKYEHLTHIQMLQEGLQVMDSTAS S FCMDNNI PLTVFS IMEEGNI KRAVMGEKI GTLITK- COOH
  • the Staphylococcus aureus strain deposit is refened to herein as "the deposited strain” or as "the DNA of the deposited strain "
  • the deposited strain contains the full length pyrH gene
  • the sequence of the polynucleotides contained in the deposited strain, as well as the amino acid sequence of any polypeptide encoded thereby, are controlling in the event of any conflict with any descnption of sequences herein
  • a license may be required to make, use or sell the deposited strain, and compounds denved therefrom, and no such license is hereby granted
  • an isolated nucleic acid molecule encoding a mature polypeptide expressible by the Staphylococcus aureus WCUH 29 stram. which polypeptide is contained m the deposited strain
  • pyrH polynucleotide sequences in the deposited strain such as DNA and RNA, and amino acid sequences encoded thereby
  • Also provided by the invention are pyrH polypeptide and polynucleotide sequences isolated from the deposited stram
  • the pyrH polypeptide of the mvention is substantially phylogenetically related to other proteins of the Undine monophosphate (UMP) kinase family hi one aspect of the mvention there are provided polypeptides of Staphylococcus aureus refened to herein as "pyrH” and "pyrH polypeptides" as well as biologically, diagnosticalh . prophylactically. clinically or therapeutically useful vanants thereof, and compositions compnsing the same
  • (a) comprises or consists of an ammo acid sequence which has at least 70% identity . preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, most preferably at least 97-99% or exact identity, to that of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (b) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1, (c) a polypeptide encoded by an isolated polynucleotide comprising or consistmg of a polynucleotide sequence encoding a polypeptide which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity
  • the polypeptides of the mvention include a polypeptide of Table 1 [SEQ ID NO 2] (in particular the mature polypeptide) as well as polypeptides and fragments, particularly those which have the biological activity of pyrH. and also those which have at least 70% identity to a polypeptide of Table 1 [SEQ ID NO l]or the relevant portion, preferably at least 80% identity to a polypeptide of Table 1 [SEQ ID NO 2and more preferably at least 90% identity to a polypeptide of Table 1 [SEQ ID NO 2] and still more preferably at least 95% identity to a polypeptide of Table 1 [SEQ ID NO 2] and also mclude portions of such polypeptides with such portion of the polypeptide generally containing at least 30 ammo acids and more preferably at least 50 ammo acids
  • the mvention also mcludes a polypeptide consistmg of or compnsmg a polypeptide of the formula
  • X is hydrogen, a metal or any other moiety descnbed herein for modified polypeptides. and at the carboxyl terminus.
  • Y is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides
  • R ⁇ and R3 are any ammo acid residue or modified amino acid residue
  • m is an mteger between 1 and 1000 or zero
  • n is an mteger between 1 and 1000 or zero
  • R2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from
  • R 2 is onented so that its ammo tennmal ammo acid residue is at the left, covalently bound to Ri and its carboxy tennmal ammo acid residue is at the nglit. covalently bound to R3 Any stretch of am o acid residues denoted by either R ⁇ or R3.
  • m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer
  • Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500, and n is an mteger between 1 and 50. 100. or 500
  • a polypeptide of the mvention is denved from Staphylococcus aureus. however, it may preferably be obtamed from other organisms of the same taxonomic genus A polypeptide of the mvention may also be obtamed, for example, from orgamsms of the same taxonomic family or order
  • a fragment is a vanant polypeptide havmg an ammo acid sequence that is entirely the same as part but not all of any ammo acid sequence of any polypeptide of the mvention
  • fragments may be "free-standing.” or compnsed within a larger polypeptide of which they form a part or region, most preferably as a single contmuous region in a smgle larger polypeptide Prefened fragments mclude.
  • truncation polypeptides havmg a portion of an ammo acid sequence of Table 1 [SEQ ID NO 2], or of vanants thereof, such as a contmuous senes of residues that mcludes an amino- and/or carboxyl-teirmnal ammo acid sequence Degradation forms of
  • polypeptides of the mvention produced by or m a host cell, particularly a Staphylococcus aureus are also prefened
  • fragments characterized by structural or functional attributes such as fragments that compnse alpha-helix and alpha-helix forming regions, beta-sheet and beta- sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions
  • Further prefened fragments mclude an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids from the ammo acid sequence of SEQ ID NO 2, or an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids truncated or deleted from the ammo acid sequence of SEQ ID NO 2
  • Also prefened are biologically active fragments which are those fragments that mediate activities of pyrH including those with a similar activity or an improved activity, or with a decreased undesirable activity
  • Also mcluded are those fragments that are antigenic or lmmunogenic m an animal, especially in a human
  • Particularly prefened are fragments compnsmg receptors or domams of enzymes that confer a function essential for viability of Staphylococcus aureus or the ability to initiate, or maintain cause Disease m an individual, particularly a human
  • Fragments of the polypeptides of the mvention may be employed for producing the conesponding full-length polypeptide by peptide synthesis, therefore, these vanants ma ⁇ be employed as intermediates for producmg the full-lengtii polypeptides of the mvention
  • the polynucleotide compnses a region encoding pyrH polypeptides compnsmg a sequence set out in Table 1 [SEQ ID NO 1] which mcludes a full lengd gene, or a variant thereof
  • SEQ ID NO 1 a sequence set out in Table 1 [SEQ ID NO 1] which mcludes a full lengd gene, or a variant thereof
  • this full length gene is essential to the growth and/or survival of an organism which possesses it.
  • isolated nucleic acid molecules encoding and/or expressmg pyrH polypeptides and polynucleotides, particularly Staphylococcus aureus pyrH polypeptides and polynucleotides mcludmg. for example unprocessed RNAs
  • RNAs mRNAs. cDNAs. genomic DNAs, B- and Z-DNAs
  • mcludmg at least one full length gene, that encodes a pyrH polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and vanants thereof
  • pvrH polypeptide from Staphylococcus aureus comprising or consistmg of an ammo acid sequence of Table 1 [SEQ ID NO 2]. or a variant thereof
  • a polynucleotide of the mvention encoding pyrH polypeptide may be obtamed usmg standard cloning and screening methods, such as those for cloning and sequencing chromosomal DNA fragments from bactena usmg Staphylococcus aureus WCUH 29 cells as starting matenal. followed by obtaimng a full lengtii clone
  • a polynucleotide sequence of the mvention such as a polynucleotide sequence given in Table 1 [SEQ ID NO 1].
  • a library of clones of chromosomal DNA of Staphylococcus aureus WCUH 29 in E coh or some other suitable host is probed with a radiolabeled ohgonucleotide, preferably a 17-mer or longer, denved from a partial sequence
  • a radiolabeled ohgonucleotide preferably a 17-mer or longer
  • Clones carrying DNA identical to that of the probe can then be distinguished using stringent hybridization conditions
  • sequencing primers designed from the original polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence in both directions to determine a full length gene sequence Conveniently, such sequencing is performed, for example, using denatured double stranded DNA prepared from a plasmid clone Suitable techniques are described by Mamatis, T , Fritsch, E F and Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed
  • each DNA sequence set out m Table 1 [SEQ ID NO 1] contains an open reading frame encoding a protem havmg about the number of ammo acid residues set forth in Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known to those skilled m the art
  • the polynucleotide of SEQ ED NO 1. between nucleotide number 1 and the stop codon which begins at nucleotide number 721 of SEQ ID NO 1. encodes the polypeptide of SEQ ID NO 2
  • the present mvention provides for an isolated polynucleotide comprising or consisting of
  • a polynucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1.
  • b a polynucleotide sequence encoding a polypeptide which has at least 70% identity . preferably at least 80% identity , more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or 100% exact, to the ammo acid sequence of SEQ ID NO 2. over the entire length of SEQ ID NO 2
  • a polynucleotide encoding a polypeptide of the present mvention, mcludmg homologs and orthologs from species other than Staphylococcus aureus may be obtamed by a process which compnses the steps of screening an appropnate library under stringent hybndization conditions with a labeled or detectable probe consistmg of or compnsmg the sequence of SEQ ID NO 1 or a fragment thereof, and isolating a full-length gene and or genomic clones containing said polynucleotide sequence
  • the mvention provides a polynucleotide sequence identical over its entire length to a codmg sequence (open readmg frame) m Table 1 [SEQ ID NO 1] Also provided by the mvention is a codmg sequence for a mature polypeptide or a fragment thereof, by itself as well as a codmg sequence for a mature polypeptide or a fragment m readmg frame with another codmg sequence, such as a sequence encoding a leader or secretory sequence, a pre-, or pro- or prepro-protem sequence
  • the polynucleotide of the mvention may also contain at least one non-coding sequence, mcludmg for example, but not limited to at least one non-coding 5 " and 3' sequence, such as the transcnbed but non- translated sequences, termination signals (such as rho-dependent and rho-mdependent termination signals), nbosome binding sites.
  • a marker sequence that facilitates punfication of the fused polypeptide can be encoded In certam embodiments of the mvention.
  • the marker sequence is a hexa-histidine peptide, as provided m the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al . Proc Natl Acad Set , USA 86 821-824 (1989). or an HA peptide tag (Wilson et al . Cell 37 161 ( 1984).
  • Polynucleotides of the mvention also mclude, but are not limited to, polynucleotides compnsmg a structural gene and its naturally associated sequences that control gene expression
  • a prefened embodiment of the mvention is a polynucleotide of consistmg of or compnsmg nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 721 set forth in SEQ ID NO 1 of Table 1, both of which encode the pyrH polypeptide
  • the mvention also mcludes a polynucleotide consistmg of or compnsmg a polynucleotide of the formula
  • X-(R ⁇ ) m -(R 2 )-(R 3 ) n -Y wherein, at the 5' end of the molecule.
  • X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule.
  • Y is hydrogen, a metal or a modified nucleotide residue, or together with X defines the covalent bond
  • each occurrence of Rj and R3 is independently any nucleic acid residue or modified nucleic acid residue
  • m is an integer between 1 and 3000 or zero .
  • n is an mteger between 1 and 3000 or zero
  • R 2 is a nucleic acid sequence or modified nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof
  • R 2 is oriented so that its 5' end nucleic acid residue is at the left. bound to Rj and its 3' end nucleic acid residue is at the right, bound to R3 Any stretch of nucleic acid residues denoted by either R ] and/or R , where m and/or n is greater than 1.
  • the polynucleotide of the abo ⁇ e formula is a closed, circular polynucleotide, which can be a double-stranded polynucleotide wherein the formula shows a first strand to which the second strand is complementary
  • m and/or n is an mteger between 1 and 1000.
  • Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500. and n is an mteger between 1 and 50, 100, or 500
  • polynucleotide of the mvention is denved from Staphylococcus aureus. however, it may preferably be obtamed from other orgamsms of the same taxonomic genus A polynucleotide of the mvention may also be obtamed, for example, from orgamsms of the same taxonomic family or order
  • polynucleotide encodmg a polypeptide encompasses polynucleotides that mclude a sequence encodmg a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Staphylococcus aureus pyrH havmg an ammo acid sequence set out in Table 1 [SEQ ID NO 2] The term also encompasses polynucleotides that mclude
  • mvention further relates to vanants of the polynucleotides descnbed herem that encode vanants of a polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Fragments of a polynucleotides of the mvention may be used, for example, to synthesize full-length polynucleotides of the mvention
  • prefened embodiments are polynucleotides encodmg pyrH vanants. that have the ammo acid sequence of pvrH polypeptide of Table 1 [SEQ ID NO 2] m which several, a few 5 to 10. 1 to 5. 1 to 3, 2, 1 or no ammo acid residues are substituted, modified deleted and/or added, in am combination Especially prefened among these are silent substitutions, additions and deletions that do not alter the properties and activities of pyrH polypeptide
  • polynucleotides that are at least 70% identical over their entire length to a polynucleotide encodmg pyrH polypeptide havmg an ammo acid sequence set out in Table 1 [SEQ ID NO 2]. and polynucleotides that are complementary to such polynucleotides
  • most highly prefened are polynucleotides that compnse a region that is at least 80% identical over its entire length to a polynucleotide encoding pyrH polypeptide and polvnucleotides complementary thereto
  • polynucleotides at least 90% identical over their entire length to the same are particularly prefened.
  • those with at least 95% are especially prefened Furthermore, those with at least 97% are highly prefened among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly prefened. with at least 99% bemg the more prefened
  • Prefened embodiments are polynucleotides encodmg polypeptides that retain substantially the same biological function or activity as the mature polypeptide encoded by a DNA of Table 1 [SEQ ID NO l]
  • polynucleotides that hybndize, particularly under stringent conditions, to pyrH polynucleotide sequences such as those polynucleotides m Table 1
  • the mvention further relates to polynucleotides that hybndize to the polynucleotide sequences provided herem
  • the mvention especially relates to polynucleotides that hybndize under stringent conditions to the polynucleotides descnbed herem
  • the terms "stringent conditions” and “stringent hybndization conditions” mean hybndization occurring only if there is at least 95% and preferably at least 97% identity between the sequences
  • the invention also provides a polynucleotide consisting of or comprising a polynucleotide sequence obtamed by screening an appropriate library containing the complete gene for a polynucleotide sequence set forth m SEQ ID NO 1 under stringent h ⁇ b ⁇ dization conditions with a probe having the sequence of said polynucleotide sequence set forth m SEQ ID NO 1 or a fragment thereof, and isolating said polynucleotide sequence Fragments useful for obtaining such a polynucleotide include, for example, probes and primers fully described elsewhere herem
  • the polynucleotides of the mvention may be used as a hybndization probe for RNA.
  • cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encodmg pyrH and to isolate cDNA and genomic clones of other genes that have a high identity, particularly high sequence identity, to the pyrH gene
  • Such probes generally will compnse at least 15 nucleotide residues or base pairs
  • such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs
  • Particularly prefened probes will have at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs
  • a codmg region of a pyrH gene may be isolated by screening usmg a DNA sequence provided m Table 1 [SEQ ID NO 1] to synthesize an oligonucleotide probe
  • a labeled oligonucleotide havmg a sequence complementary to that of a gene of the mvention is then used to screen a library of cDNA. genomic DNA or mRNA to determme which members of the library the probe hybndizes to
  • PCR PCR
  • the PCR reaction is then repeated usmg "nested" primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence)
  • the products of this reaction can then be analyzed by DNA sequencing and a full-length DNA constructed either by joining the product directly to the existing DNA to give a complete sequence, or carrying out a separate full-length PCR usmg the new sequence information for the design of the 5' primer
  • polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularh human diseases, as further discussed herem relatmg to polynucleotide assays
  • polynucleotides of the invention that are ohgonucleotides derived from a sequence of
  • Table 1 [SEQ ID NOS 1 or 2] may be used m the processes herem as described, but preferabh for PCR. to determine whether or not the polynucleotides identified herein m whole or in part are transcribed in bacteria m infected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of infection and type of infection the pathogen has attained
  • the mvention also provides polynucleotides that encode a polypeptide that is the mature protem plus additional ammo or carboxyl-terminal ammo acids, or ammo acids rntenor to the mature polypeptide (when the mature form has more than one polypeptide cham, for instance)
  • Such sequences may play a role m processmg of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-life or may facilitate manipulation of a protem for assay or production, among other things
  • the additional ammo acids may be processed away from the mature protem by cellular enzymes
  • a precursor protem, havmg a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such mactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins
  • N means that any of the four DNA or RNA nucleotides may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a nucleic acid that when taken m combmation with
  • a polynucleotide of tlie mvention may encode a mature protem.
  • a mature protem plus a leader sequence (which may be refened to as a preprotem).
  • a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotem, or a preproprotem, which is a precursor to a proprotem.
  • havmg a leader sequence and one or more prosequences which generally are removed during processmg steps that produce active and mature forms of the polypeptide
  • Tl e mvention also relates to vectors that compnse a polynucleotide or polynucleotides of the mvention.
  • host cells that are genetically engmeered with vectors of tlie mvention and tlie production of polypeptides of the mvention by recombinant techniques
  • Cell-free translation systems can also be employed to produce such protems usmg RNAs denved from the DNA constructs of the mvention
  • Recombinant polypeptides of the present mvention may be prepared by processes well known m those skilled m the art from genetically engmeered host cells compnsmg expression systems Accordingly m a further aspect, the present mvention relates to expression systems which compnse a polynucleotide or polynucleotides of the present mvention, to host cells winch are genetically engmeered with such expression systems, and to the production of polypeptides of the mvention by recombinant techniques
  • host cells can be genetically engmeered to incorporate expression systems or portions thereof or polynucleotides of the mvention
  • Introduction of a polynucleotide mto the host cell can be effected by methods descnbed m many standard laboratory manuals, such as Davis, et al . BASIC METHODS IN MOLECULAR BIOLOGY. (1986) and Sambrook. et al , MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N Y (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, micromjection. catiomc hpid-mediated transfection, electroporation, transduction. scrape loading, ballistic mtroduction and infection
  • bactenal cells such as cells of streptococci, staphylococci, enterococci E coh, streptomyces. cyanobactena, Bacillus subtihs, and Staphylococcus aureus, fungal cells, such as cells of a yeast. Kluveromyces, Saccharomyces. a basidiomycete, Candida albicans and Aspergillus, insect cells such as cells of Drosophi la S2 and Spodoptera Sf9. animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293, CV-1 and Bowes melanoma cells, and plant cells, such as cells of a gymnospenn or angiosperm
  • a great vanety of expression systems can be used to produce the polypeptides of the mvention
  • Such vectors mclude, among others, chromosomal-, episomal- and virus-denved vectors.
  • the expression system constructs may contain control regions that regulate as well as engender expression
  • any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide m a host may be used for expression m this regard
  • the appropnate DNA sequence may be inserted mto the expression system by any of a vanety of well- known and routme techmques. such as. for example, those set forth in Sambrook et al . MOLECULAR CLONING, A LABORATORY MANUAL, ⁇ supra)
  • Polypeptides of the mvention can be recovered and punfied from recombinant cell cultures by well-known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic mteraction chromatography, affinity chromatography.
  • hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography is employed for purification
  • Well known techmques for refolding protem may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or punfication Diagnostic, Prognostic, Serotyping and Mutation Assays
  • This mvention is also related to the use of pyrH polynucleotides and polypeptides of the mvention for use as diagnostic reagents Detection of pyrH polynucleotides and/or polypeptides m a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of disease, staging of disease or response of an infectious organism to drugs Eukaryotes.
  • pyrH gene or protem may be detected at the nucleic acid or ammo acid level by a vanety of well known techniques as well as by methods provided herem
  • Polypeptides and polynucleotides for prognosis, diagnosis or other analysis may be obtamed from a putatively infected and/or infected individual's bodily matenals
  • Polynucleotides from any of these sources, particularly DNA or RNA may be used directly for detection or may be amplified enzymatically by usmg PCR or any other amplification technique pnor to analysis RNA particularly
  • cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and stram of infectious or resident orgamsm present m an individual, may be made by an analysis of the genotype of a selected polynucleotide of the orgamsm Deletions and insertions can be detected by a change m size of the amplified product m companson to a genotype of a reference sequence selected from a related orgamsm, preferably a different species of the same genus or a different stram of the same species Point mutations can be identified by hybndizing amplified DNA to labeled pyrH polynucleotide sequences Perfectly or significantly matched sequences can be distinguished from imperfectly or more sigmficantly mismatched duplexes by DNase or RNase digestion, for DNA or RNA respectively, or by detectmg differences m meltmg temperatures or renaturation kmetics Polynucleotide
  • an anay of oligonucleotides probes compnsmg pyrH nucleotide sequence or fragments thereof can be constiucted to conduct efficient screening of, for example, genetic mutations, serotype, taxonomic classification or identification
  • Anay technology methods are well known and have general applicability and can be used to address a vanety of questions m molecular genetics mcludmg gene expression, genetic linkage, and genetic vanabi ty (see, for example. Chee et al . Science, 274 610 (1996))
  • the present mvention relates to a diagnostic kit which comprises
  • a polynucleotide of the present invention preferably the nucleotide sequence of SEQ ID NO 1. or a fragment thereof ,
  • polypeptide of the present mvention preferably the polypeptide of SEQ ID NO 2 or a fragment thereof, or
  • kits (a), (b). (c) or (d) may comprise a substantial component
  • Such a kit will be of use in diagnosing a disease or susceptibility to a Disease, among others
  • This mvention also relates to the use of polynucleotides of the present mvention as diagnostic reagents Detection of a mutated fonn of a polynucleotide of the mvention. preferable.
  • SEQ ID NO 1. which is associated with a disease or pathogenicity will provide a diagnostic tool that can add to. or define, a diagnosis of a disease, a prognosis of a course of disease, a determination of a stage of disease, or a susceptibility to a disease, which results from under-expression.
  • polynucleotide Orgamsms, particularly infectious orgamsms, carrying mutations m such polynucleotide may be detected at tl e polynucleotide level by a vanety of techmques. such as those descnbed elsewhere herem
  • Tlie nucleotide sequences of the present mvention are also valuable for orgamsm chromosome identification
  • the sequence is specifically targeted to. and can hybndize with, a particular location on an organism's chromosome, particularly to a Staphylococcus aureus chromosome
  • the mappmg of relevant sequences to chromosomes according to the present mvention may be an important step m conelatmg those sequences with pathogenic potential and/or an ecological niche of an orgamsm and/or drug resistance of an orgamsm, as well as the essentiality of the gene to the orgamsm
  • the physical position of the sequence on the chromosome can be conelated with genetic map data Such data may be found on-lme m a sequence database
  • the relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through known genetic methods, for example, through linkage analysis (coinhentance of physically adjacent genes
  • a polynucleotide and/or polypeptide of the mvention may also be detected at the polynucleotide or polypeptide level by a vanety of techmques. to allow for serotyprng, for example
  • RT- PCR can be used to detect mutations m the RNA It is particularly prefened to use RT-PCR m conjunction with automated detection systems, such as, for example.
  • GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose, PCR As an example.
  • PCR primers complementary to a polynucleotide encodmg pyrH polypeptide can be used to identify and analyze mutations Examples of representative primers are shown below m Table 2
