AU777676B2 - Method for identifying species of the genus eucalyptus and primer set therefor - Google Patents

Description

S&F Ref: 509005

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT

ORIGINAL

0 Name and Address of Applicant: Actual Inventor(s): Address for Service: Invention Title: Nippon Paper Industries Co., Ltd.

4-1, Oji 1-chome Kita-ku Tokyo Japan Eiji Kojima Manabu Matsuda Kunichika Murakami Spruson Ferguson St Martins Tower 31 Market Street Sydney NSW 2000 Method for Identifying Species of the Genus Eucalyptus and Primer Set Therefor The following statement is a full description of this invention, including the best method of performing it known to me/us:- IP Australia D2cllment rCiv2 MAY 2 2 MAY 2000 bacn No: 5845c METHOD FOR IDENTIFYING SPECIES OF THE GENUS EUCALYPTUS AND PRIMER SET THEREFOR BACKGROUND OF THE INVENTION i. Field of the Invention The present invention relates to a method for classifying species of the genus Eucalyptus based on DNA.

2. Description of the Background The genus Eucalyptus is a large evergreen woody o0 plant coming from Australia originally, and planted in all over the world mainly as building, pulp and fuel wood materials. About 600 species and subspecies are included in the genus Eucalyptus, and identification of *these species and subspecies have been carried out using external shapes, such as shapes of leaves and anthers, characters of the bark and the like, as the index in the .same manner as other plants Brooker and D. Kleinig, Field Guide to Eucalyptus, vols. 1-3 (1990)).

However, the identification using external shapes as the index are limited to a case in which the external shapes are maintained. For example, in the case of the production of pulp and paper, the wood to be used as the material is purchased and controlled on the form of wood pieces (smaller ones are called chips) in most cases.

1 In the production of pulp and paper, selection of species as the raw material is a markedly important factor for determining their production conditions and grasping fluctuation of their yields Tanabe, Proceedings of the Joint Australian/Japanese Workshop, 53-64 (1995)). However, it is almost impossible to identify species from external shapes of the wood pieces.

Thus, there is a demand for a method which can identify species using a raw material on the form of wood pieces.

As such an identification method, methods using biochemical or molecular biological techniques are proposed. For example, species of a plant can be identified without its external shape by an isozyme analysis or an analysis based on the nucleotide sequence information of DNA, such as RAPD (random amplified polymorphic DNA) analysis, RFLP (restriction fragment length polymorphism) analysis, and the like Sale and B.M. Potts, Aust. Syst. Bot., 127-138 (1993) L.H.

Rieseberg and S.M. Beckstrom-Sternberg, Systematic Botany, 16(1): 50-76 (1991)).

However, a considerably long time is passed after wood pieces which can be used as the raw material of pulp was obtained by cutting the original standing tree and processing the tree into such a shape. Consequently, activities of enzymes in the tissues have been already 2 lost, and autolysis of DNA is occurring. Thus, such wood pieces are not applied to isozyme analysis, RAPD analysis and RFLP analysis. Additionally, since microorganisms, such as bacteria, fungi and the like, are growing in such wood pieces, RAPD or RFLP analysis has a problem in that the DNA extracted from wood pieces are contaminated by DNA derived from microorganisms.

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for identifying species of the genus Eucalyptus based on the nucleotide sequence information of DNA, which is not influenced by autolysis of DNA and contamination of DNA derived from microorganisms.

Another object of the present invention is to provide a method for identifying species of the genus Eucalyptus, which can identify the original species of the material in the shape of wood pieces for use in the production of pulp and paper.

As a result of intensive studies, the present inventors found that the above objects can be achieved by repeating PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) analysis using primers having specific nucleotide sequences, and thus the present invention have been accomplished.

3 Specifically, the present invention relates to a method for identifying species of the genus Eucalyptus, comprising repeating PCR-SSCP analysis of DNA extracted from a tissue of a tree belonging to the genus Eucalyptus using at least two primer sets, each set comprising two primers having different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS:1 to 6, and judging the species of the genus Eucalyptus based on the result of the analysis.

