AU1739099A - Effector proteins of rapamycin - Google Patents

Description

T

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

i

I

.i S t

I

I

V''1 Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: American Home Products Corporation, The Trustees of Columbia University in the City of New York Actual Inventor(s): Katherine Lu Molnar-Kimber Amedeo Arturo Failli Thomas Joseph Caggiano SKoji Nakanishi Yanqiu Chen Address for Service: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: EFFECTOR PROTEINS OF RAPAMYCIN S Our Ref: 571964 SPOF Code: 49377/1481,64292 3: The following statement is a full description of this invention, including the best Smethod of performing it known to applicant(s): -1- -2- EFFECTOR PROTEINS OF RAPAMYCIN This application is a divisional application of Australian Patent Application 13670195 the entire contents of which is herein incorporated by reference.

This invention concerns effector proteins of Rapamycin. More particularly, this invention concerns novel Rapamycin-FKBP12 binding proteins of mammalian origin for identification, design and synthesis of immunomodulatory, anti-restenosis or anti-tumor agents.

SBACKGROUND OF THE INVENTION Rapamycin is a macrolide antibiotic produced by Streptomyces S 15 hygroscopicus which was first characterized via its properties as an antifungal i .agent. It adversely affects the growth of fungi such as Candida albicans and i Microsporum gypseum. Rapamycin, its preparation and its antibiotic activity were described in U.S. Patent No. 3,929,992, issued December 30, 1975 to Surendra Sehgal et al. In 1977 Martel, R. R. et al. reported on immunosuppressive properties of rapamycin against experimental allergic encephalitis and adjuvant arthritis in the Canadian Journal of Physiological Pharmacology, 55, 48-51 (1977). In 1989, Calne, R. Y. et al, in Lancet, 1989, no. 2, p. 227 and Morris, R. E. and Meiser, B. M. in Medicinal Science j Research, 1989, No. 17, P. 609-10, separately reported on the effectiveness of rapamycin in inhibiting rejection in vivo in allograft transplantation. Numerous articles have followed describing the immunosuppressive and rejection inhibiting properties of rapamycin, and clinical investigation has begun for the use of rapamycin in inhibiting rejection in transplantation in man.

Rapamycin alone Patent 4,885,171) or in combination with picibanil Patent 4,401,653) has been shown to have antitumor activity. R.

R. Martel et al. [Can. J. Physiol. Pharmacol. 55, 48 (1977)] disclosed that C"'h f -3rapamycin is effective in the experimental allergic encephalomyelitis model, a model for multiple sclerosis; in the adjuvant arthritis model, a model for rheumatoid arthritis; and effectively inhibited the formation of IgE-like antibodies.

The immunosuppressive effects of rapamycin have been disclosed in FASEB 3, 3411 (1989). Cyclosporin A and FK-506, other macrocyclic molecules, also have been shown to be effective as immunosuppressive Sagents, therefore useful in preventing transplant rejection [FASEB 3, 3411 (1989); FASEB 3, 5256 (1989); R. Y. Calne et al., Lancet 1183 (1978); and U.S. Patent 5,100,899].

Rapamycin has also been shown to be useful in preventing or treating systemic lupus erythematosus Patent 5,078,999], pulmonary inflammation S 15 Patent 5,080,899], insulin dependent diabetes mellitus [Fifth Int. Conf.

Inflamm. Res. Assoc. 121 (Abstract), (1990)], and smooth muscle cell proliferation and intimal thickening following vascular injury [Morris, R. J. Heart Lung Transplant 11 (pt. 197 (1992)].

20 Mono- and diacylated derivatives of rapamycin (esterified at the 28 and 43 positions) have been shown to be useful as antifungal agents Patent I 4,316,885) and used to make water soluble prodrugs of rapamycin Patent 8 :4,650,803). Recently, the numbering convention for rapamycin has been changed; therefore according to Chemical Abstracts nomenclature, the esters described above would be at the 31- and 42- positions. U.S. Patent 5,118,678 discloses carbamates of rapamycin that are useful as immunosuppressive, antiinflammatory, antifungal, and antitumor agents. U.S. Patent 5,100,883 discloses fluorinated esters of rapamycin. U.S. Patent 5,118,677 discloses amide esters of rapamycin. U.S. Patent 5,130,307 discloses aminoesters of 30 rapamycin. U.S. Patent 5,117,203 discloses sulfonates and sulfamates of rapamycin. U.S. Patent 5,194,447 discloses sulfonylcarbamates of rapamycin.

4- U.S. Patent No. 5,100,899 (Calne) discloses methods of inhibiting transplant rejection in mammals using rapamycin and derivatives and prodrugs thereof. Other chemotherapeutic agents listed for use with rapamycin are azathioprine, corticosteroids, cyclosporin (and cyclosporin and FK-506, or any combination thereof.

Rapamycin produces immunosuppressive effects by blocking intracellular signal transduction. Rapamycin appears to interfere with a calcium independent signalling cascade in T cells and mast cells [Schreiber et al. (1992) Tetrahedron 48:2545-2558]. Rapamycin has been shown to bind to certain immunophilins which are members of the FK-506 binding proteins (FKBP) family. In particular, Rapamycin has been shown to bind to the binding proteins, FKBP12, FKBP13, FKBP25 [Galat A. et al., (1992) Biochemistry S31(8);2427-2437 and Ferrera A, et al., (1992) Gene 113(1):125-127; Armistead 15 and Harding, Ann. Reports in Med. Chem. 28:207-215, 1993], and FKBP52 [WO 93/07269].

Rapamycin is able to inhibit mitogen-induced T cell and B cell proliferation as well as proliferation induced by several cytokines, including IL-2, 20 IL-3, IL4 and IL-6 (reviewed by Sehgal et al., Med. Research Rev. 14: 1-22, Sj1994). It can also inhibit antibody production. Rapamycin has been shown to block the cytokine-induced activation of p70 s 5 kinase which appears to correlate with Rapamycin's ability to decrease protein synthesis accompanying cell cycle progression (Calvo et al., Proc. Natl. Acad. Sci. USA, 89:7571-7575, 1992; Chung et al., Cell 69:1227-1236, 1992; Kuo et al., Nature 358:70-73, 1992; Price et al., Science 257:973-977, 1992). It also inhibits the activation of cdk2/cyclin E complex (Flanagan et al., Ann. N.Y. Acad. Sci, in press; Flanagan et al. Mol. Cell Biol., in press; Flanagan et al., J.Cell Biochem. 17A:292, 1993).

Rapamycin's effects are not mediated by direct binding to p70 6 kinase and cdk2cyclin E, but by action of the Rapamycin-FKBP complex on upstream component(s) which regulate the activation status of the kinases.

It is generally accepted that the action of immunosuppressive drugs, such as Rapamycin, cyclosporine and FK506, is dependent upon the formation of a complex with their respective intracellular receptor proteins called immunophilins. While the binding of these immunosuppressants with their respective immunophilins inhibits the cis-trans peptidyl prolyl isomerase (PPlase) activity of immunophilins, PPIase inhibition is not sufficient to mediate the immunosuppressive activity (reviewed in Armistead and Harding, Annual Reports in Med. Chem, 28:207-215:1993). Two rapamycin analogs which are Diels Alder adducts, one with 4-phenyl-1,2,4-triazoline-3,5-dione, and the second with 4-methyl- ,2,4-triazoline-3,5-dione, bind to FKBP, inhibited its PPIase activity, yet they did not exhibit any detectable immunosuppressive activity. The phenyl-triazolinedione Diels Alder adduct at high molar excess has been shown to competitively inhibit rapamycin's effect on DNA synthesis in mitogen-stimulated murine thymocyte proliferation (Ocain et al., Biochem.

15 Biophys. Res. Commun. 192:1340, 1993). Recent evidence suggests that the binary immunophilin-drug complex such as cyclophiiin-cyclosporin A and FKBP- FK506 gains a new function that enables it to block signal transduction by acting on specific target proteins. The molecular target of both cyclophilincyclosporin A and FKBP-FK506 complexes such as has been identified as the Ca+2/calmodulin dependent serine/threonine phosphatase calcineurin Liu et al, .ell 66, 807, 1991; J. Liu et al, Biochemistry 31, 3896, 1992; W.M.

Flanagan, et al., Nature 352, 803, 1992; McCaffrey et al., J. Biol. Chem. 268, 3747, 1993; McCaffrey et al., Science 262:750, 1993).

Rapamycin's antifungal and immunosuppressive activities are mediated via a complex consisting of Rapamycin, a member of the FK506 binding protein (FKBP) family and at least one additional third protein, called the target of Rapamycin (TOR). The family of FKBPs is reviewed by Armistead and Harding (Annual Reports in Med. Chem, 28:207-215:1993). The relevant FKBP molecule in Rapamycin's antifungal activity has been shown to be FKBP12 i (Heitman et al., Science 253:905-909:1993). In mammalian cells, the relevant FKBPs are being investigated. Although two TOR proteins (TOR1 and TOR2) e siop.\ Ev~ vspa«Mi73yxcc -6have been identified in yeast (Kunz et al., Cell 73:585-596:1993), the target of Rapamycin in human cells remains elusive. The carboxy terminus of yeast TOR2 has been shown to exhibit 20% identity with two proteins, the p110 subunit of phosphatidylinositol 3-kinase and VPS34, a yeast vacuolar sorting protein also shown to have PI 3K activity. However, J. Blenis et al. (AA1 meeting, May, 1993) have reported that Rapamycin-FKBP12 complex does not directly mediate its effects on PDGF stimulated cells via the p110, p85 PI 3K complex.

Throughout the description and claims of the specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps.

DESCRIPTION OF THE INVENTION S 15 In one aspect this invention provides a protein of mammalian origin i having a molecular weight of from about 50 kDa to 800 kDa which binds to a GST-FKBP-Rapamycin complex, or a fragment of such a protein.

SIn a further aspect this invention provides isolated, cloned and expressed proteins which bind to a complex of GST-FKBP12-Rapamycin (GST denotes glutathione-s-transferase). These proteins are isolated from membrane S' preparations of Molt 4 T cell leukemia. The sizes of the four novel proteins are estimated by PAGE migration to be 125±12 kilodaltons (kDa), 148+14 kDa, 208+15 kDa and 210±20 kDa and will be referred to herein and in the claims that follow, as 25 the 125 kDa, 148 kDa, 208 kDa, and 210 kDa, respectively. The four proteins may also be referred to herein as effector proteins.

The proteins of this invention can be used in screening assays, such as enzyme inhibitor assays and binding assays, to identify endogenous complexes and ligands and novel exogenous compounds (like Rapamycin) which modulate Stheir functions. They can also be used in assays to identify compounds with therapeutic benefit for C *WN\trSfD=NLrSPC,1SM Do&C _I rr__ s ,~iyt~ -7restenosis, immunomodulation and as antitumor agents. Cloning the proteins of this invention does not only allow the production of large quantities of the proteins, it also provides a basis for the development of related anti-sense therapeutics. The use of cDNA clones to generate anti-sense therapeutics with immunomodulatory activity (for use against transplantation rejection, graft versus host disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, rheumatoid arthritis, type I !i diabetes, and diseases of inflammation such as psoriasis,deaatitis, eczema,seborrhea, inflammatory bowel disease, pulmonary inflammation, asthma, and eve uveitis).

antirestenosis and anti-tumor activity is included within the scope of this invention.

The proteins of the present invention can be isolated from mammalian cells, such as cells of the T cell leukemia cell line, Molt 4 (ATCC 1582, American Type Cell Culture, 12301 Parklawn Drive, Rockville, MD, USA, 20852), the B cell lymphoma, BJAB, or normal human T cells. These mammalian cells can be ivsed in a buffer containing protease inhibitors and reducing agent such as hypotonic buffer A (100 mM HEPES, pH 7.5, 20 mM KCI, 1 mM EDTA, 0.4 mM PMSF and 2 mM beta mercaptoethanol The cell nuclei and unbroken cells are cleared by centrifugation at a temperature which minimizes protein degradation. The membrane S fraction of the cells can then be concentrated or pelleted by ultracentrifugation at 20 10 0 0 00 g. Detergent solubilization of the membrane pellet is carried out in a detergent containing buffer such as buffer B (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 1 0.2 mM-PMSF, 1 mM 2-ME, 2 mM CaCI, 2 mM MgCI 2 5 pg/ml aprotinin, leupep:ia, pepstatin A and antipain), containing CHAPSO (3-[(3-cholamidbpropyl)dimethylammonio]-L-propane sulfonate: 12 mM) or Triton X 100 (polyethylene p glycol 4 -isooctylphenyl ether). The solubilized membrane proteins can then be separated from the debris by 100.000g ultracentrifugation at a temperature which minimizes protein degradation. The supernatant containing solubilized membrane proteins is then preabsorbed with an affinity resin, such as glutathione resin, in the presence of protease inhibitors at a temperature which minimizes protein degradation..

After centrifugation to remove the resin from the supernatant, the supernatant is then incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST- FKBP12--Rapamycin at a temperature which minimizes protein degradation. The mixture of solubilized membrane proteins, incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST-FKBP12--Rapamycin can then be ~DIB I~C -8incubated with the affinity resin to bind the complexes of rapamycin or rapamycin analog, FKBP fusion protein and binding proteins at a temperature which minimizes protein degradation. After most non-specific proteins are rinsed away using a detergent containing buffer, such as Buffer C (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 0.2 mM PMSF, 1 mM 2-ME or 10 mM dithiothreitol, 0-5 mM CaCl2, 0-5 mM MgC12, 5 p.g/ml aprotinin, leupeptin, pepstatin A and antipain and 0.1% Triton X100) (Polyethylene glycol 4-isooctyl phenyl ether), the proteins are eluted from the resin under denaturing conditions, such as a buffer containing sufficient detergent to dissociate it from resin Laemli buffer with or without glycerol or dye, as described by Laemli, Nature 227:680, 1970), or non-denaturing conditions such as a buffer containing an appropriate eluting compound for the affinity column, such as mM glutathione. The proteins can then be separated by size using SDS polyacrylamide gel electrophoresis

(SDS-PAGE).

I1"" 1 5 The present invention also includes the genomic DNA sequences for the abovementioned proteins, as well as the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the abovementioned proteins. The present invention further includes the proteins of other mammalian species which are homologous or equivalent at least in function to the abovementioned proteins, as well as the DNA gene sequences for the homologous or equivalent proteins and the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the homologous or equivalent proteins.

For the purposes of this disclosure and the claims that follow, equivalents of the proteins of this invention are considered to be proteins, protein fragments and/or truncated forms with substantially similar, but not identical, amino acid sequences to the proteins mentioned above, the equivalents exhibiting rapamycin-FKBP complex binding characteristics and function similar to the proteins mentioned above.

Therefore, in this specification and the claims below, references to the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins of this invention are also to be understood to indicate and encompass homologous or equivalent proteins, as well as fragmented i and/or truncated forms with substantially similar, but not identical, amino acid sequences of the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins mentioned above.

S. -9- These proteins or protein homologues or equivalents can be generated by S|similar isolation procedures from different cell types and/or by recombinant DNA methods and may be modified by techniques including site directed mutagenesis. For example, the genes of this invention can be engineered to express one or all of the proteins as a fusion protein with the fusion partner giving an advantage in isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, FLAG etc).

Mutations or truncations which result in a soluble form can also be generated by site 1 directed mutagenesis and would give advantages in isolation.

This invention further includes oligopeptide fragments, truncated forms and Sprotein fragments that retain binding affinity yet have less than the active protein's amino acid sequences. This invention also includes monoclonal and polyclonal antibodies specific for the proteins and their uses. Such uses include methods for i screening for novel agents for immunomodulation and/or anti-tumor activity and methods of measuring the parent compound and/or metabolites in biological samples obtained from individuals taking immunosuppressive drugs. The use of the cDNA clone to generate anti-sense therapeutics (Milligan et al, J. Med. Chem. 36:1923-1936, S1993) with immunomodulatory activity (transplantation rejection, graft versus host i disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, rheumatoid arthritis, type I diabetes, and diseases of inflammmation such as psoriasis, dermatitieczema, seborrhea, inflammatory bowel disease, pulmonary inflammation, S ast t ma -and eye uveitis), and anti-tumor activity is also included in the present invention.