  • Tlie mvention also mcludes primers of tlie formula
  • X is hydrogen, a metal or a modified nucleotide residue, and at the 3' end of the molecule.
  • Y is hydrogen, a metal or a modified nucleotide residue.
  • R j and R3 are am nucleic acid residue or modified nucleotide residue, m is an mteger between 1 and 20 or zero , n is an mteger between 1 and 20 or zero, and R is a primer sequence of the mvention.
  • any stietch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1 may be either a heteropolymer or a homopolymer, preferably a heteropoly ⁇ ner bemg complementary to a region of a polynucleotide of Table 1 In a prefened embodiment m and/or n is an mteger between 1 and 10.
  • the mvention further provides these primers with 1, 2, 3 or 4 nucleotides removed from the 5' and or the 3' end
  • These primers may be used for, among other things, amplifymg pyrH DNA and/or RNA isolated from a sample denved from an individual, such as a bodily matenal
  • the primers may be used to amplify a polynucleotide isolated from an mfected individual, such that tlie polynucleotide may then be subject to vanous techmques for elucidation of the polynucleotide sequence In this way. mutations m the polynucleotide sequence may be detected and used to diagnose and/or prognose the infection or its stage or course, or to serotype and/or classify the infectious agent
  • the mvention further provides a process for diagnosing, disease, preferably bacterial infections, more preferably infections caused by Staphylococcus aureus. comprising determining from a sample derived from an individual, such as a bodily material, an mcreased level of expression of polynucleotide having a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of a pyrH polynucleotide can be measured using any on of the methods well known in the art for the quantitation of polynucleotides, such as. for example, amplification. PCR. RT-PCR, RNase protection, Northern blotting, spectrometry and other hybridization methods
  • a diagnostic assay m accordance with the mvention for detecting over- expression of pyrH polypeptide compared to normal control tissue samples may be used to detect the presence of an infection, for example Assay techmques that can be used to determine levels of a pyrH polypeptide.
  • Assay techmques that can be used to determine levels of a pyrH polypeptide.
  • a sample denved from a host such as a bodily matenal
  • Such assay methods mclude radioimmunoassays, competitive-binding assays. Western Blot analysis, antibody sandwich assays, antibody detection and ELISA assays Differential Expression
  • the polynucleotides and polynucleotides of the mvention may be used as reagents for differential screening methods
  • differential screening and differential display methods known m tlie art m which the polynucleotides and polypeptides of the mvention may be used
  • the differential display technique is described by Chuang et al . J Bactenol 175 2026-2036 (1993) This method identifies those genes which are expressed in an organism by identifying mRNA present using randomly-primed RT-PCR By comparing pre-mfection and post infection profiles, genes up and down regulated during infection can be identified and the RT-PCR product sequenced and matched to ORF "unknowns"
  • IVET In Vivo Expression Technology (IVET) is described by Camilli et al , Proc Nat'l Acad Sci USA 91 2634-2638 (1994) IVET identifies genes up-regulated dunng infection when compared to laboratory cultivation, implying an important role m infection ORFs identified by this technique are implied to have a significant role m infection establishment and/or mamtenance
  • random chromosomal fragments of target organism are cloned upstream of a promoter-less recombmase gene m a plasmid vector
  • This construct is introduced mto the target organism which carries an antibiotic resistance gene flanked by resolvase sites Growth in the presence of the antibiotic removes from the population those fragments cloned into the plasmid vector capable of supporting transcription of the recombmase gene and therefore have caused loss of antibiotic resistance
  • the resistant pool is introduced into a host and at various times after infection bacteria may be recovered and assessed for the presence of antibiotic resistance
  • the bacterial mRNA preparation need not be free of mammalian RNA This allows the investigator to carry out a simple and quick RNA preparation from infected tissue to obtain bacterial mRNA species which are very short lived in the bacterium (in the order of 2 minute halflives)
  • the bacterial mRNA is prepared from infected mu ⁇ ne lung tissue by mechanical disruption in the presence of TRIzole (GIBCO-BRL) for very short periods of time, subsequent processmg according to the manufacturers of TRIzole reagent and DNAase treatment to remove contaminating DNA
  • the process is optimized by finding those
  • polynucleotides of the invention may be used as components of polynucleotide array s, preferably high density arrays or grids These high density anays are particularly useful for diagnostic and prognostic purposes
  • a set of spots each comprising a different gene, and further comprising a polynucleotide or polynucleotides of the mvention. may be used for probing, such as using hybridization or nucleic acid amplification, usmg a probes
  • a grid comprising a number of variants of the polynucleotide sequence of SEQ ID NO 1 are preferred Also preferred is a comprising a number of variants of a polynucleotide sequence encoding the polypeptide sequence of SEQ ID NO 2
  • polypeptides and polynucleotides of the mvention or vanants thereof, or cells expressmg the same can be used as immunogens to produce antibodies immunospecific for such polypeptides or polynucleotides respectively
  • Antibodies generated against the polypeptides or polynucleotides of the mvention can be obtamed by administering the polypeptides and/or polynucleotides of the mvention, or epitope-bearmg fragments of either or both, analogues of either or both, or cells expressmg either or both, to an animal, preferably a nonhuman.
  • usmg routme protocols For preparation of monoclonal antibodies, am technique known m the art that provides antibodies produced by contmuous cell lme cultures can be used Examples mclude vanous techmques. such as those m Kohler. G and Milstein. C . Nature 256 495-497 (1975). Kozbor et al , Immunology Today 4 72 (1983). Cole et al . pg 77-96 m MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R Liss. Inc (1985)
  • phage display technology may be utilized to select antibody genes with binding activities towards a polypeptide of the invention either from repertoires of PCR amplified v-genes of lymphocytes from humans screened for possessing anti-pyrH or from naive libraries (McCafferty, et al , (1990), Nature 348, 552-554, Marks, et al , (1992) Biotechnology 10, 779- 783)
  • the affinity of these antibodies can also be improved by, for example, cham shuffling (Clackson et al , (1991) Nature 352 628)
  • the above-descnbed antibodies may be employed to isolate or to identify clones expressmg the polypeptides or polynucleotides of the mvention to punfy the polypeptides or polynucleotides by for example, affinity chromatography
  • antibodies against pyrH-polypeptide or pyrH-polynucleotide may be employed to treat infections, particularly bactenal infections
  • Polypeptide variants include antigemcally, epitopically or lmmunologically equivalent variants form a particular aspect of this invention
  • a polypeptide or polynucleotide of the invention such as an antigemcally or lmmunologically equivalent derivative or a fusion protein of the polypeptide is used as an antigen to immunize a mouse or other animal such as a rat or chicken
  • the fusion protein may provide stability to the polypeptide
  • the antigen may be associated, for example by conjugation, with an immunogenic carrier protem for example bovme serum albumin, keyhole limpet haemocyanm or tetanus toxoid
  • an immunogenic carrier protem for example bovme serum albumin, keyhole limpet haemocyanm or tetanus toxoid
  • a multiple antigenic polypeptide comprising multiple copies of the polypeptide. or an antigemcally or lmmunologically equivalent polypeptide thereof may be sufficiently antigenic
  • the antibody or variant thereof is modified to make it less immunogenic in the individual
  • the antibody may most preferably be "humanized.” where the comphmentarity determining region or regions of the hyb ⁇ doma-de ⁇ ved antibody has been transplanted into a human monoclonal antibody, for example as described in
  • a polynucleotide of the mvention for therapeutic or prophylactic purposes, m particular genetic immunization Among tlie particularly prefened embodiments of the mvention are naturally occurring allehc vanants of pyrH polynucleotides and polypeptides encoded thereby
  • a polynucleotide of the invention in genetic immunization will preferably employ a suitable delivery method such as direct injection of plasmid DNA mto muscles (Wolff et al , Hum Mol Genet (1992) 1 363, Manthorpe et al , Hum Gene Ther (1983) 4 419). delivery of DNA complexed with specific protein carriers (Wu et al , J Biol Chem (1989) 264 16985). coprecipitation of DNA with calcium phosphate (Benvemsty & Reshef, PNAS USA.
  • a suitable delivery method such as direct injection of plasmid DNA mto muscles (Wolff et al , Hum Mol Genet (1992) 1 363, Manthorpe et al , Hum Gene Ther (1983) 4 419). delivery of DNA complexed with specific protein carriers (Wu et al , J Biol Chem (1989) 264 16985). coprecipitation of DNA with calcium phosphate
  • Polypeptides and polynucleotides of the mvention may also be used to assess the binding of small molecule substrates and gands m. for example, cells, cell-free preparations, chemical hbranes. and natural product mixtures These substrates and hgands may be natural substrates and hgands or
  • - 22 - may be structural or functional mimetics See. e g , Cohgan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991)
  • Polypeptides and polynucleotides of the present mvention are responsible for many biological functions, mcludmg many disease states, m particular the Diseases hereinbefore mentioned It is therefore desirable to devise screemng methods to identify compounds which stimulate or which inhibit the function of the polypeptide or polynucleotide Accordingly, m a further aspect, the present mvention provides for a method of screening compounds to identify those which stimulate or which inhibit tlie function of a polypeptide or polynucleotide of the mvention, as well as related polypeptides and polynucleotides In general, agomsts or antagonists may be employ ed for therapeutic and prophylactic purposes for such Diseases as hereinbefore mentioned Compounds may be identified from a vanety of sources, for example, cells, cell-free preparations, chemical branes.
  • agomsts, antagonists or lnlnbitors so-identified may be natural or modified substrates, hgands. receptors, enzymes, etc . as the case may be. of pyrH polypeptides and polynucleotides. or may be structural or functional mimetics thereof (see Co gan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991))
  • the screening methods may simply measure the binding of a candidate compound to the polypeptide or polynucleotide, or to cells or membranes bearing the polypeptide or polynucleotide, or a fusion protem of the polypeptide by means of a label directly or indirectly associated with the candidate compound Alternatively, the screening method may involve competition with a labeled competitor Further, these screemng methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide or polynucleotide.
  • Inhibitors of activation are generally assayed m the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed
  • Constitutively active polypeptide and/or constitutively expressed polypeptides and polynucleotides may be employed m screemng methods for inverse agonists or inhibitors, in the absence of an agonist or inhibitor, by testing whether the candidate compound results m inhibition of activation of the polypeptide or polynucleotide.
  • the screemng methods may simply comprise the steps of mixing a candidate compound with a solution containing a polypeptide or polynucleotide of the present invention, to form a mixture, measuring pyrH polypeptide and/or polynucleotide activity in the mixture, and companng the pyrH polypeptide and or polynucleotide activity of the mixture to a standard Fusion proteins, such as those made from Fc portion and pyrH polypeptide. as herembefore described, can also be used for high-throughput screening assays to identify antagonists of the polypeptide of the present
  • polypeptides and antibodies that bmd to and/or interact with a polypeptide of the present invention may also be used to configure screening methods for detecting the effect of added compounds on the production of mRNA and/or polypeptide m cells
  • an ELISA assay may be constructed for measuring secreted or cell associated levels of polypeptide using monoclonal and polyclonal antibodies by standard methods known in the art This can be used to discover agents which may inhibit or enhance the production of polypeptide (also called antagonist or agonist, respectively) from suitably manipulated cells or tissues
  • the mvention also provides a method of screemng compounds to identify those which enhance (agomst) or block (antagonist) tlie action of pyrH polypeptides or polynucleotides, particularly those compounds that are bactenostatic and/or bactencidal
  • the method of screemng may mvolve high- throughput techmques For example, to screen for agomsts or antagonists, a synthetic reaction mix.
  • a cellular compartment such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compnsmg pyrH polypeptide and a labeled substrate or hgand of such polypeptide is mcubated m tlie absence or the presence of a candidate molecule that may be a pyrH agomst or antagonist
  • the ability of the candidate molecule to agonize or antagonize the pyrH polypeptide is reflected m decreased binding of the labeled hgand or decreased production of product from such substrate Molecules that bmd gratuitously, i e witliout mducmg tlie effects of pyrH polypeptide are most likely to be good antagonists Molecules that bmd well and, as tl e case may be, mcrease the rate of product production from substrate, mcrease signal transduction, or mcrease chemical channel activity are agomsts Detection of the rate or level of, as the case may be, production
  • Polypeptides of the invention may be used to identify membrane bound or soluble receptors, if any. for such polypeptide, through standard receptor binding techniques known m the art These techmques mclude, but are not limited to, hgand binding and crosshnkmg assays in which the polypeptide is labeled with a radioactive isotope (for instance. 12-1). chemically modified (for instance, biotmylated), or fused to a peptide sequence suitable for detection or purification, and incubated with a source of the putative receptor (e g . cells, cell membranes, cell supernatants. tissue extracts, bodily materials) Other methods include biophysical techniques
  • screemng methods may also be used to identify agonists and antagonists of the polypeptide which compete with the binding of the polypeptide to its receptor(s), if any Standard methods for conducting such assays are well understood in the art
  • methods for identifying compounds which bmd to or otherwise mteract with and inhibit or activate an activity or expression of a polypeptide and/or polynucleotide of the mvention compnsmg contacting a polypeptide and/or polynucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polypeptide and/or polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction preferably bemg associated with a second component capable of providing a detectable signal
  • an assay for pyrH agomsts is a competitive assay that combmes pyrH and a potential agomst with pyrH-bmdmg molecules, recombinant pyrH binding molecules, natural substrates or hgands. or substrate or hgand mimetics, under appropnate conditions for a competitive inhibition assay
  • the pyrH molecule can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of pyrH molecules bound to a bmdmg molecule or converted to product can be determined accurately to assess the effectiveness of the potential antagonist
  • Potential antagonists mclude, among others, small organic molecules, peptides. polypeptides and antibodies that bmd to a polynucleotide and/or polypeptide of the mvention and thereby inhibit or extinguish its activity or expression Potential antagonists also may be small organic molecules, a peptide. a polypeptide such as a closely related protem or antibody that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule, without mducmg pyrH-mduced activities. thereb ⁇ preventmg the action or expression of pyrH polypeptides and/or polynucleotides by excluding pyrH polypeptides and/or polynucleotides from bmdmg
  • Potential antagonists m include a small molecule that bmds to and occupies the bmdmg site of the polypeptide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented
  • small molecules include but are not limited to small organic molecules, peptides or peptide-like molecules
  • Other potential antagonists m clude antisense molecules (see Okano, J Neurochem 56 560 (1991).
  • Prefened potential antagonists mclude compounds related to and vanants of pyrH
  • Other examples of potential polypeptide antagonists mclude antibodies or, m some cases, oligonucleotides or proteins which are closely related to the hgands. substrates, receptors, enzymes. etc . as the case may be. of the polypeptide, e g . a fragment of the hgands. substrates, receptors, enzymes, etc . or small molecules which bmd to the polypeptide of the present mvention but do not elicit a response, so that the activity of the polypeptide is prevented
  • Certam of the polypeptides of the mvention are biomimetics, functional mimetics of the natural pyrH polypeptide These functional mimetics may be used for. among other things, antagomzmg tl e activity of pyrH polypeptide or as a antigen or immunogen m a manner descnbed elsewhere herem
  • Functional mimetics of tlie polypeptides of the mvention include but are not limited to truncated polypeptides
  • prefened functional mimetics m clude. a polypeptide compnsmg the polypeptide sequence set forth m SEQ ID NO 2 lacking 20. 30. 40. 50. 60.
  • the present invention relates to a screenmg kit for identifying agomsts.
  • polypeptide and/or polynucleotide of the present mvention or compounds which decrease or enhance the production of such polypeptides and/or polynucleotides , which comprises (a) a polypeptide and/or a polynucleotide of the present invention. (b) a recombinant cell expressmg a polypeptide and/or polynucleotide of the present invention.
  • a cell membrane expressmg a polypeptide and/or polynucleotide of the present invention, or
  • polypeptide and/or polynucleotide of the present invention may also be used m a method for the structure-based design of an agonist, antagonist or inhibitor of the polypeptide and/or polynucleotide, by
  • the present mvention provides methods of treatmg abnormal conditions such as. for instance, a Disease, related to either an excess of. an under-expression of. an elevated activity of. or a decreased activity of pyrH polypeptide and/or polynucleotide
  • the expression and/or activity of the polypeptide and/or polynucleotide is m excess, several approaches are available One approach compnses adrnmistenng to an individual m need thereof an inhibitor compound (antagonist) as herem descnbed, optionally m combmation with a pharmaceutically acceptable earner, m an amount effective to inhibit the function and/or expression of the polypeptide and/or polynucleotide, such as, for example, by blocking the bmdmg of hgands.
  • soluble forms of the polypeptides still capable of bmdmg the hgand. substrate. enzymes, receptors, etc m competition with endogenous polypeptide and/or polynucleotide may be administered Typical examples of such competitors include fragments of the pyrH polypeptide and/or polypeptide
  • the present invention relates to genetically engmeered soluble fusion proteins comprising a polypeptide of the present invention, or a fragment thereof, and various portions of the constant regions of heavy or light chains of lmmunoglobuhns of various subclasses (IgG, IgM, IgA, IgE) Preferred as an immunoglobuhn is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region
  • the Fc part can be removed simply by incorporation of a cleavage sequence which can be cleaved with blood clotting factor Xa
  • this invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for drug screening, diagnosis and therapy
  • a further aspect of the invention also relates to polynucleotides encoding such fusion proteins Examples of fusion protem technology can be found in International Patent Application Nos W094/29458 and W094/22914
  • expression of the gene encodmg endogenous pyrH polypeptide can be inhibited using expression blocking techniques This blocking may be targeted against any step m gene expression, but is preferably targeted against transcnption and/or translation
  • expression blocking techniques This blocking may be targeted against any step m gene expression, but is preferably targeted against transcnption and/or translation
  • An examples of a known technique of this sort involve the use of antisense sequences, either internally generated or separately administered (see, for example. O'Connor. J Neurochem
  • ohgonucleotides which form triple helices with the gene can be supplied (see, for example. Lee et al , Nucleic Acids Res (1979) 6 3073, Cooney et al Science (1988) 241 456. Dervan et al , Science (1991) 251 1360) These ohgomers can be administered per se or the relevant ohgomers can be expressed in vivo
  • Each of the polynucleotide sequences provided herem may be used in the discovery and development of antibacterial compounds
  • the encoded protem. upon expression, can be used as a target for the screemng of antibacterial drugs
  • the polynucleotide sequences encoding the amino terminal regions of the encoded protein or Shme-Delgarno or other translation facilitating sequences of the respective mRNA can be used to construct antisense sequences to control the expression of the coding sequence of interest
  • the invention also provides the use of the polypeptide. polynucleotide. agonist or antagonist of the invention to interfere with the initial physical interaction between a pathogen or pathogens and a eukaryotic, preferably mammalian, host responsible for sequelae of infection
  • the molecules of the invention may be used m the prevention of adhesion of bacteria, in particular gram positive and/or gram negative bacteria, to eukaryotic, preferably mammalian, extracellular matrix proteins on in-dwelling devices or to extracellular matrix proteins m wounds, to block pyrH protein-mediated mammalian cell invasion by .
  • This invention provides a method of screemng drugs to identify those which are antibacterial by measuring the ability of the drug to interfere with the biosynthesis UDP
  • E coh PyrH enzyme catalyzes the transfert of a phosphoryl group from ATP to UMP which forms UDP with the concommitant release of ADP
  • UMP is incubated with ATP m the presence of PyrH protein to generate ADP and UDP which can be measured colo ⁇ met ⁇ cally usmg a suitably
  • pyrH agomsts and antagonists preferably bactenostatic or bactenocidal agomsts and antagonists
  • the antagonists and agomsts of the mvention may be employed, for instance, to prevent, inhibit and/or treat diseases
  • Hehcobacter pylori (herein "H pylon") bacteria infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastritis (International Agency for Research on Cancer (1994) Schistosomes Liver Flukes and Hehcobacter Pylon (International Agenc y , for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm)
  • the International Agency for Research on Cancer recentlv recognized a cause-and- effect relationship between H pylon and gastric adenocarcinoma, classifying the bacterium as a Group I (definite) carcinogen
  • Preferred antimicrobial compounds of the invention agonists and antagonists of pvr ⁇ polypeptides and/or polynucleotides found usmg screens provided by the invention, or known in the art, particularly narrow-spectrum antibiotics, should be useful in the treatment of H pylori infection Such treatment should decrease the advent of H
  • a Staphylococcus aureus bactena Another aspect of the mvention relates to a method for inducing an immunological response in an individual, particularly a mammal which comprises inoculating the individual with pyr ⁇ polynucleotide and/or polypeptide, or a fragment or variant thereof, adequate to produce antibody and/ or T cell immune response to protect said individual from infection, particularly bacterial infection and most particularly Staphylococcus aureus infection Also provided are methods whereby such immunological response slows bacterial replication
  • Yet another aspect of the invention relates to a method of inducing immunological response in an individual which comprises delivering to such individual a nucleic acid vector, sequence or nbozyme to direct expression of pyi ⁇ polynucleotide and/or polypeptide, or a fragment or a variant thereof, for expressing pyr ⁇ polynucleotide and/or polypeptide, or a fragment or a variant thereof in vivo m
  • nucleic acid vector may comprise DNA.
  • a further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of havmg induced within it an immunological response, induces an immunological response in such individual to a pyrH polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant pyrH polynucleotide and/or polypeptide encoded therefrom and/or comprises DNA and/or RNA which encodes and expresses an antigen of said pyrH polynucleotide.
  • the immunological response may be used therapeutically or prophylactically and may take the fonn of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells
  • a pyrH polypeptide or a fragment thereof may be fused with co-protein or chemical moiety which may or may not by itself produce antibodies, but which is capable of stabilizing the first protein and producing a fused or modified protein which will have antigenic and/or immunogenic properties, and preferably protective properties
  • fused recombinant protein preferably further comprises an antigenic co-protem, such as hpoprotem D from Hemophilus influenzae, Glutathione-S-transferase (GST) or beta-galactosidase.
  • co-protein may act as an adjuvant m the sense of providing a generalized stimulation of the immune system of the organism receiving the protem