Furthermore, the present invention relates to a primer set comprising two primers having different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS:1 to 6, wherein the primer set can partially amplify a gene of the ribulose-bisphosphate carboxylase large subunit (rbcL gene) of the genus Eucalyptus by PCR.

Moreover, the present invention relates to a combination of at least two primer sets, each primer set comprising two primers having different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS:1 to 6, wherein the primer set can partially amplify a rbcL gene of the genus Eucalyptus by PCR.

4 BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a graph showing mobility after electrophoresis of amplified DNA of the genus Eucalyptus when PCR-SSCP analysis was carried out using rbcL2 and as primers.

Fig. 2 is a graph showing mobility after electrophoresis of amplified DNA of the genus Eucalyptus when PCR-SSCP analysis was carried out using rbcL3 and rbcL6 as primers.

Fig. 3 is a graph showing mobility after electrophoresis of amplified DNA of the genus Eucalyptus when PCR-SSCP analysis was carried out using rbcLl and rbcL4 as primers.

Fig. 4 is a graph showing mobility after electrophoresis of amplified DNA of the genus Eucalyptus when PCR-SSCP analysis was carried out using rbcL4 and rbcL6 as primers.

Fig. 5 is a graph schematically showing binding positions of primers rbcLl to rbcL6 on the rbcL gene of the genus Eucalyptus.

DETAILED DESCRIPTION OF THE INVENTION The primers for use in the present invention have the nucleotide sequences represented by SEQ ID NOS:1 to 6. According to the present invention, these primers 5 are respectively called rbcLl to rbcL6. Specifically, the nucleotide sequences of rbcLl, rbcL2, rbcL3, rbcL4, and rbcL6 are shown in SEQ ID NO:1 (GAATATGATCTCCACCAGAC), SEQ ID NO:2 (CGTCCCCTATTGGGATGTAC), SEQ ID NO:3 (AACTCACAACCATTTATGCG), SEQ ID NO:4 (AATCACAGGCTGAAACAGGT), SEQ ID (GTAGTCATGCATTACGATAG), and SEQ ID NO:6 (ATAACTGCATGCATTGCACG), respectively. Such primers can be synthesized easily using a commercially available DNA synthesizer. However, it is important according to the present invention that these primers have any of the nucleotide sequences shown in the SEQ ID NOS:1 to 6, so that the instrument and method for synthesizing these primers are of no importance, and the effects of the present invention are not influenced by the difference S* in instruments and methods.

According to the present invention, PCR is carried out by selecting two different primers (hereinafter referred to as "primer set") from the above-described six primers, rbcLl to rbcL6, and using DNA extracted from a tissue of a tree belonging to the genus Eucalyptus as the template, and then the DNA amplified by this PCR is subjected to SSCP analysis. In selecting primers which constitute the primer set, a 6 combination which can at least partially amplify the DNA which is applied to PCR is selected taking the primerhybridizing positions on the DNA into consideration.

Any one of primer sets selected in this manner from the primers rbcLl to rbcL6 of the present invention can partially amplify a rbcL gene of the genus Eucalyptus by PCR, and species of the genus Eucalyptus can be identified based on the result. The hybridizing positions of these primers rbcLl to rbcL6 on the rbcL gene are schematically shown in Fig. Extraction of DNA from a tissue of a tree S. belonging to the genus Eucalyptus can be carried out by a known method, such as CTAB, SDS or the like, or an optionally modified method thereof. For example, in a case in which total DNA is extracted from wood pieces of a tree of the genus Eucalyptus using the CTAB method, .".DNA can be obtained in an amount sufficient enough for carrying out the subsequent PCR-SSCP analysis when at least about 100 mg of wood pieces is available as the sample.

The PCR is carried out by mixing the thus obtained DNA with a primer set selected as described above, dNTP (a general term for dATP, dTTP, dGTP and dCTP), and DNA polymerase in a PCR reaction buffer, and 7 reacting the mixture repeatedly with appropriate temperature cycles.

Also, the PCR conditions can be optionally selected in such a manner that proper results can be obtained by the subsequent SSCP analysis, namely, the clearest electrophoresis patterns can be obtained when the thus amplified DNA is subjected to SSCP analysis.