The proteins of this invention can also be made by recombinant DNA techniques familiar to those skilled in the art. That is, the gene of the protein in S- question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with a protease, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical I' t30 Guide to Protein and Peptide Purification for Microsequencing, Academic Press (San Diego, CA, 1989)). The determined sequence can then be used to makeoligonucleotide probes which can be used to screen a human cDNA library directly or J generate probes by polymerase chain reaction. The library can be generated from human T cells or the cell lines, Molt 4, Jurkat, or other etc. to obtain clones. These y- ,i i_ I_

S;

rr

I

I

ii t 4-i

I

clones can be used to identify additional clones containing additional sequences until the protein's full gene, i.e. complete open reading frame, is cloned.

It is known in the art that some proteins can be encoded by an open reading frame which is longer than initially predicted by the size of the protein. These proteins may represent cleavage products of the precursor protein translated from the complete open reading frame (eg. IL-1 beta) or proteins translated using a downstream start codon (eg. HepatitisB surface antigen). In view of this knowledge, it is understood that the term cDNA as used herein and in the claims below refers to cDNA for the gene's complete open reading frame or any portions thereof which may code for a protein of this invention or the protein's fragments, together or separate, or truncated forms, as previously discussed.

In a complementary strategy, the gene(s) for the proteins of this invention may be identified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning. These strategies can also be combined to quicken the identification of the clones.

The relevant cDNA clone encoding the gene for any of the four proteins can 20 also be expressed in E. coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion partner giving an advantage in isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc).

Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.

The uses of such cDNA clones include production of recombinant proteins.

Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers) are useful in generation of antibodies to these proteins. Briefly, monoclonal-or polyclonal antibodies are induced by immunization with recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers conjugated to a carrier protein keyhole limpet hemocyanin or bovine serum albumin)) of animals using state of the art techniques. The antibodies can be ik

I-

-11used in the purification process of the natural proteins isolated from mammalian cells or recombinant proteins from E. coli, yeast, or baculovirus infected cells or mammalian cells, or cell products.

5 The uses of such cDNA clones include production of recombinant proteins.

Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, are useful in methods of screening for novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates for immunomodulation and/or antitumor activity. The natural products which may be screened may include, but are not limited to, cell lysates, cell supernatants, plant extracts and the natural broths of fungi or bacteria. As an example of a competitive binding assay, one of these proteins attached to a matrix (either covalently or S" noncovalently) can be incubated with a buffer containing the compounds, natural products, cell lysates or cell supernatants and a labeled rapamycin:FKBP complex. The 15 ability of the compound, natural products, exogenous or endogenous substrates to competitively inhibit the binding of the complex or specific antibody can be assessed.

Examples of methods for labeling the complex include radiolabeling, fluorescent or chemiluminescent tags, fusion proteins with FKBP such as luciferase, and conjugation to enzymes such as horse radish peroxidase, alkaline phosphatase, acetylcholine esterase (ACHE), etc. As an example of an enzymatic assay, the proteins are incubated in the presence or absence of novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates with substrate and the enzymatic Sactivity of the protein can be assessed. Methods of measuring the parent compound and/or metabolites in biological samples obtained from individuals faking 25 immunosuppressive drugs can also be assessed using these proteins.

This invention includes a method for identifying substances which may be useful as immunomodulatory agents or anti-tumor agents, the method utilizing the .following steps: a) combining the substance to be tested with one of the four mammalian proteins (125 kDa, 148kDa, 208 kDa or 210 kDa) of this invention, with L the protein being bound to a solid support: h- 'i-i aa.-eplrrrre~-rs~l -12b) maintaining the substance to be tested and the protein bound to Sthe solid support of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether binding of the substance to be tested occurred in step This invention also includes a method for identifying substances which may be useful as immunomodulatory or anti-tumor agents which involves the following steps: a) combining a substance to be tested with one of the mammalian proteins of this invention, the protein being bound to a solid support: b) maintaining the substance to be tested and the protein bound to the solid support of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether the presence of the substance to be tested modulated the activity of the mammalian protein.

This invention further includes a method for detecting, in a biological sample, rapamycin, rapamycin analogs or rapamycin metabolites which, when complexed with a FKBP, bind to one of the four listed proteins of this invention, the methbd comprising the steps of: 7 j a) combining the biological sample with a FKBP to form a first mixture containing, if rapamycin, rapamycin analogs or rapamycin metabolites are Spresent in the biological sample, a rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes; b) creating a second mixture by adding the first mixture to one of the proteins of this invention, the protein bound to a solid support; ¢f -13c) maintaining the second mixture of step under conditions appropriate for binding the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes, if present, to the protein of this invention; and d) determining whether binding of the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes and the protein occurred in step Also included in this invention is the use of the cDNA clones to generate antisense therapeutics. This can be accomplished by using state of the art techniques, such I as those described in Milligan et al, J. Med. Chem. 36:14:1924-1936. For the purposes of this disclosure and the claims that follow, antisense RNA and DNA are understood to include those RNA and DNA strands derived from a cDNA clone which encodes for one of the four proteins (125 kDa, 148 kDa, 208 kDa or 210 kDa) of the present invention which have a native backbone or those which utilize a modified A backbone. Such modifications of the RNA and DNA backbones are described in SMilligan et al, J. Med. Chem. 36:14:1924-1936. The antisense compounds created by the state of the art techniques recently described (Milligan et al, J. Med. Chem.

36:14:1924-1936) can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as luptis, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis. The antisense molecules of this invention can have antitumor, antifungal activities, and antiproliferative activities. The compounds of this invention therefore can be also useful in treating solid tumors, adult T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases such as restenosis and atherosclerosis. Thus, the present invention also comprises methods for treating the abovementioned maladies and conditions in mammals, preferably in humans. The method comprises administering to a mammal in need i thereof an effective amount of the relevant antisense therapeutic agent of this invention.

7 -14- When administered for the treatment or inhibition of the above disease states, the antisense molecules of this invention can be administered to a mammal orally, parenterally, intranasally, intrabronchially, transdermally, topically, intravaginally, or rectally.

It is contemplated that when the antisense molecules of this invention are used as an immunosuppressive or antiinflammatory agent, they can be administered in conjunction with one or more other immunoregulatory agents. Such other immunoregulatory agents include, but are not limited to azathioprine, corticosteroids, such as prednisone and methylprednisolone, cyclophosphamide, rapamycin, S cyclosporin A, FK-506, OKT-3, and ATG. By combining the complexes of this invention with such other drugs or agents for inducing immunosuppression or treating inflammatory conditions, the lesser amounts of each of the agents are required to achieve the desired effect. The basis for such combination therapy was established by 3 .15 Stepkowski whose results showed that the use of a combination of rapamycin and cyclosporin A at subtherapeutic doses significantly prolonged heart allograft survival :l time. [Transplantation Proc. 23: 507 (1991)].

Treatment with these antisense compounds will generally be initiated with small S 20 dosages less than the optimum dose of the compound. Thereafter the dosage is increased until the optin.mm effect under the circumstances is reached. Precise dosages 4, will be determined by the administering physician based on experience with the individual subject treated. In general, the antisense compounds of this invention are most desirably administered at a concentration that will afford effective results without causing any harmful or deleterious side effects.

In.light of the therapeutic value of the abovementioned antisense compounds, this invention also includes pharmaceutical compositions containing the antisense RNA and antisense DNA compounds derived from r.DNA clones which encode for the 125 kDa, 148 kDa, 208 kDa and 210 kDa proteins of this invention.

f, This invention also comprises the following process for isolating the proteins of i this invention, as well as the proteins isolated therefrom: 1| A process for isolating proteins from mammalian cells, the process comprising the steps of: 1. The mammalian cells of interest are grown and harvested. As mentioned previously, the cells may be of T cell origin T cell lymphomas, leukemias, normal human T cells), B cell origin EBV transformed B cells, normal human B cells), mast cells, or other cell sources sensitive to rapamycin. The cells may be processed shortly after harvesting or may be stored frozen, such as in pellets, prior to processing. The cells which are kept frozen may be stored in a dry ice and ethanol bath, stored frozen at -70-80* C until use. This step of growing and harvesting the cells of interest may be seen as the first step of this process or as merely preparatory for the present process.

2. Cells are lysed in a buffer containing a buffering agent (e.g.HEPES, Tris, pH low salt (e.g.10 -50 mM NaCI or KC1), chelating agent 1-2 mM EDTA), protease inhibitors (e.g.0.

4 mM PMSF) and a reducing agent 2 mM 2-ME or 1-20 mM Dithiothreitol) at a temperature which minimizes protein S: degradation 4 It should be understood that the mammalian cells may be treated in any manner capable of producing cell lysis, including sonic lysis and douncing.

3. Unbroken cells and cell nuclei are precleared from lysates by centrifugation at a temperature which minimizes protein degradation 4 Centrifugation at, for example, 1600g for 10 minutes has been found sufficient to preclear the unbroken cells and cell nuclei from the lysates. This step, while not mandatory, provides a clearer preparation for the steps that follow.

4. The membrane fraction in the precleared lysate is then concentrated, such as by ultracentrifugation. An example of this concentration would be ultracentrifugation at 100,000 g for 1-1.5 hours.

The membrane proteins transmembrane, integral and membrane associated proteins) are then solubilized. This may be accomplished by incubating the pellet of Step 4 in a buffer containing a detergent which solubilizes the

I-

1: i S 2 14 -16proteins without detrimentally denaturing them, a buffering agent 20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI 20 mM KCI), reducing agent 1-2 mM 2-ME or 1 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 .g/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations 0- 5 mM CaCI 2 0-5 mM MgCI 2 at a temperature which minimizes protein degradation 4' C) Examples of detergents useful in this step are CHAPSO cholamidopropyl)dimethylammonio]-l-propane sulfonate) or Triton X100 (polyethylene glycol 4-isooctylphenyl ether). After this step, the mixture contains solubilized membrane proteins and non-solubilized cellular debris.

S 6. The solubilized membrane proteins are separated from the nonsolubilized cellular debris, such as by ultracentrifugation (eg 100,000g for 1-1.5 hours) at a temperature which minimizes protein degradation 4 15 7. The supernatant containing solubilized membrane proteins is incubated with an affinity resin in a buffer containing a buffering agent (e.g.20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI 20 mM KCI), reducing agent 1-2 mM 2-ME or 10 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 pg/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations i 'i 20 0-5 mM CaCI 2 0-5 mM MgCI 2 at a temperature and time which allows the i absorption of the proteins which bind to affinity resin directly, and minimizes protein -I degradation 4 8. The resin is then removed from the superatant by centrifuigation at a temperature which minimizes protein degradation 4 9. The supernatant is then incubated with Rapamycin or Rapamycin analog (IC50 in LAF 500nM) complexed to fusion protein of FKBP12 +protein which enhances the isolation of the desired effector protein and through which the 7- 30 fusion protein binds to an affinity resin or affinity column, such as GST-FKBP12, ~Histidine oligomer -FKBP12, biotin-FKBPl2, etc., in a buffer containing a buffering agent 20-50 mM Tris or HEPES, pH salt 100 200 mM NaCI mM KCI), reducing agent 1-2 mM 2-ME or 1 20 mM dithiothreitol), protease L i inhibitors 0.2 mM PMSF, 5 Ig/ml aprotinin, leupeptin, pepstatin A and antipain), -17divalent cations 0-5 mM CaCI2, 0-5 mM MgCl2) at a temperature and for a time which allows binding of the effector proteins to the fusion FKBP protein:Rapamycin or analog complexes and minimizes protein degradation 4 *C and 1-2 hours).

10. The mixture of Step 9 containing the effector proteins and fusion FKBP protein:Rapamycin complexes is incubated with an affinity resin at a temperature and for a time which allows binding of the complexes of the effector proteins and fusion FKBP protein:Rapamycin or analog to the affinity resin and minimizes protein degradation 4 *C and 0.5-2 hours).

11. Most non-specific proteins are rinsed away from the resin using a buffer which dissociates binding of non-specific proteins but not the complex between the desired proteins and RAPA-FKBP, such as a buffer containing a buffering agent (e.g.20-50 mM Tris or HEPES, pH salts 100 1000 mM NaC1, KC1), [15 reducing agent 1-2 mM 2-ME or 10 20 mM dithiothreitol), protease inhibitors 0.2 mM PMSF, 5 gg/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations 0-5 mM CaCl2, 0-5 mM MgCI2) and detergent which dissociates binding of non-specific proteins but not the complex between the four proteins and RAPAfusion FKBP protein such as Triton Xl00 (Polyethylene glycol 4-isooctyl phenyl 20 ether).

12. The effector proteins and the fusion FKBP protein:Rapamycin complexes are eluted from the resin using an appropriate buffer, such as a buffer Si containing sufficient detergent to dissociate it from resin Laemli buffer With or without glycerol or dye, Laemli, Nature 227:680, 1970), or an appropriate eluting compound for the affinity column, such as glutathione, histidine.

i 13. The effector proteins can then be separated by size. This may be accomplished in any manner which separates the proteins by size, including, but not 30 limited to, polyacrylamide gel electrophoresis and size exclusion column chromatography.

It might also be useful to compare the proteins isolated by a control procedure, that is a procedure which substitutes buffer for the rapamycin or rapamycin analog with Be-iin iiii~iii IiiBn~ jiiinjrnjimia n- -18an IC50 in LAF 500 nM in step 8, can be used to more easily distinguish proteins which bind to the rapamycin:FKBP complex.

The proteins of this invention can also be made by recombinant DNA techniques familiar to those skilled in the art. That is, the gene of the protein in question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with an appropriate endopeptidase, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical Guide to Protein and Peptide Purification for Microsequencing, Academic Press, San Diego, CA 1989). The determined sequence can then be used to make oligonucleotide probes which can be used to screen a human cDNA library, such as those for human T cells, Molt 4, Jurkat, etc, to obtain clones.(Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989) These clones can be used to identify additional clones containing additional sequences until the protein's full gene is cloned (Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold SSpring Harbor Press, 1989). In a complementary strategy, the gene(s) may be Sidentified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning (Chien et al., Proc. Natl. Acad. Sci. 88: 9578-9582, 1991). These strategies can also be combined to quicken the identification of the clones.

The relevant cDNA clone can also be expressed in E.coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion partner giving an advantage in isolation HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc). Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.

Homologs in the mouse, rat, monkey, dog and other mammalian species can be fi 30 obtained using similar procedures. In addition, upon isolation of the human clone of zthe proteins, the clone can be used to screen for homologs in other mammalian species.

These homologs can also be used to develop binding assays and to set up high through put screening assays for compounds, endogenous ligands, exogenous ligands with P gimmunomodulatory activity. -19- Compounds, endogenous ligands and exogenous ligands having such immunomodulatory activity would can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as lupus, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis.

The compounds, endogenous ligands and exogenous ligands mentioned above can also have antitumor, antifungal activities, and antiproliferative activities. The S' compounds of this invention therefore can be also useful in treating solid tumors, adult T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases III. 15 such as restenosis and atherosclerosis.

-F

F

f liZ a

~I

si ;'rj ~ai 3-; d

I

E

i 6f .i EXAMPLE 1 The proteins of the present invention were isolated utilizing a fusion protein of glutathione S-transferase--FK506 binding proteinl2 (GST-FKBP). GST-FKBP is produced by a recombinant E. coli containing the plasmid, pGEX-FKBP. The cells were grown, induced with IPTG and the fusion protein was isolated using standard technology described in D.B. Smith and K.S. Johnson, Gene 67, 31, 1988 and K.L.

Guan and J.E. Dixon, Anal. Biochem. 192, 262, 1991. The solution containing glutathione and GST-FKBPI2 was exchanged 5x using a Centricon 10 filtration unit (Amicon) to remove the glutathione and exchange the buffer.