  • co-protem may be attached to either the amino- or carboxy-terminus of the first protem
  • compositions particularly vaccine compositions, and methods comprising the polypeptides and or polynucleotides of the mvention and lmmunostimulatory DNA sequences, such as those described in Sato, Y et al Science 273 352 (1996)
  • polynucleotide constructs used m such genetic immunization experiments in animal models of infection with Staphylococcus aureus Such experiments will be particularly
  • a polypeptide of the invention may be used as an antigen for vaccination of a host to produce specific antibodies which protect against invasion of bacteria, for example by blocking adherence of bacteria to damaged tissue
  • tissue damage include wounds in skm or connective tissue caused, for example, by mechanical, chemical, thermal or radiation damage or by implantation of indwelling devices, or wounds in the mucous membranes, such as the mouth, throat, mammary glands, urethra or vagma
  • the invention also includes a vaccine formulation which comprises an immunogenic recombinant polypeptide and/or polynucleotide of the mvention together with a suitable carrier.
  • a suitable carrier such as a pharmaceutically acceptable carrier
  • each is preferably administered parenterally, including, for example, administration that is subcutaneous, intramuscular, intravenous, or lntradermal
  • Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacte ⁇ ostatic compounds and solutes which render the formulation isotonic with the bodily fluid, preferably the blood, of the individual, and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-d ⁇ ed condition requiring only the addition of the ster
  • compositions compnsmg a pyrH polynucleotide and/or a pyrH polypeptide for administration to a cell or to a multicellular orgamsm
  • the mvention also relates to compositions compnsmg a polynucleotide and/or a polypeptides discussed herem or their agomsts or antagonists
  • the polypeptides and polynucleotides of the mvention may be employed m combmation with a non-stenle or stenle earner or earners for use with cells, tissues or orgamsms. such as a pharmaceutical earner suitable for admimstration to an mdividual
  • Such compositions compnse for instance, a media additive or a therapeutically effective amount of a polypeptide and or polynucleotide of the mvention and a pharmaceutically acceptable earner or excipient
  • Such earners may mclude.
  • Tlie formulation should suit tlie mode of admimstration
  • the mvention further relates to diagnostic and pharmaceutical packs and kits compnsmg one or more containers filled with one or more of tlie ingredients of the aforementioned compositions of the mvention
  • Polypeptides Polypeptides. polynucleotides and other compounds of the mvention may be employed alone or m conjunction with other compounds, such as therapeutic compounds
  • compositions may be adrmmstered m any effective, convement manner mcludmg. for instance, administration by topical, oral, anal, vagmal, mtravenous. rntrapentoneal. intramuscular, subcutaneous, mtranasal or lntradermal routes among others
  • the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic
  • compositions may be formulated for topical application for example in the form of ointments, creams, lotions, eye ointments, eye drops, ear drops, mouthwash.
  • impregnated dressings and sutures and aerosols and may contain appropriate conventional additives, including, for example, preservatives, solvents to assist drug penetration and emollients in ointments and creams
  • Such topical formulations may also contain compatible conventional carriers, for example cream or ointment bases, and ethanol or oleyl alcohol for lotions
  • Such earners may constitute from about 1% to about 98% by weight of the formulation, more usually they will constitute up to about 80% by weight of the formulation
  • the present mvention provides for pharmaceutical compositions compnsmg a therapeutically effective amount of a polypeptide and/or polynucleotide.
  • a polypeptide and/or polynucleotide of the present mvention agomst or antagonist peptide or small molecule compound, m combination with a pharmaceutically acceptable earner or excipient
  • earners mclude, but are not limited to, salme, buffered salme, dextrose, water, glycerol. ethanol. and combmations thereof
  • the mvention further relates to pharmaceutical packs and kits compnsmg one
  • Polypeptides, polynucleotides and other compounds of the present mvention may be employed alone or m conjunction with other compounds, such as therapeutic compounds
  • composition will be adapted to the route of admimstration, for instance by a systemic or an oral route
  • Prefened forms of systemic administration mclude injection, typically by mtravenous injection
  • Other injection routes such as subcutaneous, intramuscular, or rntrapentoneal.
  • transmucosal and transdermal admimstration usmg penetrants such as bile salts or fusidic acids or other detergents
  • penetrants such as bile salts or fusidic acids or other detergents
  • Admimstration of these compounds may also be topical and/or localized, mthe form of salves, pastes, gels, and the like
  • the daily dosage level of the active agent will be from 0 01 mg/kg to 10 mg/kg, typically around 1 mg/kg
  • the physician in any event will determine the actual dosage which will be most suitable for an individual and will vary with the age. weight and response of the particular individual
  • the above dosages are exemplary of the average case There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are withm the scope of this invention
  • In-dwelhng devices include surgical implants, prosthetic devices and catheters, I e . devices that are introduced to the body of an individual and remain m position for an extended time Such devices mclude, for example, artificial joints, heart valves, pacemakers, vascular grafts, vascular catheters, cerebrospmal fluid shunts, urinary catheters, contmuous ambulatory peritoneal dialysis (CAPD) catheters
  • composition of the invention may be administered by injection to achieve a systemic effect against relevant bacteria shortly before insertion of an in-dwelhng device Treatment may be continued after surgery during the in-body time of the device
  • composition could also be used to broaden perioperative cover for any surgical technique to prevent bactenal wound infections, especially Staphylococcus aureus wound mfections
  • compositions of this invention may be used generally as a wound treatment agent to prevent adhesion of bacteria to matnx protems
  • composition of the mvention may be used to bathe an indwelling device immediately before insertion
  • the active agent will preferably be present at a concentration of 1 ⁇ g/ml to 1 Omg/ml for bathing of wounds or indwelling devices
  • a vaccine composition is conveniently in mjectable form
  • Conventional adjuvants may be employed to enhance the immune response
  • a suitable unit dose for vaccination is 0 5-5 microgram/kg of antigen, and such dose is preferably administered 1 -3 times and with an interval of 1-3 weeks With the indicated dose range, no adverse toxicological effects will be observed with the compounds of the invention which would preclude their administration to suitable individuals Sequence Databases, Sequences in a Tangible Medium, and Algorithms
  • Polynucleotide and polypeptide sequences form a valuable information resource with which to detennme their 2- and 3 -dimensional structures as well as to identify further sequences of similar homology
  • These approaches are most easily facilitated by storing the sequence m a computer readable medium and then usmg the stored data m a known macromolecular structure program or to search a sequence database usmg well known searching tools, such as GCC
  • polynucleotide and polypeptide sequences of the invention are particularly useful as components in databases useful for search analyses as well as in sequence analysis algorithms As used m this section entitled “Sequence Databases. Sequences in a Tangible Medium, and Algorithms.” and m claims related to this section, the terms “polynucleotide of the invention” and “polynucleotide sequence of the invention” mean any detectable chemical or physical characteristic of a polynucleotide of the invention that is or may be reduced to or stored in a tangible medium, preferably a computer readable form For example, chromatographic scan data or peak data, photographic data or scan data therefrom, called bases, and mass spectrographic data As used in this section entitled Databases and Algorithms and m claims related thereto, the terms “polypeptide of the mvention” and “polypeptide sequence of the invention” mean any detectable chemical or physical characteristic of a polypeptide of the invention that is or may be reduced to or stored in a
  • the mvention provides a computer readable medium havmg stored thereon polypeptide sequences of the invention and/or polynucleotide sequences of the invention
  • a computer readable medium comprising and having stored thereon a member selected
  • sequence analysis comprises the steps of providing a polynucleotide sequence comprising the sequence a polynucleotide of the invention in a computer readable medium, and companng said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a computer based method is also provided for performing homology identification, said method comprising the steps of providing a polypeptide sequence compnsmg the sequence of a polypeptide of the invention in a computer readable medium, and comparing said polypeptide sequence to at least one polynucleot
  • a computer based method is still further provided for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of a polynucleotide of the invention in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
  • a further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polynucleotide sequence comprising the sequence of a polynucleotide of the mvention in a computer readable medium, and comparing said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a further embodiment of the invention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of a polypeptide of the invention m a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a further embodiment of the invention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of a polynucleotide of the invention in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
  • a computer readable medium having stored thereon a member selected from the group consistmg of a polynucleotide comprising the sequence of SEQ ID NO 1, a polypeptide comprising the sequence of SEQ ID NO 2.
  • a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 2, a data set representing a polynucleotide sequence comprising the sequence of SEQ ID NO 1.
  • a data set representmg a polynucleotide sequence encoding a polypeptide sequence comprising the sequence of SEQ ID NO 2 A further preferred
  • - 36 - embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providmg a polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and companng said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a still further preferred embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of SEQ ID NO 2 m a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homolog ⁇
  • a further embodiment of the mvention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
  • a further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providmg a polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and comparing said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of SEQ ID NO 2 in a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homology
  • a further embodiment of the invention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence compnsmg the sequence of SEQ ID NO 1 in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
  • ant ⁇ body( ⁇ es) as used herein includes polyclonal and monoclonal antibodies, chime ⁇ c. single cham. and humanized antibodies, as well as Fab fragments, including the products of an Fab or other lmmunoglobulm expression library "Antigemcally equivalent de ⁇ vat ⁇ ve(s)" as used herein encompasses a polypeptide.
  • Bispecific ant ⁇ body( ⁇ es) means an antibody comprising at least two antigen bmdmg domains, each domain directed against a different epitope
  • Bodily mate ⁇ al(s) means any matenal denved from an individual or from an organism infecting, infesting or inhabiting an individual, mcludmg but not limited to. cells, tissues and waste. such as, bone, blood, serum, cerebrospmal fluid, semen, saliva, muscle, cartilage, organ tissue, skm. urine, stool or autopsy matenals
  • D ⁇ sease(s) means any disease caused by or related to infection by a bactena. mcludmg . for example, disease, such as, infections of the upper respiratory tract (e g . otitis media, bactenal tracheitis. acute epiglottitis. thyroiditis), lower respiratory (e g . empyema. lung abscess), cardiac (e g infective endocarditis), gastromtestmal (e g , secretory dianhoea, splenic absces, retropentoneal abscess), CNS (e g , cerebral abscess), eye (e g . blephantis, conjunctivitis, keratitis.
  • infections of the upper respiratory tract e g otitis media, bactenal tracheitis. acute epiglottitis. thyroiditis
  • lower respiratory e g . empyema. lung abscess
  • cardiac e g
  • endophthalmitis preseptal and orbital celluhtis, darcryocystitis), kidney and urinary tract (e g , epididymitis. mtrarenal and pennephnc abscess, toxic shock syndrome), skm (e g , impetigo, follicuhtis, cutaneous abscesses, celluhtis, wound infection, bactenal myositis) bone and joint (e g . septic arthntis, osteomyelitis)
  • Fusion protem(s) refers to a protein encoded by two, often unrelated, fused genes or fragments thereof
  • EP-A-0464 discloses fusion proteins comprising various portions of constant region of lmmunoglobulm molecules together with another human protem or part thereof
  • employing an lmmunoglobulm Fc region as a part of a fusion protem is advantageous for use m therapy and diagnosis resulting in. for example, improved pharmacokmetic properties [see, e g , EP-A 0232262]
  • EP-A 0232262 for some uses it
  • “Host cell(s)” is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence "Identity.” as known m the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be. as determined by companng the sequences In the art, “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be. as determined by the match between strings of such sequences "Identity” can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology. Lesk. A M . ed , Oxford University Press. New York.
  • Parameters for polynucleotide comparison include the following
  • Polynucleotide embodiments further mclude an isolated polynucleotide comprising a polynucleotide sequence having at least a 50, 60. 70, 80. 85, 90. 95, 97 or 100% identity to the reference sequence of SEQ ID NO 1. wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may include up to a certain mteger number of nucleotide alterations as compared to the reference sequence wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, mcludmg transition and transversion.
  • alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides m the reference sequence or in one or more contiguous groups withm the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides m SEQ ID NO 1 by the mteger defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides m SEQ ID NO 1. or
  • n n is the number of nucleotide alterations
  • x n is the total number of nucleotides in SEQ
  • y is 0 50 for 50%. 0 60 for 60%. 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%, 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-mteger product of x n and y is rounded down to the nearest integer prior to subtracting it from x n Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO 2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
  • a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 2. that is it may be 100% identical, or it may include up to a certain integer number of amino acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity
  • Such alterations are selected from the group consisting of at least one nucleic acid deletion, substitution, including transition and transversion.
  • nucleic acid alterations for a given percent identity is determined by multiplying the total number of ammo acids in SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of ammo acids in SEQ ID NO 2. or
  • n n is the number of ammo acid alterations.
  • x n is the total number of ammo acids in SEQ
  • Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 50,60. 70, 80, 85, 90. 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2.
  • said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may include up to a certam mteger number of ammo acid alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the ammo- or carboxy-termmal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids in the reference sequence or in one or more contiguous groups within the reference sequence, and wherem said number of ammo acid alterations is determined by multiplymg the total number of ammo acids m SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids m SEQ ID NO 2. or
  • n a is the number of amino acid alterations.
  • x a is the total number of ammo acids m SEQ
  • ID NO 2. y is 0 50 for 50%. 0 60 for 60%. 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%. 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-mteger product of x a and y is rounded down to the nearest integer prior to subtracting it from x a
  • a polypeptide sequence of the present mvention may be identical to the reference sequence of SEQ ID NO 2 that is it may be 100% identical, or it ma-s mclude up to a certam mteger number of amino acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity
  • Such alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids m the reference sequence or in one or more contiguous groups within the reference sequence
  • the number of ammo acid alterations for a given % identity is determined by multiplymg the total number of ammo acids in SEQ ID NO 2 by the mteger defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids m SEQ ID NO 2, or
  • n a is the number of ammo acid alterations
  • x a is the total number of amino acids m SEQ
  • y is, for instance 0 70 for 70%, 0 80 for 80%, 0 85 for 85% etc . and • is the symbol for the multiplication operator, and wherein any non-mteger product of x a and y is rounded down to the nearest integer prior to subtracting it from x a
  • “lmmunologically equivalent de ⁇ vat ⁇ ve(s)” as used herem encompasses a polypeptide. polynucleotide, or the equivalent of either which when used in a suitable formulation to raise antibodies in a vertebrate, the antibodies act to interfere with the immediate physical interaction between pathogen and mammalian host
  • Immunospecific means that charactenstic of an antibody whereby it possesses substantially greater affihity for the polypeptides of the mvention or the polynucleotides of the mvention than its
  • Ind ⁇ v ⁇ dual(s) means a multicellular eukaryote. mcludmg, but not limited to a metazoan, a mammal, an ovid. a bovid, a simian, a primate, and a human "Isolated” means altered “by the hand of man” from its natural state. / e .
  • a polynucleotide or a polypeptide naturally present m a Irving orgamsm is not “isolated.” but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is "isolated", as the term is employed herem
  • a polynucleotide or polypeptide that is mtroduced mto an organism by transformation, genetic manipulation or by any other recombmant method is "isolated” even if it is still present in said orgamsm. winch organism may be living or non-living
  • Organ ⁇ sm(s) means a (l) prokaryote.
  • mcludmg but not limited to, a member of the genus Streptococcus, Staphylococcus, Bordetella Corynebactenum, Mycobactenum, Neissena Haemophilus, Actinomycetes, Streptomycetes, Nocardia, Enterobacter Yersinia Fancisella Pasturella, Moraxella, Acinetobacter, Erysipelothnx, Branhamella, Actinobacillus, Streptobac llus Listena, Calymmatobacterium, Brucella, Bacillus, Clostridium, Treponema Eschenchia Salmonella, Kleibsiella, Vibrio, Proteus, Erwinia, Borrelia, Leptospira, Spirillum, Campylobacter, Shigella, Legwnella, Pseudomonas, Aeromon
  • Bordatella parapertusis Bordetella bronchiseptica, Eschenchia coh, Shigella dysentenae, Haemophilus influenzae, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus ducrey , Bordetella, Salmonella typhi, Citrobacter freundu, Proteus mirabihs, Proteus vulgans Yersinia pestis, Kleibsiella pneumoniae, Serratia marcessens, Serratia liquefaciens. Vibrio cholera.
  • Shigella dysenteni Shigella flexneri, Pseudomonas aeruginosa, Franscisella tularensis, Brucella abortis, Bacillus anthracis, Bacillus cereus, Clostndium perfnngens, Clostridium tetani Clostridium botubnum, Treponema pallidum, Rickettsia nckettsii and Chlamydia trachomitis, (n) an archaeon, mcludmg but not limited to Archaebacter. and (in) a unicellular or filamentous eukaryote. mcludmg but not limited to. a protozoan, a fungus, a member of the genus Saccharomyces
  • Kluveromyces or Candida, and a member of the species Saccharomyces cenviseae, Kluveromyces lactis or Candida albicans
  • Polynucleotide(s) generally refers to any polynbonucleotide or polydeoxynbonucleoude. which may be unmodified RNA or DNA or modified RNA or DNA "Polynucleot ⁇ de(s)" mclude. without limitation, smgle- and double-stranded DNA. DNA that is a mixture of smgle- and double- stranded regions or smgle-.
  • polynucleotide refers to tnple-stranded regions compnsmg RNA or DNA or both RNA and DNA The strands m such regions may be from the same molecule or from different molecules The regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules One of the molecules of a tnple-hehcal region often is an oligonucleotide As used herem.
  • polynucleot ⁇ de(s) also mcludes DNAs or RNAs as descnbed above that contain one or more modified bases Thus. DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is mtended herem Moreover.
  • DNAs or RNAs compnsmg unusual bases, such as mosme, or modified bases, such as tntylated bases, to name just two examples, are polynucleotides as the term is used herem It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill m the art
  • polynucleotide(s) as it is employed herem embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA charactenstic of viruses and cells, mcludmg. for example, simple and complex cells
  • "Pohnucleotide(s)” also embraces short polynucleotides often refened to as ohgonucleotide(s)
  • Polypeptide(s) refers to any peptide or protem compnsmg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds
  • Polypeptide(s) refers to both short chains, commonly refened to as peptides, ohgopeptides and ohgomers and to longer chains generally refened to as protems
  • Polypeptides may contain ammo acids other than the 20 gene encoded ammo acids
  • “Po ypept ⁇ de(s)” mclude those modified either by natural processes, such as processmg and other post- translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and in more detailed monographs, as well as m a volummous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present m the same or varying degree at several sites m a given polypeptide Also, a given polypeptide may contain many types
  • Modifications include, for example, acetylation. acylation. ADP-nbosylation. amidation. covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative, covalent attachment of a hpid or hpid denvative. covalent attachment of phosphotidylmositol, cross-linking, cyclization. disulfide bond formation, demethylation formation of covalent cross-links, formation of cysteme. formation of pyroglutamate. formylation. gamma-carboxylation. GPI anchor formation, hydroxylation, lodination, methylation.
  • Polypeptides may be branched or cyclic, with or without branching Cyclic, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well
  • Recombmant expression system(s) refers to expression systems or portions thereof or polynucleotides of the mvention mtroduced or transformed mto a host cell or host cell lysate for the production of the polynucleotides and polypeptides of the mvention
  • “Subtraction set” is one or more, but preferably less than 100, polynucleotides comprising at least one polynucleotide of the invention
  • Va ⁇ ant(s) ' as the tenn is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties
  • a typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the variant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result in ammo acid substitutions, additions, deletions, fusion proteins and truncations m the polypeptide encoded by the reference sequence, as discussed below
  • a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide Generally , differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical
  • a vanant and reference polypeptide may differ in amino acid sequence by one or more
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code
  • the present mvention also mcludes mclude vanants of each of the polypeptides of the mvention, that is polypeptides that van from tl e referents by conservative a mo acid substitutions, whereby a residue is substituted by another with like charactenstics Typical such substitutions are among Ala, Val. Leu and He. among Ser and Thr. among the acidic residues Asp and Glu. among Asn and Gin. and among the basic residues Lys and Arg. or aromatic residues Phe and Tyr Particularly prefened are vanants m which several. 5-10.
  • a variant of a polynucleotide or polypeptide may be a naturally occurring such as an allehc variant, or it may be a variant that is not known to occur naturally
  • Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techmques. by direct synthesis, and by other recombinant methods known to skilled artisans EXAMPLES
  • the polynucleotide having a DNA sequence given in Table 1 [SEQ ID NO 1] was obtamed from a library of clones of chromosomal DNA of Staphylococcus aureus in E coh
  • the sequencing data from two or more clones containing overlapping Staphylococcus aureus DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routine methods, for example Methods 1 and 2 below
  • Total cellular DNA is mechanically sheared by passage through a needle m order to size- fractionate according to standard procedures
  • DNA fragments of up to 1 lkbp in size are rendered blunt by treatment with exonuclease and DNA polymerase. and EcoRI linkers added Fragments are ligated into the vector Lambda Zapll that has been cut with EcoRI.
  • the library packaged by standard procedures and E coh infected with the packaged library The library is amplified by standard procedures Method 2