In general, good results can be obtained when from 25 to ng of DNA is mixed with from 2.5 to 10 pl of 10 x PCR reaction buffer, from 0.2 to 0.5 pM of each primer, from 20 to 200 pM of dNTP, and from 1 to 2.5 U of DNA polymerase, and then the mixture is diluted to a total volume of from 25 to 100 pl and subjected to the reaction with the following temperature cycles. Since the 10 x PCR reaction buffer, dNTP and DNA polymerase are commercially available, they can be used.

Temperature conditions in PCR: Step 1: 94 to 96 0 C for about 7 min. 55 to 58°C for about 0.5 to 1 min. 70 to 74 0 C for about 1 to 2 min., 1 cycle Step 2: 94 to 96 0 C for about 1 min. 55 to 58 0 C for about 0.5 to 1 min. 70 to 74 0 C for about 1 to 2 min., 28 cycles 8 Step 3: 94 to 96 0 C for about 1 min. 55 to 58 0 C for about 0.5 to 1 min. 70 to 74 0 C for about 5 to min., 1 cycle The SSCP analysis is a method in which the DNA fragments amplified by the PCR are made into single strands by adding formamide, followed by heat denaturation, and the single strands are subjected to electrophoresis to detect differences among nucleotide sequences of the DNA fragments based on their mobility.

Generally, formamide is added as a formamide loading buffer (95% formamide, 10 mM EDTA (pH 0.05% Bromophenol Blue, and 0.05% of xylene cyanol), and the heating is carried out at a temperature of from 85 to •95 0 C. The amount of the formamide loading buffer to be added is decided depending on the amount of DNA to be denatured. For example, good results were obtained in the following Examples by carrying out PCR under the above-described conditions and then adding 16 il of the formamide loading buffer to 4 pl of the DNA sample after amplification.

Also, the electrophoresis is carried out using non-denaturing polyacrylamide gel as the carrier. In this case, the electrophoresis is preferably carried out at the concentration of acrylamide of from 5 to 10 w/v%, at a temperature of from 4 to 10 0 C and under a voltage 9 of from 60 to 100 V. When electrophoresis of denatured DNA samples is carried out under such conditions, clear electrophoresis patterns with large difference in mobility among the samples can be obtained using x TBE buffer (45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA). However, in some cases, separation among samples can be further improved by adding up to 10 w/v% of glycerol to this buffer.

Also, the results of the electrophoresis thus carried out can be detected using a known method, such as ethidium bromide method or the like. That is, the mobility can be measured by treating the polyacrylamide gel after electrophoresis by such a known method and then detecting the mobilized single-strand DNA bands.

The identification of species according to the present invention is carried out by repeating the PCR- SSCP analysis of DNA extracted from the same Eucalyptus species. The primer set for use in PCR is changed in each repetition. For example, when rbcLl and rbcL2 are used as the primer set in the first PCR-SSCP, the subsequent PCR-SSCP must be carried out using primer sets other than rbcLl and rbcL2. In this case, however, there is no problem if both of these two primers are not used as a primer set. In other words, rbcLl and rbcL3 can also be used in the subsequent PCR-SSCP analyses.

10 As described above, the primer set selected from rbcLl to rbcL6 of the present invention partially amplifies the rbcL gene when PCR is carried out using the same, but the portion to be amplified is different for each primer set. Thus, even in DNA samples extracted from Eucalyptus tissues belonging to the same species, the DNA amplified by PCR is different if the primer set is different. On the other hand, in DNA samples extracted from Eucalyptus tissues belonging to different species, the number of bases and the sequences of the DNA samples amplified by PCR may be different from each other even if the same primer set is used.

Accordingly, they are divided into several groups by SSCP analysis based on the difference in mobility.

Accordingly, when the primer set of the present invention is used in the PCR-SSCP analysis as described above, each species of the genus Eucalyptus is divided into groups by different electrophoresis patterns based on the mobility of DNA samples amplified by each primer set used in the PCR. The identification of species can be carried out using such a difference in behavior of each primer set as the index.