Molt 4 cells (lx 09) were grown in standard media (RPMI 1640 containing 100 U/ml pennicillin, 100 ug/ml L-glutamine, 10% FCS). The cells were harvested and 30 rinsed 3x with PBS (50mM phosphate buffer, pH 7.0, 150 mM NaCI), flash frozen in dry-ice ethanol bath and stored at -80'C. On ice, the cells were thawed and lysed using a dounce homogenizer with B pestle in 5 ml of buffer A (10 mM Hepes, pH 7.5, 20 mM KCI, 1 mM EDTA, 0.4 mM PMSF and 2 mM 2-ME). After the debris was cleared by centrifugation at 1600g for 10 min. and the membrane fraction was I -i

I

;i- :r~ b C -~-ri concentrated by 100,000g centrifugation (1 hour), the 100,000 g pellet was incubated in 3 ml buffer B (50 mM Tris, pH 7.2, 100 mM NaCI, 20 mM KCI, 0.2 mM PMSF, 1 mM 2-ME, 2 mM CaCl2, 2 mM MgCI2, 5 pg/ml aprotinin, leupeptin, pepstatin A and antipain), containing 12 mM CHAPSO for two hours at 4°C. The solubilized membrane proteins were separated from the debris by a 100,000 g centrifugation. After preabsorption of the supernatant for 3-18 hours with 0.4 ml glutathione sepharose resin swollen in buffer B, the supernatant was incubated with complexed Rapamycin-GST-FKBP12 (preformed by incubation of 660 ug GST- FKBP 60 ug RAPA in buffer B for 1-2 hours, 4°C) for two hours at 4°C. The supernatant was then incubated for 2 hours at 4°C with 100 ul glutathione resin (1:1 Buffer Nonspecific proteins were rinsed 5x with buffer C (buffer B 0.1% Triton x 100) and the proteins eluted from the resin in Laemli buffer by incubation at for 3 minutes and microcentrifugation. The proteins were separated by size using a 7% SDS-PAGE followed by silver stain. Four bands corresponding to proteins of molecular weights of 210kDa, 208 kDa, 148 kDa, and 125 kDa were present in higher concentrations in the sample containing RAPA GST-FKBP12 vs GST- FKBP alone.

The mitogen-stimulated thymocyte proliferation assay called the LAF (Lymphocyte Activation Factor assay, also known as the comotigen-induced lymphocyte proliferation procedure), can be inhibited by rapamycin or analogs such as demethoxyrapamycin and indicates relative activity of rapamycin analogs in immunosuppression. The same proteins were isolated using GST-FKBP complexed with the immunosuppressive analog, demethoxyrapamycin (Table 1).

The Diels Alder adducts bound to FKBP12 and inhibited PPlase activity of FKBP12 but did not exhibit detectable immunosuppressive activity and thus do not bind to the target of rapamycin. The use of these two compounds complexed with GST- FKBP12 in the analogous isolation procedure (ie. replacing rapamycin:GST- FKBP12) yielded background levels of the 210kDa proteins (no rapamycin)(Table FK506, is an immunosuppressive compound which binds to FKBP and mediates at least some of its effects through the binding of the FK506-FKBP complex with calcineurin. FK506 when complexed with GST-FKBP in an analogous procedure yielded only background levels of the 210 kDa protein (Table 1).

iI

I

4 7s

I'

i.

1.~ .I

I~

ft ~C ~ti~Bwraa~-aer ~u i:

.I'K

I

-21- TABLE I Comparison of Bindin2 of Rallamycin Analog--FKBP12 comni)exes to 210 kDa Protein Crimnound 10 kfbi r AF 2 10 kDa

LAF

t0

'A'

RAPA

demethoxyrapamnycin 6 nIN1 5811M 1000aiM >1000WM 3n1N4 0.12niM 4.4 nM 12 nMI 12 nM 0.4 nM Diels Alder adduct (phenyl) Diels Alder adduct (methyl) FK506 none (FKBP) (mechanism of action is different) It is known that rapamycin must bind to a member of the FKBP family in order to mediate its effects. To verify that the~ proteins of this inven tion bind to the complex RAPA-GST-FKBP and not individually to rapamycin or FKBP12, a modified isolation procedure was employed. The modification consists of using a rapamycin-42biotin glycinate ester in place of rapamycin (both exhibit equivalent immunosuppressive activity in the LAF assay), no exogenous FKBP and a strepatavidin-conjugated resi in placeb ctathione-resin. Only background levels of the 210 kDa protein was soedusing- hxs modifie.. isolation procedure.

The- 21 ;K a protein. Was is lated using the GST--FKBP12--rapamycin cornplev~frorn BJAB'cells(B cell -lympihoma) and normal human T lymphocytes ipurified by.Ficoll-Hpaue and T c.ell columns.

The results of the partial -amino acid composition analysis are set forth in Table -2.bWelfw. It should be -noted- that the percentage of the basic amino acids was not dete-----edw -22- TABLE 2 Peak Component Number Name Retention Peak Response Time Area Factor Peak Concentration Heicht Nn PiflI I 2 Asp/Asn Thr Ser

"Z

3, 4 Glu/Gln Prp 5 Gly 6 Ala 20 7 Val Niel 8 le 9 Leu nLeu 9.38 11.09 12.06 12.47076 0.02344 0.05 142 13.05 2.92898 0.00000 0.00985 13.78 6.43968 0.00000 0.01995 15.68 16.87 25.47273 0.00000 0.05285 18.24 22.35 21-50384 0.00000 0.04645 22.90 23.73 16.69160 0.00000 0.03113 26.06 2)8.81 29.39 4.83 196 0.00000 0.00605, 32.28 34.10 3.00560 0.2326 0.00782 35.09 5.73202 0.0233 1 0.01372 36.27 20.48232 0.02 174 0.04286 0.30 0.068 0.15 0.59 0.14 0.44 0.36 0.11 0.0699 0. 1383 0.4453 4 1ii ASbSSKS

RS^

-23- TABLE 2 (Cont'd) Peak Component Retention Peak Number Name Time Area Response Peak Concentration FPn.tnr HP-i ht Nn 1nfliil

L;

-1 ;i i:i

D

i g 1 i i 'h i z i :3 -r F rlsr

S

i~n

PB

i:

S

11 Tyr 38.33 1.44792 0.02618 0.00226 0.0379 12 Phe 40.05 1.25017 0.02703 0.00187 0.0338 13 His 47.79 1.50905 0.02553 0.00580 0.0385 14 51.80 12.66136 0.00000 0.01960 0.0000 Lys 53.34 9.90767 0.02283 0.02274 0.2262 Totals 146.53645 0.33436 15 Not Determined 144.29 EXAMPLE 2 The 210 kDa (210±20 kDa) protein of this invention was isolated from 4 x 20 1011 Molt 4 cells using the affinity matrix protocol as described previously. Bound proteins were eluted from the affinity matrix with lx Laemli buffer without glycerol and dye (0.0625 M Tris-HCl, ph6.8, 2% SDS, 0.37M b-mercaptoethanol) and were concentrated 3 consecutive times by centrifugation using centricon 100 (Amicon, Beverly, MA) at 4 'C the first two times and at 18 "C the third time. The concentrated 25 sample was eluted from the centricon 100 filter by incubating 2 hours at room temperature with an equal volume of 2 x laemli buffer without glycerol and dye the first 2 x and 2 x laemli buffer the third time. The proteins in the sample were separated by PAGE on a 1.5mm thick 7% polyacrylamide gel The proteins were transferred to polyvinylidine difluoride, PVDF, (Biorad, Hercules, CA) in 10 x Tris/glycine buffer 30 (Biorad) containing 0.037% SDS at 50 mAmps at 4 "C overnight. The proteins on the PVDF were stained with amido black (Biorad) in 10% ethanol, 2% acetic acid and the appropriate band was excised, rinsed with PBS and water and stored frozen.

i .ii !r 1., :1~ :j~~i -24- Sequencing The protein (approx. 3 ug) on the PVDF membrane was digested in situ with trypsin using a modification described by J. Fernandez et al, (Anal.Biochem. 201: 255- 64, 1992 Briefly, the PVDF was cut into 1 mm 2 pieces, prewet, and the protein digested in a 100rmM Tris-HC1, pH buffer containing 10% acetonitrile, and 1% reduced triton (CalBiochem) with 0.2ug trypsin at 37 "C for 6 hours followed by addition of 0.2 ug trypsin and incubation overnight. The fragments were eluted from the membrane by sonication and the buffer containing the fragments were separated by microfuge centifugation. The membranes were backextracted 2x 50 ul buffer was added to membranes, sonicated, and centrifuged in a microfuge and solution pooled with the original buffer containing the eluted fragments.) The sample (140-145 ul) was separated by narrow bore high performance liquid chromatography using a Vydac C18 2.1mm x 150 mm reverse phase column on a Hewlett Packard HPLC 1090 with a 40 diode array detector as described previously by W.Lane et al, (J.Protein Chem., 10(2): 151-60, 1991). Multiple fractions were collected and measured for absorption at multiple wavelengths (210, 277 and 292 nm). Optimal fractions were chosen for i sequencing based on resolution, symmetry, and ultraviolet absorption and spectra (210 nm, 277 nm and 292 An aliquot of the optimal fractions was analyzed for homogeneity and length of fragment by matrix assisted laser desorption time of flight mass spectrometry, MALDE-TOF-MS, on a Finnigan lasermat. Selected optimal fractions.were sequenced by automated Edman degradation on an Applied Biosystems 477A protein sequencer using microcartridge and manufacturer's recommended chemistry cycle.

Seauence comparison Comparison was performed using the Intelligenetics suite (Intelligenetics, CA).

Sequences Utilizing the methods mentioned above, it was determined that the 210 kDa i 35 (210±20 kDa) protein of this invention contains peptide fragments, four of which have .amino acid sequences as shown below: F k -v a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K) Those skilled in the art will recognize the one-letter symbols for the amino acids in question (the definitions for which can also be seen at page 21 of the text Biochemistry, Third Edition, W.H. Freeman and Company, 1988 by Lubert Stryer).

Those so skilled will also understand that the X in sequence c) indicates an as yet unidentified amino acid and the parentheses in sequence d) indicates that the amino acid in the position in question is possibly lysine.

As mentioned previously, the present invention includes fragmented or truncated forms of the proteins mentioned herein. This includes proteins which have as part or all of their amino acid sequence one or more of the four sequences listed as a)above. For the purposes of the claims, below, the proteins referred to as including one or more of the "internal amino acid sequences" are understood to be any protein which contains one of the sequences listed above, whether the protein is comprised wholly of one or more of the sequences or whether one or more of the sequences mentioned above form any portion of the protein. This is understood to include all U locations on the protein's amino acid sequence including, but not limited to, those sections of the protein which initiate and terminate the protein's amino acid chain.

4 These partial amino acid sequences were compared with sequences in the Genbank database. There was identity with the sequence, accession number L34075 (Brown et al., Nature 369, 756-758 (1994)). The cDNA of the SEP gene was cloned as follows: Two micrograms of Molt 4 cDNA (Clontech, Palo Alto,CA) in 1 x PCR Sbuffer (10 mM Tris-HCI, pH 8.3, 50 mM KCI, 1 mM MgCl, 200 .M dATP, 200 p.M dTTP, 200 gM dCTP, 200 pM dGTP; Perkin Elmer,) with 1 unit Taq polymerase :i (Perkin Elmer),was amplified by Polymerase chain reaction (PCR) at 94 C for 30 sec., 1:3| 66C for 4 min for 30 cycles, 72 C for 10 min by three separate reactions containing one of the following pairs of oligomers: p| -26- CGATCGGTCGACTGCAGCACrIGGGGAf-rGTGCTCTC and GCGGCCGCAGCTITC1TCATGCATGACAACAGCCCAGGC or GCGGCCGCAAGC'ITCAAGTATGCAAGCCTGTGCGGCAAGA and CGATCGGTCGACACCflTCfGCATCAGAGTCAAGTGGTCA; or GCGGCCGCAAGCTTCCTCAGCTCACATCCTTAGAGCrGCA and CGATCGGTCGAC1TATTACCAGAAAGGGCACCAGCCAATATA.

The oligonucleotides were synthesized and isolated by methods previously described and known in the art (Chemical and Enzymatic Synthesis of Gene Fragments, ed. by H.G.Gassin and Anne-Lang, Verlag Chemie, FLA, 1982). The resulting PCR products named SEP3, SEP4, and SEP5, respectively, were incubated at 15 C overnight in buffer containing T4 DNA ligase (1 unit) and 50 ng pcII which was modified to efficiently ligate PCR products (TA cloning kit, Invitrogen, San Diego, CA) to yield PCR-pcL[ ligated products. The PCR-pcII products were transformed into competent E. coli INVaiphaF cells obtained commercially from Invitrogen. Mniprep DNA was prepared using the Quiagen miniprep kits (Quiagen, Chatsworth, CA) and the clones containing the appropriate sized PCR product were identified by restriction enzyme digestion with commercially available HindmH or Sal 1, electrophoresis, and comparison to standards. Sep2 and Sep I cDNA was made using TimeSaver cDNA synthesis Kit (Pharm acia, Piscataway, NJ) with the first strand synthesis reaction containing oligodT 13 jig) and 250 pmoles of CGATCGGTCGACCAG-ATGAGCACATCATAGCGGTGATGA or

CGATCGGTCGACATCAAAGCTGCCAAGCGTCGGAG,

respectively. Sep2 and Sept second strand synthesis was performed using the TimeSaver cDNA synthesis kit with the addition 'of 250 pmioles of GCGGCCGCAAG=T1GGCCGAGCAATGGGGCCAGGCA or GCGGccGCAAGCITAAGATGG'rrGGAACCGCACCTGCCG, respectively. The Sep2 and Sept cDNA was then amnplified by PCR using -27- CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA and GCGGCCGCAAGCITGGCTCGAGCAATGGGGCCAGGCA or GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG and

CGATCGGTCGACAAAITCAAAGCTGCCAAGCGTTCGGAG,

respectively as described above. The Sep2 PCR products were cloned into pll using the TA cloning kit (Invitrogen). The Sep 1 PCR products were digested with Hind m and Sal I, separated from the pcII vector by agarose electrophoresis. The Sepl 1 (Hindll-Sall) fragment was isolated using the Sephaglas bandprep kit from Pharmacia and cloned into the HindII and Sal I sites of pUC 19 as described (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). Ligation of the isolated Sep2(HindIH, AspI) and Sep3(AspI, Sall) fragments or Sep4(HindIII, AccIII/MroI) and Sal I) fragments into pUC18(HindIII, Sail) vector and transformation of competent E. coli INValphaF cells (Invitrogen) was performed by techniques known to those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain pUC18-Sep 23 and pUC18-Sep45 which contain nucleotides 1468- 5326 and 4964 7653, respectively, of the full length clone shown 4 in the attached Sequence No. 1. Ligation of the pUC19-Sepl (EcoRV, Sail), Sep23 (EcoRV, BstEII) and Sep45 (BstEII, Sal) fragments and transformation of competent E. coli INValphaF cells (Invitrogen) can be performed by techniques known to those skilled in the art (as described by Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain the full length clone. The nucleic acid sequence coding for this protein is shown in Sequence No. 1.

A fusion protein, called glutathione S transferase-sirolimus effector protein, GST-SEP, was engineered by subcloning the Sep4 and SepS fragments into the plasmid, pGEX-KG (Guan, K. and Dixon, J.E. (1991) Anal. Biochem. 192, 262-267) as follows. Briefly, Sep4 was digested with commercially available HindII restriction enzyme, the restriction site was filled in with the Klenow fragment of DNA polymerase (Gibco), and the DNA was extracted with phenol-chloroform and ethanol precipitated using techniques known by those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). The SEP4 (HindII-Klenow) was further digested with Mrol restriction enzyme, separated from the pcll vector by agarose electrophoresis and isolated as the fragment SEP4-HindIl-Kienow-MroI. Sep5 fragment was prepared by [i -28digestion with Sall and Mrol, separated from the pcII vector by agarose electrophoresis and isolated as the fragment SEP5-SalI-MroI. pGEX-KG (Guan, K. and Dixon, J.E.