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides pyrH polypeptides and polynucleotides encoding pyrH polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing pyrH polypeptides to screen for antibacterial compounds.

Description

STAPHYLOCOCCUS AUREUS pyrH POLYPEPΗDES AND POLYNUCLEOTIDES
FIELD OF THE INVENTION
This invention relates to newly identified polynucleotides and polypeptides. and their production and uses, as well as their variants, agonists and antagonists, and their uses In particular, the invention relates to polynucleotides and polypeptides of the Undine monophosphate (UMP) kinase family, as well as their variants, hereinafter referred to as "pyrH." "pyrH polynucleotιde(s) " and "pyrH polypeptιde(s) "
BACKGROUND OF THE INVENTION
It is particularly preferred to employ Staphylococcal genes and gene products as targets for the development of antibiotics The Staphylococci make up a medically unportant genera of microbes They are known to produce two types of disease, invasive and toxigemc hwasive infections are characterized generally by abscess formation effecting both skin surfaces and deep tissues S aureus is the second leading cause of bacteremia in cancer patients Osteomyelitis, septic arthritis, septic thrombophlebitis and acute bacterial endocarditis are also relatively common There are at least three clinical conditions resulting from the toxigemc properties of Staphylococci The manifestation of these diseases result from the actions of exotoxins as opposed to tissue invasion and bacteremia These conditions include Staphylococcal food poisoning, scalded skin syndrome and toxic shock syndrome
The frequency of Staphylococcus aureus infections has risen dramatically in the past few decades This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune systems It is no longer uncommon to isolate Staphylococcus aureus strains which are resistant to some or all of the standard antibiotics This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism
Moreover, the drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics," that is, high throughput genome- or gene-based biology This approach is rapidly superseding earlier approaches based on "positional cloning" and other methods Functional genomics relies heavily on the vaπous tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available as well as from other sources There is a continuing and significant need to identify and characterize further genes and other polynucleotides sequences and their related polypeptides, as targets for drug discovery
- 1 - UMP kinase is involved in the biosynthesis of pvπmidine tπphosphate nucleosides from glucose metabolism intermediates via the de novo pathway or from exogenous uracil and undine The pynmidine tnphosphate nucleotides are precursors in the biosynthesis of macromolecules such as RNA, DNA, phospho pids and peptidoglycan The essential nature of the gene product of pyrH in Eschenchia co has been demonstrated by the construction of temperature sensitive mutants (Yamanaka, K . Ogura, T . Niki. H . and Hiraga. S 1992 J Bactenol 174. 7517-7526) Cold sensitive mutants have also been isolated in Eschenchia coh (Yamanaka, K . Ogura, T , Niki. H . and Hiraga. S 1992 J Bactenol 174. 7517- 7526 Bucurenci. N , Senna. L . Zahana. C , Landais, S . Danchin. A . and Barzu 0 1998 J Bactenol 180. 473-477) and Salmonella typhrmunum (Ingraham. J L . and Neuhard. J 1972 J Biol Chem 247, 6259-6265) Furthermore, corrsistent vvim tl e important physiological role of UMP kinase, the pyrH mutants show pleiotroplnc effects including inhibition of macromolecule synthesis, defects in the membrane and change in the cell morphology (Yamanaka. K , Ogura. T . Niki. H . and Hiraga. S 1992 J Bactenol 174. 7517-7526) Clearly, there exists a need for polynucleotides and polypeptides. such as the pyrH embodiments of the invention, that have a present benefit of. among other things, being useful to screen compounds for antibiotic activity Such factors are also useful to determine their role in pathogenesis of infection, dysfunction and disease There is also a need for identification and charactenzation of such factors and their antagonists and agonists to find ways to prevent, ameliorate or conect such infection, dysfunction and disease
Certain of the polypeptides of the invention possess significant amino acid sequence homology to a known Bacillus subti s smbA, Synechocystis sp pyrH. Mycobactenum leprae pyrH. Mycobactenum tuberculosis pyrH. Eschenchia coh smbA, Haemophilus influenzae pyrH. Hehcobacter pylon pyrH. Mycoplasma pneumoniae pyrH, Chlamydia trachomatis pyrH. Mycoplasma gemtahum smbA, Thermus aquaticus pyrH, Archaeoglobus fulgidus pyrH, Methanococcus jannaschii pyrH, Pyrococcus honkoshn pyrH and Bonelia burgdorfen smbA protein (smbA (pyrH) in Bacillus subtihs GeneBank Z99112, pyrH in Synechocystis sp GeneBank D90915. pyrH in Mycobactenum leprae GeneBank Z97369, pyrH in Mycobactenum tuberculosis GeneBank Z74024, smbA (pyrH) in Eschenchia coh GeneBank D26562 and X78809. pyrH in Haemophilus influenzae GeneBank U32786, pyrH in Hehcobacter pylori GeneBank AE000589. pyrH in Mycoplasma pneumoniae GeneBank AE000021, pyrH m Chlamydia trachomatis GeneBank U60196, smbA (pyrH) in Mycoplasma gemtahum GeneBank U39730. pyrH m Thermus aquaticus (partial) GeneBank X83598, pyrH in Archaeoglobus fulgidus GeneBank
- 2 AE000962. pyrH m Methanococcus jannaschii GeneBank U67566, pyrH in Pyrococcus honkoshn GeneBank AB005215. smbA (pyrH) in Borreha burgdorfeπ GeneBank AE001158)
SUMMARY OF THE INVENTION
The present invention relates to pyrH, in particular pyrH polypeptides and pyrH polynucleotides. recombinant matenals and methods for their production In another aspect, the invention relates to methods for using such polypeptides and polynucleotides. including the treatment of microbial diseases, amongst others In a further aspect, the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified compounds In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting pyrH expression or activity
Vanous changes and modifications within the spmt and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descnptions and from reading the other parts of the present disclosure
DESCRIPTION OF THE INVENTION
The invention relates to pyrH polypeptides and polynucleotides as descnbed in greater detail be m In particular, the invention relates to polypeptides and polynucleotides of a pyrH of Staphylococcus aureus. which is related by ammo acid sequence homology to Bacillus subtihs smbA. Synechocystis sp pyrH, Mycobactenum leprae pyrH, Mycobactenum tuberculosis pyrH. Eschenchia co smbA. Haemophilus influenzae pyrH. Hehcobacter pylon pyrH. Mycoplasma pneumoniae pyrH. Chlamydia trachomatis pyrH, Mycoplasma gemtahum smbA, Thermus aquaticus pyrH. Archaeoglobus fulgidus pyrH, Methanococcus jannaschii pyrH, Pyrococcus honkoshn p\τH and Bone a burgdorfen smbA polypeptide The invention relates especially to pyrH having the nucleotide and ammo acid sequences set out in Table 1 as SEQ ID NO 1 and SEQ ID NO 2 respectively
TABLE 1 pyrH Polynucleotide and Polypeptide Sequences (A) Staphylococcus aureus pyrH polynucleotide sequence [SEQ ID NO 1]
5 ' -ATGGCTCAAATTTCTAAATATAAACGTGTAGTTTTGAAACTAAGTGGTGAAGCGTTAGCT GGAGAAAAAGGATTTGGCATAAATCCAGTAATTATTAAAAGTGTTGCTGAGCAAGTGGCT GAAGTTGCTAAAATGGACTGTGAAATCGCAGTAATCGTTGGTGGCGGAAACATTTGGAGA GGT7\AAACAGGTAGTGACTTAGGTATGGACCGTGGAACTGCTGATTACATGGGTATGCTT GCAACTGTAATGAATGCCTTAGCATTACAAGATAGTTTAGAACAATTGGATTGTGATACA CGAGTATTAACATCTATTGAAATGAAGCAAGTGGCTGAACCTTATATTCGTCGTCGTGCA ATTAGACACTTAGAAAAGAAACGCGTAGTTATTTTTGCTGCAGGTATTGGAAACCCATAC TTCTCTACAGATACTACAGCGGCATTACGTGCTGCAGAAGTTGAAGCAGATGTTATTTTA ATGGGCAAAAATAATGTAGATGGTGTATATTCTGCAGATCCTAAAGTAAACAAAGATGCG GTAAAATATGAACATTTAACGCATATTCAAATGCTTCAAGAAGGTTTACAAGTAATGGAT TCAACAGCATCCTCATTCTGTATGGATAATAACATTCCGTTAACTGTTTTCTCTATTATG GAAGAAGGGAATATTAAACGTGCTGTTATGGGTGAAAAGATAGGTACGTTAATTACAAAA TAA-3 '
(B) Staphylococcus aureus pyrH polypeptide sequence deduced from a polynucleotide sequence in this table [SEQ ID NO 2]
NH2-MAQI SKYKRWLKLSGEALAGEKGFGINPVI I KSVAEQVAEVAKMDCEIAVIVGGGNIWR GKTGSDLGMDRGTADYMGMLATλMNALALQDSLEQLDCDTRVLTS I EMKQVAEPYI RRRA I RHLEKKRWI FAAGI GNPYFSTDTTAALRAAEVEADVI LMGKNNVDGVYSADPKVNKDA
VKYEHLTHIQMLQEGLQVMDSTAS S FCMDNNI PLTVFS IMEEGNI KRAVMGEKI GTLITK- COOH
Deposited materials A deposit containing a Staphylococcus aureus WCUH 29 strain has been deposited with the
National Collections of Industnal and Marine Bactena Ltd (herem "NCIMB"). 23 St Machar Dnve Aberdeen AB2 IRY. Scotland on 11 September 1995 and assigned NCIMB Deposit No 40771. and refened to as Staphylococcus aureus WCUH29 on deposit The Staphylococcus aureus strain deposit is refened to herein as "the deposited strain" or as "the DNA of the deposited strain " The deposited strain contains the full length pyrH gene The sequence of the polynucleotides contained in the deposited strain, as well as the amino acid sequence of any polypeptide encoded thereby, are controlling in the event of any conflict with any descnption of sequences herein
The deposit of the deposited strain has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure The stram will be inevocably and without restnction or condition released to the public upon the issuance of a patent The deposited strain is provided merely as convenience to those of skill in the art
- 4 and is not an admission that a deposit is required for enablemen such as that required under 35 U S C §112
A license may be required to make, use or sell the deposited strain, and compounds denved therefrom, and no such license is hereby granted In one aspect of the invention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressible by the Staphylococcus aureus WCUH 29 stram. which polypeptide is contained m the deposited strain Further provided by the mvention are pyrH polynucleotide sequences in the deposited strain, such as DNA and RNA, and amino acid sequences encoded thereby Also provided by the invention are pyrH polypeptide and polynucleotide sequences isolated from the deposited stram
Polypeptides
The pyrH polypeptide of the mvention is substantially phylogenetically related to other proteins of the Undine monophosphate (UMP) kinase family hi one aspect of the mvention there are provided polypeptides of Staphylococcus aureus refened to herein as "pyrH" and "pyrH polypeptides" as well as biologically, diagnosticalh . prophylactically. clinically or therapeutically useful vanants thereof, and compositions compnsing the same
Among the particularly prefened embodiments of the mvention are vanants of pyrH polypeptide encoded by naturally occurring alleles of the pyrH gene The present mvention further provides for an isolated polypeptide which
(a) comprises or consists of an ammo acid sequence which has at least 70% identity . preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, most preferably at least 97-99% or exact identity, to that of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (b) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1, (c) a polypeptide encoded by an isolated polynucleotide comprising or consistmg of a polynucleotide sequence encoding a polypeptide which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity, to the ammo acid sequence of SEQ ID NO 2. over the entire length of SEQ ID NO 2
- 5 The polypeptides of the mvention include a polypeptide of Table 1 [SEQ ID NO 2] (in particular the mature polypeptide) as well as polypeptides and fragments, particularly those which have the biological activity of pyrH. and also those which have at least 70% identity to a polypeptide of Table 1 [SEQ ID NO l]or the relevant portion, preferably at least 80% identity to a polypeptide of Table 1 [SEQ ID NO 2and more preferably at least 90% identity to a polypeptide of Table 1 [SEQ ID NO 2] and still more preferably at least 95% identity to a polypeptide of Table 1 [SEQ ID NO 2] and also mclude portions of such polypeptides with such portion of the polypeptide generally containing at least 30 ammo acids and more preferably at least 50 ammo acids
The mvention also mcludes a polypeptide consistmg of or compnsmg a polypeptide of the formula
X-(R1)m-(R2)-(R3)n-Y wherem. at the ammo terminus. X is hydrogen, a metal or any other moiety descnbed herein for modified polypeptides. and at the carboxyl terminus. Y is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides, R\ and R3 are any ammo acid residue or modified amino acid residue, m is an mteger between 1 and 1000 or zero, n is an mteger between 1 and 1000 or zero, and R2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from
Table 1 or modified forms thereof In the formula above, R2 is onented so that its ammo tennmal ammo acid residue is at the left, covalently bound to Ri and its carboxy tennmal ammo acid residue is at the nglit. covalently bound to R3 Any stretch of am o acid residues denoted by either R\ or R3. where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500, and n is an mteger between 1 and 50. 100. or 500
It is most prefened that a polypeptide of the mvention is denved from Staphylococcus aureus. however, it may preferably be obtamed from other organisms of the same taxonomic genus A polypeptide of the mvention may also be obtamed, for example, from orgamsms of the same taxonomic family or order
A fragment is a vanant polypeptide havmg an ammo acid sequence that is entirely the same as part but not all of any ammo acid sequence of any polypeptide of the mvention As with pyrH polypeptides, fragments may be "free-standing." or compnsed within a larger polypeptide of which they form a part or region, most preferably as a single contmuous region in a smgle larger polypeptide Prefened fragments mclude. for example, truncation polypeptides havmg a portion of an ammo acid sequence of Table 1 [SEQ ID NO 2], or of vanants thereof, such as a contmuous senes of residues that mcludes an amino- and/or carboxyl-teirmnal ammo acid sequence Degradation forms of
- 6 - the polypeptides of the mvention produced by or m a host cell, particularly a Staphylococcus aureus are also prefened Further prefened are fragments characterized by structural or functional attributes such as fragments that compnse alpha-helix and alpha-helix forming regions, beta-sheet and beta- sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions
Further prefened fragments mclude an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids from the ammo acid sequence of SEQ ID NO 2, or an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids truncated or deleted from the ammo acid sequence of SEQ ID NO 2
Also prefened are biologically active fragments which are those fragments that mediate activities of pyrH including those with a similar activity or an improved activity, or with a decreased undesirable activity Also mcluded are those fragments that are antigenic or lmmunogenic m an animal, especially in a human Particularly prefened are fragments compnsmg receptors or domams of enzymes that confer a function essential for viability of Staphylococcus aureus or the ability to initiate, or maintain cause Disease m an individual, particularly a human
Fragments of the polypeptides of the mvention may be employed for producing the conesponding full-length polypeptide by peptide synthesis, therefore, these vanants ma\ be employed as intermediates for producmg the full-lengtii polypeptides of the mvention
In addition to the standard single and triple letter representations for amino acids, the term "X" or "Xaa" may also be used in describing certain polypeptides of the invention "X" and "Xaa" mean that any of the twenty naturally occurring amino acids may appear at such a designated position in the polypeptide sequence Polynucleotides
It is an object of the mvention to provide polynucleotides that encode pyrH polypeptides, particularly polynucleotides that encode the polypeptide herein designated pyrH
In a particularly preferred embodiment of the mvention the polynucleotide compnses a region encoding pyrH polypeptides compnsmg a sequence set out in Table 1 [SEQ ID NO 1] which mcludes a full lengd gene, or a variant thereof The Applicants believe that this full length gene is essential to the growth and/or survival of an organism which possesses it. such as Staphylococcus aureus
As a further aspect of the mvention there are provided isolated nucleic acid molecules encoding and/or expressmg pyrH polypeptides and polynucleotides, particularly Staphylococcus aureus pyrH polypeptides and polynucleotides mcludmg. for example unprocessed RNAs
- 7 - nbozyme RNAs, mRNAs. cDNAs. genomic DNAs, B- and Z-DNAs Further embodiments of the mvention mclude biologically, diagnostically. prophylactically, clinically or therapeutically useful polynucleotides and polypeptides. and vanants thereof, and compositions compnsmg the same Another aspect of the mvention relates to isolated polynucleotides. mcludmg at least one full length gene, that encodes a pyrH polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and vanants thereof
In another particularly preferred embodiment of the invention there is a pvrH polypeptide from Staphylococcus aureus comprising or consistmg of an ammo acid sequence of Table 1 [SEQ ID NO 2]. or a variant thereof
Using the urformation provided herein, such as a polynucleotide sequence set out in Table 1 [SEQ ID NO 1], a polynucleotide of the mvention encoding pyrH polypeptide may be obtamed usmg standard cloning and screening methods, such as those for cloning and sequencing chromosomal DNA fragments from bactena usmg Staphylococcus aureus WCUH 29 cells as starting matenal. followed by obtaimng a full lengtii clone For example, to obtain a polynucleotide sequence of the mvention, such as a polynucleotide sequence given in Table 1 [SEQ ID NO 1]. typically a library of clones of chromosomal DNA of Staphylococcus aureus WCUH 29 in E coh or some other suitable host is probed with a radiolabeled ohgonucleotide, preferably a 17-mer or longer, denved from a partial sequence Clones carrying DNA identical to that of the probe can then be distinguished using stringent hybridization conditions By sequencing the individual clones thus identified by hybridization with sequencing primers designed from the original polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence in both directions to determine a full length gene sequence Conveniently, such sequencing is performed, for example, using denatured double stranded DNA prepared from a plasmid clone Suitable techniques are described by Mamatis, T , Fritsch, E F and Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed , Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York (1989) (see m particular Screening By Hybridization 1 90 and Sequencing Denatured Double-Stranded DNA Templates 13 70) Direct genomic DNA sequencmg may also be performed to obtain a full length gene sequence Illustrative of the mvention. each polvnucleotide set out m Table 1 [SEQ ID NO 1] was discovered m a DNA library denved from Staphylococcus aureus WCUH 29
Moreover, each DNA sequence set out m Table 1 [SEQ ID NO 1] contains an open reading frame encoding a protem havmg about the number of ammo acid residues set forth in Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known to those skilled m the art The polynucleotide of SEQ ED NO 1. between nucleotide number 1 and the stop codon which begins at nucleotide number 721 of SEQ ID NO 1. encodes the polypeptide of SEQ ID NO 2
In a further aspect, the present mvention provides for an isolated polynucleotide comprising or consisting of
(a) a polynucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1. (b) a polynucleotide sequence encoding a polypeptide which has at least 70% identity . preferably at least 80% identity , more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or 100% exact, to the ammo acid sequence of SEQ ID NO 2. over the entire length of SEQ ID NO 2
A polynucleotide encoding a polypeptide of the present mvention, mcludmg homologs and orthologs from species other than Staphylococcus aureus, may be obtamed by a process which compnses the steps of screening an appropnate library under stringent hybndization conditions with a labeled or detectable probe consistmg of or compnsmg the sequence of SEQ ID NO 1 or a fragment thereof, and isolating a full-length gene and or genomic clones containing said polynucleotide sequence
The mvention provides a polynucleotide sequence identical over its entire length to a codmg sequence (open readmg frame) m Table 1 [SEQ ID NO 1] Also provided by the mvention is a codmg sequence for a mature polypeptide or a fragment thereof, by itself as well as a codmg sequence for a mature polypeptide or a fragment m readmg frame with another codmg sequence, such as a sequence encoding a leader or secretory sequence, a pre-, or pro- or prepro-protem sequence The polynucleotide of the mvention may also contain at least one non-coding sequence, mcludmg for example, but not limited to at least one non-coding 5" and 3' sequence, such as the transcnbed but non- translated sequences, termination signals (such as rho-dependent and rho-mdependent termination signals), nbosome binding sites. Kozak sequences, sequences that stabilize mRNA mtrons, and polyadenylation signals The polynucleotide sequence may also compnse additional codmg sequence encoding additional ammo acids For example, a marker sequence that facilitates punfication of the fused polypeptide can be encoded In certam embodiments of the mvention. the marker sequence is a hexa-histidine peptide, as provided m the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al . Proc Natl Acad Set , USA 86 821-824 (1989). or an HA peptide tag (Wilson et al . Cell 37 161 ( 1984). both of which may be useful m punfyrng polypeptide sequence fused to them Polynucleotides of the mvention also mclude, but are not limited to, polynucleotides compnsmg a structural gene and its naturally associated sequences that control gene expression
A prefened embodiment of the mvention is a polynucleotide of consistmg of or compnsmg nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 721 set forth in SEQ ID NO 1 of Table 1, both of which encode the pyrH polypeptide
The mvention also mcludes a polynucleotide consistmg of or compnsmg a polynucleotide of the formula
X-(Rι )m-(R2)-(R3)n-Y wherein, at the 5' end of the molecule. X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule. Y is hydrogen, a metal or a modified nucleotide residue, or together with X defines the covalent bond, each occurrence of Rj and R3 is independently any nucleic acid residue or modified nucleic acid residue, m is an integer between 1 and 3000 or zero . n is an mteger between 1 and 3000 or zero, and R2 is a nucleic acid sequence or modified nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof In the polynucleotide formula above, R2 is oriented so that its 5' end nucleic acid residue is at the left. bound to Rj and its 3' end nucleic acid residue is at the right, bound to R3 Any stretch of nucleic acid residues denoted by either R] and/or R , where m and/or n is greater than 1. may be either a heteropolymer or a homopolymer, preferably a heteropolymer Where, in a preferred embodiment, X and Y together define a covalent bond, the polynucleotide of the abo\ e formula is a closed, circular polynucleotide, which can be a double-stranded polynucleotide wherein the formula shows a first strand to which the second strand is complementary In another preferred embodiment m and/or n is an mteger between 1 and 1000. Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500. and n is an mteger between 1 and 50, 100, or 500
It is most prefened that a polynucleotide of the mvention is denved from Staphylococcus aureus. however, it may preferably be obtamed from other orgamsms of the same taxonomic genus A polynucleotide of the mvention may also be obtamed, for example, from orgamsms of the same taxonomic family or order The term "polynucleotide encodmg a polypeptide" as used herem encompasses polynucleotides that mclude a sequence encodmg a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Staphylococcus aureus pyrH havmg an ammo acid sequence set out in Table 1 [SEQ ID NO 2] The term also encompasses polynucleotides that mclude
- 10 - a single contmuous region or discontinuous regions encodmg the polypeptide (for example, polynucleotides interrupted by mtegrated phage, an integrated insertion sequence, an mtegrated vector sequence, an mtegrated transposon sequence, or due to RNA editing or genomic DNA reorganization) together with additional regions, that also may contain codmg and/or non-coding sequences The mvention further relates to vanants of the polynucleotides descnbed herem that encode vanants of a polypeptide havmg a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Fragments of a polynucleotides of the mvention may be used, for example, to synthesize full-length polynucleotides of the mvention
Further particularly prefened embodiments are polynucleotides encodmg pyrH vanants. that have the ammo acid sequence of pvrH polypeptide of Table 1 [SEQ ID NO 2] m which several, a few 5 to 10. 1 to 5. 1 to 3, 2, 1 or no ammo acid residues are substituted, modified deleted and/or added, in am combination Especially prefened among these are silent substitutions, additions and deletions that do not alter the properties and activities of pyrH polypeptide
Further prefened embodiments of the mvention are polynucleotides that are at least 70% identical over their entire length to a polynucleotide encodmg pyrH polypeptide havmg an ammo acid sequence set out in Table 1 [SEQ ID NO 2]. and polynucleotides that are complementary to such polynucleotides Alternatively, most highly prefened are polynucleotides that compnse a region that is at least 80% identical over its entire length to a polynucleotide encoding pyrH polypeptide and polvnucleotides complementary thereto In this regard, polynucleotides at least 90% identical over their entire length to the same are particularly prefened. and among these particularly prefened polynucleotides, those with at least 95% are especially prefened Furthermore, those with at least 97% are highly prefened among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly prefened. with at least 99% bemg the more prefened
Prefened embodiments are polynucleotides encodmg polypeptides that retain substantially the same biological function or activity as the mature polypeptide encoded by a DNA of Table 1 [SEQ ID NO l]
In accordance with certam prefened embodiments of this mvention there are provided polynucleotides that hybndize, particularly under stringent conditions, to pyrH polynucleotide sequences, such as those polynucleotides m Table 1 The mvention further relates to polynucleotides that hybndize to the polynucleotide sequences provided herem In this regard, the mvention especially relates to polynucleotides that hybndize under stringent conditions to the polynucleotides descnbed herem As herem used, the terms "stringent conditions" and "stringent hybndization conditions" mean hybndization occurring only if there is at least 95% and preferably at least 97% identity between the sequences A specific example of
- 1 1 - stringent hybridization conditions is overnight incubation at 42°C in a solution comprising 50% formamide. 5x SSC (150mM NaCl. 15mM trisodmm citrate), 50 mM sodium phosphate (pH7 6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/ml of denatured, sheared salmon sperm DNA, followed by washing the hybridization support m 0 lx SSC at about 65°C Hybridization and wash conditions are well known and exemplified m Sambrook, et al . Molecular Cloning A Laboratory Manual. Second Edition. Cold Spring Harbor. N Y . (1989) particularly Chapter 11 therein Solution hybridization may also be used with the polynucleotide sequences provided by the mvention
The invention also provides a polynucleotide consisting of or comprising a polynucleotide sequence obtamed by screening an appropriate library containing the complete gene for a polynucleotide sequence set forth m SEQ ID NO 1 under stringent h\ bπdization conditions with a probe having the sequence of said polynucleotide sequence set forth m SEQ ID NO 1 or a fragment thereof, and isolating said polynucleotide sequence Fragments useful for obtaining such a polynucleotide include, for example, probes and primers fully described elsewhere herem
As discussed elsewhere herem regarding polynucleotide assays of the mvention. for instance. the polynucleotides of the mvention, may be used as a hybndization probe for RNA. cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encodmg pyrH and to isolate cDNA and genomic clones of other genes that have a high identity, particularly high sequence identity, to the pyrH gene Such probes generally will compnse at least 15 nucleotide residues or base pairs Preferably, such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs Particularly prefened probes will have at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs
A codmg region of a pyrH gene may be isolated by screening usmg a DNA sequence provided m Table 1 [SEQ ID NO 1] to synthesize an oligonucleotide probe A labeled oligonucleotide havmg a sequence complementary to that of a gene of the mvention is then used to screen a library of cDNA. genomic DNA or mRNA to determme which members of the library the probe hybndizes to