The present invention can be applied to species of the genus Eucalyptus, such as Eucalyptus bicostata, Eucalyptus camaldulensis, Eucalyptus citriodora, 11 Eucalyptus globulus, Eucalyptus grandis, Eucalyptus maidenii, Eucalyptus nitens and Eucalyptus urophylla (hereinafter referred to as bicostata", camaldulensis", citriodora", globulus", grandis", maidenii", nitens", and urophylla", respectively). These may be either standing trees or cut wood materials. Also, according to the present invention, the DNA applied to PCR-SSCP analysis may be extracted from any tissue thereof.

The primers rbcLl to rbcL6 shown in SEQ ID NOS:1 I to 6 are designed in such a manner that a certain S..o segment of the rbcL gene of the genus Eucalyptus is partially amplified when PCR is carried out using a primer set selected therefrom. The rbcL gene relates to carbon dioxide fixation in the photosynthesis and is present on the chloroplast DNA. Microorganisms, such as bacteria, fungi, and the like, do not have such a gene.

Therefore, even if a sample applied to PCR is contaminated with DNA of such microorganisms, the DNA is not amplified by PCR and does not exert influence upon the results of SSCP analysis so long as the primer set of the present invention is used. Consequently, the present invention can be applied to wood pieces materials etc. in which microorganisms, such as bacteria, fungi and the like, are growing, and can judge 12 species of the genus Eucalyptus based on the nucleotide sequence information of DNA without taking influences of such microorganisms into consideration.

Also, according to the PCR-SSCP analysis in the present invention, slight difference in the nucleotide sequence of a relatively short length DNA molecule can be detected. That is, the DNA amplified by PCR is subjected to electrophoresis as a single strand in this analysis, and the single stranded DNA has a different secondary structure depending on its nucleotide sequence, vc..

so that it is detected by the electrophoresis as a relatively large difference in mobility even if the difference in nucleotide sequence is small.

Consequently, autolysis of DNA, which causes a problem in identification of species using the RAPD or RFLP analysis, does not cause a problem in the method of the *...present invention. Also, difference in the nucleotide -sequence of the rbcL gene among species of the genus Eucalyptus, which is probably not so large, can be o detected by the method of the present invention.

On the other hand, there are unlimited number of primers which can be used for the partial amplification of the rbcL gene of the genus Eucalyptus. Also, among these primers, a little over ten can be considered as primers which can be applied commonly to the genus 13 Eucalyptus and can amplify a region where a certain difference is present depending on its species, namely primers which are considered to be useful in the identification of species of the genus Eucalyptus.

However, according to tests carried out in the present invention, all primers of a little over ten cannot be always used in the identification of species of the genus Eucalyptus. That is, when the PCR-SSCP analysis is carried out on DNA samples extracted from various species of the genus Eucalyptus using primer sets J selected from these primers, difference in the mobility s.-.among these DNA samples can be detected only when primer sets selected from the primers rbcLl to rbcL6 shown in SEQ ID NOS:1 to 6 are used and, surprisingly, species of the genus Eucalyptus can be identified by repeating the PCR-SSCP analysis using these primer sets selected from only six primers.

*0 According to the present invention, species of the genus Eucalyptus can be identified based on the

S..

nucleotide sequence information of DNA without

S*

influences of autolysis of DNA and contamination of microbial DNA.

Thus, according to the present invention, species of the genus Eucalyptus can be identified even if the tree is cut and processed on the form of wood pieces and 14 a considerable period of time is passed after its felling.

Consequently, the present invention can be applied to efficient material control etc. in the pulp and paper industry using a tree of the genus Eucalyptus and in the other forest industries.

The present invention will be explained below based on the following examples; however, the present invention is not limited thereto.

Example 1 I. Extraction of total DNA from various species of the genus Eucalyptus Using the CTAB method, total DNA was extracted from each of E. bicostata, E. citriodora, E. globulus, E. grandis, E. maidenii, E. nitens and E. urophylla.

Specifically, 100 mg of fresh leaves of each of these species were frozen with liquid nitrogen and pulverized and then added to 0.75 ml of CTAB solution (2 w/v% cetyltrimethylammonium bromide, 1.4 M sodium chloride, 20 mM EDTA, 100 mM Tris-HCl, 0.2 v/v% 2mercaptoethanol) and incubated at 60 0 C for 30 minutes.