(1991) Anal. Biochem. 192, 262-267) was digested with Nco I, filled in with the Klenow fragment of DNA polymerase and the DNA was extracted with phenolchloroform and ethanol precipitated, using techniques of those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). pGEX-KG (NcoI, Klenow) was further digested with Sal I, separated from the undigested vector by agarose electrophoresis and isolated as the vector pGEX-KG-NcoI-Klenow-SalI, using Jtechniques of those skilled in the art. Ligation of the vector, pGEX-KG-NcoI-Klenow- Sall and Sep 4 (HindmI, Mrol) and Sep5 (MroI, Sall) fragments and transformation into E. coli strain INValphaF cells (Invitrogen) using techniques of those skilled in. the art yielded the plasmid, pGEX-Sep45. The DNA and protein sequence of this fusion q protein is shown in Sequence No. 2.

S 15 Flag sequences can be added at the amino terminal end, within SEP or at the carboxy terminus of SEP, SEP4,5 or other fragments using an oligonucleotide which includes the coding sequence for Asp Tyr Lys Asp Asp Asp Asp Lys. The fusion protein can be isolated by affinity chromatography with anti-flag specific antibodies using the commercially available kits from IBI, New Haven, Conn.

Transformed host cells containing the pUC19-Sepl (EcoRV, SalI), Sep23 (EcoRV, BstEII) and Sep45 (BstEII, Sall) fragments as shown in Sequence No. 1 were deposited with the American Type Culture Collection (ATCC) 12301 Parklawn-Drive, Rockville, Maryland 20852, USA, on 2 March 1995 and were assigned the following accession numbers: 0.

Vh ;i 7:i

I

Sample (all in INV alpha F) puci 8-Sep 23 pucl 8-Sep 45 pGEX-Sep 45 puc-1 9-Sep I ATCC Accession Number 69753 69754 69755 69756

I,

J.

EXAMPLE 3 The 210 kDa protein of this invention was also isolated by the techniques described in Example 1 utilizing the following rapamyciri analogs: a) 42-Deoxy-42-[1-( 1 -dimethylethoxy)-2-oxoethoxy] rapamycin (which is described in U.S. Patent. No. 5,233,036); b) ,1-Dimethylethyl)dimethylsilylDI rapamycin (described in U.S. Patent. No- 5,120,842); c) Rapamycin 42-ester -with N-El A -dimethylethoxy)carborIylI-Nmethyiglycine (described in U.S. Patent. No. 5,130,307); d) Rapamycin 42-ester with 5-(1 1 -dimethylethoxy)-2-[[IX, 1 acid ethyl acetate solvate three 20 quarter hydrate (see U.S. Patent. No. 5,130,307); e) Rapamycin 42-ester with ,1dimethylethoxy)c-arbonyl]lycylglycine hydrate (see U Pat,-ni. No.

5,130,307); and f) Rapamycin 42-ester with N2, N6-bis[(l,1dimethylethoxy)carbolyl]-L-lysifle (see U.S. Patent. No. 5,130,307).

C ,AMA0RM-7an"- A16MM

I

1 j~~ 1w

I.

SEQUENCE ISTING GENERAL INFORMATION: INVENTORS: Molnar-Kimber, Katherine L.

Failli,Amedeo F.

Caggiano,Thomas J.

Nakanishi, Koji Chen, Yanqiu TITLE OF INVENTION: Effector Proteins of Raparnycin (iii) NUMBER OF SEQUENCES: 2 COMPUTER READABLE FORM: MEDIUM TYPE: Diskette, 3.50 inch, 1.4 Mb storage COMPUTER: Apple Macintosh OPERATING SYSTEM: Macintosh 7.1 C(D) SOFTWARE: Microsoft Word CURRENT APPLICATION DATA: APPLICATION NUMBER: 4(B) FILING DATE:

CLASSIFICATION:

(vii) PRIOR APPLICATION DATA: APPLICATION NUMBER: US 08/312,023 FILING DATE: 26-SEPTEMBER-1994 APPLICATION NO: US 08/207,975 FILING DATE: 08-MRH19

NMI

-31-

N!,

INFORMATION FOR SEQ. ID NO: 1: SEQUENCE

CHAPRACTERISTICS:

LENGTH: amino acids TYPE: nucleic acid STRAN1DEONESS: sense orientation of the double-stranded DNA strana TOPOLOGY:- linear (ii) MOLECULE TYPE: sense orientati.on of doublestranded cDNA to mRNA (iii) HYPOTHETICAL: no (iv) ANTISENSE: no (vi) ORIGINAL

SOURCE:

ORGANISM: Molt 4 human T-cell leukemia tells ?0 STRAIN: ATCC Strain CRL 1582 (xi) SEQUENCE DESCRIPTION: SEQ. ID NO: I.

ANG ATG CTT GGA ACC GGA CCT GCC GCC GCC ACC ACC GCT GCC ACC ACA TCT AGC 2527 54 Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser Ser 1 5 10 AP.T GTG AGC GTC CTG CAG CAG TTT GCC AGT OGC CTA AAO AGC CGG AAT GAG GAA 81 108 Asn Val Ser Val Leu Gin Gin Phe Ala Ser Gly Leu Lys Ser Arg Asn Glu. Glu 25 30 AC .C AGG 0CC AAA GCC GCC AAG GAG CTC CAG CAC TAT GTC ACC ATO GAA CTC CGA 135 162 Thr Arg Ala Lys Ala Ala Lys Gin Len Gin His Tyir Val Thr MET Glu Leu-Arg 40 45 GAG ATO AGT CAA GAG GAG TCT ACT CGC TTC TAT GAC CAA CTG AAC CAT CAC ATT 189 216 Gin MET Ser Gin Glu Giu Ser Thr Arg Phe Tyr Asp Gin Len Asn His His Ile EQ06 TTT GAA 'TO GTT TCC AGC TCA OAT 0CC AAT GAG AGO AAA GGT GGC ATC TTO 0CC 243 270 Phe Giu Leu Val Ser Ser Ser Asp Ala Asn Glu Arg Lys Gly GlyIle Len Ala 75 80 ATA GCT AOC CTC ATA GGA GTG GAA GOT GGG AAT GCC ACC CGA ATT GOC AGA TTT 297 324 Ile Ala Ser Leu Ile Gly Val Giu Gly Gly Asn Ala Thr Arg Ile Oly Arg Phe 95 100 105 owl -32- CCC .ACTATCTT CGG AAC CTC CTC CCC 'ICC AAT CACCC

TGCATGAAG

351 3*78 Ala Asn Tyr Leu Arg Asn Leu Leu Pro Ser Asn Asp Pro Val Val MET Glu MET 110 115 120 125 GCA TCC AAG GCC ATT GGC CGT CTT CCC ATG GCA GGG GAC ACT TTT ACC GCT GAG 405 432 Ala Ser Lys Ala Ile Gly Arg Leu Ala MET Ala Gly Aso Thr Phe Thr Ala Glu 130 135 140 TAC GTG GAAk TTT GAG GTG AAG CGA GCC CTG GAA 'EGG CTG GGT GCT GAC CGC AAT 459 486 Tyr Val Giu'Phe Glu Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg Asa 145 150 155 160 GAG GGC CGG AGA CAT GCA GCT GTC CTG GTT CTC CGT GAG CTG GCC ATC AGC GTC 51354 Glu Gly Arg Arg His Ala Ala Val Leu Val. Leu Arg Glu Leu Ala Ie Ser Val 165 170 175 CCT ACC 'ETC 'TC TIC CAG CAA GTG CAA CCC 'ETC TTT GAC AAC ATT TTT GTG GEE 567 594 Pro Thr Phe Phe ?he Gin Gin Val Gln Pro -Phe Phe Asp Asn Ie Phe Val Ala 10185 190 195 G-TG 'EGG GAC CCC AAA CAG GCC ATE CGT GAG GGA GCT GT& GEE GCC CTT CGT GC A621 648 Val Trp Asp Pro Lys Gin Ala Ile Arg Glu Gly Ala Val Ala Ala Leu Arg Ala 200 205 210 215 TGT CTC ATT CTC ACA ACC CAG CGT GAG CCC AAG GAG ATG CAG AAG CET CAG TGG 675 702 Cys Leu Ile Leu Thr Thr Gin Arg Glu Pro Lys Glu MET Gin Lys Pro Gin Trp 220 225 230 TAC AGG CAC ACA TTT GAFA GAAz GCA GAG AAG GGA TTT CAT GAG ACC TTG GEE AAAk 729 -756 Tyr Arg His Thr ?he Glu Giu Ala Glu Lys Gly Phe Asp Glu Thr Leu Al& Lys A *."235 240 245 250 GAG NAG GCC ATG AAT EGG CAT GAT CCC ATC CAT GGA CCC TTG TTC ATC CTT AAC 783 810 -Glu Lys Gly MET Asn Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn 255 260 265 GAG CTC GTC CGA ATC AGE AGE ATG GAG GGA GAG CCT CTC AGA GAA GAA ATO GAA 837 864 Glu Leu Val Arg Ile Ser Ser MET Glu Gly Giu Arg Leu Arg Glu Glu MET Glu 270 275 280 285r GAA ATC ACA CAG CAG CAG ETC GTA CAC GAC AAG TAC TGC AAA GAT CTC ATG GC 891 918 Glu Ile Thr Gin Gin Gin Leu Val His Asp Lys Tyr Cys Lys Asp Leu MET Gly 290 25300 305 295 -33- TTC C-GA ACA AAA CCT GT CAC ATT ACC CCC TTC ACC AGT TTC GAG GC~T C-TA CAG 945 9 97 2 Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe ThrSer Phe Gin Ala Val. Gin 310 315 320 CCC CAG CAG TCA AAT C-CC TTG C-TG GGG CTG CTG GGG TAG AC-C TCT CAC CAA GGC 999 1012 6 Pro Gin Gin Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr Ser Ser His Gin Gly 325 330 335 340 CTC ATG C-CA TTT GGG ACC TCC CCC AGT CCA C-CT AAG TCC ACC CTG GTG GAG AGC 1053 1080 Leu MET Gly Phe Gly Thr Ser Pro Ser Pro Ala Lys Ser Thr Leu Val C-lu Ser 345 350 355 CGG TGT TGC AGA GAC TTG ATG GAG GAG AAA TTT G-AT CAG GTG TGC GAG TGG C-TG 1107 1134 Arg Gys Gys Arg Asp Leu MET Glu Glu Lys Phe Asp Gin Val Cys Gin Trp Val 30365 370 375 CTG AS~k TGC ACG -X-AT AC-C kADG AAC TCGC- TG ATC CAA ATG ACA ATC CTT AAT TTC- 1161 1188 Leu Lys Cys Arg Asn Ser Lye e e e i l MET Thr le Leu Asn Lei- 380 385 390 395 TTG CCC CC-C TTG C-CT C-CA TTC C GA CCT TCT GCC T'TC ACA C-AT ACC GAG TAT CTC 1215 1242 -T Leu Pro Arg Leu Ala Ala Phe Ara-Pro Ser Ala Phe Thr Asp Thr G-ln Tyr Leu 400 405 410 CAA GAT ACC ATG AAC CAT GCC CTA AC-C TGT GTC AAG AAkG GAG AAG GAA CGT ACA 1269 1296 Gin Asp Thr MET Asn His Ala Leu Ser Gys Val Lys Lys C-lu Lys Glu Arg Thr 415 420 425 430 GCG C-CC TTC C.PA GCC CGC C--C CTA CTT TCT C-TC GCT GTG AGG TCT GAG TTT, AAG 1323 E350 Ala Ala Phe Gin Ala Leu Gly Leu Leu Ser Val Ala Val Ary Ser Giu Phe'-Lys 40435 440 445 GTC TAT TTG CGT CC-C GTG CTG GAC ATC ATC CC-A CG GCC CTG CCC CCA A GAC 1377 1404 Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro Pro Lys Asp 450 455 460 465 TTG GGC CAT AAG AGC-CAG AAG CA ATGC- AG C-T C-AC GCC ACA GTC TTG ACT TG 14131 1458 Phe Ala His Lys Arg Gin Lys Ala MET C-in Val Asp Ala Thr Val Phe Thr Cys 470 475 480 485 ATC AC-C ATG CTG C-CT CC-A C-CA ATG C-C-C CCA GGC ATC GAG GAG C-AT ATC PAd GAG 1485 1512 Ile Ser MET Leu Ala Arg Ala MET Gly Pro Gly Ile Gin C-in Asp le Lys C-lu 490 495 500 .~ri~2~2O CTG. CTG Leu Leu 505 TAC GAC Tyr Asp -34- GAG CCC ATG CTG GCA GTG c-GA CTAk AGC CCT GCC CTC ACT c-CA GC CTC 1539 16 c-lu Pro MET Leu Ala Val Glyv Leu Ser Pro Ala Leu Thr Ala Val Leu 510 51552 CTG Ac-C Cc-T CAG ATT CCA CAG CTA kkG AAG c-AC ATT CAA c-AT Cc-C CTA 1593 1620 Leu Ser Ar-g Gin Tle Pro Gin Leu Lys Lys Aso Ile Gin Asp Gly Leu 525 530 5235 ATG CTG TCC CTG GTC CTT ATG CAC AAA CCC CTT Cc-C CAC CCA GGC ATG 1647 16714 MET Leu Ser Leu Val Leu MET His Lys Pro Leu Arg His Pro c-1y MET 545 550 .555 c-cC CTc- GCC CAT CAG CTG c-Cc TCT CCT c-cC CTC ACG ACC CTC CCT .GAG 1701 12 Gly Leu Ala His Gin Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro c-lu 560 565 570 575 CTG A Leu Lys 540 CCC -AAG Pro Lys Y2 c-CC Ac-C c-AT GTG c-cC Ac-C ATC ACT CTT c-CC CTC Cc-A ACG CTT c-CC Ac-C TTT GAA 1755 1782 Ala Ser Asp Val Gly S c T7-1e Th r L eu Ala Leu Ara Thr Leu Gly Ser Phe c-lu .580 585 590 TTT G.PA GGC CAC TCT CTC ACC CA A TTT GTT Cc-C CAC TT c-Cc- GAT CAT TTC CTG 1809 1836 Phe c-lu c-iv His Ser Leu Thr Gln Phe Val Arg His Cys Al!a Asp His Phe Leu 59i; 600 605 610 AAC Ac-T GAG CAC AAG GAG ATC Cc-C ATG c-AG c-CT c-CC CGC ACC TGC TCC Cc-C CTG 1863 1890 Asri 5cr c-lu His Lys c-lu Ile Arg MET c-lu, Ala Ala Arg Thr Cys Ser Arg Leu 615 620 625 CTC ACA CCC TCC ATC CAC CTC ATC Ac-T c-c-C CAT c-CT CAT GTG c-TT Ac-C CA- ACC 1917 1944 Leu Thr Pro Ser Ile His Leu Uia Ser Gly Hi~s Ala His Val Val Ser G In mTh-- 630 635 640 c-CA GTGC CAAGTG GTc- c-CAc'-AT,.-GTG CTT Ac- AACc-CCkCT -T -cc-AA C 1971. 19987 AlaVl c-nVa a A sValalLu e Lys Leu Leu Vl£V- Cy- .Thr -650 5S' GATaYT;& c,-AC. CCT c-AC ATT Cc-C TA-C TGT GTC TCC c-Cc- 7CC CTG c-AC-GA:G CCC TTT 2025:,-. i-2052 Asp Po Asp -Pro- Asp, le Ar -Tyr7 Cys -a Lu Ala' Ser,; 'Leu Asp c-lu Arg 2 670. 67 680 CAT c-CA CAC CTG. c-Cc CAG GCG c-AG A AC TTCj. CAC -CC TTG 7 3TC c-CT C~-AAT ii Asp la His Leu Ala Gin 2079 -21.0 6 Ala-. (lu-"-Asn, Gecin Ala .t~e u Me4 Val Ala Leui Asn -65. 70 0 1 2. GAC CAG GTG TTT GAG ATC CGG GAG CTG GCC ATC TGC ACT GTG GO-C CGA CTC DGT 2133 2160 Aso Gin Val ?he Clu Tie Arag Glu Leu Ala Ile C ,s Thr Val GIN, Ara Leu Ser '7 1 AC-C ATG Ser MET 720 to 705 AAC CCT Asn Pro GCC TTT C-TC ATG CCT 2187 Ala Phe Val MET Pro TTC. ACA GAG Leu Thr Giu 740 ATG CTG GG MET Leu Gly TTG- GAG CAC Leu Glu His AGT1 CGG ATT 2241 Ser Gly Ile 745 TCC JAAT GCC 2295 Ser Asn Ala TTC CTG CGC A.AG Phe Le! -Ar9 -L-s 730 GGA: AGA ATC AAA~ Gly Arg Ile Lys 750 CCC CGA CTC ATC Pro Arg Leu Ile ATG CTC ATOC CAG ATT MET Leu Ile Gin le GAG CAG ACT GCC CGC 22-68 Glu Gin Ser Ala Ara 755 CGC CCC TAC ATG GAG 2322 Arg Pro Tyr MET Glu 770 CAC CTG His Leu .760 CT ATT CTG AAG OCA Pro lie Leu Lys Ala 775 CCA OCT GTG ATC AAT Pro Gly Val le Asfl TTA ATT Leu lie 760 TTG A- ,A 2349 Leu Lys CTO- AAA~ GAT Leu Lvs Aso 785 ACA ATA GGA Thr Ile Gly GAO CCT Aso Pro GAT CCA AAC 2376 Asp Pro Asn 790 CAG GTT AGT 2430 Gin Val Ser AAT GTC CTG GCA 2403 Val Leu Ala 800 GAA TTG Glu Leu 805 ATT ATC lie Ile