There are several methods available and well known to those skilled in the art to obtain full-length DNAs, or extend short DNAs. for example those based on the method of Rapid Amplification of cDNA ends (RACE) (see, for example, Frohman. et al . PNAS USA 85. 8998- 9002. 1988) Recent modifications of the technique, exemplified by the Marathon™ technology (Clontech Laboratories Inc ) for example, have significantly simplified the search for longer cDNAs In the Marathon™ technology. cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence gated onto each end Nucleic acid amplification
- 12 - (PCR) is then carried out to amplify the "missing" 5' end of the DNA using a combination of gene specific and adaptor specific oligonucleotide primers The PCR reaction is then repeated usmg "nested" primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence) The products of this reaction can then be analyzed by DNA sequencing and a full-length DNA constructed either by joining the product directly to the existing DNA to give a complete sequence, or carrying out a separate full-length PCR usmg the new sequence information for the design of the 5' primer
The polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularh human diseases, as further discussed herem relatmg to polynucleotide assays
The polynucleotides of the invention that are ohgonucleotides derived from a sequence of
Table 1 [SEQ ID NOS 1 or 2] may be used m the processes herem as described, but preferabh for PCR. to determine whether or not the polynucleotides identified herein m whole or in part are transcribed in bacteria m infected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of infection and type of infection the pathogen has attained
The mvention also provides polynucleotides that encode a polypeptide that is the mature protem plus additional ammo or carboxyl-terminal ammo acids, or ammo acids rntenor to the mature polypeptide (when the mature form has more than one polypeptide cham, for instance) Such sequences may play a role m processmg of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-life or may facilitate manipulation of a protem for assay or production, among other things As generally is the case m vivo, the additional ammo acids may be processed away from the mature protem by cellular enzymes
For each and every polynucleotide of the mvention there is provided a polynucleotide complementary to it It is prefened that these complementary polynucleotides are fully complementary to each polynucleotide with which they are complementary
A precursor protem, havmg a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such mactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins
In addition to the standard A, G, C, T/U representations for nucleotides. the term "N" may also be used in describing certain polynucleotides of the invention "N" means that any of the four DNA or RNA nucleotides may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a nucleic acid that when taken m combmation with
- 13 - adjacent nucleotide positions, when read in the correct reading frame, would have the effect of generating a premature termination codon in such reading frame
In sum, a polynucleotide of tlie mvention may encode a mature protem. a mature protem plus a leader sequence (which may be refened to as a preprotem). a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotem, or a preproprotem, which is a precursor to a proprotem. havmg a leader sequence and one or more prosequences, which generally are removed during processmg steps that produce active and mature forms of the polypeptide
Vectors, Host Cells, Expression Systems
Tl e mvention also relates to vectors that compnse a polynucleotide or polynucleotides of the mvention. host cells that are genetically engmeered with vectors of tlie mvention and tlie production of polypeptides of the mvention by recombinant techniques Cell-free translation systems can also be employed to produce such protems usmg RNAs denved from the DNA constructs of the mvention
Recombinant polypeptides of the present mvention may be prepared by processes well known m those skilled m the art from genetically engmeered host cells compnsmg expression systems Accordingly m a further aspect, the present mvention relates to expression systems which compnse a polynucleotide or polynucleotides of the present mvention, to host cells winch are genetically engmeered with such expression systems, and to the production of polypeptides of the mvention by recombinant techniques
For recombinant production of the polypeptides of the mvention, host cells can be genetically engmeered to incorporate expression systems or portions thereof or polynucleotides of the mvention Introduction of a polynucleotide mto the host cell can be effected by methods descnbed m many standard laboratory manuals, such as Davis, et al . BASIC METHODS IN MOLECULAR BIOLOGY. (1986) and Sambrook. et al , MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N Y (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, micromjection. catiomc hpid-mediated transfection, electroporation, transduction. scrape loading, ballistic mtroduction and infection
Representative examples of appropnate hosts mclude bactenal cells, such as cells of streptococci, staphylococci, enterococci E coh, streptomyces. cyanobactena, Bacillus subtihs, and Staphylococcus aureus, fungal cells, such as cells of a yeast. Kluveromyces, Saccharomyces. a basidiomycete, Candida albicans and Aspergillus, insect cells such as cells of Drosophi la S2 and Spodoptera Sf9. animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293, CV-1 and Bowes melanoma cells, and plant cells, such as cells of a gymnospenn or angiosperm
A great vanety of expression systems can be used to produce the polypeptides of the mvention Such vectors mclude, among others, chromosomal-, episomal- and virus-denved vectors.
- 14 - for example, vectors derived from bactenal plasrmds, from bactenophage, from transposons. from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40. vaccinia viruses, adenoviruses, fowl pox viruses. pseudorabies viruses, picornaviruses and retroviruses, and vectors denved from combmations thereof. such as those denved from plasmid and bactenophage genetic elements, such as cosmids and phagenuds The expression system constructs may contain control regions that regulate as well as engender expression Generally, any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide m a host may be used for expression m this regard The appropnate DNA sequence may be inserted mto the expression system by any of a vanety of well- known and routme techmques. such as. for example, those set forth in Sambrook et al . MOLECULAR CLONING, A LABORATORY MANUAL, {supra)
In recombinant expression systems m eukaryotes, for secretion of a translated protem mto the lumen of the endoplasmic reticulum. mto the penplasmic space or mto the extracellular environment, appropnate secretion signals may be incorporated mto the expressed polypeptide These signals may be endogenous to tlie polypeptide or they may be heterologous signals
Polypeptides of the mvention can be recovered and punfied from recombinant cell cultures by well-known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic mteraction chromatography, affinity chromatography. hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography is employed for purification Well known techmques for refolding protem may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or punfication Diagnostic, Prognostic, Serotyping and Mutation Assays This mvention is also related to the use of pyrH polynucleotides and polypeptides of the mvention for use as diagnostic reagents Detection of pyrH polynucleotides and/or polypeptides m a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of disease, staging of disease or response of an infectious organism to drugs Eukaryotes. particularly mammals, and especially humans, particularly those infected or suspected to be infected with an organism compnsmg the pyrH gene or protem, may be detected at the nucleic acid or ammo acid level by a vanety of well known techniques as well as by methods provided herem
Polypeptides and polynucleotides for prognosis, diagnosis or other analysis may be obtamed from a putatively infected and/or infected individual's bodily matenals Polynucleotides from any of these sources, particularly DNA or RNA, may be used directly for detection or may be amplified enzymatically by usmg PCR or any other amplification technique pnor to analysis RNA particularly
- 15 - mRNA, cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and stram of infectious or resident orgamsm present m an individual, may be made by an analysis of the genotype of a selected polynucleotide of the orgamsm Deletions and insertions can be detected by a change m size of the amplified product m companson to a genotype of a reference sequence selected from a related orgamsm, preferably a different species of the same genus or a different stram of the same species Point mutations can be identified by hybndizing amplified DNA to labeled pyrH polynucleotide sequences Perfectly or significantly matched sequences can be distinguished from imperfectly or more sigmficantly mismatched duplexes by DNase or RNase digestion, for DNA or RNA respectively, or by detectmg differences m meltmg temperatures or renaturation kmetics Polynucleotide sequence differences may also be detected by alterations m the electrophoretic mobility of polynucleotide fragments m gels as compared to a reference sequence This may be earned out with or without denaturing agents Polynucleotide differences may also be detected by direct DNA or RNA sequencmg See. for example. Myers et al . Science, 230 1242 (1985) Sequence changes at specific locations also may be revealed by nuclease protection assays, such as Rnase. VI and SI protection assay or a chemical cleavage method See. for example. Cotton et al . Proc Natl Acad Sci USA, 85 4397-4401 (1985)
In another embodiment, an anay of oligonucleotides probes compnsmg pyrH nucleotide sequence or fragments thereof can be constiucted to conduct efficient screening of, for example, genetic mutations, serotype, taxonomic classification or identification Anay technology methods are well known and have general applicability and can be used to address a vanety of questions m molecular genetics mcludmg gene expression, genetic linkage, and genetic vanabi ty (see, for example. Chee et al . Science, 274 610 (1996))
Thus in another aspect, the present mvention relates to a diagnostic kit which comprises
(a) a polynucleotide of the present invention, preferably the nucleotide sequence of SEQ ID NO 1. or a fragment thereof ,
(b) a nucleotide sequence complementary to that of (a),
(c) a polypeptide of the present mvention, preferably the polypeptide of SEQ ID NO 2 or a fragment thereof, or
(d) an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO 2
It will be appreciated that in any such kit, (a), (b). (c) or (d) may comprise a substantial component Such a kit will be of use in diagnosing a disease or susceptibility to a Disease, among others
- 16 This mvention also relates to the use of polynucleotides of the present mvention as diagnostic reagents Detection of a mutated fonn of a polynucleotide of the mvention. preferable. SEQ ID NO 1. which is associated with a disease or pathogenicity will provide a diagnostic tool that can add to. or define, a diagnosis of a disease, a prognosis of a course of disease, a determination of a stage of disease, or a susceptibility to a disease, which results from under-expression. over-expression or altered expression of the polynucleotide Orgamsms, particularly infectious orgamsms, carrying mutations m such polynucleotide may be detected at tl e polynucleotide level by a vanety of techmques. such as those descnbed elsewhere herem
Tlie nucleotide sequences of the present mvention are also valuable for orgamsm chromosome identification The sequence is specifically targeted to. and can hybndize with, a particular location on an organism's chromosome, particularly to a Staphylococcus aureus chromosome The mappmg of relevant sequences to chromosomes according to the present mvention may be an important step m conelatmg those sequences with pathogenic potential and/or an ecological niche of an orgamsm and/or drug resistance of an orgamsm, as well as the essentiality of the gene to the orgamsm Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be conelated with genetic map data Such data may be found on-lme m a sequence database The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through known genetic methods, for example, through linkage analysis (coinhentance of physically adjacent genes) or matmg studies, such as by conjugation The differences in a polynucleotide and/or polypeptide sequence between organisms possessing a first phenotype and organisms possessing a different, second different phenotype can also be determined If a mutation is observed in some or all organisms possessing the first phenotype but not in any organisms possessing the second phenotype. then the mutation is likely to be the causative agent of the first phenotype Cells from an orgamsm carrying mutations or polymorphisms (allehc vanations) m a polynucleotide and/or polypeptide of the mvention may also be detected at the polynucleotide or polypeptide level by a vanety of techmques. to allow for serotyprng, for example For example, RT- PCR can be used to detect mutations m the RNA It is particularly prefened to use RT-PCR m conjunction with automated detection systems, such as, for example. GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose, PCR As an example. PCR primers complementary to a polynucleotide encodmg pyrH polypeptide can be used to identify and analyze mutations Examples of representative primers are shown below m Table 2
Table 2
- 17 - Primers for amplification of pyrH polynucleotides SEQ ID NO PRIMER SEQUENCE
3 5 ' -GAGGATAAGAAAATGGCTC-3 ' 4 5'-CACCTCTAAATTTATTTTG-3'
Tlie mvention also mcludes primers of tlie formula
X-(R1)m-(R2)-(R3)n-Y wherem, at the 5' end of the molecule. X is hydrogen, a metal or a modified nucleotide residue, and at the 3' end of the molecule. Y is hydrogen, a metal or a modified nucleotide residue. Rj and R3 are am nucleic acid residue or modified nucleotide residue, m is an mteger between 1 and 20 or zero , n is an mteger between 1 and 20 or zero, and R is a primer sequence of the mvention. particularly a primer sequence selected from Table 2 hi tlie polynucleotide formula above R2 is onented so that its 5' end nucleotide residue is at the left, bound to Rj and its 3' end nucleotide residue is at tlie nght. bound to R3 Any stietch of nucleic acid residues denoted by either R group, where m and/or n is greater than 1 may be either a heteropolymer or a homopolymer, preferably a heteropolyτner bemg complementary to a region of a polynucleotide of Table 1 In a prefened embodiment m and/or n is an mteger between 1 and 10.
The mvention further provides these primers with 1, 2, 3 or 4 nucleotides removed from the 5' and or the 3' end These primers may be used for, among other things, amplifymg pyrH DNA and/or RNA isolated from a sample denved from an individual, such as a bodily matenal The primers may be used to amplify a polynucleotide isolated from an mfected individual, such that tlie polynucleotide may then be subject to vanous techmques for elucidation of the polynucleotide sequence In this way. mutations m the polynucleotide sequence may be detected and used to diagnose and/or prognose the infection or its stage or course, or to serotype and/or classify the infectious agent
The mvention further provides a process for diagnosing, disease, preferably bacterial infections, more preferably infections caused by Staphylococcus aureus. comprising determining from a sample derived from an individual, such as a bodily material, an mcreased level of expression of polynucleotide having a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of a pyrH polynucleotide can be measured using any on of the methods well known in the art for the quantitation of polynucleotides, such as. for example, amplification. PCR. RT-PCR, RNase protection, Northern blotting, spectrometry and other hybridization methods
- 18 - In addition, a diagnostic assay m accordance with the mvention for detecting over- expression of pyrH polypeptide compared to normal control tissue samples may be used to detect the presence of an infection, for example Assay techmques that can be used to determine levels of a pyrH polypeptide. m a sample denved from a host, such as a bodily matenal, are well-known to those of skill m the art Such assay methods mclude radioimmunoassays, competitive-binding assays. Western Blot analysis, antibody sandwich assays, antibody detection and ELISA assays Differential Expression
The polynucleotides and polynucleotides of the mvention may be used as reagents for differential screening methods There are many differential screening and differential display methods known m tlie art m which the polynucleotides and polypeptides of the mvention may be used For example, the differential display technique is described by Chuang et al . J Bactenol 175 2026-2036 (1993) This method identifies those genes which are expressed in an organism by identifying mRNA present using randomly-primed RT-PCR By comparing pre-mfection and post infection profiles, genes up and down regulated during infection can be identified and the RT-PCR product sequenced and matched to ORF "unknowns "
In Vivo Expression Technology (IVET) is described by Camilli et al , Proc Nat'l Acad Sci USA 91 2634-2638 (1994) IVET identifies genes up-regulated dunng infection when compared to laboratory cultivation, implying an important role m infection ORFs identified by this technique are implied to have a significant role m infection establishment and/or mamtenance In this technique random chromosomal fragments of target organism are cloned upstream of a promoter-less recombmase gene m a plasmid vector This construct is introduced mto the target organism which carries an antibiotic resistance gene flanked by resolvase sites Growth in the presence of the antibiotic removes from the population those fragments cloned into the plasmid vector capable of supporting transcription of the recombmase gene and therefore have caused loss of antibiotic resistance The resistant pool is introduced into a host and at various times after infection bacteria may be recovered and assessed for the presence of antibiotic resistance The chromosomal fragment carried by each antibiotic sensitive bactenum should carry a promoter or portion of a gene normally upregulated during infection Sequencmg upstream of the recombmase gene allows identification of the up regulated gene RT-PCR may also be used to analyze gene expression patterns For RT PCR using the polynucleotides of the invention, messenger RNA is isolated from bacterial infected tissue, e g . 48 hour murme lung infections, and the amount of each mRNA species assessed by reverse transcription of the RNA sample primed with random hexanucleotides followed by PCR with gene specific primer pairs The determination of the presence and amount of a particular mRNA
- 19 - species by quantification of the resultant PCR product provides information on the bacterial genes which are transcribed in the infected tissue Analysis of gene transcription can be carried out at different times of infection to gain a detailed knowledge of gene regulation m bacterial pathogenesis allowing for a clearer understanding of which gene products represent targets for screens for antibactenals Because of the gene specific nature of the PCR primers employed it should be understood that the bacterial mRNA preparation need not be free of mammalian RNA This allows the investigator to carry out a simple and quick RNA preparation from infected tissue to obtain bacterial mRNA species which are very short lived in the bacterium (in the order of 2 minute halflives) Optimally the bacterial mRNA is prepared from infected muπne lung tissue by mechanical disruption in the presence of TRIzole (GIBCO-BRL) for very short periods of time, subsequent processmg according to the manufacturers of TRIzole reagent and DNAase treatment to remove contaminating DNA Preferably the process is optimized by finding those conditions which give a maximum amount of Staphylococcus aureus 16S πbosomal RNA as detected by probing Northerns with a suitably labeled sequence specific oligonucleotide probe Typically a 5' dye labeled primer is used in each PCR primer pair m a PCR reaction which is terminated optimally between 8 and 25 cycles The PCR products are separated on 6% polyacrylamide gels with detection and quantification using GeneScanner (manufactured by ABI)
Gridding and Polynucleotide Subtraction Methods have been described for obtaining information about gene expression and identity using so called "high density DNA arrays" or grids See, e g , M Chee et al . Science. 274 610-614 (1996) and other references cited therein Such griddmg assays have been employed to identify certain novel gene sequences, refened to as Expressed Sequence Tags (EST) (Adams et a , Science. 252 1651-1656 (1991)) A variety of techmques have also been described for identifying particular gene sequences on the basis of their gene products For example, see International Patent Application No W091/07087, published May 30. 1991 In addition, methods have been described for the amplification of desired sequences For example, see International Patent Application No W091/17271, published November 14. 1991 The polynucleotides of the invention may be used as components of polynucleotide array s, preferably high density arrays or grids These high density anays are particularly useful for diagnostic and prognostic purposes For example, a set of spots each comprising a different gene, and further comprising a polynucleotide or polynucleotides of the mvention. may be used for probing, such as using hybridization or nucleic acid amplification, usmg a probes
- 20 - obtamed or derived from a bodily sample, to determine the presence of a particular polynucleotide sequence or related sequence in an individual Such a presence may mdicate the presence of a pathogen, particularly Staphylococcus aureus, and may be useful in diagnosing and or prognosing disease or a course of disease A grid comprising a number of variants of the polynucleotide sequence of SEQ ID NO 1 are preferred Also preferred is a comprising a number of variants of a polynucleotide sequence encoding the polypeptide sequence of SEQ ID NO 2
Antibodies
The polypeptides and polynucleotides of the mvention or vanants thereof, or cells expressmg the same can be used as immunogens to produce antibodies immunospecific for such polypeptides or polynucleotides respectively
In certam prefened embodiments of the mvention there are provided antibodies agamst pyrH polypeptides or polynucleotides
Antibodies generated against the polypeptides or polynucleotides of the mvention can be obtamed by administering the polypeptides and/or polynucleotides of the mvention, or epitope-bearmg fragments of either or both, analogues of either or both, or cells expressmg either or both, to an animal, preferably a nonhuman. usmg routme protocols For preparation of monoclonal antibodies, am technique known m the art that provides antibodies produced by contmuous cell lme cultures can be used Examples mclude vanous techmques. such as those m Kohler. G and Milstein. C . Nature 256 495-497 (1975). Kozbor et al , Immunology Today 4 72 (1983). Cole et al . pg 77-96 m MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R Liss. Inc (1985)
Techmques for the production of smgle cham antibodies (U S Patent No 4.946.778) can be adapted to produce smgle cham antibodies to polypeptides or polynucleotides of this mvention Also transgenic mice, or other orgamsms such as other mammals, may be used to express humanized antibodies immunospecific to the polypeptides or polynucleotides of the mvention
Alternatively, phage display technology may be utilized to select antibody genes with binding activities towards a polypeptide of the invention either from repertoires of PCR amplified v-genes of lymphocytes from humans screened for possessing anti-pyrH or from naive libraries (McCafferty, et al , (1990), Nature 348, 552-554, Marks, et al , (1992) Biotechnology 10, 779- 783) The affinity of these antibodies can also be improved by, for example, cham shuffling (Clackson et al , (1991) Nature 352 628)
The above-descnbed antibodies may be employed to isolate or to identify clones expressmg the polypeptides or polynucleotides of the mvention to punfy the polypeptides or polynucleotides by for example, affinity chromatography
- 21 - Thus, among others, antibodies against pyrH-polypeptide or pyrH-polynucleotide may be employed to treat infections, particularly bactenal infections
Polypeptide variants include antigemcally, epitopically or lmmunologically equivalent variants form a particular aspect of this invention A polypeptide or polynucleotide of the invention, such as an antigemcally or lmmunologically equivalent derivative or a fusion protein of the polypeptide is used as an antigen to immunize a mouse or other animal such as a rat or chicken The fusion protein may provide stability to the polypeptide The antigen may be associated, for example by conjugation, with an immunogenic carrier protem for example bovme serum albumin, keyhole limpet haemocyanm or tetanus toxoid Alternatively, a multiple antigenic polypeptide comprising multiple copies of the polypeptide. or an antigemcally or lmmunologically equivalent polypeptide thereof may be sufficiently antigenic to improve lmmunogenicity so as to obviate the use of a carrier
Preferably, the antibody or variant thereof is modified to make it less immunogenic in the individual For example, if the individual is human the antibody may most preferably be "humanized." where the comphmentarity determining region or regions of the hybπdoma-deπved antibody has been transplanted into a human monoclonal antibody, for example as described in
Jones et al (1986). Nature 321. 522-525 or Tempest et al , (1991) Biotechnology 9, 266-273
In accordance with an aspect of the mvention, there is provided the use of a polynucleotide of the mvention for therapeutic or prophylactic purposes, m particular genetic immunization Among tlie particularly prefened embodiments of the mvention are naturally occurring allehc vanants of pyrH polynucleotides and polypeptides encoded thereby
The use of a polynucleotide of the invention in genetic immunization will preferably employ a suitable delivery method such as direct injection of plasmid DNA mto muscles (Wolff et al , Hum Mol Genet (1992) 1 363, Manthorpe et al , Hum Gene Ther (1983) 4 419). delivery of DNA complexed with specific protein carriers (Wu et al , J Biol Chem (1989) 264 16985). coprecipitation of DNA with calcium phosphate (Benvemsty & Reshef, PNAS USA. (1986) 83 9551), encapsulation of DNA in various forms of hposomes (Kaneda et al , Science (1989) 243 375), particle bombardment (Tang et al , Nature (1992) 356 152, Eisenbraun et al , DNA Cell Biol (1993) 12 791) and in vivo infection using cloned retroviral vectors (Seeger et al , PNAS USA (\9U) U 5849)
Antagonists and Agonists - Assays and Molecules
Polypeptides and polynucleotides of the mvention may also be used to assess the binding of small molecule substrates and gands m. for example, cells, cell-free preparations, chemical hbranes. and natural product mixtures These substrates and hgands may be natural substrates and hgands or
- 22 - may be structural or functional mimetics See. e g , Cohgan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991)
Polypeptides and polynucleotides of the present mvention are responsible for many biological functions, mcludmg many disease states, m particular the Diseases hereinbefore mentioned It is therefore desirable to devise screemng methods to identify compounds which stimulate or which inhibit the function of the polypeptide or polynucleotide Accordingly, m a further aspect, the present mvention provides for a method of screening compounds to identify those which stimulate or which inhibit tlie function of a polypeptide or polynucleotide of the mvention, as well as related polypeptides and polynucleotides In general, agomsts or antagonists may be employ ed for therapeutic and prophylactic purposes for such Diseases as hereinbefore mentioned Compounds may be identified from a vanety of sources, for example, cells, cell-free preparations, chemical branes. and natural product mixtures Such agomsts, antagonists or lnlnbitors so-identified may be natural or modified substrates, hgands. receptors, enzymes, etc . as the case may be. of pyrH polypeptides and polynucleotides. or may be structural or functional mimetics thereof (see Co gan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991))