Next, the same volume of chloroform isoamyl alcohol (24 1) mixed solution was added thereto, followed by mixing, the mixture was centrifuged (at 15,000 rpm and 15 4 0 C for 15 minutes) to recover the supernatant, and the supernatant was mixed with 0.5 ml of isopropyl alcohol and then allowed to stand at room temperature for 2 hours to precipitate a mixture of DNA and RNA. The thus precipitated mixture was again centrifuged (at 15,000 rpm and 4 0 C for 20 minutes) to separate it in the form of pellets and subsequently dissolved in 0.2 ml of TE buffer (1 mM EDTA (pH 10 mM Tris-HCl (pH the resulting solution was mixed with 1 [il of 10 mg/ml ribonuclease (manufactured by Wako Pure Chemical Industries), incubated at 37C for 30 minutes to hydrolyze RNA, and then mixed with 0.1 ml of 7.5 M ammonium acetate and 0.75 ml of ethanol to precipitate total DNA. The thus precipitated total DNA was centrifuged (at 15,000 rpm and 4°C for 20 minutes), and the resulting pellets were dissolved by adding 0.1 ml of TE buffer and subjected to the subsequent procedure.

The amount of the thus obtained total DNA per 1 pl TE buffer was 15 ng/pl in the case of E. bicostata, 86 ng/pLl in E. citriodora, 155.5 ng/ipl in E. globulus, 44.5 ng/pl in E. grandis, 105 ng/.Ll in E. maidenii, 17.5 ng/pl in E. nitens and 11.5 ng/pil in E. urophylla.

o o oe* 16 II. Isolation of rbcL gene and determination of its sequence To 50 ng of the total DNA of each species of the genus Eucalyptus obtained in the above procedure I, pM of each of known rbcL gene amplification primers, PrL1: 5'-GTCCGATTCAAAGCTGGTGT-3' (SEQ ID NO:7) and PrL2: 5'-TCACAAGCAGCAGCTAGTTC-3' (SEQ ID NO:8), 5 il of x PCR reaction buffer (manufactured by Takara Shuzo Co., Ltd.), 200 pM of each dNTP and 1.5 U of DNA polymerase ("TaKaRa EX Taq", manufactured by Takara Shuzo Co., Ltd.) were added, and the mixture was filled up to a total volume of 50 Vil with sterile distilled water, and then subjected to PCR by the following temperature cycles.

PCR temperature conditions: Step 1: 94 0 C for 7 min. 55 0 C for 1 min. 72 0 C for 2 min., 1 cycle Step 2: 94 0 C for 1 min. 55 0 C for 1 min. 72 0 C for 2 min., 28 cycles Step 3: 94 0 C for 1 min. 55 0 C for 1 min. 72 0 C for min., 1 cycle The thus obtained PCR products (amplified DNA) were subjected to electrophoresis (buffer: 0.5 x TBE buffer, carrier: 3% agarose gel), and the thus separated band of about 1.3 kbp was cut out along with agarose gel 17 and isolated by purifying it using a commercially available nucleic acid purification kit ("GENECLEAN SPIN KIT", manufactured by Funakoshi Co., Ltd.). In this case, all of the DNA fragments amplified by the above PCR showed the same mobility regardless of the difference among the species of the genus Eucalyptus which they were extracted. The nucleotide sequences of the isolated DNA fragments were determined by the Sanger dideoxy-mediated chain-termination method using PrLl and PrL2 as sequencing primers.

Next, a sequence common to these species of the genus Eucalyptus was detected by analyzing the thus revealed nucleotide sequences of the DNA fragments, and primers rbcLA: 5'-TGTATTTGGGTTCAAAGCCC-3' (SEQ ID NO:9) and rbcLB: 5'-GAATATGATCTCCACCAGAC-3' (SEQ ID NO:1) including the sequence of this consensus sequence were designed to carry out PCR again in the same manner as described above using, as the template, each of the total DNA preparations obtained in the above-described S: procedure I from respective species of the genus Eucalyptus.