GCA

Aid GGC CTG GAA ATG Gly Leu Glu MET 810 CTC CAd GAT TC Leu Gin Asp Ser 830 CAG TTG GTG GCC Gin Leu Val Ala AGG AAA TGGG OTr GAT GAA CTT TIT 2457 Arg Lys Trp Val Aso Giu Leu Phe 815 820 TCT TTG TTG 0CC AA AGG CAG GTG 2511 Ser Leu Leu Ala Lys Arg Gin Val 835 ACC ACT GGC TAT GTA OTA GAG CCC 2565 Ser Thr Gly Tyr Val Val Glu Pro 850 855 OTA CTG AAT TTT CTG AAG ACT GAG 261D Leu Leu Asn Phe Leu Lys Thr Clu 870.- 875 ATC ATG Ile MET 825 TOG ACC Trp Thr

OCT

Ala 840

CTG

Leu TAC AGG AAG TAC Tyr Arg Lys Tiyr 860 CAG AAC CAG GGT Gin Asn Gin Gly GAO ATG 2484 Asp MET CTG OGA -2538 Gly 845 CCT ACT 2592, Pro Thr ACA CGC 2646 Thr Arg 880 AAG CAC 2700 ,Lys Hiis TTG CTT GAG GTG Leu Leui Giu Val 865 AGAGAG GCC ATC A r G iU Ala Ile 885 COT GTG TmA GGG-CT-T TTACG Ar6g.Val Leuly Leu Ziau OW 890 O.CT TTG Aia Leu GdAT CCT -,Asp Pro 895" -i

N

Ama -36- G-TG AAC ATT GGC ATG ATA GAC CAG TOG CGG GAT GCC 2727 Val Asn Ile Gly MET lie Asp Gin' Ser Arg-Asp Ala 900 905 910 TCT GCT GTC AGC CTG Ser Ala Val Ser Leu 915S ACT ACT GAA CTG 2803 Thr Ser Glu MET Leu

I

I

*9t 1± -v a

I

TCA GAA TCC AAkG Ser Clu Ser Lys 920 to GTC AAC ATO C-CA Val Asn M ET Gly 15 GCC CTCG ATG CGG Ala Leu MET1 Arg 20 GTC CAG GCC ATC Ser Se-- Gin AAC TTG CCT Asn Leu Pro 940 ATG TTC CGA Ile Phe Arg Aso Ser 925

GGCAT

2835 Lei- Asp GAG GAG 2889 Asp Gin TIC AAG 2943 ?he Lys 980 TIGA AGT GAG GAT TCC 2761 TGT GAG TAT Ser Aso Tv'r GAG TIC TAG c-la Phe Tyr 945 IGA CTC TCT Ser Lea Ser ICC GIG GGA, Ser Leu Gly AAk T C AlT Asn Val ie 1000 GCT CTC ICC Ala Val Ser 950 CAT CAG ACc His His Thr 935 .AIG c-IC 2862 MET Val ATG CIT 2916 MET Val 970 GAG TTC 2970 Gi-n Phe ZACG TTC

CTC

Leu 990

ATC

Gin Ala Tie Thr P11- 975 CCC CAG GIG ATC CCC Pro Gin Val MET Pro 995 CCC CAAk TTT TTG TTC GTC AA:, Lea Lvs 9085 GA GTC Arg Val TGi' GIG Gvs Val AGG TIC GT 29971 Thr ?he Lea TGT CAT GGG CC 3024 Cys Asp Cly Ala 1005 GAG GAG GIG GGA ATC TIC GIG TCC ITT GTG AAG AGC 3051 3078 Ile Ara Cia Phe Lea ?he Gin Gin Lea Gly MET Leu Val Ser Phe Val Lys Ser 1010 1015 1020 1025 CAC ATGC AGA CCI TAT ATG CAT GAA ATA GIG ACG GIG ATG AGA CAA TTG TGG GTG 3105 3132 His Ile Arg Pro Tvr MET Asp Ci Ile Vai Thr Lea MET Arg Ciu Phe Tro-Val 1030 1035 1040 40 AIG AAG ACC TCA ATT CAG AGC AGG -AIG Al TT IG T ATT GAG CAA ATT GIG CIA 3159 3186 MET Asn Thr Ser Ile Gin Ser Thr Ile Ie Leu Lea Ile Clii Gin Ile Val Val 1045 1050 1055 1060 OCT CIT CCC CCI CGA TTIT AA CGTG TAG GIG CCC GAG GIG ATC CGA GAG ATG CG 3213 3240 A 1a Lea Cly Cly Cia Phe Lys Lea Tyr Leu Pro Gin Lea Ile Pro His MET Leu 1065 1070 10*75 CGT GTG TTC ATG CAT GAG AAC AGC CGA GGC GGC All GIG IGI ATG AAG TTACG 3267 3294 Arg Val Phe MET His Asp Asn Ser Pro Gly Arg le Val Ser Ile Lys Leu Leu 1080 108S 1090 1095 -37- GCT GCA ATC CAG CTG TTT GGC GCC AAkC CTG GAT GAC TAC CTG CAT TTA CTG CTG 3321 3348 Ala Ala ile Gin Leu Phe Gly Ala Asn Leu Asp Asp Tyr Leu His Leu Leu Leu 1100 1105 1110 111; CCT CCT ATT GTT AAG TTG TTT GAT GCC CCT GMA GCT CCA CTG CCA TCT CGA AMG 3375 3402 Pro Pro Ile Val Lys Leu Phe Asp Ala Pro Giu Ala Pro Leu Pro Ser Arg Lys 11201125 1130 GCA GCG CTA GAG ACT GTG GAC CGC 010 ACG GAG 'ICC CTG GAT TTC* ACT GAC TAT 3429 3456 Ala Ala Leu Giu Thr Val Asp Arg Leu Thr-Giu Ser Leu Asp Phe Thr Asp Tyr 1135 1140 1145 1150 CCC TCC CGG ATC ATT CAC CCT ATT GTT GGA ACA CTG GAC CAG AGC CCA GAA CTG 3483 3 510 Ala Ser Arg Ile Ile His Pro Ile Val Arg Thr Leu Asp Gin Ser Pro Glu Leu 1155 !1160 1165 CGC 'ICC ACA GCC ATO GAO ACO CTG TCT TCA OTT GTT 'ITT CAG CTG GGG MAG MAG 3537 3564 Arg Ser Thr Ala MET Asu Thr Leu Ser Ser Leu Val Phe Gin Leu Gly Lys Lys 1170 1175 1130 1185 TAC CMA ATT TTC ATT CCA ATG GTG MAT AMA GTT CTG GTG CGA CAC CGA ATC MAT 3591 3618 Tyr Gin Ile Phe Ile Pro MET Val Asn Lys Val Leu Val Arg His Arg Ile Asn 1190 1195 1200 1205 CAT CAG CGC TAT GAT GTG OTC ATC 'ICC AGA ATT GTC MAG GGA TAC ACA CTT GCT 3645 3672 His Gin Arg Tyr Asp Val Leu Ile Cys Arg Ile Val Lys Gly Tyr Thr Leu Ala 1210 1215 1220 OAT GMA GAG GAG GAT CCT TTG ATT TAO CAG CAT CGG ATO CTT AGG AGT GGC CMA 3699 3726 Asp Glu Glu Glu Asp Pro Leu Ile Tyr Gin His Arg MET Leu Arg Ser 0Wy-Gin 1225 1230 1235 1240 G GAT OCA TTG GCT ACT GCA CCA GTG GMA ACA GGA CCC ATG MAG AMA CTG CAC 3753 3760 Gly Asp Ala Leu Ala Ser Oly Pro Val Giu Thr Gly Pro MET Lys Lys'Leu His 1245 1250 1255 GTC AGC ACC ATOC MC CTC CMA MG GCC TGG GGC OCT 0CC AGG AGG.GTC TCC A 3807 3834 Val Ser Thr Ile Asn Leu Gin LYS Ala Trp Gly Ala- Ala Arg Arg Val Ser Lys 1260 126S 1270 1275 GAT GAO TGG CTG GMA TGG CTG AGA COG CTG AGC CTC GAG CTG CTG MAG rGAC TCA 3861 3888 Asp Asp Trp Leu Glu Trp Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser 1280 1285 1290 1295 44 r

K

-38f1t C CCC UUTC CIG CCC TCC TGC TGG GCC CTG GCA CAG GCC TAC AAC CCG ATG 3915 3942 Ser Ser Pro Ser Leu Arg Ser Cys Trp Ala Leu Ala Gin Ala Tyr Asn Pro MET 1300 1305 1310 GCC AGG GAT CTC TTC AAT GCT GCA TTT GTG TCC TGC TGG TCT GAA CTG AAT GAAZ 3969 3996 Ala Arg Asp Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Giu Leu Asn Glu 1315 1320 1325 1330 GAT CAA CAG GAT GAG CTC ATC AGA AGC ATC GAG TTG GCC CTC ACC TCA CAP. GAC 4023 4050 Asp Gla Gin Asp Giu Leu Ile Arg Ser le Glu Leu Ala Leu Thr Ser Gin Asp 1335 1340 1345 ATC CC CAA GTC ACA CAG ACC CTC TTA AAC TTG GCT GAA TTC ATG GAA CAC AGT 4077 4104 Ile Ala Glu Val Thr Gin Thr Leu Leu Asn Leu Ala Giu Phe MET Glu His Ser 1350 1355 1360 1365 GAC AAG GGC CCC CTG CCA CTG ACA CAT GAC AAT GGC ATT GTT CTG CTG GGT GAG 4131 4158 Asp Lys Cly Pro Leu Pro Leu Arg Asp Asp Asn Gly Ile Val Leu Leu Cly Glu 1370 1375 1380 1385 AGA GCT Ara Ala TTC CAG AA-A Phe Gin Lys 1405 AAG CTA- CAC Lys Leu Gi~n AAG TGC CGA GCA TAT CCC AAA CCA 4185 Lys Cys Arg Ala Tyr Ala Lys Ala 1390 1395 GGC CCC ACC CCT GCC ATT CTA CAA 4239 Giy Pro Thr Pro.Ala Ile Leu Glu 1410 CAG -CC GAG CCA CC GCC CCA GTG 4293 Gin Pro Giu Ala Ala Ala Gly Val.

1425 1430 CTG GAG ATC CAG GCT ACC TGG TAT 4347 Leu Ciu Ile Gin Ala Thr Trp Tyr 1445 .1450 GTG CCC TAT GAC AAG AAA ATC GAC CTA CAC TAC AAA GAA CTC GAG 4212 Leu His Tyr Lys Glu Leu Ciu 1400 TCT CTC ATC AGC ATT AAT AAT 4266 Ser Leu Ile Ser Ile Asn Asn 1415 1420 TTA GAA TAT CCC ATG AAA CAC 4320 Leu Glu Tyr Ala MET Lys> His ITT CGA Phe Cly 1440 C1 AT CC

GAG

Giu

CTT

1435 AAA CTG CAC GAG Lys Leu His Ciu 1455 AAC AAC GAC CAC Asn Lys Asp Asp Asp, Ala .Leu Val Ala 1460 CTG ATG CTC CCC CC .Lett MET Leu-Gly Arg- 4401.

Tyr Asp Lys Lys MET 1465 ATCI CGC.TGC CITC GAG 4455 MET Arg Cys Leu Clii I .1485 Asp Thr TCC GAG .4374 rrp Ciu CCA GAG 442B Pro Ciu 1475 -AA CTC 4482 31n Leu 1470 CCC TTG CCC GAA TCC Ala Leu Gly Glu Trp .1490

C

F

-39- CAC CAG CAG His Gin Gin 1495 TOC TGT GAA Cys Cys Glu AAG TGG ACC 4509 Lys Trp Thr 1500 CTG GTT Leu Val AAT CAT GAG Asn Asp Glu 1505 TTA CCT CAG Leu Gly Gin IATG GCC CCC ATC GCT CCT CCA CCT CCA TCG CGT DIET Ala CAA GAA Glu Clu 1530 GCT CTC Ala Val Azg MET Ala Ala Ala 1515 TAC ACC TCT ATG ATC Tyr Thr Cys MET 'Ile 2.1535 CTC GCA CTG CAT CAG Leu Ala Leu His Gin 1550 AGG CAC CTG CTG CAT Arg Asp Leu Leu Asp 11570 4563 Ala Ala TrP Cly 1520 CCT CCC CAC ACC 4617 Pro Arg Asp Thr 1540 CAC CTC TTC TCC 4671 Aso Leu Phe Ser CAT GAT His Asp 152~

GCG

Gly ACC CAA Thr Gin TGG GAC Trp Asp GCA TTT Ala Phe CCC AAG 4536 Ala Lys 1510 AGC ATG 4590 Ser MET TAT AGA 4644 Tyr Arg 1545 2LkG GCC Lys Ala 1555 GCT GAA 4725 Ala Glu TTA ACT Leu Thr 1575 TCC CAC Cys His ~TC GCA CAA Leu Ala Gin 1560 GCA ATC GCA Ala MET Ala CAG TGC Gin Cys CCA GAG Cly Giu 1580 GAG CTG Clu Leu ATT GAC 4698 Ile Asp 1565 ACT TAC 4752 Ser Tyr GAG GAG 4806 Clu Glu 1600 ATC TGC 4860 Ile Trp ACT CCC CCA Ser-Arg Ala 1585 GTT ATC- CAG Val Ile Gin TAT CCC GCC ATG CTT TCT 4779 Tyr Cly Ala MET Val Ser 1590 TAC AAA CTT GTC CCC GAG 4833 Tyr Lys Leu Val Pro C-lu 1605 161' CTC CAC CCC TCC CAC CCT 4887 Leu Cln Gly Cys Gln Arg 1625 TCC CTT CTC CTC ACC CCT 4941 Ser Leu Val Val Ser Pro ATC CTG MET Leu 1595 GAG ATC Glu Ile

CGA

Arg 0

ATC

Ile

ATC

I le 1615

TGG

Trp :GC CAC kig Gin *TGC GAG Trp Clu 1620 ATC CTG MET Va 1

ACA

Arg

CCC

Ara OTA GAG Val Glu 1630 GAA GAC Clu Asp 1640 TAT :GCA AGC CTG 1645 ACT GC ATG AGA MET Arg 1650 CTT GCT CAG AAA ATC CTT Gin Lys 114-Leu 1635 ACC TGC CTC AAC 4968 Thr Trp Leu Lys 1655 CAT AAA ACT TTA 5022 His Lys Thr Leu 1670 CCT CTC CCA ACA 5076 Pro Leu Pro Thr TCC GGC AAC ACC CTG GCT 4995 Tyr Ala Ser Leu Cys 1661 Gly Lys Ser Cly Arg Leu Ala Leu Ala 0 1665 GTC TTG CTC CTG CCA CTT. CAT CCC TCT, CCC CAA CTT GAG CAT 5049 Val Leu Leu Leu Cly Val Asp Pro Ser Arg Gln Leu Asp His, 1675 1680 1685 Th

I;

7777 7 GTT CAC Val His CCT CAC GTC- Pro Gin Val 1695 GAT GCC TTC Asp Ala Phe ACC TAT Thr Tyr AAG ATC Lys Ile 1710 CAG CAC sin His 1715 GCT ACT Ala Thr CCC TAC ATG 5103 Ala Tyr MET 1700 ATG CAG CAT 5157 MET Gin His GAG GAC CAG, 5211 Giu Asp Gin 1735 AAA AAC Lys Asn TTT GTC Phe Vai 1720 ATG TCC AAG AGT GCC CC 5130 MET Trp Lys Ser Ala Arg 1705 CAG ACC ATG CAG CAA CAG 5184 Gin Thr MET Gin Gin Gin.