The screening methods may simply measure the binding of a candidate compound to the polypeptide or polynucleotide, or to cells or membranes bearing the polypeptide or polynucleotide, or a fusion protem of the polypeptide by means of a label directly or indirectly associated with the candidate compound Alternatively, the screening method may involve competition with a labeled competitor Further, these screemng methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide or polynucleotide. usmg detection systems appropriate to the cells comprising the polypeptide or polynucleotide Inhibitors of activation are generally assayed m the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed Constitutively active polypeptide and/or constitutively expressed polypeptides and polynucleotides may be employed m screemng methods for inverse agonists or inhibitors, in the absence of an agonist or inhibitor, by testing whether the candidate compound results m inhibition of activation of the polypeptide or polynucleotide. as the case may be Further, the screemng methods may simply comprise the steps of mixing a candidate compound with a solution containing a polypeptide or polynucleotide of the present invention, to form a mixture, measuring pyrH polypeptide and/or polynucleotide activity in the mixture, and companng the pyrH polypeptide and or polynucleotide activity of the mixture to a standard Fusion proteins, such as those made from Fc portion and pyrH polypeptide. as herembefore described, can also be used for high-throughput screening assays to identify antagonists of the polypeptide of the present
- 23 - invention, as well as of phylogenetically and and/or functionally related polypeptides (see D Bennett et al . J Mol Recognition, 8 52-58 (1995), and K Johanson et al , J Biol Chem. 270(16) 9459-9471 (1995))
The polynucleotides, polypeptides and antibodies that bmd to and/or interact with a polypeptide of the present invention may also be used to configure screening methods for detecting the effect of added compounds on the production of mRNA and/or polypeptide m cells For example, an ELISA assay may be constructed for measuring secreted or cell associated levels of polypeptide using monoclonal and polyclonal antibodies by standard methods known in the art This can be used to discover agents which may inhibit or enhance the production of polypeptide (also called antagonist or agonist, respectively) from suitably manipulated cells or tissues
The mvention also provides a method of screemng compounds to identify those which enhance (agomst) or block (antagonist) tlie action of pyrH polypeptides or polynucleotides, particularly those compounds that are bactenostatic and/or bactencidal The method of screemng may mvolve high- throughput techmques For example, to screen for agomsts or antagonists, a synthetic reaction mix. a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compnsmg pyrH polypeptide and a labeled substrate or hgand of such polypeptide is mcubated m tlie absence or the presence of a candidate molecule that may be a pyrH agomst or antagonist The ability of the candidate molecule to agonize or antagonize the pyrH polypeptide is reflected m decreased binding of the labeled hgand or decreased production of product from such substrate Molecules that bmd gratuitously, i e witliout mducmg tlie effects of pyrH polypeptide are most likely to be good antagonists Molecules that bmd well and, as tl e case may be, mcrease the rate of product production from substrate, mcrease signal transduction, or mcrease chemical channel activity are agomsts Detection of the rate or level of, as the case may be, production of product from substrate, signal transduction, or chemical channel activity may be enhanced by usmg a reporter system Reporter systems that may be useful m this regard mclude but are not limited to colonmetnc. labeled substrate converted mto product, a reporter gene that is responsive to changes m pyrH polynucleotide or polypeptide activity, and binding assays known m the art
Polypeptides of the invention may be used to identify membrane bound or soluble receptors, if any. for such polypeptide, through standard receptor binding techniques known m the art These techmques mclude, but are not limited to, hgand binding and crosshnkmg assays in which the polypeptide is labeled with a radioactive isotope (for instance. 12-1). chemically modified (for instance, biotmylated), or fused to a peptide sequence suitable for detection or purification, and incubated with a source of the putative receptor (e g . cells, cell membranes, cell supernatants. tissue extracts, bodily materials) Other methods include biophysical techniques
- 24 - such as surface plasmon resonance and spectroscopy These screemng methods may also be used to identify agonists and antagonists of the polypeptide which compete with the binding of the polypeptide to its receptor(s), if any Standard methods for conducting such assays are well understood in the art In other embodiments of the mvention there are provided methods for identifying compounds which bmd to or otherwise mteract with and inhibit or activate an activity or expression of a polypeptide and/or polynucleotide of the mvention compnsmg contacting a polypeptide and/or polynucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polypeptide and/or polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction preferably bemg associated with a second component capable of providing a detectable signal m response to the bmdmg or mteraction of the polypeptide and or polynucleotide with the compound, and determining whether the compound bmds to or otherwise mteracts with and activates or inhibits an activity or expression of the polypeptide and/or polynucleotide by detectmg tlie presence or absence of a signal generated from the bmdmg or mteraction of the compound with the polypeptide and/or polynucleotide
Another example of an assay for pyrH agomsts is a competitive assay that combmes pyrH and a potential agomst with pyrH-bmdmg molecules, recombinant pyrH binding molecules, natural substrates or hgands. or substrate or hgand mimetics, under appropnate conditions for a competitive inhibition assay The pyrH molecule can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of pyrH molecules bound to a bmdmg molecule or converted to product can be determined accurately to assess the effectiveness of the potential antagonist
Potential antagonists mclude, among others, small organic molecules, peptides. polypeptides and antibodies that bmd to a polynucleotide and/or polypeptide of the mvention and thereby inhibit or extinguish its activity or expression Potential antagonists also may be small organic molecules, a peptide. a polypeptide such as a closely related protem or antibody that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule, without mducmg pyrH-mduced activities. thereb\ preventmg the action or expression of pyrH polypeptides and/or polynucleotides by excluding pyrH polypeptides and/or polynucleotides from bmdmg
Potential antagonists mclude a small molecule that bmds to and occupies the bmdmg site of the polypeptide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented Examples of small molecules mclude but are not limited to small organic molecules, peptides or peptide-like molecules Other potential antagonists mclude antisense molecules (see Okano, J Neurochem 56 560 (1991). OLIGODEOXYNUCLEOTIDES AS ANTISENSE
- 25 - INHIBITORS OF GENE EXPRESSION, CRC Press. Boca Raton. FL (1988). for a descnption of these molecules) Prefened potential antagonists mclude compounds related to and vanants of pyrH Other examples of potential polypeptide antagonists mclude antibodies or, m some cases, oligonucleotides or proteins which are closely related to the hgands. substrates, receptors, enzymes. etc . as the case may be. of the polypeptide, e g . a fragment of the hgands. substrates, receptors, enzymes, etc . or small molecules which bmd to the polypeptide of the present mvention but do not elicit a response, so that the activity of the polypeptide is prevented
Certam of the polypeptides of the mvention are biomimetics, functional mimetics of the natural pyrH polypeptide These functional mimetics may be used for. among other things, antagomzmg tl e activity of pyrH polypeptide or as a antigen or immunogen m a manner descnbed elsewhere herem Functional mimetics of tlie polypeptides of the mvention include but are not limited to truncated polypeptides For example, prefened functional mimetics mclude. a polypeptide compnsmg the polypeptide sequence set forth m SEQ ID NO 2 lacking 20. 30. 40. 50. 60. 70 or 80 ammo- or carboxy -terminal ammo acid residues, mcludmg fusion proteins compnsmg one or more of these truncated sequences Polynucleotides encodmg each of these functional mimetics may be used as expression cassettes to express each mimetic polypeptide It is prefened that these cassettes compnse 5' and 3' restnction sites to allow for a convenient means to hgate tlie cassettes together when desired It is further prefened that these cassettes compnse gene expression signals known m the art or descnbed elsewhere herem Thus, m another aspect, the present invention relates to a screenmg kit for identifying agomsts. antagonists, hgands, receptors, substrates, enzymes, etc for a polypeptide and/or polynucleotide of the present mvention, or compounds which decrease or enhance the production of such polypeptides and/or polynucleotides , which comprises (a) a polypeptide and/or a polynucleotide of the present invention. (b) a recombinant cell expressmg a polypeptide and/or polynucleotide of the present invention.
(c) a cell membrane expressmg a polypeptide and/or polynucleotide of the present invention, or
(d) antibody to a polypeptide and/or polynucleotide of the present invention, which polypeptide is preferably that of SEQ ID NO 2, and which polynucleotide is preferably that of SEQ ID NO 1 It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise a substantial component
It will be readily appreciated by the skilled artisan that a polypeptide and/or polynucleotide of the present invention may also be used m a method for the structure-based design of an agonist, antagonist or inhibitor of the polypeptide and/or polynucleotide, by
- 26 - (a) determining in the first instance the three-dimensional structure of the polypeptide and/or polynucleotide, or complexes thereof.
(b) deducing the three-dimensional structure for the likely reactive sιte(s). binding sιte(s) or motifis) of an agomst. antagonist or inhibitor. (c) synthesizing candidate compounds that are predicted to bind to or react with the deduced bmding sιte(s). reactive sιte(s). and/or motifis), and
(d) testing whether the candidate compounds are indeed agomsts. antagonists or inhibitors It will be further appreciated that this will normally be an iterative process, and this iterative process may be performed usmg automated and computer-controlled steps In a further aspect, the present mvention provides methods of treatmg abnormal conditions such as. for instance, a Disease, related to either an excess of. an under-expression of. an elevated activity of. or a decreased activity of pyrH polypeptide and/or polynucleotide
If the expression and/or activity of the polypeptide and/or polynucleotide is m excess, several approaches are available One approach compnses adrnmistenng to an individual m need thereof an inhibitor compound (antagonist) as herem descnbed, optionally m combmation with a pharmaceutically acceptable earner, m an amount effective to inhibit the function and/or expression of the polypeptide and/or polynucleotide, such as, for example, by blocking the bmdmg of hgands. substrates, receptors, enzymes, etc , or by lnhibitmg a second signal, and thereby alleviating the abnormal condition In another approach, soluble forms of the polypeptides still capable of bmdmg the hgand. substrate. enzymes, receptors, etc m competition with endogenous polypeptide and/or polynucleotide may be administered Typical examples of such competitors include fragments of the pyrH polypeptide and/or polypeptide
In a further aspect, the present invention relates to genetically engmeered soluble fusion proteins comprising a polypeptide of the present invention, or a fragment thereof, and various portions of the constant regions of heavy or light chains of lmmunoglobuhns of various subclasses (IgG, IgM, IgA, IgE) Preferred as an immunoglobuhn is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region In a particular embodiment, the Fc part can be removed simply by incorporation of a cleavage sequence which can be cleaved with blood clotting factor Xa Furthermore, this invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for drug screening, diagnosis and therapy A further aspect of the invention also relates to polynucleotides encoding such fusion proteins Examples of fusion protem technology can be found in International Patent Application Nos W094/29458 and W094/22914
27 - In still another approach, expression of the gene encodmg endogenous pyrH polypeptide can be inhibited using expression blocking techniques This blocking may be targeted against any step m gene expression, but is preferably targeted against transcnption and/or translation An examples of a known technique of this sort involve the use of antisense sequences, either internally generated or separately administered (see, for example. O'Connor. J Neurochem
(1991) 56 560 m Ohgodeoxynucleotides as Antisense Inhibitors of Gene Expression. CRC Press. Boca Raton. FL (1988)) Alternatively, ohgonucleotides which form triple helices with the gene can be supplied (see, for example. Lee et al , Nucleic Acids Res (1979) 6 3073, Cooney et al Science (1988) 241 456. Dervan et al , Science (1991) 251 1360) These ohgomers can be administered per se or the relevant ohgomers can be expressed in vivo
Each of the polynucleotide sequences provided herem may be used in the discovery and development of antibacterial compounds The encoded protem. upon expression, can be used as a target for the screemng of antibacterial drugs Additionally, the polynucleotide sequences encoding the amino terminal regions of the encoded protein or Shme-Delgarno or other translation facilitating sequences of the respective mRNA can be used to construct antisense sequences to control the expression of the coding sequence of interest
The invention also provides the use of the polypeptide. polynucleotide. agonist or antagonist of the invention to interfere with the initial physical interaction between a pathogen or pathogens and a eukaryotic, preferably mammalian, host responsible for sequelae of infection In particular, the molecules of the invention may be used m the prevention of adhesion of bacteria, in particular gram positive and/or gram negative bacteria, to eukaryotic, preferably mammalian, extracellular matrix proteins on in-dwelling devices or to extracellular matrix proteins m wounds, to block pyrH protein-mediated mammalian cell invasion by . for example, initiating phosphorylation of mammalian tyrosine kmases (Rosenshtne et al , Infect Immun 60 221 1 (1992), to block bacterial adhesion between eukaryotic. preferably mammalian, extracellular matrix proteins and bacterial pyrH protems that mediate tissue damage and/or. to block the normal progression of pathogenesis in infections initiated other than by the implantation of ln- dwellmg devices or by other surgical techmques
This invention provides a method of screemng drugs to identify those which are antibacterial by measuring the ability of the drug to interfere with the biosynthesis UDP
It has been shown that E coh PyrH enzyme catalyzes the transfert of a phosphoryl group from ATP to UMP which forms UDP with the concommitant release of ADP
In a prefened embodiment, UMP is incubated with ATP m the presence of PyrH protein to generate ADP and UDP which can be measured coloπmetπcally usmg a suitably
- 28 - sensitive procedure (Blondin, C . Senna, L . Wiesmuller, L . Gilles. A M . and Barzu. 0 1994 Anal Biochem 220, 219-221) The decrease of enzymatic activity m this reaction would indicate the presence of an inhibitor
In accordance with yet another aspect of the mvention, there are provided pyrH agomsts and antagonists, preferably bactenostatic or bactenocidal agomsts and antagonists
The antagonists and agomsts of the mvention may be employed, for instance, to prevent, inhibit and/or treat diseases
Hehcobacter pylori (herein "H pylon") bacteria infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastritis (International Agency for Research on Cancer (1994) Schistosomes Liver Flukes and Hehcobacter Pylon (International Agency, for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm) Moreover, the International Agency for Research on Cancer recentlv recognized a cause-and- effect relationship between H pylon and gastric adenocarcinoma, classifying the bacterium as a Group I (definite) carcinogen Preferred antimicrobial compounds of the invention (agonists and antagonists of pvrΗ polypeptides and/or polynucleotides) found usmg screens provided by the invention, or known in the art, particularly narrow-spectrum antibiotics, should be useful in the treatment of H pylori infection Such treatment should decrease the advent of H pylon -induced cancers, such as gastrointestinal carcinoma Such treatment should also prevent, inhibit and/or cure gastric ulcers and gastritis Vaccines
There are provided by the mvention, products, compositions and methods for assessmg pyrΗ expression, treatmg disease, assaymg genetic vanation. and administering a pyrΗ polypeptide and or polynucleotide to an orgamsm to raise an immunological response against a bacteπa. especially a Staphylococcus aureus bactena Another aspect of the mvention relates to a method for inducing an immunological response in an individual, particularly a mammal which comprises inoculating the individual with pyrΗ polynucleotide and/or polypeptide, or a fragment or variant thereof, adequate to produce antibody and/ or T cell immune response to protect said individual from infection, particularly bacterial infection and most particularly Staphylococcus aureus infection Also provided are methods whereby such immunological response slows bacterial replication Yet another aspect of the invention relates to a method of inducing immunological response in an individual which comprises delivering to such individual a nucleic acid vector, sequence or nbozyme to direct expression of pyiΗ polynucleotide and/or polypeptide, or a fragment or a variant thereof, for expressing pyrΗ polynucleotide and/or polypeptide, or a fragment or a variant thereof in vivo m
- 29 - order to induce an immunological response, such as. to produce antibody and/ or T cell immune response, including, for example, cytokme-producing T cells or cytotoxic T cells, to protect said individual, preferably a human, from disease, whether that disease is already established within the individual or not One example of administering the gene is by accelerating it into the desired cells as a coating on particles or otherwise Such nucleic acid vector may comprise DNA. RNA. a πbozyme. a modified nucleic acid, a DNA/RNA hybrid, a DNA-protem complex or an RNA- protem complex
A further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of havmg induced within it an immunological response, induces an immunological response in such individual to a pyrH polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant pyrH polynucleotide and/or polypeptide encoded therefrom and/or comprises DNA and/or RNA which encodes and expresses an antigen of said pyrH polynucleotide. polypeptide encoded therefrom, or other polypeptide of the invention The immunological response may be used therapeutically or prophylactically and may take the fonn of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells
A pyrH polypeptide or a fragment thereof may be fused with co-protein or chemical moiety which may or may not by itself produce antibodies, but which is capable of stabilizing the first protein and producing a fused or modified protein which will have antigenic and/or immunogenic properties, and preferably protective properties Thus fused recombinant protein, preferably further comprises an antigenic co-protem, such as hpoprotem D from Hemophilus influenzae, Glutathione-S-transferase (GST) or beta-galactosidase. or any other relatively large co-protem which solubihzes the protein and facilitates production and purification thereof Moreover, the co-protein may act as an adjuvant m the sense of providing a generalized stimulation of the immune system of the organism receiving the protem The co-protem may be attached to either the amino- or carboxy-terminus of the first protem
Provided by this invention are compositions, particularly vaccine compositions, and methods comprising the polypeptides and or polynucleotides of the mvention and lmmunostimulatory DNA sequences, such as those described in Sato, Y et al Science 273 352 (1996)
Also, provided by this invention are methods using the described polynucleotide or particular fragments thereof, which have been shown to encode non-vanable regions of bacterial cell surface proteins, in polynucleotide constructs used m such genetic immunization experiments in animal models of infection with Staphylococcus aureus Such experiments will be particularly
- 30 - useful for identifying protem epitopes able to provoke a prophylactic or therapeutic immune response It is believed that this approach will allow for the subsequent preparation of monoclonal antibodies of particular value, derived from the requisite organ of the animal successfully resisting or clearing infection, for the development of prophylactic agents or therapeutic treatments of bacterial infection, particularly Staphylococcus aureus infection, m mammals, particularly humans
A polypeptide of the invention may be used as an antigen for vaccination of a host to produce specific antibodies which protect against invasion of bacteria, for example by blocking adherence of bacteria to damaged tissue Examples of tissue damage include wounds in skm or connective tissue caused, for example, by mechanical, chemical, thermal or radiation damage or by implantation of indwelling devices, or wounds in the mucous membranes, such as the mouth, throat, mammary glands, urethra or vagma
The invention also includes a vaccine formulation which comprises an immunogenic recombinant polypeptide and/or polynucleotide of the mvention together with a suitable carrier. such as a pharmaceutically acceptable carrier Since the polypeptides and polynucleotides may be broken down in the stomach, each is preferably administered parenterally, including, for example, administration that is subcutaneous, intramuscular, intravenous, or lntradermal Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteπostatic compounds and solutes which render the formulation isotonic with the bodily fluid, preferably the blood, of the individual, and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dπed condition requiring only the addition of the sterile liquid carrier immediately prior to use The vaccine formulation may also mclude adjuvant systems for enhancing the immunogemcity of the formulation, such as oil-m water systems and other systems known in the art The dosage will depend on the specific activity of the vaccine and can be readily determined by routine expenmentation
While the invention has been described with reference to certam pyrH polypeptides and polynucleotides, it is to be understood that this covers fragments of the naturally occurring polypeptides and polynucleotides, and similar polypeptides and polynucleotides with additions, deletions or substitutions which do not substantially affect the immunogenic properties of the recombinant polypeptides or polynucleotides Compositions, kits and administration
- 31 - In a further aspect of the mvention there are provided compositions compnsmg a pyrH polynucleotide and/or a pyrH polypeptide for administration to a cell or to a multicellular orgamsm
The mvention also relates to compositions compnsmg a polynucleotide and/or a polypeptides discussed herem or their agomsts or antagonists The polypeptides and polynucleotides of the mvention may be employed m combmation with a non-stenle or stenle earner or earners for use with cells, tissues or orgamsms. such as a pharmaceutical earner suitable for admimstration to an mdividual Such compositions compnse. for instance, a media additive or a therapeutically effective amount of a polypeptide and or polynucleotide of the mvention and a pharmaceutically acceptable earner or excipient Such earners may mclude. but are not limited to, salme. buffered salme. dextrose, water. glvcerol. ethanol and combmations thereof Tlie formulation should suit tlie mode of admimstration The mvention further relates to diagnostic and pharmaceutical packs and kits compnsmg one or more containers filled with one or more of tlie ingredients of the aforementioned compositions of the mvention
Polypeptides. polynucleotides and other compounds of the mvention may be employed alone or m conjunction with other compounds, such as therapeutic compounds
The pharmaceutical compositions may be adrmmstered m any effective, convement manner mcludmg. for instance, administration by topical, oral, anal, vagmal, mtravenous. rntrapentoneal. intramuscular, subcutaneous, mtranasal or lntradermal routes among others
In therapy or as a prophylactic, the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic
Alternatively the composition may be formulated for topical application for example in the form of ointments, creams, lotions, eye ointments, eye drops, ear drops, mouthwash. impregnated dressings and sutures and aerosols, and may contain appropriate conventional additives, including, for example, preservatives, solvents to assist drug penetration and emollients in ointments and creams Such topical formulations may also contain compatible conventional carriers, for example cream or ointment bases, and ethanol or oleyl alcohol for lotions Such earners may constitute from about 1% to about 98% by weight of the formulation, more usually they will constitute up to about 80% by weight of the formulation
In a further aspect, the present mvention provides for pharmaceutical compositions compnsmg a therapeutically effective amount of a polypeptide and/or polynucleotide. such as the soluble form of a polypeptide and/or polynucleotide of the present mvention, agomst or antagonist peptide or small molecule compound, m combination with a pharmaceutically acceptable earner or excipient Such earners mclude, but are not limited to, salme, buffered salme, dextrose, water, glycerol. ethanol. and combmations thereof The mvention further relates to pharmaceutical packs and kits compnsmg one
- 32 - or more containers filled with one or more of the ingredients of the aforementioned compositions of the mvention Polypeptides, polynucleotides and other compounds of the present mvention may be employed alone or m conjunction with other compounds, such as therapeutic compounds
The composition will be adapted to the route of admimstration, for instance by a systemic or an oral route Prefened forms of systemic administration mclude injection, typically by mtravenous injection Other injection routes, such as subcutaneous, intramuscular, or rntrapentoneal. can be used Alternative means for systemic admimstration mclude transmucosal and transdermal admimstration usmg penetrants such as bile salts or fusidic acids or other detergents In addition, if a polypeptide or other compounds of the present mvention can be formulated m an entenc or an encapsulated foundation, oral admimstration may also be possible Admimstration of these compounds may also be topical and/or localized, mthe form of salves, pastes, gels, and the like
For administration to mammals, and particularly humans, it is expected that the daily dosage level of the active agent will be from 0 01 mg/kg to 10 mg/kg, typically around 1 mg/kg The physician in any event will determine the actual dosage which will be most suitable for an individual and will vary with the age. weight and response of the particular individual The above dosages are exemplary of the average case There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are withm the scope of this invention
In-dwelhng devices include surgical implants, prosthetic devices and catheters, I e . devices that are introduced to the body of an individual and remain m position for an extended time Such devices mclude, for example, artificial joints, heart valves, pacemakers, vascular grafts, vascular catheters, cerebrospmal fluid shunts, urinary catheters, contmuous ambulatory peritoneal dialysis (CAPD) catheters
The composition of the invention may be administered by injection to achieve a systemic effect against relevant bacteria shortly before insertion of an in-dwelhng device Treatment may be continued after surgery during the in-body time of the device In addition, the composition could also be used to broaden perioperative cover for any surgical technique to prevent bactenal wound infections, especially Staphylococcus aureus wound mfections
Many orthopedic surgeons consider that humans with prosthetic jomts should be considered for antibiotic prophylaxis before dental treatment that could produce a bacteremia Late deep infection is a serious complication sometimes leading to loss of the prosthetic joint and is accompanied by significant morbidity and mortality It may therefore be possible to extend the use of the active agent as a replacement for prophylactic antibiotics in this situation
In addition to the therapy described above, the compositions of this invention may be used generally as a wound treatment agent to prevent adhesion of bacteria to matnx protems
- 33 - exposed in wound tissue and for prophylactic use in dental treatment as an alternative to. or in conjunction with, antibiotic prophylaxis
Alternatively, the composition of the mvention may be used to bathe an indwelling device immediately before insertion The active agent will preferably be present at a concentration of 1 μg/ml to 1 Omg/ml for bathing of wounds or indwelling devices