The DNA fragments amplified by the PCR were subjected to electrophoresis in the same manner as described above, the thus separated band of about 600 bp was cut out along with agarose gel and isolated by 18 purifying it using the nucleic acid purification kit, and then its nucleotide sequence was determined by the Sanger dideoxy-mediated chain-termination method. As the sequencing primers, rbcLA and rbcLB were used. Also, in the electrophoresis of this case, all of the DNA fragments amplified by the PCR showed the same mobility regardless of the difference among the species which they were extracted.

III. Designing of primers rbcLl to rbcL6 By analyzing the nucleotide sequences of DNA fragments finally revealed in the above procedure II, a total of 11 primers including the nucleotide sequences common to the respective species of the genus Eucalyptus and also capable of amplifying segments including substantially different nucleotide sequences among these species of the genus Eucalyptus were designed and synthesized using a DNA synthesizer. Using these primers, each of DNA samples extracted from wood pieces of each species of the genus Eucalyptus was subjected to PCR-SSCP analysis, and primers rbcLl to rbcL6 having the nucleotide sequences shown in SEQ ID NOS: 1 to 6 were "selected as the primers which can achieve the objects of the present invention, and used in the following identification method of species of the genus Eucalyptus.

19 Also, as is apparent from the procedure II, each of these primers is designed in such a manner that it can amplify a certain segment of the rbcL gene of the genus Eucalyptus. Additionally, the rbcLl is identical to the above-described rbcLB.

IV. Identification of species of the genus Eucalyptus Extraction of total DNA from wood pieces of each species of the genus Eucalyptus About 100 mg of a wood piece (chip) of E. bicostata, E. camaldulensis, E. citriodora, E. globulus, E. grandis, E. maidenii, E. nitens or E. urophylla was scraped thinner with a knife and frozen Swith liquid nitrogen, and then total DNA was extracted in the same manner as described in the procedure I.

**Also, since the total DNA extracted from wood contains many impurities, it was purified by a nucleic acid purification kit and subjected to the following PCR-SSCP analysis.

PCR-SSCP analysis To 50 ng of the total DNA of each of E. bicostata, citriodora, E. globulus, E. grandis, E. maidenii, E. nitens and E. urophylla extracted in the above step 0.5 LM of each of rbcL2 and rbcL5 as PCR primers, 20 1p of 10 x PCR reaction buffer, 200 pM of each dNTP and U of DNA polymerase were added, and the mixture was adjusted to a total volume of 50 p1 with sterile distilled water and then subjected to PCR by the following temperature cycles.

Step 1:94°C for 7 min. 55 0 C for 1 min. 72 0 C for 2 min., 1 cycle Step 2: 94 0 C for 1 min. 55 0 C for 1 min. 72 0 C for 2 min., 28 cycles Step 3: 94 0 C for 1 min. 55'C for 1 min. 72 0 C for min., 1 cycle The SSCP analysis was carried out by adding 16 p1 of the above-described formamide loading buffer to 4 il of the thus obtained PCR product, heating the resulting mixture at 95 0 C to effect denaturation, and subjecting it to electrophoresis for 3.5 hours at 4 0 C and under a voltage of 100V using 5 w/v% of non-denaturing polyacrylamide gel as the carrier. Also, the gel after the electrophoresis was soaked in 200 ml of 0.5 x TBE S: buffer supplemented with ethidium bromide (final ethidium bromide concentration, 0.5 pg/ml) and shaken for 5 to 10 minutes, and then the gel was irradiated with ultraviolet light to detect DNA mobilized by the electrophoresis.

The results are shown in Table 1 and Fig. 1.

21 In Fig. 1, lanes 1 to 7 in the electrophoresis correspond to E. bicostata, E. citriodora, E. globulus, E. grandis, E. maidenii, E. nitens and E. urophylla, respectively.

As apparent from Fig. 1, when the DNA samples extracted from these Eucalypti are amplified using rbcL2 and rbcL5 as the PCR primers, the thus amplified products of DNA can be divided into 3 groups based on their mobility by the PCR-SSCP analysis. Accordingly, these groups were named Groups A, B and C conveniently as described in Table 1. That is, E. citriodora belongs to Group A, E. globulus belongs to Group B, and E. bicostata, E. grandis, E. maidenii, E. nitens and

*S

E. urophylla belong to Group C.

Also, when the above-described PCR products were 3 subjected to electrophoresis (buffer: 0.5 x TBE, carrier: 3% agarose gel) without heat denaturation, difference in the mobility among these species was not found.