1725 GCC CAG CAT GCC ATC Ala Gin His Ala Ile I 1 1 1730 CTC ATGOCCC CGA TGC Leu MET Ala Arg Cys 1750 ATC AAT GAG AGC ACA Ile Asn Glu Ser Thr

CAG

Gin CTG AAA CTT 5265 Leu Lys Leu CCC AAA GTG 5319 Pro Lys Val 1770 AAC GCC TGG 5373 Lys Ala Trp GGA GAG Gly Glu 1755 CTG CAG Leu Gin.

CAT GCG His Ala CAT. AAG CAG GAA His Lys Gin Giu 1740 TGG CAG CTG AAT1 Trp Gin Leu Asn 1760 TAC TAC AGC CC Tyr Tyr Ser Ala 1775 TGG GCA GTG ATG Trp Ala Val, MET 1795 CTG CAC AAG 5238 Leu His Lys 1745 CTA CAG GGC 5292 Lau Gin Gly 1765 CAC GAC His Asp ACA GAG 5346 Thr Glu 1780 TTC GAA 5400 Phe CGlu AGC TG Ser Trp 1785 CAC TAC His Tyr GCT GTG Ala Val 1800 CGT CAT Arg His

CTA

Lau

AAA

Lys 180~

GCC

Ala 5 1790 CAG AAC 5427 Gin Asn

CC

Ala 1820

GCC

Ala

S

GC GGG er Gly GCC ACT Ala. Thr ACC ACC ACT Thr Thr Thr 1840 GAG AAC AGC AAC ATC ACC 5481 Asn Ile Thr 1825 GCC AGC ACC 5535 Ala Ser Thr CCC ACC CCA 5589 Pro Thr Pro 1860 CTG ATO TAC CAA CC Gin Ala 1810 AAC CC Asn Ala GAG GCC Glu Gly 1845 1830 AAC ACT Asn Ser GAG AGC Glu Ser 1850.

GAT GAG AAG AJAG AAAk CTG 5454 Asp Glu Lys Lys Lys Leu 1815 ACT CCC GCC ACC ACG CC 5508 Thr Ala Ala Thr .Thi- Ala 1835 GAG CC 5562 Glu Ala GAG AGC ACC .Glu Ser Thr Giu Asn Ser 1855 GAT CTG TCC AAA ACC-CTC TCG CCG CTG CAG AAG Ser Pro Leu Gin Lys 1865 ACG GTG CCT GCC GTC AAG GTC ACT GAG 5616 Lys Val Thr Giu 1870 CAG CGC TTC TTC 5670 5643 Asp Lau Ser Lys Thr Leu 1875.

Leu MET Tyr Thr Val Pro Ala Vai Gin Gly Phe Phe ~.r

F'

1880 1885 CGT TCC ATC TCC'TTG TCA CGA GGC AAC AAC CTC CAG GAT ACA CTC AGA GTT CTC 5697 5724 Arg Ser Ile Ser Leu Ser Arg Gly Asn Asn Leu Gin Asp Thr Leu Ara Val Leu 1890 1895 1900 1905 ACC TTA TGG TTT GAT TAT GGT CAC TGG CCA GAT GTC AAT GAG GCC TTA GTG GAG 5751 5778 Thr L eu Trp Phe Asp Tyr Gly His Trp Pro Asp Val. Asn Giu Ala Leu. Val Glu- 1910 1915 1920 1925 GGG GTG AAA GCC ATG GAG ATT GAT ACC TGG CTA CAG GTT ATA CCT CAG CTC ATT 5805 5832 Gly Val Lys Ala Ile Gin Ile Asp Thr Trp Leu Gln Val Ile Pro Gin Leu Ile 1930 1935 1940 *GCA AGA ATT GAT ACG CCC AGA CCC TTG GTG GGA CGT CTC ATT GAG CAG CTT CTG 5859 5886 *Ala Arg Ie Asp Thr Pro Arg Pro Leu Val Gly Arg Leu Ile His Gin Lieu. Leu 1945 1950 1955 1960 ACA GAG ATT GGT GGG TAG GAG CCC CAG GCC CTC ATC TAG CCA GTG ACA GTG GCT 5913 5940 Thr Asp le Gly Arg Tyr His Pro Gin Ala Leu. ile Tyr Pro Leu. Thr Val Ala 1965 1970 1975 *TGT AAG TCT AGC AGG AGA GCC CGG CAC AAT GGA GGG AAC AAG ATT GTG AAG AAC 5967 5994 Ser Lys Ser Thr Thr Thr Ala Arg His Asn Ala Ala Asfl Lys Ile Leu Lys Asn 1980 1985 1990 1995 ATG TGT GAG CAC AGC AAC ACC CTG GTC CAG GAG GCG ATG ATG GTG AGG GAG GAG 6021 6048 MET Gys Giu. His Ser Asn Thr Leu Val Gin Gin Ala MET MET Val Ser Glu Giu 2000 2005 2010 2015 Ak GTG ATC CGA GTG GGG ATC CTC TGG CAT GAG ATG TGG CAT GAA GGG GTG GAA GAG 6075. 6102 Leu Ile Arq Val Ala Ile Leu Trp His Giu MET Trp His Giu Gly Lau .Gli Glu 2020 2025 2030 GCA TCT CGT TTG TAG TTT GGG GAA AGG AAC GTG AAA GGC ATG TTT GAG GTG CTG 6129 6156 Ala Ser Arg Leu. Tyr Phe Gly Giu Arg Asn Val Lys Giy MET Phe Glu Val Leu 2035 2002045 2050 GAG CCC TTG CAT GCT ATG ATG GAA CGC GGC CCC GAG ACT CTG AAG GAA ACA TCC 6183 6210 Giu. Pro Leu His Ala MET MET Giu. Arg Gly Pro Gin Thr Leu Lys Glu Thr Ser 12055 2060 2065 TTT.AAT GAG GCC TAT GGT GGA GAT TTA ATG GAG GCC CAA GAG TGG TGC AGO AAG Ph AnGi la*6237 6264 PheAsnGlnAlaTyr Gly Arg.AspLeu:MET Clii Ala Gin Glu Trp Gys Arg Lys 2070 2075 2080 2085 W -42- TAG ATG AAA TCA GGG AAT GTC AAG GAG CTC ACC CAA GCC TGG GAC CTC TAT TAT 6291 6318 Tyr MET Lys Ser Gly Asn Val Lys Asp Leu Thr Gin Ala Trp Asp Leu Tyr Tyr 2090 2095 2100 2105 CAT GTG TTC CGA CGA ATG TCA AAG CAG CTG GCT GAG CTC ACA TCG TTA GAG CGG 6345 6372 His Val Phe Arg Arg Ile Ser Lys Gin Len Pro Gin Len Thr Ser Leu Glu Leu 2110 2115 2120 CAA TAT GTT TCC CCA AAA CTT GTG ATG TGG GGG GAG GTT GAA TO OCT GTG GCA 3 9 9 6426 Gin Tyr Val Ser Pro Lys Leu Leu MET Gys 'Arg Asp Leu Giu Leu Ala Val Pro 2125 2130 2135 2140 GGA AGA TAT GAG CCC AAC GAG CCA ATG ATT GG ATT GAG TGC ATA GCA CCG TCT 6453 6480 *Giy Thr.Tyr Asp Pro Asn Gin Pro Ile Ile Arg Ile Gin Ser Ile Ala Pro Ser 2145 2150 2155 TO GAJ3 GTG ATC AGA TCG AAG GAG AOG CCC CGG AAA TTG ACA GTT ATG GGG AGC 6507 6534 Leu Gin Val Ile Thr Ser Lys Gin Arg Pro Arg Lys Leu Thr Leu MET Gly Ser 2102165 2170 2175 *AAG GGA CAT GAG TTT OTT TTG CTT GTA AAA GGC CAT GAA OAT GTG CG GAG GAT 6561 6588 Asn Gly His Giu Phe Val Phe Leu Leu Lys Gly His Oiu Asp Len Arg Gin Asp .2180 2185 2190 2195 GAG CGT OTO ATO GAG GTG TTG GOC GTG GTT AAG ACC CTT CTG GGG AAT GAG GGA 6615 6642 Giu Arg Val MET Gin Leu Phe Gly Leu Val Asn Thr Leu Leu Ala Asn Asp Pro 2200 2205 2210 ACA TCT CTT CGG AAA AAG CTG AGG ATG GAG AGA TAG GCT GTG ATG GGT TTA TCG A&6669 ;696 Thr Ser Leu Arg Lys Asn Len Ser Ile Gin Arg Tyr Ala Val Ile Pro LetwSer 2215 2220 2225 2230 .ACC AAC TCG GGC GTG ATT GGG TGG GTT GGG GAG TGT GAG ACA GTG GACG0CC GIG 6723. .6750 Thr Asn Scr Giy Leu Ile Oly Trp Val Pro His Gys Asp Thr Leu His Ala Leu 2235 2240 2245 6777 6804 IleArg Asp Tyr Arg Oiu Lys Lys Lys Ile Leu Len Asn Ile Giu His Arg Ile 2250 .2255 2260 2265 ATO TTG CGG ATG GGT CCG GAG TAT GAG GAG ITO ACT CTG ATG GAG AAG GIG GAG4 6831 6858 MET Leu Arg M4ET AlaPro AspTyr Asp H is Leu Thr Leu MET Gin Lys Val Glu 2270 2275 2280 2285 j -pow -43- GTG TTT GAG CAT GCC GTC AAT AAT ACA GCT GGG GAC GAC CTG GCC AAG CTG CTG 6885 6912 Val Phe Glu His Ala Val Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu 2290 2295 2300 TGG CTG MAA AGC CCC AGC TCC GAG GTG TGG TTT GAG CGA AGA ACC AAT TAT ACC 6939 6966 Trp, Leu Lys Ser Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr Thr 2305 2310 2315 2320 CGT TCT TTA GCG GTC ATG TCA ATG GTT GGG TAT ATT TTA CGC CTG GGA GAT AGA 6993 7020 Arg Ser Leu Ala Val MET Ser MET Val Gly Tyr Ilie Leu Gly Leu Gly Asp Arg 2325 -2330 2335 CAC CCA TCC His Pro Ser 2340 TTT GGG GAC Phe Gly Asp 236( CCA TTT AGA Pro Phe Arg AAC CTG ATG CTG GAG CGT CTG 7047 Asn Leu MET Leu Asp Arg Leu 2345 TGC TTT GAG GTT OCT ATG ACC 7101 Gys Phe Glu Val Ala MET Thr 0 2365 CTA ACA AGA ATG TTG ACC AAT 7155 Leu Thr Arg MET Leu Thr Asn 2380 238 AGA ATC ACA TCC CAC ACA GTG 7209 Arg Ile Thr Cys His Thr Val 2400 AGT GOG AAG Ser Gly LYS 2350 Ile 7074 Leu His Ile Asp 2355 GCA GAG AAG ATT '7128 Pro Glu Lyvs Ile CGA GAG AAG TTT Arg Glu Lys Phe .23-70 GCT ATG GAG GTT Ala MET Giu Val ATG GAG GTG CTG MET Glu Val Leu 2405 ACA GCC Thr G2.y 2390 CGA GAG Arg Giu CTG GAT 7182 Leu Asp GAG AAG 7236 His Lys 2410 GGC AAC TAG GLY Asn Tyr 2395 GAG ACT CTC ATG CCC GTG CTG GAA GCC TTT GTC TAT GAG CCC TTG GTG AAC TGG 7263 7290 Asp Ser Val MET Ala Val Leu Glu Ala Phe Val Tyr Asp Pro Leu Leu As6-Trp 2415 2420 2425 ACC CTG ATG GAG ACA MAT ACC AMA GGG MGC MG CGA TGG GGA ACG AGO AGGCAT 7317 7344 Arg Leu MET Asp Thr Asn Thr Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp 2430 2435 2440 2445 TCC TAG TGT GGT GGC GAG TCA GTG GMA ATT TTG GACGCGT GTG GMA GTT GGA GAG 7371 7398 Ser Tyr Ser Ala Gly Gin Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly Glu 2450 2455 2460 2465 CCA GCC CAT MAG AMA ACG GGG ACC ACA GTG CCA GMA TCT ATT CAT TCT TTC ATT 7425 7452 Pro Ala His Lys Lys Thr Cly Thr Thr Val. Pro Glu Ser Ile His Ser Phe Ile .2470 2475 2480

A

-A

-44- GGA GAC GOT TTG Gly Asp Gly Leu 2485 AAC AGG GTT CGA Asn Arg Val Arg 2505 GAT OTT CCA ACO Asp Val Pro Thr GTG AAA CCA GAG GCC CTA A-AT 7479 Val Lys Pro Glu Ala Leu Asn 2490 GAT AAG CTC ACT GGT CGG GAC 7533 Asp Ly's Leu Thr Gly Arg Asp AAG AAAk Lys Lys 2495 GCT ATC Ala Ile

TTC

Phe 2520 CTC TGC Leu Cx's

CAG

Gin

TGC

Cx's CAA OTT GAG Gln Val Glu :2525 TAT ATT GGC Tyr Ile 01 x' 2510 CTG CTC ATC 7587 Leu Leo Ile TGG TAC CCT 7641 Trp Tyr Pro 2545 AAA CAA Lys Gin 2530 TTC TG Phe Trp TCT CAT GAT GAC Ser His Asp Asp 2515 C ACA TCC CAT Ala Thr Ser His 2535

TAA

ATT ATT 7506 Ile Ile 2500 ACT TTG 7560 Thr Leu GAA AAC '7614 Glu Asn 2540 INFORMATION FOR SEQ. ID NO: 2: i) SEQUENCE CHARACTERISTICS: LENGTH: 1140 amino acids TYPE: nucleic acid STRANDEDNESS: sense orientation of the doublestranded DNA strand TOPOLOGY: linear (ii) MOLECULE TYPE: sense orientation of double-stranded cDNA to mRNA DESCRIPTION: Sequence No. 2 illustrates a portion of the OST-SEP fusion protein beginning at the linker sequence 1between the OST and portions of the protein.