A vaccine composition is conveniently in mjectable form Conventional adjuvants may be employed to enhance the immune response A suitable unit dose for vaccination is 0 5-5 microgram/kg of antigen, and such dose is preferably administered 1 -3 times and with an interval of 1-3 weeks With the indicated dose range, no adverse toxicological effects will be observed with the compounds of the invention which would preclude their administration to suitable individuals Sequence Databases, Sequences in a Tangible Medium, and Algorithms
Polynucleotide and polypeptide sequences form a valuable information resource with which to detennme their 2- and 3 -dimensional structures as well as to identify further sequences of similar homology These approaches are most easily facilitated by storing the sequence m a computer readable medium and then usmg the stored data m a known macromolecular structure program or to search a sequence database usmg well known searching tools, such as GCC
The polynucleotide and polypeptide sequences of the invention are particularly useful as components in databases useful for search analyses as well as in sequence analysis algorithms As used m this section entitled "Sequence Databases. Sequences in a Tangible Medium, and Algorithms." and m claims related to this section, the terms "polynucleotide of the invention" and "polynucleotide sequence of the invention" mean any detectable chemical or physical characteristic of a polynucleotide of the invention that is or may be reduced to or stored in a tangible medium, preferably a computer readable form For example, chromatographic scan data or peak data, photographic data or scan data therefrom, called bases, and mass spectrographic data As used in this section entitled Databases and Algorithms and m claims related thereto, the terms "polypeptide of the mvention" and "polypeptide sequence of the invention" mean any detectable chemical or physical characteristic of a polypeptide of the invention that is or may be reduced to or stored in a tangible medium, preferably a computer readable form For example. chromatographic scan data or peak data, photographic data or scan data therefrom, and mass spectrographic data
The mvention provides a computer readable medium havmg stored thereon polypeptide sequences of the invention and/or polynucleotide sequences of the invention For example, a computer readable medium is provided comprising and having stored thereon a member selected
- 34 - from the group consisting of a polynucleotide comprising the sequence of a polynucleotide of the mvention, a polypeptide comprising the sequence of a polypeptide sequence of the invention, a set of polynucleotide sequences wherein at least one of the sequences comprises the sequence of a polynucleotide sequence of the invention, a set of polypeptide sequences wherein at least one of the sequences comprises the sequence of a polypeptide sequence of the invention, a data set representing a polynucleotide sequence comprising the sequence of polynucleotide sequence of the invention, a data set representing a polynucleotide sequence encodmg a polypeptide sequence comprising the sequence of a polypeptide sequence of the invention, a polynucleotide comprising the sequence of a polynucleotide sequence of the mvention, a polypeptide comprising the sequence of a polypeptide sequence of the invention, a set of polynucleotide sequences wherein at least one of the sequences comprises the sequence of a polynucleotide sequence of the invention, a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of a polypeptide sequence of the invention, a data set representing a polynucleotide sequence comprising the sequence of a polynucleotide sequence of the invention, a data set representing a polynucleotide sequence encodmg a polypeptide sequence comprising the sequence of a polypeptide sequence of the invention The computer readable medium can be any composition of matter used to store information or data, including, for example, commercially available floppy disks, tapes, chips, hard drives, compact disks, and video disks
Also provided by the invention are methods for the analysis of character sequences or strings, particularly genetic sequences or encoded genetic sequences Preferred methods of sequence analysis mclude. for example, methods of sequence homology analysis, such as identity and similarity analysis, RNA structure analysis, sequence assembly, cladistic analysis, sequence motif analysis, open reading frame determination, nucleic acid base calling, nucleic acid base trimming, and sequencing chromatogram peak analysis A computer based method is provided for performing homology identification This method comprises the steps of providing a polynucleotide sequence comprising the sequence a polynucleotide of the invention in a computer readable medium, and companng said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology A computer based method is also provided for performing homology identification, said method comprising the steps of providing a polypeptide sequence compnsmg the sequence of a polypeptide of the invention in a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homology
35 - A computer based method is still further provided for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of a polynucleotide of the invention in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
A further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polynucleotide sequence comprising the sequence of a polynucleotide of the mvention in a computer readable medium, and comparing said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
A further embodiment of the invention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of a polypeptide of the invention m a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homology
A further embodiment of the invention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of a polynucleotide of the invention in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
In another prefened embodiment of the mvention there is provided a computer readable medium having stored thereon a member selected from the group consistmg of a polynucleotide comprising the sequence of SEQ ID NO 1, a polypeptide comprising the sequence of SEQ ID NO 2. a set of polynucleotide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 1 , a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 2, a data set representmg a polynucleotide sequence comprising the sequence of SEQ ID NO 1, a data set representmg a polynucleotide sequence encoding a polypeptide sequence comprising the sequence of SEQ ID NO 2, a polynucleotide comprising the sequence of SEQ ID NO 1, a polypeptide compnsmg the sequence of SEQ ID NO 2. a set of polynucleotide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 1. a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 2, a data set representing a polynucleotide sequence comprising the sequence of SEQ ID NO 1. a data set representmg a polynucleotide sequence encoding a polypeptide sequence comprising the sequence of SEQ ID NO 2 A further preferred
- 36 - embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providmg a polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and companng said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
A still further preferred embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of SEQ ID NO 2 m a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homolog\
A further embodiment of the mvention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
A further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providmg a polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and comparing said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
A further embodiment of the mvention provides a computer based method for performing homology identification, said method comprising the steps of providing a polypeptide sequence comprising the sequence of SEQ ID NO 2 in a computer readable medium, and comparing said polypeptide sequence to at least one polynucleotide or polypeptide sequence to identify homology A further embodiment of the invention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence compnsmg the sequence of SEQ ID NO 1 in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
All publications and references, including but not limited to patents and patent applications, cited m this specification are herem incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicated to be incorporated by reference herein as bemg fully set forth Any patent application to which this
- 37 - application claims priority is also incorporated by reference herem in its entirety in the manner described above for publications and references
GLOSSARY The following definitions are provided to facilitate understanding of certam terms used frequently herem
"Antιbody(ιes)" as used herein includes polyclonal and monoclonal antibodies, chimeπc. single cham. and humanized antibodies, as well as Fab fragments, including the products of an Fab or other lmmunoglobulm expression library "Antigemcally equivalent deπvatιve(s)" as used herein encompasses a polypeptide. polynucleotide, or the equivalent of either which will be specifically recognized bv certam antibodies which, when raised to the protem, polypeptide or polynucleotide according to the invention, interferes with the immediate physical interaction between pathogen and mammalian host "Bispecific antιbody(ιes)" means an antibody comprising at least two antigen bmdmg domains, each domain directed against a different epitope
"Bodily mateπal(s) means any matenal denved from an individual or from an organism infecting, infesting or inhabiting an individual, mcludmg but not limited to. cells, tissues and waste. such as, bone, blood, serum, cerebrospmal fluid, semen, saliva, muscle, cartilage, organ tissue, skm. urine, stool or autopsy matenals
"Dιsease(s)" means any disease caused by or related to infection by a bactena. mcludmg . for example, disease, such as, infections of the upper respiratory tract (e g . otitis media, bactenal tracheitis. acute epiglottitis. thyroiditis), lower respiratory (e g . empyema. lung abscess), cardiac (e g infective endocarditis), gastromtestmal (e g , secretory dianhoea, splenic absces, retropentoneal abscess), CNS (e g , cerebral abscess), eye (e g . blephantis, conjunctivitis, keratitis. endophthalmitis, preseptal and orbital celluhtis, darcryocystitis), kidney and urinary tract (e g , epididymitis. mtrarenal and pennephnc abscess, toxic shock syndrome), skm (e g , impetigo, follicuhtis, cutaneous abscesses, celluhtis, wound infection, bactenal myositis) bone and joint (e g . septic arthntis, osteomyelitis)
"Fusion protem(s)" refers to a protein encoded by two, often unrelated, fused genes or fragments thereof In one example, EP-A-0464 discloses fusion proteins comprising various portions of constant region of lmmunoglobulm molecules together with another human protem or part thereof In many cases, employing an lmmunoglobulm Fc region as a part of a fusion protem is advantageous for use m therapy and diagnosis resulting in. for example, improved pharmacokmetic properties [see, e g , EP-A 0232262] On the other hand, for some uses it
- 38 - would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified
"Host cell(s)" is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence "Identity." as known m the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be. as determined by companng the sequences In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be. as determined by the match between strings of such sequences "Identity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology. Lesk. A M . ed , Oxford University Press. New York. 1988, Bwcomputmg Informatics and Genome Projects. Smith. D W . ed , Academic Press. New York, 1993. Computer Analysis of Sequence Data. Part I. Gnffm. A M . and Griffin. H G . eds . Humana Press. New Jersey, 1994, Sequence Analysis in Molecular Biology, von Heinje, G . Academic Press. 1987. and Sequence Analysis Primer, Gnbskov. M and Devereux, J . eds , M Stockton Press. New York, 1991 , and Carillo, H . and Lipman. D .
SIAM J Applied Math , 48 1073 (1988) Methods to determine identity are designed to give the largest match between the sequences tested Moreover, methods to determine identity are codified in publicly available computer programs Computer program methods to determine identity between two sequences mclude, but are not limited to, the GCG program package (Devereux. J , et al . Nucleic Acids Research 12(1) 387 (1984)), BLASTP. BLASTN. and FASTA (Altschul, S F st al , J Molec Biol 215 403-410 (1990) The BLAST X program is pubhch available from NCBI and other sources (BLAST Manual, Altschul, S . et al , NCBI NLM NIH Bethesda. MD 20894, Altschul. S , et al . J Mol B ol 215 403-410 (1990) The well known Smith Waterman algorithm may also be used to determine identity Parameters for polypeptide sequence comparison include the following
1) Algorithm Needleman and Wunsch. J Mol Biol 48 443-453 (1970) Comparison matrix BLOSSUM62 from Hentikoff and Hentikoff. Proc Natl Acad Sci USA 89 10915-10919 (1992) Gap Penalty 12 Gap Length Penalty 4
A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group. Madison WI The aforementioned parameters are the default parameters for peptide comparisons (along with no penalty for end gaps)
Parameters for polynucleotide comparison include the following
- 39 - 1) Algorithm Needleman and Wunsch. J Mol Biol 48 443-453 (1970) Comparison matrix matches = +10, mismatch = 0 Gap Penalty 50 Gap Length Penalty 3 Available as The "gap" program from Genetics Computer Group. Madison WI These are the default parameters for nucleic acid comparisons
A preferred meaning for "identity" for polynucleotides and polypeptides. as the case may be, are provided in (1) and (2) below
(1) Polynucleotide embodiments further mclude an isolated polynucleotide comprising a polynucleotide sequence having at least a 50, 60. 70, 80. 85, 90. 95, 97 or 100% identity to the reference sequence of SEQ ID NO 1. wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may include up to a certain mteger number of nucleotide alterations as compared to the reference sequence wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, mcludmg transition and transversion. or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides m the reference sequence or in one or more contiguous groups withm the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides m SEQ ID NO 1 by the mteger defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides m SEQ ID NO 1. or
nn ≤ n " (xn * y),
wherein nn is the number of nucleotide alterations, xn is the total number of nucleotides in SEQ
ID NO 1. y is 0 50 for 50%. 0 60 for 60%. 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%, 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-mteger product of xn and y is rounded down to the nearest integer prior to subtracting it from xn Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO 2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
40 - By way of example, a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 2. that is it may be 100% identical, or it may include up to a certain integer number of amino acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity Such alterations are selected from the group consisting of at least one nucleic acid deletion, substitution, including transition and transversion. or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleic acids in the reference sequence or m one or more contiguous groups within the reference sequence The number of nucleic acid alterations for a given percent identity is determined by multiplying the total number of ammo acids in SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of ammo acids in SEQ ID NO 2. or
nn ≤ xn (*n • y)»
wherein nn is the number of ammo acid alterations. xn is the total number of ammo acids in SEQ
ID NO 2. y is. for instance 0 70 for 70%. 0 80 for 80%. 0 85 for 85% etc . • is the symbol for the multiplication operator, and wherein any non-mteger product of xn and y is rounded down to the nearest integer prior to subtracting it from xn (2) Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 50,60. 70, 80, 85, 90. 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2. wherein said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may include up to a certam mteger number of ammo acid alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the ammo- or carboxy-termmal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids in the reference sequence or in one or more contiguous groups within the reference sequence, and wherem said number of ammo acid alterations is determined by multiplymg the total number of ammo acids m SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids m SEQ ID NO 2. or
41 - na ≤ xa " (xa • y).
wherein na is the number of amino acid alterations. xa is the total number of ammo acids m SEQ
ID NO 2. y is 0 50 for 50%. 0 60 for 60%. 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%. 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-mteger product of xa and y is rounded down to the nearest integer prior to subtracting it from xa
By way of example, a polypeptide sequence of the present mvention may be identical to the reference sequence of SEQ ID NO 2 that is it may be 100% identical, or it ma-s mclude up to a certam mteger number of amino acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity Such alterations are selected from the group consisting of at least one ammo acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids m the reference sequence or in one or more contiguous groups within the reference sequence The number of ammo acid alterations for a given % identity is determined by multiplymg the total number of ammo acids in SEQ ID NO 2 by the mteger defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids m SEQ ID NO 2, or
na ≤ xa (χ a • y)>
wherein na is the number of ammo acid alterations, xa is the total number of amino acids m SEQ
ID NO 2, y is, for instance 0 70 for 70%, 0 80 for 80%, 0 85 for 85% etc . and • is the symbol for the multiplication operator, and wherein any non-mteger product of xa and y is rounded down to the nearest integer prior to subtracting it from xa
"lmmunologically equivalent deπvatιve(s)" as used herem encompasses a polypeptide. polynucleotide, or the equivalent of either which when used in a suitable formulation to raise antibodies in a vertebrate, the antibodies act to interfere with the immediate physical interaction between pathogen and mammalian host
"Immunospecific" means that charactenstic of an antibody whereby it possesses substantially greater affihity for the polypeptides of the mvention or the polynucleotides of the mvention than its
- 42 - affinity for other related polypeptides or polynucleotides respectively, particularly those polypeptides and polynucleotides m the pnor art
"Indιvιdual(s)" means a multicellular eukaryote. mcludmg, but not limited to a metazoan, a mammal, an ovid. a bovid, a simian, a primate, and a human "Isolated" means altered "by the hand of man" from its natural state. / e . if it occurs m nature, it has been changed or removed from its ongmal environment, or both For example, a polynucleotide or a polypeptide naturally present m a Irving orgamsm is not "isolated." but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is "isolated", as the term is employed herem Moreover, a polynucleotide or polypeptide that is mtroduced mto an organism by transformation, genetic manipulation or by any other recombmant method is "isolated" even if it is still present in said orgamsm. winch organism may be living or non-living
"Organιsm(s)" means a (l) prokaryote. mcludmg but not limited to, a member of the genus Streptococcus, Staphylococcus, Bordetella Corynebactenum, Mycobactenum, Neissena Haemophilus, Actinomycetes, Streptomycetes, Nocardia, Enterobacter Yersinia Fancisella Pasturella, Moraxella, Acinetobacter, Erysipelothnx, Branhamella, Actinobacillus, Streptobac llus Listena, Calymmatobacterium, Brucella, Bacillus, Clostridium, Treponema Eschenchia Salmonella, Kleibsiella, Vibrio, Proteus, Erwinia, Borrelia, Leptospira, Spirillum, Campylobacter, Shigella, Legwnella, Pseudomonas, Aeromonas, Rickettsia, Chlamydia, Borrelia and Mycoplasma. and further mcludmg. but not limited to, a member of the species or group. Group A Streptococcus Group B Streptococcus, Group C Streptococcus, Group D Streptococcus, Group G Streptococcus Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus Jaecalis, Streptococcus faecium, Streptococcus durans, Neissena gonorrheae, Neissena meningitidis, Staphylococcus aureus, Staphylococcus epidermidis, Corynebactenum dipthenae Gardnerella vaginal s, Mycobactenum tuberculosis, Mycobactenum bovis, Mycobactenum ulcerans, Mycobactenum leprae, Actinomyctes israeln, Listena monocytogenes, Bordetella pertusis. Bordatella parapertusis, Bordetella bronchiseptica, Eschenchia coh, Shigella dysentenae, Haemophilus influenzae, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus ducrey , Bordetella, Salmonella typhi, Citrobacter freundu, Proteus mirabihs, Proteus vulgans Yersinia pestis, Kleibsiella pneumoniae, Serratia marcessens, Serratia liquefaciens. Vibrio cholera. Shigella dysenteni, Shigella flexneri, Pseudomonas aeruginosa, Franscisella tularensis, Brucella abortis, Bacillus anthracis, Bacillus cereus, Clostndium perfnngens, Clostridium tetani Clostridium botubnum, Treponema pallidum, Rickettsia nckettsii and Chlamydia trachomitis, (n) an archaeon, mcludmg but not limited to Archaebacter. and (in) a unicellular or filamentous eukaryote. mcludmg but not limited to. a protozoan, a fungus, a member of the genus Saccharomyces
- 43 - Kluveromyces, or Candida, and a member of the species Saccharomyces cenviseae, Kluveromyces lactis or Candida albicans
"Polynucleotide(s)" generally refers to any polynbonucleotide or polydeoxynbonucleoude. which may be unmodified RNA or DNA or modified RNA or DNA "Polynucleotιde(s)" mclude. without limitation, smgle- and double-stranded DNA. DNA that is a mixture of smgle- and double- stranded regions or smgle-. double- and tnple-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of smgle- and double-stranded regions, hybnd molecules compnsmg DNA and RNA that may be single-stranded or, more typically, double-stranded, or tnple-stranded regions, or a mixture of smgle- and double-stranded regions In addition, "polynucleotide" as used herem refers to tnple-stranded regions compnsmg RNA or DNA or both RNA and DNA The strands m such regions may be from the same molecule or from different molecules The regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules One of the molecules of a tnple-hehcal region often is an oligonucleotide As used herem. the ten "polynucleotιde(s)" also mcludes DNAs or RNAs as descnbed above that contain one or more modified bases Thus. DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is mtended herem Moreover. DNAs or RNAs compnsmg unusual bases, such as mosme, or modified bases, such as tntylated bases, to name just two examples, are polynucleotides as the term is used herem It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill m the art The tenn "polynucleotide(s)" as it is employed herem embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA charactenstic of viruses and cells, mcludmg. for example, simple and complex cells "Pohnucleotide(s)" also embraces short polynucleotides often refened to as ohgonucleotide(s)
"Polypeptide(s)" refers to any peptide or protem compnsmg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds "Polypeptide(s)" refers to both short chains, commonly refened to as peptides, ohgopeptides and ohgomers and to longer chains generally refened to as protems Polypeptides may contain ammo acids other than the 20 gene encoded ammo acids "Po ypeptιde(s)" mclude those modified either by natural processes, such as processmg and other post- translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and in more detailed monographs, as well as m a volummous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present m the same or varying degree at several sites m a given polypeptide Also, a given polypeptide may contain many types of modifications Modifications can occur anywhere m a polypeptide. mcludmg the peptide backbone, the ammo acid side-chains, and the ammo
- 44 - or carboxyl termini Modifications mclude, for example, acetylation. acylation. ADP-nbosylation. amidation. covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative, covalent attachment of a hpid or hpid denvative. covalent attachment of phosphotidylmositol, cross-linking, cyclization. disulfide bond formation, demethylation formation of covalent cross-links, formation of cysteme. formation of pyroglutamate. formylation. gamma-carboxylation. GPI anchor formation, hydroxylation, lodination, methylation. mynstoylation. oxidation, proteolytic processmg. phosphorylation, prenylation. racemization. glycosylation. hpid attachment, sulfation. gamma-carboxylation of glutamic acid residues, hydroxylation and ADP- nbosylation. selenoylation. sulfation, transfer-RNA mediated addition of ammo acids to proteins, such as arginylation. and ubiquitination See, for instance. PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES. 2nd Ed , T E Creigliton. W H Freeman and Company. New York (1993) and Wold. F . Posttranslational Protem Modifications Perspectives and Prospects, pgs 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS. B C Johnson. Ed . Academic Press. New York (1983). Seifter et al . Meth Enzymol 182 626-646 (1990) and Rattan et al . Protein Synthesis Posttranslational Modifications and Aging, Ann N Y Acad Sci 663 48-62 (1992) Polypeptides may be branched or cyclic, with or without branching Cyclic, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well
"Recombmant expression system(s)" refers to expression systems or portions thereof or polynucleotides of the mvention mtroduced or transformed mto a host cell or host cell lysate for the production of the polynucleotides and polypeptides of the mvention
"Subtraction set" is one or more, but preferably less than 100, polynucleotides comprising at least one polynucleotide of the invention
"Vaπant(s)' as the tenn is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the variant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result in ammo acid substitutions, additions, deletions, fusion proteins and truncations m the polypeptide encoded by the reference sequence, as discussed below A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide Generally , differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical A vanant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any
- 45 - combination A substituted or inserted amino acid residue may or may not be one encoded by the genetic code The present mvention also mcludes mclude vanants of each of the polypeptides of the mvention, that is polypeptides that van from tl e referents by conservative a mo acid substitutions, whereby a residue is substituted by another with like charactenstics Typical such substitutions are among Ala, Val. Leu and He. among Ser and Thr. among the acidic residues Asp and Glu. among Asn and Gin. and among the basic residues Lys and Arg. or aromatic residues Phe and Tyr Particularly prefened are vanants m which several. 5-10. 1-5, 1-3, 1-2 or 1 ammo acids are substituted, deleted, or added m any combmation A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allehc variant, or it may be a variant that is not known to occur naturally Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techmques. by direct synthesis, and by other recombinant methods known to skilled artisans EXAMPLES
The examples below are earned out usmg standard techmques. which are well known and routme to those of skill m the art, except where otherwise descnbed m detail The examples are illustrative, but do not limit tl e mvention Example 1 Strain selection, Library Production and Sequencing
The polynucleotide having a DNA sequence given in Table 1 [SEQ ID NO 1] was obtamed from a library of clones of chromosomal DNA of Staphylococcus aureus in E coh The sequencing data from two or more clones containing overlapping Staphylococcus aureus DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routine methods, for example Methods 1 and 2 below
Total cellular DNA is isolated from Staphylococcus aureus WCUH 29 according to standard procedures and size-fractionated by either of two methods Method 1
Total cellular DNA is mechanically sheared by passage through a needle m order to size- fractionate according to standard procedures DNA fragments of up to 1 lkbp in size are rendered blunt by treatment with exonuclease and DNA polymerase. and EcoRI linkers added Fragments are ligated into the vector Lambda Zapll that has been cut with EcoRI. the library packaged by standard procedures and E coh infected with the packaged library The library is amplified by standard procedures Method 2
46 - Total cellular DNA is partially hydrolyzed with a one or a combination of restriction enzymes appropriate to generate a series of fragments for cloning into library vectors (e g , Rsal. Pall. Alul, Bshl235I). and such fragments are size-fractionated according to standard procedures EcoRI linkers are ligated to the DNA and the fragments then ligated into the vector Lambda Zapll that have been cut with EcoRI, the library packaged by standard procedures, and E coh infected with the packaged library The library is amplified by standard procedures
47