Using 0.5 [iM of each of rbcL3 and rbcL6 as PCR primers, 50 ng of the total DNA extracted in the above step from E. bicostata, E. citriodora, E. globulus, E. grandis, E. maidenii, E. nitens or E. urophylla was subjected to PCR-SSCP analysis in the same manner as 22 described in (in this case, 10 w/v% of glycerol was added to the 5 w/v% polyacrylamide gel used as the carrier, and the electrophoresis was carried out for 4 hours).

The results are shown in Table 1 and Fig. 2.

In Fig. 2, lanes 1 to 7 in the electrophoresis correspond to E. urophylla, E. nitens, E. maidenii, E. grandis, E. globulus, E. citriodora, and E. bicostata, respectively.

As apparent from Fig. 2, though the DNA samples were extracted from the same species of the genus Eucalyptus used in when they were amplified using S: rbcL3 and rbcL6 as PCR primers, the thus amplified products of DNA were divided into 2 groups showing different mobility from the case of Accordingly, these groups were named Groups A and B conveniently as described in Table 1. These group names do not correspond to the group names used in In this case, E. bicostata, E. globulus and E. nitens belong to Group A, and E. citriodora, E. grandis, E. maidenii, and E. urophylla belong to Group B.

Also, the above-described PCR products were also subjected to electrophoresis (buffer: 0.5 x TBE, carrier: 3% agarose gel) without heat denaturation, but 23 difference in the mobility among these species was not found.

Using 0.5 pM of each of rbcLl and rbcL4 as PCR primers, 50 ng of the total DNA extracted in the above step from E. bicostata, E. camaldulensis, E. globulus, E. grandis, E. maidenii or E. nitens was subjected to PCR-SSCP analysis in the same manner as described in (in this case, the electrophoresis was carried out for 5 hours).

The results are shown in Table 1 and Fig. 3.

In Fig. 3, lanes 1 to 6 in the electrophoresis correspond to E. nitens, E. maidenii, E. grandis, S. E. globulus, E. camaldulensis, and E. bicostata, respectively.

As apparent from Fig. 3, when the DNA samples extracted from these Eucalypti were amplified using rbcLl and rbcL4 as PCR primers, the thus amplified products of DNA were divided into 4 groups showing different mobility from the case of and based on the mobility by the PCR-SSCP analysis. Accordingly, these groups were named Groups A, B, C and D conveniently as described in Table 1, though these group names do not correspond to the group names used in (a) and In this case, E. bicostata belongs to Group A, 24 E. camaldulensis and E. grandis, belong to Group B, E. globulus and E. maidenii belong to Group C, and E. nitens belongs to Group D.

Also, the above-described PCR products were also subjected to electrophoresis (buffer: 0.5 x TBE, carrier: 3% agarose gel) without heat denaturation, but difference in the mobility among these species was not found.

Using 0.5 pM of each of rbcL4 and rbcL6 as PCR primers, 50 ng of the total DNA extracted in the above step from E. globulus, E. grandis, E. maidenii, S: E. nitens or E. urophylla was subjected to PCR-SSCP analysis in the same manner as described in (in this case, 10 w/v% of glycerol was added to the 5 w/v% polyacrylamide gel used as the carrier, and the electrophoresis was carried out for 4 hours).

The results are shown in Table 1 and Fig. 4.

In Fig. 4, lanes 1 to 5 in the electrophoresis correspond to E. urophylla, E. nitens, E. maidenii, E. grandis, and E. globulus, respectively.

As apparent from Fig. 4, when the total DNA extracted from these Eucalypti was amplified using rbcLl and rbcL6 as PCR primers, the thus amplified products of DNA were divided into 3 groups showing different 25 mobility from the case of and by PCR-SSCP analysis. Accordingly, these groups were named Groups A, B and C conveniently as described in Table 1, though these group names do not correspond to the group names used in and In this case, E. globulus and E. nitens belong to Group A, E. grandis and E. maidenii belong to Group B, and E. urophylla belongs to Group C.