(iii) HYPOTHETICAL: -no A.NT7ISENSE: no (vi) ORIGIN4AL SOURCE: (Al ORGANISM: Molt 4 human T-cell leukemia cells STRAIN: ATCC Strain CRL 1582 (xi) SEQUENCE DESCRIPTION: SEQ. ID NO: 2 ATG TCC CCT ATA CTA GOT TAT TOG AAA ATr AAG GGC CTT GTG CAA CCC ACT CGA 27 54 MET Ser Pro Ile Leo Gly Tyr Trp Lys Ile Lys Gly Leu Val Gin Pro Thr Arg 1 5 10 CT CTTr 7IT GAA TAT CTT GAA GAA AAA TAT GAA GAG CAT T1TG TAT GAG CGC OAT 81 108 Leo Leu Leu Giu Tyr Leu Glu 010 Lys Tyr Olu Glu His Leo Tyr Glu Arg Asp 25 30 q!~ GMk GGT GAT AAA TGG CCA AAC AAzkA MG TTT GAA TTC GGT TTG GAG TTT CCC AMT i3 51 Glu Gly Asp Lys Trp Arg 40 CCT TAT TAT ATT GAT Pro Tyr Tyr Ile Asp Asn Lys Lys Phe Gin Len GIly Leu Giu 45 Phe Pro Asn

CTT

Leu

CGT

Arg GAT GTT AAA 189 ASP Val Lys ACA CAG Thr Gin

TAT

Tyr ATA GCT GAC Ile Ala Asp

CAC

His GAG AT? TCA ATG CTT GAA CGA Gin Ile Ser MET Leu Glu Cly 95 GATTATA A T -NTTGATTATAA C T Ile Ala Tyr Ser Lys Asp Phe 110 115 AAC ATG 243 Asn MET 80 GCG CTT _297 Ala Val GAAD ACT -351 Gin Thr GOT OCT TGT Gly Gly CYS 85 GAT ATT AGA Asp Ile Arg TCT ATG Ser MET CCA AAA Pro Lys TAC GGT Tyr Gly 105 GAG COT GCA 270 Glu Arg Ala OTT TCG AGA 324 Vai Ser Arg GCC ATC Ala Ile AAA GTT Lys Val 120 TTA TGT Leu Cys CCT GAA ATG CTG AAkA ATG TTC GAA Pro Glu MET Leu Lys MET Phe Oiu 130 GGT GAT CAT OTA ACC CAT CCT GAC Gly Asp His Val Thr His Pro Asp 145 150 TTA TAC ATO GAC CCA ATG TGC CTG Leu Tyr MET Asp Pro MET Cys Len GAT COT 405 Asp Arg 135

GAT

Asp

CAT

His

GAC

Asp TTT CTT AGC AAG CTA 378 Phe Leu Ser Lys Len 125 AAA ACA TAT TTA AAT 432 Lys Thr Tyr Leu Asn 140

TTC

459 Phe

GAT

513 Asp ATG TTO MET Leu 155 GCG TTC Ala Phe Ala

TTA

Leu Leu Asp 160 GTT TGT Val Cys AAA COT Lys Arg 165 ATT GAA GCT le Gin Ala ATC CCA CAA le Pro Gin CCA AAA Pro LYS 175 TAC TTG Tyr Leu ATT CAT 567 Ile Asp 190 AAA TCC Lys Ser 195 486 Val Val TTT AAA 540 -Phe- Lys 180 MAG TAT 594 Lys Tyr *ATA OCA TGG CCT T G CAG GGC TOG CMJ GCC ACO T'rT GGT OCT CCC GAC CAT CCT 621 648 Ile Ala Trp Pro Len Gin Gly Trp Gin Ala Thr Phe Gly Giy Cly Asp His Pro 200 205 210 215 CCA AMA TCO CAT CTO OTT CCG COT GOT CGA TCC CCC GGA ATT TCC OCT OCT CGT 675 702 -Pro Lys Ser Asp Leu Val Pro Arg Ciy Civ Ser Pro Oly Ile Ser Cly Oly Gly 220 225 230 T~ 4 -46- GGT GGT GGA ATT CTA GAC GAC TCC ATG AGC TTC AAG TAT GCA AGC CTG ICC GCC 729 756 Gly c-ly Gly Ile Leu Asp Asp Ser MET Ser 235 240 AMG AGT GGC AGG- CTG GCT CIT CCT CAT AAA 783 Lys Ser Gly Arg Leu Ala Leu Ala His Lys 255 260 GAT CCG TCT CGG CAA CTT GAG CAT CCT G 837 Asp Pro Ser Arg Gin Leu Asp His Pro Leu PheLysTyrAlaSerLeuC250 l 245 ACT TTA GTG Thr Leu Val 265 CCA JACA GTT Pro Thr Val.

TTG CTC Leu Leu CAC CCT His Pro 285 CIG GGA GTT 62.0 Leu Gly Val.

270 GAG GTG ACC 864 Gin Val Thr TAT GCG TAG AIG AAA AAC ATG Tyr Ala Tyr MET Lys Asn MET 290 295 CAC ATG CAG CAT TTT GTC GAG His MET Gin His Phe Val Gln 310 ACT GAG GAG GAG GAG CAT AAG Thr Giu Asp Gin Gin His Lys TGG AAG 891 Trp Lys ACC AIG 945 Thr MET 315 GAG GAA 999 Gin Giu GIG AAT 103 Leu Asn 350 AGC GCC 1107 Ser Ala CCC CC Ala Arg 300 Ile Gin CAG CC Gln Ala AJAG GIG Lys Leu

CAG

Gin 320

ATG

MET

CTG GAG Leu His 335 325 CTG AAA CTT Leu Lys Leu 345 CCC AAA GTG Pro Lys Val GAT CCC TTC GAG 918 Asp Ala Phe Gin 305 CAT CCC ATC 0-CT 972 His Ala Ile Ala 330 GAG TGG GAG Glu Trp Gin Leu

CC

Ala GAG GGC AIG AAT Gin Gly Ile Asn 355 ACA GAG CAC GAG Thr Giu His Asp CCC CGA Ala Arg 340 GAG AC Clu Ser CCC AGC Arg Ser 375 CTA GAG Leu His TGG TIC 1026 Cys ?he ACA AT C 1080 Thr Ile 360 ICC TAG 1134 Trp- Tyr TAG AAA 1188 Tyr Lys 395 CTGCGAG TAG Leu Gin Tyr 365 AAG CCC ICC CAT Lys Ala Trp His 380 CC TCC GCA GTG ATG 1161 Ala Trp Ala Val MET 370 AAC TIC Asn Phe Ciu Ala CAT GAG AAC CAA GGC CCC CAT GAG AAG AAG MAA CTG CCT CAT CCC AGC CCC CC 1215 1242 His Gin Asn Gin Ala Arg Asp Glu Lys Lys Lys Leu Arg His Ala Ser Cly Ala 400 405 410 AAC ATC ACC MAC CCC ACC ACT CCC CCC ACC ACG CCC CCC ACT CCC ACC ACC ACT 1269 1296 Asn Ile Thr Asn Ala Thr Thr Ala Ala Thr Thr Ala Ala Thr Ala Thr Thr Ihr 415 420 425 430 t

V.

4

_A

-47- GCAGC ACC GAG GGC AC-C AAC AGT GAG Zk-C GAG GCC GAG AC-C ACC GAG AAC Ac-C 1323 1350 Ala Ser Thr Glu Gly Ser Asn Ser C-lu Ser C-lu Ala- Glu ter Thr C-lu Asa Ser 435 440 445 -450 CCC ACC CCA TCG CCG CTC- CAG AAG AAG, GTC ACT G-A GGAT CTG TCC:_AM OACC _CTC 1377 -1404- Pro Thr Pro Ser Pro Leu ai y Y iTrsl Asu Leu Ser Lys Thr Leu, 455 40465 CTGATGTAGA~c C-O CT CCC C-TC -CA c-c"C TCGT _TCC ATC TCC TTG-TCA 14311458 Leu MET Tyr Thr Val Pro Ala-Val C-in- Gly 'Thle, Ph6 Arg Ser Ile-Ser- Leu Ser- 470 475'7 480 485 Cc-A C-CC AAC AAC CTCtCAC- CAT-ACA CTC Ac-A GTT CTC 4CC TTA TOO, TTT GAT -TAT 1485 1512 Arg Gly Asa sr Leu 0 in sp' 'Thr Leu Arg Val-Leu T1hr Leu T rp Phe Asp Tyr, GGT CAC TGG .CA C-kT.GTC AM AT-GCC TTA GTG[OAO -cGGG GTG AAA -CC.-AIC CAG -1539 >56 6SE Gly His Trp Pro Asp.-Val-ksfi G l Ala Leu Val.Glu Cli Val. Lys Ala _le C-in 505 51 15 .520 ATT G-AT ACC TC-( CTA CtAG GTT ATA CCT CAG-CTC ATT C-A Ac-A ATT G-AT ACG CCC 1593 1620 Ile Asp Thr:!7rpLeu cln V~l TIle Pro- Gln Leu Ile Ala Arg Ile Asp Thr Pro; 525 530:- 535. 540 AGA CCC_ -tTG OGTqGGC-C CGTCTC ATT CAC__CAC CIT CTC ACA GC-CATT -GT CGG TAC 1647 -1674 Arg Pro tieui ValI Gly'lArg- Leu Ile His Gln Leui Leu Thr Asple Gly Arg Tyr '55 550 -555 CAC CCC CAG._CC -CTC AtC TAC CCA CTC- ACA GTG C-CT TCT- AAC- TCT ACC ACc- ACA 1701 1728 His Pro c-in Ala Leu Ile, Tyr Pro- L .eu Thin ValI Ala Ser Lys_ Ser Thr Thr- Thr.

560 565 570 575 C-CC Cc-c CAC AANT C-CA C-CC AAC -AAG A'T CTC- AAC- AAC ATG TGT C-AGCAC AGC AAC 1755 -1782 Ala Arg His Asri Ala -Ala Asn Lys Ile -Leui Lys Asn MET 2ys c-lu His-S Asn.

580 -585" 590 6 ACC CTG GTC CAC- CAC- C-C ATG ATG GT- ACC GAC- C-AGCTG ATC Cc-A GTG C-CC ATC 1809-, 1836 Thin Leu Val Cin Gin Ala MET MET'Val Ser c-lu Glui Leu Ile Arg Yal Ala 1le 595. 600 605 -1 CTC TC-G CAT GAG ATC- TGG CAT GAA GGC CTG GM 'GAG GCA TCT CGT- TTG TAC TTT 1863 1890 Leu Trp His c-lu MET Trp His Glu Gly Leu C-lu c-lu Ala Set Arg Leu Tyr-Phe 615 620 625 -~630 '53 1t K F, ~G G' G.A!A AC]' A2,C rGTG--AA G GC C y C u Arg A s n a I Lys -1v SA GGM C3G, GGC CCC C.GAC M7 T G u A.CTG-1 C-PrO Gn I C-A GAT -TTZ -ATG _GAG GCC CMA- Arq- As,) Leu-MET, Gi Itl 'a Gin -1 CTrc Gc CTC ACC CMU C-CC Na!tLys Aso Leu TtrG Iri Ala TCA AC CAC CTG C CAG CTC -Ser Lvs- Gin--Leux P-o _Gin Leu.

CT CTG, ATG TCCGG. A CT Led Leu MET Cys Arg Asp7-Leu CAG CCNTC ATT CGC.X7kTT CAG- Gin ProIle, Ile Arg le* Gin AAG CAG AGO CCC CGG A i TTG Lys Gin Arg Pro Arg Lys Leu 760 Phe ou Lu Ly GlyHis l 7780 :TTC GGC CTG GTT MAC ACC CTT Phe Gly Lou Val. Asn Thr Leu CTC AGCATC CAG AGA TAC GCT Leu Ser le Gin Ptr4 Tyr-Ala 815 Xic TTT-GjQG qGTG CTCG C C Cr- A G ATG 1917 64 AAG GAA ACxA TCC Lu Lvs G lu Thr Se GAC TGG TGC AGG MLC 2025- Giu -Trp, Cys A::g Lys TG -,AC CTC TAT-TA 2079 Trp Asp Leu_-Tvr Tlyr 695- ACA -TCC TTA GAG CTG :-hr -ser Lou Gi luLeu- Glu_ Leu ia -Val Pro.

1 .Pr0 *Lau 6~ .TTT AAT--CAG Phe Asn Gin TAC. ATG Tyr -MET- Lys £2 CA ,T GTG TTC His- Val -Phe CTAT- _GT Girt Tyr -Val1 GGA ACK TAT GiThr- Tyr- -7 735 H Mr.

GCC TAT CG, 1 99 A 11Y C 665- TCA GGG: AT -20521 SrG iv Asn? -_CCACGA. ATC 2106 TCC CC~ AkA Ser, Pro Lvs GAC. CCC- AMC ,2214 Asp -Pro- Asn ATC ACA TCC_ 226 8 -Cle Th&:-Ser TCCI- ATA_ GCA _G ,2241 Ser t-Ile Aid 0 ro AC4 CTT ATC GGC 2295 Thr Leu- MET G1 765 GAT CTG CGC CAG 2349 Asp Leu Arg Gin 785 CTG GCC AAT GAC 2403 Leij Ala Asn Asp 800 GTC ATC CCT TTA 2457 Val Ile Pro Lou 820

TCT

Ser 750

AGC

-Ser'

TTG*

Leiu CAA GTC AAC GGA--CAT GAG Asn Gly His ,Glu 770-

_CAG

Giu CCA ACA Pro Thr 805 TCG ACC Ser Thr CGT GTG.ATG Arg Val MET 790 TCT CTT CGG Ser Leu Arg MAC TCG GGC Asn Ser Gly 825 ~755 TTT. GTT _2322 Ph-_ Val.

CAG CTC 2376 Gin Leu MAA MAC 2430 Lys Asn 810 CTC ATT 2484 Leua le

V

'i

IA

N

I

-4 9.

U-

I

-CC TGG1-GTT C.CC CAC lTG7 GAC :A CTG' CAC :GCC CTC _A C CGG Glj :Ttp VaT l rit. Cys sT Leu His. Ala- Leu -le, Arg 830 83n 4 AAG TOCT CT&C AAC _A7C GAG CAT CC~C~ Lys FS LyLsle Leu Leu ASa- Ile tUu His 'Ar lie N I I..eu A ZT GAC CAC TIC AC1 GIEG A TG CAGIAG IG 'GA G G ~TGT -ASp Tyr Asp 41is-e h Leu -MET "Gi Ly I' -luVal Phe _ZAT AA;' -ZCA 6-C'i7 CGGr GAC GAC CTG GCC AAG GG CGG CTG 2 673 Asr Asn Tr rAla .G1 vs As Le l ys Leu Leu Trp Leu LCC CG GTG TTT 'Lix. CGAk Ak-%c 'AAT 'AT _ACC _CGT TCT Se 0-Val_ Tr6n 1 -ie _spo Aro .Ar-g Thr.. Asn Tyr Thr lj-:igbe 2 TC CGGG -TAT:Ar T GGC CT -GA GAT AGA: A'C C c 2M8 Sec'- MET Va 1 :Gl Tx.'Ir- iie Leu Gly Leu Gly Asp Arad-.; Pro 92S930 CTG. CG -CCC ACT GOG ":LkG ATC C±G ,,CAC ATT CGLC T T GGG Le ?83L5Ao Pe l Le s rg eu Ser- Cly Lys Ilie Leu Hi.s 1 s h 44 950 GCC AC AGGC GAIG Asp. TC- CCT GCu 2 592 Ara, MET Ala Pro G.AG-CkT CGCC GTC Glu Hrs -Ala Vai_ 680 AAAGC CCC AGC -2700 Lv -_Se r Pro Ser Asp Cys AGA C-IA 900 C-IC ATG 12754 Va:T M ET GIG ATG 2808 Leu 'NET TIT GAG r2862 Phe :G lu -ACA AGA 2916 Thr- Arg ATC ACA 2970 Ile Thr 990 GCC GIG 3024 A !aVal GIT C ATG ACC CGA GAG SLAG TTT GCA GAG 'AAG ATlT CCA TIT Val A la ATG TIC MET Leu MET Thr Arg Glu Lys Phe Pro Glu Lys Pro 960 965 ACC ANT GCT ATG GAG GTT ACA GGC GIG GAT' GGC 2943 Ihr Asn Ala MET. Glu Val Thr Gly Leu Asp Gly 975 980 985 ACA GIG AT-- GAG GTG GIG CGA GAG CAC AAC GAG 2991 Thr Val MET Clu Val Leu Arg Glu His Lis Asp 995 1000o Phe Arg Leu AAC TAC AGA Asn Tyr Arg ICC CAC Cys His GTCj ValI 1005 CTG G.AA GCC TTT GTCI TAT GAG CCC TTIC GIG AAC TGG AGG GIG ATG GAC ACA AAT 3051 3078 Leu Glu Ala ?he Val. Tyr Asp Pro Leu Leu Asn Trp Arg Leu MET Asp Thr.Asri 1010 101iS 1020 1025: NCC CGC AAC AAG CC-A TCC CG.A ACG AC-C ACC- GAT TCC TAC TCT C-CT C-CC CAG 3105 Thr Lys Gly Asp Lys Arq Ser Ara Thr.Arc Ttr Asp Ser Tv'r Ser Ala ClV G!, 1030 1035 1040 TCA GTC C-AA ATT TTO C-AC C-GT GTG GAIA CTT GGA GAG CCA C-CC CAT AAG A2,A ACG 3159 3186 Ser Val C-lu Ile Leu Asp Gly Val C-lu Leu GlY Clu Pro Ala Hi s Lvs Lvs Thr 1045 1050 l055 1060 C-C-C ACC ACA GTG CCAk CAA TCT ATT CAT TCT TTC ATT C-CA C-ALC GOT TTC- C-TC AAA, 3213 3240 Glv Thr Thr Val Pro C-lu Se-r Ile His Ser Phe Ile Gly Asp Gly Leu'Val Lys 1065 1070 1075 1080 CCA C-AC- C-CC CTA h r AA LC- CCT- ATC CAC- ATT ATT A.4C A-C C-TT CCA C-AT AAG 3267 3294 Pro Glu Ala Leu Asn' Lys Lvs Ala Ile C-in Ile Ile Asn Arg ValArg Asp Lys 1085 1090 109r 20 CTC ACT C-CT CGG C-AC TTC TCT CAT CAT -AC 'TTC CAT Ai~C ACC-e; T Leu Thr Clv Arg As-_ Phe Se- His Aso Asp h e s a~~oTrCbV 1100 lO'10 1 GAC- CTC- CTC ATC AA CA..L CG -sPrCCR CAACCCT-LCC G XTT~ Gl- -Lu11420v Gin ±3 2 GGC TOGTAC2 CCT TTC IC-- T' Ty- ro.Pe-T- 4 1135N

Claims (25)

1. A protein of mammalian origin having a molecular weight of from about kDa to 800 kDa which binds to a GST-FKBP-Rapamycin complex, or a fragment of such a protein.