Claims

What is claimed is: 1 An isolated polypeptide selected from the group consisting of
(1) an isolated polypeptide comprising an ammo acid havmg at least
(a) 70% identity.
(b) 80% identity.
(c) 90% identity, or
(d) 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID
NO 2, (π) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO 2. (m) an isolated polypeptide which is the amino acid sequence of SEQ ID NO 2. and (iv) a polypeptide which is encoded by a recombinant polynucleotide comprising the polyncleotide sequence of SEQ ID NO 2
2 An isolated polynucleotide selected from the group consistmg of
(l) an isolated polynucleotide compnsmg a polynucleotide sequence encodmg a polypeptide that has at least
(a) 70% identity,
(b) 80% identity.
(c) 90% identity, or
(d) 95% identity, to the ammo acid sequence of SEQ ID NO 2. over the entire length of SEQ ID NO 2. (n) an isolated polynucleotide compnsmg a polynucleotide sequence that has at least
(a) 70% identity
(b) 80% identity,
(c) 90% identity, or
(d) 95% identity, over its entire length to a polynucleotide sequence encodmg the polypeptide of SEQ ID
NO 2,
(in) an isolated polynucleotide compnsmg a nucleotide sequence which has at least
(a) 70% identity.
(b) 80% identity,
(c) 90% identity, or
- 48 - (d) 95% identity . to that of SEQ ID NO 1 over the entire length of SEQ ID NO 1.
(iv) an isolated polynucleotide compnsmg a nucleotide sequence encodmg the polypeptide of
SEQ ID NO 2.
(vi) an isolated polynucleotide which is the polynucleotide of SEQ ID NO 1.
(vi) an isolated polynucleotide obtainable by screemng an appropnate library under strmgent hybndization conditions with a probe havmg tlie sequence of SEQ ID NO 1 or a fragment thereof,
(vn) an isolated polynucleotide encodmg a mature polypeptide expressed by the pyrH gene contained m the Staphylococcus aureus, and
(vni) a polynucleotide sequence complementary to said isolated polynucleotide of (i). (n). (m) (iv). (v). (vi) or (vn)
3 An antibody antigenic to or immunospecific for the polypeptide of claim 1
4 A method for the treatment of an individual
(I) in need of enhanced activity or expression of the polypeptide of claim 1 comprising the step of
(a) administering to the individual a therapeuticalh effective amount of an agomst to said polypeptide, or
(b) providing to the individual an isolated polynucleotide compnsmg a polynucleotide sequence encodmg said polypeptide m a form so as to effect production of said polypeptide activity in vivo, or
(n) having need to inhibit activity or expression of the polypeptide of claim 1 comprising
(a) administering to the individual a therapeutically effective amount of an antagonist to said polypeptide, or
(b) administering to the individual a nucleic acid molecule that inhibits the expression of a polynucleotide sequence encodmg said polypeptide, or
(c) administering to the individual a therapeutically effective amount of a polypeptide that competes with said polypeptide for its hgand. substrate or receptor
49 - 5 A process for diagnosing or prognosing a disease or a susceptibility to a disease m an individual related to expression or activity of the polypeptide of claim 1 m an mdividual comprising the step of
(a) determining the presence or absence of a mutation in the nucleotide sequence encodmg said polypeptide m the genome of said individual, or
(b) analyzing for the presence or amount of said polypeptide expression in a sample derived from said individual
6 A method for screening to identify compounds that activate or that inhibit the function of the polypeptide of clam 1 which compnses a method selected from the group consistmg of
(a) measuring the bmdmg of a candidate compound to the polypeptide or to the cells or membranes bearing the polypeptide or a fusion protem thereof by means of a label directly or indirectly associated with the candidate compound,
(b) measuring the bmdmg of a candidate compound to the polypeptide or to the cells or membranes bearing the polypeptide or a fusion protem thereof in the presence of a labeled competitor,
(c) testing whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide, using detection systems appropriate to the cells or cell membranes bearing the polypeptide,
(d) mixing a candidate compound with a solution containing a polypeptide of claim 1. to form a mixture, measuring activity of the polypeptide in the mixture, and comparing the activity of the mixture to a standard,
(e) detecting the effect of a candidate compound on the production of mRNA encodmg said polypeptide and said polypeptide in cells, using for instance, an ELISA assay, or
(f) (1) contacting a composition compnsmg the polypeptide with the compound to be screened under conditions to permit mteraction between the compound and the polypeptide to assess the mteraction of a compound, such mteraction bemg associated with a second component capable of providmg a detectable signal m response to the mteraction of the polypeptide with the compound, and
(2) determrnmg whether the compound interacts with and activates or inhibits an activity of the polypeptide by detectmg the presence or absence of a signal generated from the mteraction of the compound with tlie polypeptide
7 An agonist or an antagonist of the activity or expression polypeptide of claim 1
- 50 - 8 An expression system compnsmg a polynucleotide capable of producing a polypeptide of claim 1 when said expression system is present m a compatible host cell
9 A host cell comprising the expression system of claim 8 or a membrane thereof expressmg a polypeptide selected from the group consisting of
(l) an isolated polypeptide comprising an amino acid sequence selected from the group having at least
(a) 70% identity,
(b) 80% identity.
(c) 90% identity, or
(d) 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID
NO 2, (π) an isolated polypeptide compnsmg the ammo acid sequence of SEQ ID NO 2. (in) an isolated polypeptide which is the ammo acid sequence of SEQ ID NO 2. and (iv) a polypeptide which is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO 2
10 A process for producing a polypeptide selected from the group consisting of
(I) an isolated polypeptide compnsmg an ammo acid sequence selected from the group havmg at least
(a) 70% identity,
(b) 80% identity.
(c) 90% identity, or
(d) 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (n) an isolated polypeptide compnsmg the amino acid sequence of SEQ ID NO 2, (in) an isolated polypeptide which is the amino acid sequence of SEQ ID NO 2. and (iv) a polypeptide which is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO 2. comprising the step of culturmg a host cell of claim 9 under conditions sufficient for the production of said polypeptide
- 51 - 11 A process for producing a host cell comprising the expression system of claim 8 or a membrane thereof expressmg a polypeptide selected from the group consisting of
(l) an isolated polypeptide comprising an ammo acid sequence selected from the group having at least
(a) 70% identity,
(b) 80% identity,
(c) 90% identity, or
(d) 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (n) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO 2, (m) an isolated polypeptide which is the ammo acid sequence of SEQ ID NO 2. and (iv) a polypeptide which is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO 2, said process comprising the step of transforming or transfectmg a cell with an expression system compnsmg a polynucleotide capable of producing said polypeptide of (l), (n). (m) or (iv) when said expression system is present in a compatible host cell such the host cell, under appropriate culture conditions, produces said polypeptide of (I), (n), (in) or (iv)
12 A host cell produced by the process of claim 11 or a membrane thereof expressing a polypeptide selected from the group consisting of
(I) an isolated polypeptide comprising an amino acid sequence selected from the group havmg at least
(a) 70% identity,
(b) 80% identity,
(c) 90% identity, or
(d) 95% identity to the amino acid sequence of SEQ ID NO 2 over the entire length of SEQ ID
NO 2, (n) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO 2, (in) an isolated polypeptide which is the amino acid sequence of SEQ ID NO 2. and (iv) a polypeptide which is encoded by a recombinant polynucleotide compnsmg the polynucleotide sequence of SEQ ID NO 2
- 52 - 13 A computer readable medium having stored thereon a member selected from the group consisting of a polynucleotide comprising the sequence of SEQ ID NO 1. a polypeptide comprising the sequence of SEQ ID NO 2, a set of polynucleotide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 1, a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 2, a data set representing a polynucleotide sequence comprising the sequence of SEQ ID NO 1. a data set representing a polynucleotide sequence encoding a polypeptide sequence comprising the sequence of SEQ ID NO 2, a polynucleotide comprising the sequence of SEQ ID NO 1 , a polypeptide comprising the sequence of SEQ ID NO 2. a set of polynucleotide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 1, a set of polypeptide sequences wherein at least one of said sequences comprises the sequence of SEQ ID NO 2. a data set representing a polynucleotide sequence comprising the sequence of SEQ ID NO 1. a data set representmg a polynucleotide sequence encodmg a polypeptide sequence comprising the sequence of SEQ ID NO 2
14 A computer based method for performing homology identification, said method comprising the steps of providing a polynucleotide sequence comprising the sequence of SEQ ID NO 1 m a computer readable medium, and comparing said polynucleotide sequence to at least one polynucleotide or polypeptide sequence to identify homology
15 A further embodiment of the invention provides a computer based method for polynucleotide assembly, said method comprising the steps of providing a first polynucleotide sequence comprising the sequence of SEQ ID NO 1 in a computer readable medium, and screening for at least one overlapping region between said first polynucleotide sequence and a second polynucleotide sequence
- 53
EP19990918764 1998-04-27 1999-04-22 STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES Withdrawn EP1073677A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US6692298A 1998-04-27 1998-04-27
US66922 1998-04-27
PCT/US1999/008785 WO1999055729A1 (en) 1998-04-27 1999-04-22 STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES

Publications (2)

Publication Number Publication Date
EP1073677A1 true EP1073677A1 (en) 2001-02-07
EP1073677A4 EP1073677A4 (en) 2002-10-29

Family

ID=22072588

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19990918764 Withdrawn EP1073677A4 (en) 1998-04-27 1999-04-22 STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES

Country Status (3)

Country Link
EP (1) EP1073677A4 (en)
JP (1) JP2002512777A (en)
WO (1) WO1999055729A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001251370A1 (en) 2000-04-06 2001-10-23 Pharmacia And Upjohn Company Antimicrobial methods and materials
JP2005503831A (en) * 2001-09-28 2005-02-10 ファルマシア アンド アップジョン カンパニー リミティド ライアビリティー カンパニー Antimicrobial methods and materials
GB0311789D0 (en) * 2003-05-22 2003-06-25 Astrazeneca Ab Method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0832973A2 (en) * 1996-09-24 1998-04-01 Smithkline Beecham Corporation GTP-binding protein

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0832973A2 (en) * 1996-09-24 1998-04-01 Smithkline Beecham Corporation GTP-binding protein

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BUCURENCI N ET AL: "Mutational analysis of UMP kinase from Escherichia coli." JOURNAL OF BACTERIOLOGY. UNITED STATES FEB 1998, vol. 180, no. 3, February 1998 (1998-02), pages 473-477, XP002216100 ISSN: 0021-9193 *
See also references of WO9955729A1 *

Also Published As

Publication number Publication date
EP1073677A4 (en) 2002-10-29
WO1999055729A1 (en) 1999-11-04
JP2002512777A (en) 2002-05-08

Similar Documents

Publication Publication Date Title
WO1999062527A1 (en) nrdE
US6162618A (en) 6-phosphogluconate dehydrogenase of Streptococcus pneumoniae
US6346397B1 (en) GyrA
WO2000029547A1 (en) YfiI PSEUDOURIDINE SYNTHASE
EP1032591A1 (en) NOVEL pth
WO2000021544A1 (en) Ups (undecaprenyl diphosphate synthase)
EP1073677A1 (en) STAPHYLOCOCCUS AUREUS pyrH POLYPEPTIDES AND POLYNUCLEOTIDES
WO1999018117A1 (en) 3-hydroxyacyl-coa dehydrogenase from staphylococcus aureus
US6555338B1 (en) NrdF from Staphylococcus aureus
US6287804B1 (en) nrdG
WO1999062946A1 (en) nrdF
WO2000028819A1 (en) Yfil pseudouridine synthase
EP1109566A1 (en) Gcp
WO2000015769A1 (en) Topa
WO2000030662A1 (en) Fabz
WO1999017795A1 (en) RIBOSOME RECYCLING FACTOR (FRR) OF $i(STAPHYLOCOCCUS AUREUS)
WO1999018122A1 (en) Ama
EP1077983A2 (en) Pria
WO2000028820A1 (en) DnaB
EP1105411A1 (en) nrdE
WO2000012531A1 (en) Ratc
WO2000023611A9 (en) FabG
WO2000023467A1 (en) birA
WO2000039286A1 (en) DnaE
WO2000023575A1 (en) Ups (ugc)

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20001127

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE CH DE DK FR GB IT LI NL

A4 Supplementary search report drawn up and despatched
AK Designated contracting states

Kind code of ref document: A4

Designated state(s): BE CH DE DK FR GB IT LI NL

A4 Supplementary search report drawn up and despatched

Effective date: 20021029

17Q First examination report despatched

Effective date: 20030818

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031230