Also, the above-described PCR products were also subjected to electrophoresis (buffer: 0.5 x TBE, carrier: 3% agarose gel) without heat denaturation, but difference in the mobility among these species was not found.

Table 1 rbcL3/rbcL6 rbcLl/rbcL4 rbcL4/rbcL6 E. bicostata C A A E. camaldulensis B E. citriodora A B E. globulus B A C A E. grandis C B B B E. maidenii C B C B E. nitens C A D A E. urophylla C B C 26 Identification of species Table 1 summarizes results of the PCR-SSCP analysis carried out in the above procedure According to this, when the PCR-SSCP analysis is carried out, for example, using only a primer set of rbcL2 and E. citriodora and E. globulus can be identified from each other based on the difference in the mobility of DNA amplified by this primer set, but E. bicostata, E. grandis, E. maidenii, E. nitens and E. urophylla cannot be identified from each other. However, when the PCR-SSCP analysis is repeated using a primer set of rbcL2 and rbcL5, a primer set of rbcL3 and rbcL6 and a primer set of rbcLl and rbcL4, E. bicostata, E. grandis, E. maidenii and E. nitens can be identified from each other by comparing mobility of DNA amplified by each of these primer sets and studying the integrated results.

The reason for this is that, when the PCR amplification is carried out using these primer sets, the mobility of DNA by the SSCP analysis showed the pattern of C, A, A

-XX-

in E. bicostata; the pattern of C, B, B in E. grandis; the pattern of C, B, C in E. maidenii; and the pattern of C, A, D in E. nitens. On the other hand, E. urophylla can be identified from E. grandis or E. maidenii when the PCR-SSCP analysis is repeated in the same manner using a primer set of rbcL2 and rbcL5, a 27 primer set of rbcL3 and rbcL6 and a primer set of rbcL4 and rbcL6. Consequently, E. bicostata, E. citriodora, E. globulus, E. grandis, E. maidenii, E. nitens and E. urophylla can finally be identified from each other by repeating the PCR-SSCP analysis using a primer set of rbcL2 and rbcL5, a primer set of rbcL3 and rbcL6, a primer set of rbcLl and rbcL4, and a primer set of rbcL4 and rbcL6.

Thus, the effects of the present invention have been described above using some species of the genus Eucalyptus as typical examples, but it can be easily understood that the present invention can be applied to I* other species of the genus Eucalyptus. Additionally, S. though only few limited primer sets were used in the above-described examples, the present invention can be applied to identification of various species of the genus Eucalyptus using other primer sets selected from rbcLl to rbcL6. Thus, application of the present invention is not limited to the species used in the examples. The present invention can be applied to various species of the genus Eucalyptus, and the various species can be identified based on the nucleotide sequence information of DNA.

28

Claims (4)

1. A method for identifying species of the genus Eucalyptus, comprising repeating PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) analysis of DNA extracted from a tissue of a tree belonging to the genus Eucalyptus using at least two primer sets, each set comprising two primers having different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS:1 to 6, and judging the species of the genus Eucalyptus based on the result of the analysis.

2. The method according to claim 1, wherein the o species which is identified is selected from the group consisting of Eucalyptus bicostata, Eucalyptus camaldulensis, Eucalyptus citriodora, Eucalyptus globulus, Eucalyptus grandis, Eucalyptus maidenii, Eucalyptus nitens and Eucalyptus urophylla.

3. A primer set comprising two primers having S" different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS:1 to 6, wherein the primer set can partially amplify a gene 29 of the ribulose-bisphosphate carboxylase large subunit (rbcL gene) of the genus Eucalyptus by PCR.

4. A combination of at least two primer sets, each-primer set comprising two primers having different nucleotide sequences selected from six primers having the nucleotide sequences shown in SEQ ID NOS: 1 to 6, wherein the primer set can partially amplify a gene of the ribulose-bisphosphate carboxylase large subunit (rbcL gene) of the genus Eucalyptus by PCR. A method for identifying species of the genus Eucalyptus, said method being, substantially as hereinbefore described with reference to any one of the examples. Dated 22 May, 2000 Nippon Paper Industries Co., Ltd. Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON C Ce [R:\LI 3M]27778.doc:mef