2. A protein as claimed in Claim 1 having a molecular weig-hE of from about kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa, about 148 kDa, about 208 kDa or about-210 kDa, which binds to a GST-FKBP- Rapantycin complex.

3-A protein as claimed in Claim I or Claim 2 which is of human originM.

4. A recambinantly produced protein comprising at least part of the nmino acid sequence of a protein of mam malian orign having a molecular weight of from about kDa to 800 kfla which binds to a GST-FKBP-Rapaxnycin complex. A recombinantly produced protein as claimed in Claim 4 comprising at least part of the armino acid sequence of a protein, of mammalian origin having a molecular weight of from about 50 kDa to 500 kDa, suitably from about 100 kDa to 300 k~ suitably about 125 kDa, about 148 kDa, about 208 kDa or about 210 tDa, which bids to a GST-FKBP-Rapamycin complex.

6. A reconibinantly produced protein as claimed in Claim 4 or which has at least a segment which has at least 20 (preferably at Iea= 30%, preferably at least 40%7a, preferably at least 50%, preferably at least 60%, preferably at least preferably, at least 80%6, preferably at least 90%, preferably at least 95%) amino acid sequence homology with the protein of mammalian origin which binds to a GYST-FKBP- Rapamycin complex.

7. A protein as claimed in any one of Claims I to 6 which includ s one or More of the following internal amino acid sequences: a) ILNIEHR; b).-LIRPYNMKJC -52- C) DXM.EAQBO; and d) QLDHPLPTVHPQVTYAYM(K) S. cD)NA which encode-R at least part of the sequence of a prote in of mammalian origin having a molecular weight of from abouL 50 kDa to 800 kDa which binds to a GST-FKBP-Rapamyc-in complex-

9. cDNA as claimed in Claim 8 which encodes at least part of the sequence of a protein of mammalian origin having a molecular weight of from about 5CI kDa to 500 kDa, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa, about 148 4 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex. A cDNA as claimed in Claim 8 or Claim 9 which encodcs at least parn Of a 210 kDa protein including one or more of the following internal am-ino acid sequences: a) LLLNIBHR; b) LIRPYMEPILK; .f c) DXMEAQB; and 7 d) QLDHiPLPTVHPQ=TAYM(K)

11. DNA encoding for at least part of the amino acid sequence of a protein of mamnmaliaa-origin having a molecular weight of from about 50 kDa to 800 kDa-which binds to a GST-FKBP-Rapamycin complex. 77 12. DNA as claimed in Claim I1I encoding for at least part of the; ;mino acid sequence of a protein of mammalian origin having a molecular weight of froi i about kDa to 500 kDa, suitably froum about 100 k.Da to 300 kDa, suitably about M2± kDa, about 148 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex14

13. AD~slaimcd in Claimn 1I orii 12 in whichthecprotcin of mammalian origin includes one or more of the- following internal amnino acid sequences: 4A -53- a) LLLNIEHR4 b) LIRPYMEPILK-. c) DXMEAQE; and d) QLDHPL-PT'VIPQVTYAYM(K)

14. Antisense RNA derived from a cDNA clone, the cDNA ca. 'e enicoding for at least part of the amino acid sequence of a protein of mammalian oriiain havin- a molecular weichr of from about 50 kDa to 800 kDa which binds to a (.ST-FKBP- Rapamycin complex. Antisense RNA as claimed in Claim 14, wherein the cDNA clone encodes for at least part of the amino acid sequence of a protein of mammalian origin having a molecular weight of ftrm about 50 kDa to 500 I~a, suitably from about 100 kDa to 300 kDa, suitably about 125 kDa, about 148 ]cDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex.

16. An anrisense RNA as claimed in Claim 14 or Claim 15 derived from a cE)NA clone encoding for at least part of a protein of mammalian origrin including one or more of the following internal amino acid sequences: a) ILLNIBHR-, b) LIRPYMEPIIJC; c) DXIAQE; and d) QLDHPLPTVHPQVTYAYM(K)

17- Antisense DINA derived from a cDNA clone, the cDNA clone encoding for at least part of the amino acid sequence of a protein of manmmalian origin having a molecular weight of from about 50 kDa to 800 kDa which binds to a G'ST-FKBP- Rapamnycin complex. 1. Antisense DNA as claimed in Claim 17 wherein the cDNA clone encodes for at least Part Of the amnino acid sequence of a protein of mammalian origin having a molecular weight of from about 50 kDa to 500 kDa, suitably from, about 100 kDa to 300 W-~ -54- kDa, suitably about 125 kDa, about 148 kDa, about 208 kDa or about 210 kDa, which binds to a GST-FKBP-Rapamycin complex. i9. An antisense DNA as claimed in Claim 17 or Claim 18 derived from a cDNA clone encoding for at least part of the amino acid sequence of a protein of mammalian origin which includes one or more of the following internal a=in;, acid sequences: a) ILLNIEHR; b) LIRPYbMPILK; c) DXMEAQE-; and d) QLDHPLPTVHPQVrYAYM(K) A proces for isolating a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP- Rapamaycin complex from mammalian cells, the process comprising: a) lysiag the mammalian cells in the presence of a buffering agent, a chelating agent, a protease inhibitor, and a reducing agent and preferably a low salt at a temperature which minimizes protein degradation, the lysing creating unbroken cells, cell nuclei, and lysates. the lysates including cellular membrane fractions and cellular debris; b) preclearing unbroken cells and cell nuclei from the lysates at a temaperature which minimizes protein degradation to create a precleared iys ate;. c) concentrating the cellular membrane fractions of the mammalian cells from the precleared lysatc, the membrane ftdctions containing membrane proteins, d) solubilizing the membranie proteins in a buffer containing a detergent which solubilizes the proteins, without detrimentally denaruring the proteins, at a temperature which. minimizes protein degradation, resulting in solubilized proteins and mammalian clluLar debris; e) separating the solubilized proteins, from the mammalian cellular debris; iji tf) incubating a solution containing the solubilized protisna buffer, the buffer containing a buffering agent, a reducing agent, one or more protease iNibitor(s), divalent cations and p~referably a salt, with an affinity matrix to absorb to the affinity matrix those proteins which have anI binding affinity to the affinity matrix at a temperature which allows binding to the affinity matrix and minimizes protein degradation-, g) separating the affinity Matrix from the solution of step at a temperature which Minimizes protein degradation, yielding a solution containing 1% solubolized proteins which do not bind to the affinity matrix in step hi) incubating the solution with Rapanlycin or a Rapamnycin analog (IC50 in LAP 500nM)corrnplexed to a fusion protein of FEB12+potein, thc fusion protein enhancizng the isolation of the desired abou 125 kDa protein, about 148 kDa, about 208 kDa, or about 210 kDa yielding a mixture containing the dcsired V. proteins having a molecular weight of about 125 kDa, about 148 kDa. about 208 kDa. or I-atabout 210 kDa bound to a fusion FKBP protein :Rapamycifl complexes or fusion FKBP protein :Rapamnycin -analog complexes;. i) incubating the mixture (hi) containing the desired proteins having a molecular weight of about 125 kDa, about 148 kDa, about 208 kfla, or about 210 kDa bound to fusion FKBP protein :Rapamycin complexes or fusion FKBP protein :Rapamycin analog complexes with an affinity matrix which binds to the fusion protein at a temperature and for a time which allows the binding to the affinity matrix and minimizes protein degradation, bound to a fusion FKBP protein :Raparnycin complexes or fusion FKBP protein :Rapamnycin analog complexes; j) rinsing the affinity matrix containiing the bound complexes with a buffer which dissociates binding of proteins other than the desired about 125 kDa. about 148 k.Da, about 208 kDa. or about 210 k.Da proteins;0" k) eluting the about 125 kDa. about 148 kDa, about 208 kDa, or about 210 O~a protein: fusion FKBP protein- rapamycill complexes fusion or the 125 I k~a protein:MKP protein:rapamycin analog complexes from the affinity matrix Ci) with k~i a buffer; -56- I) separating the proteins cluted in step by size.

21. A method for identifying an irumunomodulatory or anti-tumor agent, comprising the steps ofh a) combining a substance to be tested with a protein as claimed in any one of Claims I to 5 which binds to an FKBP-Rapamycin complex, the protein preferably being bound to a solid support: b) maintaining the substance to be tested and the protein (preferably bound to a solid support) of step under conditions appropriate for binding of the substance to be tested with the protein, and c) determining whether binding of the substance to be tested occurred in step

22. ,A method of Claim 21 in which the mammalian protein includes one or more of the following internal amino acid sequences: a) ILLNtEHR; b) LIRPYMEPILK; c) DXMvEAQE; and d) QLDHPLPTVHPQVTYAYM(K)

23. A method for identifying an irumunomodulatory or anti-tumfor agent. comprising the steps of: a) combining a substance to be tested with a protein as claimed in any one of Cla imns. 1 to 5 which binds to an FKBP-Rapainycin complex, the protein preferably being bound to a solid support b) maintaining the substance to be tested and the protein (preferably bound ~to a solid support) of step under conditions appropriate for binding of dhe substance to be tested with the protein, and A -57- c) determining, whether the presence of the substance to be tested modulated the activity of the protein which binds to an FKBP-Rapamaycin comnplex.

24. A method of Claim 23 in which the protein includes one or more of thc following internal amino acid sequences: a) TLLNIEH-R; b) LIRPYMEPILK; c) DXMEAQE; and d) QLD)HPLPTVHiPQVTYAYM(K) cc. A method for detecting, in a biological sample, rapamycin, rapaniycin analogs or rapamycin metabolites which, when cornplexed with a FKBP, bind to a mammalian protein having a molecular weight of about 125 kDa, about 148 kl~a, about 208 kDa, or about 210 kDa which binds to a GST-F1BP-Rapamycin complex. the method comprising the steps of: a) combining the biological sample with a PKBP to farm a first mixture containing, if rapamycin, rapamycin analogs or rapainycin mnetabolites are present in the biological sample, a rapamycin:FKBP complexes, raparnycin analog:FKBP complexes, or rapamycin inctabolite.FKBP complexes; b) creating a second Mixture by adding the first mixture to a protein as claimed in any one of Claims I to 5 which binds to a: OST-FKBP-Rapaznrycin complex, the protein preferably being bound to a solid support; c) maintainingr the second mixture of step under conditions appropriate for binding the rapamycin:EKBP complexes, rapamycin an.,tlog:.FKBP complexes, or rapamycin znetabolite:FKBP complexes, if present, to the pretein which binds to a GST-FKBP-Rapamycin complex; and d) determining whether binding of the rapamyciir.FKBP :.omplexes, rapamycin analog:FKBP complexes, or rapamycin mcztabolite:FKBP complexcs and the j protein occurred in step -58-

26. A method of Claim 25 in which die protein includes one or more of the following interna amino acid sequences: a) lLLNIEHR; LIRPYMEPILK;, DXMEAQE; and d) QLDHPLPTVHPQVTYAYM1(K)

27. A method for modulating the immune system of a mammial in need thereof, the method comprising administering to the mammal an iinmunornodulatory amount of antisense RNA derived from a cDNA clone which encodes for at least part of the amino acid sequence of a protcin having a molecular weight of from about 50 kDa to 1000 kDa (preferably about 125 kDa, about 148 kDa, about 208 kfla, or about 2fO kDa) which bindlsto an FKBP-Rapamycin complex. -A

28. A method of Claim 27 in which the protein includes one or more of the following internal amino acid sequences: a) LLLNIEHR;4 b) LIRPYMEPJLK;, c) DXMEAQE; and d) QLDHPLPTV]HPQVTYAYM(K)

29. A method for modulating the immune system of a mammal irf need thereof, thc method comprising administering. to the mammal an immnunorxnodulatory amount of antisense DNA derived from a cDNA clone which cncodes for at least part of the amrino acid sequence of a protein having a molecular weight of from about 50 kDa to 1000 kDa (preferably about 12.5 kDa, about 148 kDa, about 208 kDa, or about 210 kDa )which binds to an IKBP-Rapamycin complex. A method of Claim 29 in which the protein includes one or more of the folowing internal amino acid sequences: a) ILLN~iHRaM. LMYEUK -59- c) DXME.AQE; and d) QLDHiPLPTVHPQVTYAYM(K) 3'1. A protein of marmalian origin which includeq one or more of the following internal amino acid sequences: a)ILNER b) LIRPYPLK- -4 c) DXMEAQE:, and d) QLDHPLPTVHPQVTYAYM(K)

32. A recombinantly produced protein which includes one or mrore of the following inrcrnal amino acid sequences: a) ILLNTE-HR; b) LIRPYMEPLIC; c) DXMEAQE; and A4 d) QLDHPLPTVHPQVTYAYM(K)

33. A cDNA which encodes a protein which includes one or more of the following internal amnino, acid sequences: a) ILLNIEHR; b) LIRPYMP1J c) DXMEAQE;, and d) QLD)HPLPTrVHPQVTYAYM(K)

34. A DNA encoding for a protcin of mammnalian origin which includes one or more of the following internel amino acid sequences: 4 a) LLNIEHR; c) DXMAQE: and '1 d) QLDHPLPTVHPQVTYAYM(K) An antisense RNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and d) QLDHPLPTVHPQVTYAYM(K)

36. An antisense DNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences: a) ILLNIEHR; b) LIRPYMEPILK; c) DXMEAQE; and 15 d) QLDHPLPTVHPQVTYAYM(K) S37. A composition comprising a protein as claimed in any one of Claims 1 to 7 in substantially pure form, optionally in combination with a non- -m proteinous diluent or carrier. .j 38. A protein according to any one of claims 1 to 7 when isolated by a process according to claim

39. A process according to claim 20 substantially as hereinbefore described with reference to the examp'es. A protein according to claim 1 substantially as hereinbefore described with reference to the examples. DATED: 17 February, 1999 PHILLIPS ORMONDE FITZPATRICK Attorneys for: AMERICAN HOME PRODUCTS CORPORATION, THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK i A4- P W j awwoRus? ~ap6T~iira~v~wx :fe: