AU772693B2 - Detection of nucleic acid amplified products - Google Patents

Description

WO 00/58505 PCT/EP99/07127 Detection of nucleic acid amplified products The present patent application relates in particular to processes for the amplification and quantitative real-time detection of nucleic acids as well as kits for carrying out the processes.

Various nucleic acid amplification techniques (NAT), such as for example polymerase chain reaction (PCR) or nucleic acid sequencebased amplification (NASBA3), have been developed to date for the multiplication of deoxyribonucleic acids (DNA) or ribonucleic acids (RNA). Assays based on these amplification techniques are used for example for the highly-sensitive detection and/or the quantification of pathogens in the medical-diagnostic field.

DNA amplification techniques such as PCR lead to the production of large quantities of amplified target DMA (or via an initial reverse transcriptase step to amplified RNA). Usually, the amplification products are detected after a defined period by means of postamplification methods in general through hybridization (end-point analysis).

According to a new approach "TaqMan for quantitative PCR, fluorescence resonance transfer (FRET; cf. Heid et al., Genome Res. 6 (1996) 986-994) with double-fluorescence-marked DNA WO 00/58505 2 PCT/EP99/07127 probes is proposed for real-time detection of DNA amplification. A disadvantage of this method is that the probe adheres to the target until it is removed by the 5' exonuclease activity of the Taq DNA polymerase. Due to the temperature profile of the PCR, stringency can be controlled only with great difficulty, and the solution of this problem through appropriate probe design is conceivable only with major outlay. A further disadvantage of TaqMan" is the production of an equimolar signal, i.e. that only one probe molecule is split per amplified DNA target molecule per amplification cycle, which results in a comparatively weak signal.

NASBA® in contrast to thermocyclical PCR is a homogenous, isothermal in vitro amplification (cf. e.g. T. Kievits et al, J. Vir.

Meth. 35 (1991) 273-286), EP 0 329 822 as well as R. Sooknanan et al.

in "Molecular Methods for Virus Detection", D.L. Wiedbrauk and D.H.

Farkas Academic Press 1995, chapter 12, 261-285). Compared with other amplification processes, NASBA® and other isothermal reactions have the advantage that they can be carried out without particular technical outlay, as the amplification takes place at a single temperature value and these reaction conditions are retained during the whole process. The duration of each amplification step is thus not shortened either. In conjunction with the amplification efficiency, high e.g. compared with PCR, high amplified fragment concentrations are thus achieved in a short time by means of NASBA7 and other isothermal amplification techniques. A further advantage of NASBA7 compared with PCR results from the selective detection potential of RNA. This is important in particular in connection with the amplification or quantification of cellular mRNA, with which possible cellular DNA contaminations can be avoided.

A disadvantage of NASBA® and other isothermal amplification strategies is however that a real-time detection by means of fluorescence, such as with the PCR-based TaqMan® (Perkin Elmer) or Light-Cycler (Roche Diagnostics) is not possible.

wo 00/58505 PCT/EP99/07127 There are problems with the end-point analysis proposed in this connection for quantification as, in the case of detection of different target-RHA concentrations, some samples may already have reached saturation level (plateau phase), whilst other samples are still in the phase of increasing amplified fragment concentrations (cf. also Heid et al, op cit). Furthermore, this end-point analysis is more expensive and time-consuming due to additional work steps following the RNA amplification. Due to the need to open the reaction vessels for the quantification steps, there is also the risk of a cross-contamination of highly amplified RNA and DNA targets.

Leone et al. (Nucleic Acids Research 26 (1998) 2150-2155) proposed an approach to the real-time detection of NASBA®-amplified RNA in which a double-fluorescence-marked DNA probe is used. In contrast to the PCR process (cf. Heid et al., op cit), the probe adheres to the target and is not removed during the amplification reaction. This leads to potential complications, as the DNA probes can interfere during the early amplification stages with the binding to the first antisense-RTA, amplified fragments, which can lead to decomposition by Rnase H and thus to the elimination of.RNA substrates and consequently to an erroneous concentration determination. Moreover the accuracy of the quantitative target determination depends decisively on the quantity of probe added., However, the system proposed by Leone et al. allows only a very poor quantification irrespective of whether the preferred evaluation is carried out based on the threshold value (cf. Leone et al., Figure 7; curves for 100 fg and 1 pg overlap at the beginning) or after reaching the plateau (cf. Leone et al., Figure 7; curves for 1 pg and 10 pg overlap at the end).

Furthermore, only a very low stringency is possible, as the probe adheres to the target and the isothermal reaction takes place at a relatively low temperature (41 0

C),

which results in a high risk of falsely positive results.

Obviously, a maximum signal could be obtained even at low temperatures, depending on the probe (cf. Leone et al., Figure but due to the test procedure chosen, this would result in an additional risk of falsely positive results. As was ascertained within the framework of further studies using the protocol proposed by Leone et al., the optimum temperature for the hybridization of the fluorescence marker varies depending on the length or the sequence of the hybridizing target section.

The present invention thus relates to a process for the amplification and quantitative real-time detection of nucleic acids in which a) a primer is used to which a nucleic acid sequence, preferably with a length of 1 to 40 nucleotides, is attached, which codes for the sequence motif 5'-GAAA-3' (motif A) in the transcript, b) the amplification being carried out in the presence of an excess, preferably in a concentration of 50 to 500 nM, of a nucleic acid probe, preferably with a length of 25 to 60 nucleotides (particularly preferably approx. nucleotides) which contains the sequence motif 3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and .e o m:\specifications\090000\94000\94217resl maw.doc wo 00/58505 PCT/EP99/07127 c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during amplification, the relative concentration "Cre. being determined according to the following formula: Cre..= t 1 tp..

where Cp corresponds to the time measured for the sample from the start of amplification to the reaching of the fluorescence threshold value and tpef. corresponds to time measured for a reference nucleic acid of known concentration from the start of amplification to the reaching of the fluorescence threshold value.

The process according to the invention .which, due to the sequence motif A introduced via the primer or attached t.o the amplified nucleic acid fragments and the motif B used in the probe, makes the formation of a hammerhead ribozyme possible, involves the cleavage of the probe and thus the production of a fluorescence signal. The principle according to the invention is shown schematically in Fig. 1 (and Figs. 2 to 16). According to the invention, it is of course possible to exploit sequences which, instead of the hammerhead ribozyme, are suitable for the development of other, smaller ribozymes the "hairpin-ribozyme" or the "hepatitis delta").

The process according to the invention is particularly suitable for the quantification of RNA, DNA or RNA/DNA chimeras nucleic acids containing ribo- and deoxyribonucleotides) which are called "target nucleic acid", where a melting of double-stranded nucleic acids upstream from the process may be necessary to obtain single strands.

WO 00/58505 PCT/EP99/07127 The amplification processes suitable within the framework of the present invention are preferably isothermal amplification processes such as NASBA transcription mediated amplification (TMA; cf. e.g.

M. Hirose et al, J. Clin. Microbiol. 36 (1998) 3122-6) or selfsustained sequence replication (3SR; cf. E. Fahy et al. in PCR Methods and Applications, Cold Spring Harbor Laboratory Press 1991, 25-33) or cyclical amplification processes such as e.g. PCR.

Unless otherwise indicated herein, the nucleotides A, C and G can each be ribonucleotides (rNTP) or deoxyribonucleotides (dNTP). "N" can stand for any ribo- or dexoyribonucleotide. In the case of RNA/DNA chimeras oligonucleotides which contain both ribo- and deoxyribonucleotides), the obligatory ribonucleotides are provided with the prefix rA, rC. rG) or U. The sequence motifs A and B of the probes can thus consist either exclusively of ribonucleotides (RINA probe) or RNA/DNA chimeras. In the case of motif A, it is necessary however that the ribonucleotide adenine (rA) be used at the 3' end in each case In the case of motif B (5'-CUGANGA-3'), it is necessary that guanine be present as ribonucleotide and adenine also be a ribonucleotide (rA) at the 3' end 5'-CU(rG).Az(rG) U can optionally be replaced by T.

By "fluorescence threshold value" is meant within the framework of the present invention a fluorescence value which exceeds by a factor of 5-10 the background fluctuation measured under comparable conditions reaction mixture without target or reference nucleic acid).

The time tp corresponds to the time which elapses after the start of the amplification reaction until.so many amplified fragments of the target nucleic acid have formed that the fluorescence threshold value (threshold value) is reached.

Wo 00/58505 PCT/EP99/07127 The time tRpf. corresponds to the time which elapses after the start of the amplification reaction until, starting from a reference nucleic acid of known concentration, so many amplified fragments have formed that the threshold value is reached. The reference nucleic acid should deviate only slightly in its nucleic acid sequence from the target nucleic acid sequence so that as accurate a quantification as possible is achieved.

To be able to determine the concentration of the target nucleic acid as accurately as possible, several tRef. values for reference nucleic acids of different concentration are preferably measured sothat the measured tp value lies if possible between two tRef. measurement points and thus a specified concentration can be allocated.

Preferably, three tp.I. values are measured for one reference nucleic acid at three different concentrations and the measurement curve (standard curve) resulting from this established. The target nucleic acid of unknown concentration can then be determined after determination of the t. value by comparison with the standard curve.

According to a particular version of the invention, the process is carried out by using the target nucleic acid in simultaneous presence of one or more, preferably of three reference nucleic acids of known concentration, and for detection, different sequence-specific, fluoresence-marked probes which produce a different fluorescence signal. The sequences of the reference nucleic acids in one amplification set differ only slightly from each other and should be variants of the target nucleic acid. In this way, the tr and t,,f values in one reaction set can be determined simultaneously and thus the concentration of the target nucleic acid determined without additional operating outlay (so-called "Multiplexing"; cf.

also US 5,837,501).

Instead of the use of a primer containing the sequence motif A and a probe containing the sequence motif B, the reverse combination is also equally suitable, i.e. the WO 00/58505 PCT/EP99/07127 combination of a primer containing the motif B and a probe containing the motif A.

Practically all fluorescence dyes and in particular the dyes given in Tab. III (above all FAM, HEX, TET, ALEXA, Texas Red, Light Cycler Red, IRD 700, CY-7, IRD 41 or La Jolla Blue (TIB MOLBIOL)) come into consideration as reporters. Preferably, the reporter dyes are substances with a high fluorescence signal high "light yield").

and a low "photobleaching".

As quenchers, dyes can be used which absorb at wavelengths of approx. 500 nm. Among the substances coming into consideration, TAMRA, LCR, CY-5 or DABCYL are preferred.

Within the framework of the present invention, reporter/quencher combinations are preferred which allow an excitation at approx. 490 nm and an emission at approx. 650 nm (TaqMan® SDS 7700, Perkin Elmer) or 700 (Light Cycler, Boehringer). The fluorescence can be measured with practically every fluorimeter customary in the trade.

For multiplexing, the combination of the universal quencher DABCYL with reporter dyes such as cumarin (emitted fluorescence at 475 nm), FAM (emitted fluorescence at 515 nm), BODIPY (emitted fluorescence at 525 nm), TAMRA (emitted fluorescence at 575 nm), Texas Red (emitted fluorescence at 615 nm), CY-5 (emitted fluorescence at 674 nm) etc.

suggests itself (cf. e.g. S. Tyagi et al., Nature Biotech. 16 (1998) 49-53).

Should the nucleic acid to be amplified already contain the sequence motifs 5'-GAAA-3' or 5'-CUGANGA-3' ("ribozyme motifs"), the process for amplification and quantitative real-time detection can also be carried out according to the invention; because of the ribozyme motif already contained in the target nucleic acid, unmarked primers are used, i.e. primers to which motif A or motif B are not attached. The CORRECTED PAGE (RULE 91)

ISA/EP

WO 00/58505 PCT/EP99/07127 detection finally takes place by carrying out the nucleic acid amplification preferably NASBA, TMA, 3SR or PCR in the presence of an excess of a probe which contains the motif "complementary" to the ribozyme motif contained in the target nucleic acid in .each case.

By "complementary motif" is meant within the framework of the present invention a motif which depending on the ribozyme motif contained in the target RNA (5'-GAAA-3' or 5'-CUGANGA-3') is necessary for the development of a hammerhead ribozyme structure (hammerhead ribozyme).

The present invention thus relates to a process for the amplification and quantitative real-time detection of a nucleic acid containing the sequence motif 5'-GAAA-3' (motif A) or the sequence motif 3' (motif in which a) the sequences of the primers used are chosen such that the sequence range of the nucleic acid which codes for the motif A in the transcript is amplified, b) the amplification being carried out in the presence of an excess, preferably in a concentration of 50 to 500 nM, of a nucleic acid probe, preferably with a length of 25 to nucleotides (particularly preferably approx. nucleotides) which contains the sequence motif CUGANGA-3' (motif B) or the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined.by measuring the time-dependent change in fluorescence during amplification, the relative concentration being determined according to the following formula: Cre. =ti/tRef.

wo 00/58505 PCT/EP99/07127 where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the fluorescence threshold value and tpef. corresponds to the time measured for a reference nucleic acid of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

With the process according to the invention, a quantitative real-time detection of nucleic acids RNA, DNA or RNA-DNA chimeras) within the framework of an isothermal nucleic acid amplification, e.g. by means of NASBA®, TMA or 3SR, is thus possible for the first time. In the case of NASBA5, in particular the problems affecting the system of Leone et al. (op cit) are avoided. Furthermore, there is no possible competition between detection and amplification as the probe an RNA substrate probe does not adhere to the target but is split off and released, whereby a detectable -signal is generated.

Furthermore, it is advantageous that Rnase H cannot decompose the target RNA in the hybrid comprising RNA substrate probe and RNA target. Furthermore, the quantity of RINA substrate probe is not critical, and it can be used in a very large excess, such as e.g. 500 nM vis-a-vis 2 nM ribozyme target or 0.066 nM ribozyme.

Compared with the PCR-based real-time processes such as TaqManT or Light Cyclero, the process according to the invention also has advantages under isothermal and cyclical temperature conditions (PCR). Due to the possibility of cleaving several probes within the framework of one amplification step, a comparatively higher signal can be generated. This leads to a higher sensitivity of the reaction and to a shortened reaction time. In addition, the signal generation is in principle controllable due to the enzymatic cleavage. A further advantage of the described process lies in the high specificity wo 00/58505 PCT/EP99/07127 of the reaction, as only an exact hybridization of the probe with the target sequence leads to the cleavage process and thus to the formation of a significant signal. Furthermore, in particular compared with TaqMan', no costly probe design is necessary,, as the probe detaches itself from the target sequence after each cleavage process. A further advantage of the described process lies in the possibility of multiplexing.

The process according to the invention allows a very good and exact linear quantification due to the enzymatic cleavage of the probe. In the ribosystem according to the invention, the hybridization itself produces only a very weak signal, whilst every ribozyme present in the amplified nucleic acid splits a large number of nucleic acid substrate probes. This further amplification is very specific and requires the presence of a completely hybridizing sequence (cf. Singh et al., Antisense and Nucleic Acid Drug Dev. 6 (1996) 165-168).

Without the risk of obtaining falsely positive results, temperature and other reaction conditions can be optimized in order to achieve a maximum fluorescence signal. For example, synthetic peptides (cf.

MUller et al., J. Mol. Biol. 242 (1994) 422-429.), CTAB (Nedbal et al., Biochemistry 36 (1997) 13552-7) or GAP-DH (Sioud et al., J. Mol.

Biol. 257 (1996) 775-789) can be added which can increase efficiency, such as e.g. the hybridization speed and the specificity of target recognition.

Compared with the amplification processes used or proposed in the state of the art with target quantification, the stability of the RNA probe can be increased by the present invention and its costs simultaneously reduced. Thus it is e.g. possible to replace almost all ribonucleotides, more expensive in chemical synthesis, with 2'deoxyribonucleotides which are cheaper and more resistant to decomposition (through longer-term storage, exposure to nucleases, metal ions such as magnesium, as well as heat etc.; cf. Bratty et al., Biochim. Biophys. Acta 1216 (19.93) 345-359).

WO 00/58505 PCT/EP99/07127 With regard to an improvement in the general ribozyme structure and efficiency of the process, the following modifications are possible, among others: To increase the reaction speed, i.e. to produce more signals relative to the number of amplified nucleic acid molecules, the sequence UA should follow the cleavage site of the ribozyme (cf. Clouet-d'Orval et al, Biochemistry 36 (1997) 9087-9092). Moreover, the position X (cf. Figure 4B) should contain the modified base pyridine-4-on (cf.

Burgin et al., Biochemistry 35 (1996) 14090-14097), which likewise leads to an increase in the reaction speed of the detection stage.

By replacing most ribonucleotides with deoxyribonucleotides, the costs for an RNA probe can be reduced by up to 10 times.

Ribonucleotides are however essential at four positions, which are identified by e.g. in Fig. 2B, 4B, 15 and 16 (cf. Byang et al, Biochemistry 31 (1992) 5005-5009). Further, in the tables present therein, to distinguish between deoxy- and ribonucleotides, upper case letters are used (for dNTPs) and lower case (for rNTPs).

Furthermore, it has been shown that chimeric DNA/RNA hammerhead ribozymes have an increased catalytic efficient and stability (N.R.

Taylor et al, Nucleic Acids Research 20 (1992) 4559-4565). This principle can be exploited according to the invention in particular for amplification processes such as e.g. PCR which are carried out at higher temperatures or with cyclical temperature profiles.

Additives such as e.g. the protein GAP-DH (cf. Sioud et al., J. Mol.

Biol. 257 (1996) 776-789), short synthetic peptides which are derived from the viral coat protein (cf. MUller et al., J. Mol. Biol. 242 (1994) 422-429) or the chemical substance CTAB (Netbal et al., Biochemistry 36 (1997) 13552-13557) are suitable for increasing the effectiveness of the process with regard to the discovery of targets "hidden" in large nucleic acid structures, i.e.

WO 00/58505 PCT/EP99/07127 ribozyme motifs.

On the basis of the present invention, it is possible for the first time to detect several different targets simultaneously by using corresponding ribozyme probes with different reporter dyes. Sequencespecific probes are necessary which adhere selectively to the target nucleic acids to be detected in each case and produce fluorescence signals of different wavelength during ribozyme cleavage. For example, it is possible to combine the quencher DABCYL with reporter dyes such as e.g. cumarin (fluorescence emission at 475 nrm), FAM (fluorescence emission at 515 nm), BODIPY (fluorescence emission at 525 nm), TAMRA (fluorescence emission at 575 nm), Texas Red (615 nm), (674 nm) etc. (cf. Tyagi et al., Nature Biotech. 16 (1998) 49- 53). It is thus possible with this so-called "multiplexing" to simultaneously amplify within one reaction set a target RNA and several reference samples of known concentration, the sequences of which differ slightly from one another in the primer-binding section in each case, a quantification being able to take place through sequence-specific probes which carry different reporter/quencher combinations, without separate amplifications and fluorescence measurements having to be carried out with the RNA reference samples.

The present invention furthermore relates to a kit for carrying out the above-named processes which comprises either a) an amplification primer to which a nucleic acid sequence, preferably with a length of 1 to 40 nucleotides, is attached, which codes for the sequence motif 5'-GAAA-3' (or 5'-CUGANGA-3') in the transcript, b) a further amplification primer, c) enzymes and reagents for carrying out the amplification reaction, d) a nucleic acid probe, preferably with a length of 25 to 60 nucleotides (particularly preferably approx. WO 00/58505 PCT/EP99/07127 nucleotides) which contains the sequence motif CUGAIGA-3' (or 5'-GAAA-3'), a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally e) apparatus and auxiliaries necessary for carrying out the reaction, or a) two amplification primers, b) enzymes for carrying out the amplification, c) a nucleic acid probe, preferably with a length of 25 to nucleotides (particularly preferably approx. nucleotides), which contains the sequence motif CUGANGA-3' (or 5'-GAAA-3'), a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally d) apparatus and auxiliaries necessary for carrying out the reaction.

According to a partial aspect of the present invention, for the first time, a process for the detection of nucleic acids as well as kits for carrying out the process are made available.

In particular, the invention relates to a process for detecting nucleic acids which contain the sequence motif 5'-GAAA-3' (motif A) or the sequence motif 5'-CUGANGA-3' (motif in which a sample containing the nucleic acid is brought into contact with a probe, preferably with a length of 25 to 60 nucleotides (particularly preferably approx. 50 nucleotides) which contains the sequence motif 5'-CUGANGA-3' (motif B) or the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, the probe having to contain a sequence suitable for the hybridization with the nucleic acid to be detected and the nucleic acid being detected by obtaining a fluorescence signal corresponding to the choice of reporter and quencher molecules.

A kit according to the invention for carrying out this detection process comprises in addition to solvent and reagents necessary for carrying out the reaction, a probe, preferably with a length of 25 to 60 nucleotides (particularly preferably approx. 50 nucleotides) which contains the sequence motif CUGANGA-3' (motif B) or the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule (see above) being attached to each probe molecule, the probe having to contain a sequence suitable for the hybridization with the nucleic acid to be detected.

In the event that the target nucleic acids contain none of the sequence motifs A or B, the nucleic acid can be detected by introducing one of the motifs e.g. through nucleic acid amplification using a primer named above. A corresponding double-fluorescence-marked probe (see above) which contains a sequence motif suitable for ribozyme formation is necessary for detection.

With the process and kits according to the invention with or without use of a nucleic acid amplification a new method for 25 pathogen detection is made available. As indicated in the following, for example the 16S rRNA of many pathogen species already naturally contains a 5-'GAAA-3' ribozyme motif which can be used to form the hammerhead ribozyme. If the nucleic acids of the pathogens contain none of the sequence motifs suitable for the development of ribozymes, the former can, as indicated above, be introduced or "added" within the framework of the amplification stages by using suitable primers.

ft m:\specifications\090000\94000\94217res1 maw.doc In another aspect the invention provides a process for the amplification and quantitative real-time detection of nucleic acids, characterized in that a) a primer is used to which a nucleic acid sequence is attached, which codes for the sequence motif 3' (motif A) in the transcript, b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during amplification, the relative concentration "Crei." being determined according to the following formula: Crel.=tp/tRef.

where ft tp corresponds to the time measured for the sample from the 25 start of amplification to the reaching of the fluorescence threshold value and tRef. corresponds to time measured for a reference nucleic acid of known concentration from the start of amplification to the reaching of the fluorescence threshold value.

In another aspect the invention provides a process for the amplification and quantitative real-time detection of nucleic acids, characterized in that m:\specificatons\090000\94000\94217res1 maw.doc a) a primer is used to which a nucleic acid sequence is attached, which codes for the sequence motif CUGANGA-3' (motif B) in the transcript, b) the amplification is carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crel." being determined according to the following formula: Crel.=tp/tRef.

where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the fluorescence threshold value and tRef. corresponds to time measured for a reference nucleic 25 acid of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

In another aspect the invention provides a process for the o 30 amplification and quantitative real-time detection of a nucleic V. acid containing the sequence motif 5'-GAAA-3' (motif A), characterized in that S *oo m:\specifications\090000\94000\9421 7res maw.doc a) the sequences of the primers used are chosen such that the sequence range of the nucleic acid which contains motif A is amplified, b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crei." being determined according to the following formula: Crel.=tp/tRef.

where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the fluorescence threshold value and tRef. corresponds to the time measured for a reference 25 nucleic acid of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

In another aspect the invention provides a process for the amplification and quantitative detection of a nucleic acid Scontaining the sequence motif 5'-CUGANGA-3' (motif B), *i characterized in that o m:\specifications\090000\94000\9421 7resl maw.doc a) the sequences of the primers used are chosen such that the sequence range of the nucleic acid which contains motif B is amplified, b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crel." being determined according to the following formula: Crel.=tp/tRef.

where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the .o.

fluorescence threshold value and tRef. corresponds to the time measured for a reference RNA 25 of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

In another aspect the invention provides a process for the detection of bacterial pathogens in a sample, characterized in o 30 that the sample is brought into contact with a probe which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each sequence motif, the probe containing a sequence suitable for hybridization with a section of the 16S rRNA, of the pathogens m:\specifications\090000\94000\94217resl maw.doc containing the sequence motif 5'-GAAA-3' (motif and the pathogens being detected by measuring the occurring fluorescence signal.

In another aspect the invention provides a kit for carrying out the process as previously described, characterized in that it comprises a) an amplification primer to which a nucleic acid sequence is attached, which codes for the sequence motif 5'-CUGANGA-3' in the transcript, b) a further amplification primer, c) enzymes and reagents for carrying out the amplification, d) a nucleic acid probe which contains the sequence motif 5'-GAAA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally e) apparatus and auxiliaries necessary for carrying out the reaction.

In another aspect the invention provides a kit for carrying out the process as previously described, characterized in that it comprises a) two amplification primers, b) enzymes for carrying out the amplification, c) a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3', a reporter molecule and a quencher 30 molecule being attached to each probe molecule, as well as optionally d) apparatus and auxiliaries necessary for carrying out the reaction.

m:\specifications\090000\94000\9421 7res maw.doc In another aspect the invention provides a kit for carrying out the process as previously described, characterized in that it comprises a) two amplification primers, b) enzymes for carrying out the amplification, c) a nucleic acid probe which contains the sequence motif 5'-GAAA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally d) apparatus and auxiliaries necessary for carrying out the reaction.

In another aspect the invention provides a kit for carrying out the process as previously described, characterized in that it comprises a probe with a sequence suitable for the hybridization with a section of the 16S rRNA of the pathogens containing the sequence motif 5'-GAAA-3' (motif which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally further apparatus and auxiliaries necessary for carrying out the reaction.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer m:\specifcations\090000\94000\9421 7res maw.doc 1 or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

V M:\specificatjons\090000\94000\9421 7resl maw.doc WO 00/58505 WO 0058505PCT/EP9 9/07 127 Table 1: GAAA in 16S rRNA Region in E.coii 70-100 115-145 16S rR.NA F.coi-- taatgtctggGActgcctg~atg Salmonella taatgtctggGAAActgcctgatg Staphylococcus---- C. perfringens tttccttcggGAAAcqgattagcg Vibrio aagtcgagcgGAAAcgagttatct taatgcctagGAAAttgccctgat B. cereus---- C. botulinum Campylobacter Yersinia taatgtctggGAAActgcctgatg Listeria Region in E.coli 145-175 180-210 16S rRNA E.coli ataactactgGAAAcggtagctaa Salmonella ataactactgGAAAcggtggctaa Staphylococcus ataacttcggGAAAccggagctaa gttcaaaagtGAAAgacggtcttg C. perfringens atagccttccGAAAggaagattaa tcataatgttGAAAgatggcatca Vibrio ataaccattgGAAAcgatggctaa B. cereus ataactccggGAAAccggggctaa cgcatggttcGAAAttGAAAggcg C. botulinum atagccttccGAAAggaaqattaa Campylobacter acaacagttgGAAAcgactgctaa gttgagtaggGAAAgtttttcggt Yersinia ataactactgGAAAcggtagctaa Listeria I a-t aact ccg gGAAAc cggg gct aa ccacgcttttGAAAgatggtttcg Region in E.coli 370-400 485-515 16S E.coli---- Salmonella---- Staphylococcus cgcaatgggcGAAAgcctgacgga tacctaatcaGAAAgccacggcta C. perfringens agggtcattgGAAActgGAAAact Vibrioj B. cereus IcgcaatggacGAAAgtctgacgga tacctaaccaGAAAgccacggcta C. botulinum cgcaatggggGAAAccctgacgga Campylobacter IcgcaatggggGAAAccctgacgca Yersinia Listeria cgcaatggacGAAAgtctgacgga tatctaaccaGAAAgccacggcta CORRECTED PAGE (RULE 91) ISA E P WO 00/58505 WO 0058505PCT/EP99/07 127 Region in E.coli 595-625 625-655 16S rRNA E.coli.at e tA tccg ct Salmonella agtcgqatgtGAAAtccccgggct Staphylococcus agtctgatgtGAAAgcccacggct agggtcattgGAAActgGAAAact C. perfringens a.0La c gq c Vibria nattgcatttGAAActggcagact B. cereus agtctgatgtGAAAgcccacggct qgt tGAMC-tqg- a~ C. botulinun t.

Campyloba.te...

Yersinia Sapylobcccu k:V tgaagg C.ggatc C. B. cereus-- tggcaaaggGAgtggaatat Region in E.coli 650-615 755-790 16S rRNA E. coli gcgGA~ggtgg gggGA~ctgg Salmonella gcgGA~ggtgg gggGA~ctgg Staphylococcus t gcgaggGAAAgctgggat C. perfringens gcgGA~ggtgg ggtGA~ctgg Vibrio ggacgGAtctgg B. cereus gcgGA~ggt g atgaggagGAAAgtgggag C. botulinum 6%tggtAAtctgg ggaGA~ctgga Campylobacter gggGA~ctgga ersoii gtgtagcggtGAAAtgcgtagaga gctcaggtgcGAAAgcgtqgggag Slsteia[ gtgtagcggtGAAAtgcgtagaga gctgaggtgcGAAAgcgtggggag wo 00/58505 WO 0058505PCT/EP99/07 127 Region in E.coli 895-925 1000-1050 165 rRNA__ E.coli--- Salmonella---- Staphylococcus ccgcaaggttGActcaaaggaa C. per fringens-- Vibrio---- B. cereus ccqcaaggctGAAActcaaaggaa C. botulinum---- Campylobacter---- YersiniaI-- Listeria ccgcaaggttGAAActcaaaggaa Region in E.coli 1065-1095 1245-1275 16S E.coli ctcgtgttgtGAAAtgttgggtta Salmonella ctcgtgttgtGAAAtqtcgggtta Staphylococcus caa.. gggt C. perfringens-- Vibrio ctcgtgttgtGAAAtgttgggtta watv.

B. cereus- C. botulinum---- Campylobacter Yersinia ctcgtgttgtGAAAtgttgggtta ,Listeria Region in E.coli 1305-1335 16S rRNA E.coli Salmonella-- Staphylococcus-- C. perfringens tgtGA tqCtC Vibrio B. cereus-- C. botulinum Campylobacter_________ lYersinia Listeria WO 00/58505 WO 0058505PCT/EP99/07 127 Table II: GAAA in 16S rRNA Region in E.coii 16S 70-100 115-145 r RINAI S. aureus---- S. epiderinidis S. pneumoniae S. pyogenes-- E. faecalis cactcaattgGAAAgaggagtggc N. meningitidis E. coil taatgtctggGAAActgcctgatg Enterobacter spec. taatgtctggGAAActgccgatgg Proteus spec. ggtaacaggaGAAAgcttgctttc P. aeruginosa P. fluorescens---- P. mendocina---- P. syringae---- H. influenzae ggtagcaggaGAAAgcttgctttc H. ducreyi---- Bacteroides spec. Region in E.coli 16S -145-175 180-210 S. aureus ataacttcggGAAAccqgagctaa gttcaaaagtGAAAgacggtcttg S. epidermidis ataacttcqgGAAAccggagctaa gttcaatagtGAkAgacggttttg S. pneumoniae ataactattgGAAAcgatagctaa S. pyogenes ataactattgGAAAcgitagctaa E faecaiis ataacacttgGAAAcaggtgctaa. gcataagagtGAAAggcgctttcg N. meningitidis ataactgatcGAAAgatcagctaa tcttgagagaGAAAgcaggggacc E. coil ataactactgGAAAcggtagctaa Enterobacter spec. ataactactgGAAAcggtagctaa Proteus spec. ataactactgGAAAcggtggctaa P. aeruginosa ataacgtccgGAAAcggccgctaa tcctgagggaGAAAgtcggggatc P. fluorescens ataacgttcgGAAAcggacgctaa tcctacgggaGAAAgcagggacc P. mendocina ataacgttccGAAAggaacgctaa tcctacgggaGAAAgcangggacc P. syringae ataacgctcgGAAAcggacgctaa tcctacgggaGAAAgcaggggacc H. influenzae ataactactgGAAAcggtagctaa taaagggggcGAAAgctgttgcca H. ducreyi ataactacggGAAActgtagctaa Bacteroides spec. atagcctttcGAAAGAAAgattaaI--I CORRECTED PAGE (RULE 91)

ISA/EP

WO 00/58505 WO 0058505PCT/EP99/07127 Region in E.coli 16S 370-400 450-480 r RNA S. aureus cqcaatgggcGAAAgcctgacgga S. epidermidis cgcaatgggcGAAAgcctgacgga S. pneurnoniae tg t t tq S. pyogenes aggatccc~ E. faecalis P. aeruginosa---- P. fluorescens gacaatgggcGAAAgcctgatcca P. mendocina gacaatgggcGAAAgcctnatcca P. syringae gacaatgggcGAAAgcctgatcca H. influenzae cgcaatgggqGAAAccctgatgca H. ducreyi cacaatgggqGAAAccctgatgca Bacteroides spec.

Region in E.coli 16S 485-515 595-625 rRNA S. aureus tacctaatcaGAAAgccacggcta agtctgatgtGAAAgcccacggct S. epidermidis tacctaatcaGAAAgccacggcta agtctgatgtGAAAgcccacggct S. pneurnoniae tatcttaccaGAAAgggacggcta S. pyogenes taactaaccaGAAAgggacggcta E. faecalis tatctaaccaGAAAgccacggcta agtctgatgtGAAAgcccccggct N. meningitidis agcaggatgtGAAAtccccgggct E. coli .agtcagatgtGAAAtccccgggct Enterobacter spec. aagtcgatgtGAAAtccccgggct Proteus spec. agtcagatgtGAAAgccccgagct P. aeruginosa agcttgatgtGAAAtccccgggct P. fluorescens agttggatgtGAAAtccccgggct P. mendocina agttggatgtGAAAgccccgggct P. syringae agttgaatgtGAAAtccccgggct H. influenzae agtgaggtgtGAAAgccctgggct H. ducreyi agtgagatgtGAAAgccccgggct Bacteroides spec. WO 00/58505 WO 0058505PCT/EP99/07 127 Region in E.coli 163 625-655 650-680 rRDNA S. aureus agqgtcattgGAAActgGAAAact ttgGA.AActgGAAAacttgagtgc S. epidermicis agggtcattgGAAActgGAAAact ttgGAAActgGAAAacttgagtgc_ S. pneumoniae g~~i S. pyogenes gtacgctttgGAAActggagaact E. faecaiis agggtcattgGAAActgqgagact N. meningitidis E. coli-- Enterobacter spec. A, Proteus spec.

P. aeruginosa---- P. fluorescens---- P. mendocina---- P. syringae---- H. influenzae---- H. ducreyl Bacteroides spec. Region in E.coli 16S 660-690 685-715 r RNA S. aureus tgcagaagagGAAAgtggaattcc gtgtagcgqtGAAAtgcgcagaga S. epidermidis tgcagaagagGAAAgtggaattcc gtgtagcggtGAAAtgcgcagaga S. pneumoniae gtgtagcggtGAAAtgcgtagata S. pyogenes gtgtagcggtGAAAtgcgtagata E. faecalis gtgtagcggtGAAAtgcgtagata N. meningitidis gtgtagcagtGAAAtgcgtagaga E. coi gtgtagcggtGAAAtgcgtagaga Enterobacter spec. gtgtaqcggtGAAAtgcgt~gaga Proteus spec. gtgtagcggtGAAAtgcgtagaga P. aeruginosa gtgtagcggtGAAAtgcgtagata P. fluorescens gtgtagyggtGAAAtgcgttgata P. mendocina gtgtagcggtGAAAtgcgtagata P. syringae gtgtagcggtGAAAtgcgtagata H. infiuenzae gtgtagcggtGAAAtgcgtagaga H. ducreyi gtgtagcggtGAAAtgcgtagaga Bacteroides spec. IgtgtagcggtGAAAtgcttagata WO 00/58505 WO 0058505PCT/EP9 9/07 127 Region in E-coii 16s 715-745 755-780 r RNA S. aureus gctgatgtgcGAAAgcgtggggat S. epidermidis qctgatgtgcGAAAgcgtggggat S. pneumoniae caccggtggcGAAAgcgctctct gctgaggctcGAAAgcgtggggag S. pyogenes caccggtggcGAAAgcggctctct gctgaggctcGAAAgcgtggggag E. faecalis gctgaggctcGAAAgcgtggggag N. meni ngiti di s X. 4 q~t~~ E. coli-- gctcaggtgcGAAAgcgtggggag Enterobacter spec. gctcaggtgcGAAAgcgtggggag Proteus spec. gctcaggtgcGAAAgcgtggggac P. aeruginosa actgaqgtgcGAAAgcgtggqag P. fluorescens actgaggtgcGAAAgcgtggggag P. mendocina actgaggtgcGAAAgcgtggggag P. syringae actgaggtgcGAAAgcgtggggag H. influenzae gctcatgtgtGAAAgcgtggggag H. ducreyi gctcatgtgcGAAAgcgtggggag Bacteroides spec. actgatgctcGAAAgtgtgggtat Region in E.coii 16S [845-475 895-925 r RNAI S. aureus ccgcaaggttGAAActcaaaggaa S. epidermidis ccgcaaqgttGAAActcaaaggaa S. pneumoniae ccgcaaggttGActcaaaggaa S. pyogenes ccgcaaggttGAAActcaaaggaa E. faecaiis ccgcaaggttGAAActcaaaggaa N. meningitidistac GAtqCt E. coli Enterobacter spec. Proteus spec. P. aeruginosa P. fluorescens P. mendocina P. syringae H. influenzae H. ducreyi .Bacteroides spec. Rimwo 00/58505 wo 0058505PCT/EP99/07 127 Region in E.coii 16S 1065-1095 1245-1275 rRNA S. aureus aaagggcagcGAAAccgcgagqtc S. epidermiciis aaagggtagcGAAAccgcgaggtc S. pneumoniae---- S. pyogenes E. faecaiis IT. meninitidis---- E. coli ctcgtgttgtGAAAtgttgggtta-- Enterobacter spec. ctcgtgttgtGAAAtgttgggtta_ Proteus spec. tcgttgttgtGAAAtgttgggtta-- P. aeruginosa P. fluorescens P. mendocina P. syringae H. influenzae ctcgtgttgtGAAAtgttgggttn t H. ducreyi ctcgtgttgtGAAAtgttgggttn Bacteroides spec. Region in E.coli 16S 1400-1430 r S. aureus S. epidermidis-- S. pneurnoniae-- S. pyogenes-- E. faecalis-- N. meningitidis-- E. coli Enterobacter spec. Proteus spec.-- P. aeruginosa P. fluorescens P. mendocina-- P. syringae-- H. influenzae H. ducreyirBacteroides spec. t~A A~tgtaC WO 00/58505 PCT/EP99/07127 The invention is explained in more detail in the following using examples and figures.

Description of the figures: Fig. 1: General scheme of NASBA® combined with ribozymes for real-time detection.

Ribozyme motif within one of the two primers. Only one possibility is shown in which the ribozyme motif is located at the 3' end of the amplified RNA. The RNA substrate probe is marked with a fluorescence dye, the reporter (circle) and a quencher (triangle). In the intact probe, the efficient interaction of both labels leads to "FRET" or quenching, i.e. to no (or only a very weak) reporter signal (empty circle). The ribozyme cleaves many probe molecules. In the cleaved probe, both labels are separated and a strong reporter signal is produced (filled circles).

Fig. 2: A: General structure of hammerhead ribozymes. Only preserved nucleotides are identified by corresponding letters, all non-preserved positions are shown as N. The length of the hybridizing arms can be adjusted to the requirements in each case. Three locations for possible hairpin loops are shown by dotted lines. The polarity direction) is given only for the cleaved section. B: Corresponds to Fig. 2A, the positions at which the ribonucleotides are preferably used being provided with the prefix while the remaining nucleotides can in each case be either ribo- or deoxyribonucleotides.

Fig. 3: A possibility for cleaving a minimal ribozyme and a nucleic acid substrate probe. The preserved ribozyme motif was shortened to GAAA.

wo 00/58505 PCT/EP99/07127 Fig. 4: A: Based on the possibility shown in Fig. 3, an amplified nucleic acid (thick line) is shown with the minimal ribozyme motif.

The nucleic acid substrate probe contains reporters and quenchers (a few possibilities are given below) at both ends, but they can also be linked to other positions. B: Corresponds to Fig. 4A, the positions at which ribonucleotides are preferably placed are provided with the prefix while the remaining nucleotides can in each case be either ribo- or deoxyribonucleotides.

Fig. 5: A further possibility for cleaving a nucleic acid substrate probe. The preserved ribozyme motif is reduced to CUGA-N-

GA.

Fig. 6: Based on the possibility shown in Fig. 5, an amplified nucleic acid (thick line) is shown with the minimal ribozyme motif.

The nucleic acid substrate probe contains reporters and quenchers at both ends, but they can also be linked to other positions (cf. Fig.

4).

Fig. 7: Based on the possibility shown in Fig. 3, the reverse primer contains the ribozyme motif. The hybrid between primary target nucleic acid and primer is shown above. The position within the target nucleic acid and the length of the base-pair-forming section can vary. The resulting amplified nucleic acid with the complete ribozyme motif is shown below.

Fig. 8: Based on the possibility shown in Fig. 3, the reverse primer contains the ribozyme motif in a bulge. The hybrid between primary target nucleic acid and primer is shown above. The position within the target nucleic acid and the length of both base-pairforming sections can vary. The resulting amplified nucleic acid with the complete ribozvme motif is shown below.

WO 00/58505 PCT/EP99/07127 Fig. 9: Based on the possibility shown in Fig. 3, the reverse primer contains the ribozyme motif in a bulge, followed by a very short 3'-terminal base-paired section. As is shown, this section can overlap with the ribozyme motif and the bulge can be so short that it comprises only one nucleotide. The hybrid between primary target nucleic acid and primer is shown above. The position within the target nucleic acid and the length of both base-pair-forming sections can vary. The resulting amplified nucleic acid with the complete ribozyme motif is shown below.

Fig. 10: Based on the possibility shown in Fig. 2B, the reverse primer contains the ribozyme motif in a bulge followed by a single rA-T base pairing with the target sequence. The hybrid between primary target nucleic acid and primer is shown above. The position within the target nucleic acid and the length of both base-pairforming sections can vary. The resulting amplified nucleic acid with the complete ribozyme motif is shown below.

Fig. 11: Corresponds to the possibility shown in Fig. 10. Here, however, the target sequence already contains a longer stretch of the ribozyme motif (or, as shown, of the complete motif).

Fig. 12: By way of example, structure of a DNAzyme(= catalytic DNA). The substrate can either be wholly RNA, or a minimum of rA must be present.

Fig. 13: By way of example, structure of another DNAzyme. The substrate can either be wholly RNA or a minimum of rRrY must be present.

WO 00/58505 PCT/EP99/07127 Fig. 14: Corresponds to Fig. 10, the primer containing the greatest part of the Nazyme motif (of the catalytic nucleic acid motif) and only the two last nucleotides being absent. Shown here is a possibility based on "prototype For "prototype the presence of longer motifs TCGTTG instead of TCGT) makes it possible to use a more deleted motif in the primer, the 3'-terminal ACGA in the elongated primer being supplied by the target sequence.

Fig. 15: Example of a universal ribozyme probe.

Fig. 16: Example of a HIV ribozyme probe.

EXAMPLES

Material: The primers and probes used within the framework of the invention can be obtained by the route familiar to a person skilled in the art, such as e.g. by oligonucleotide synthesis.

Example 1 NASBA® reaction in combination with ribozyme-dependent detection: All enzymes were commercially available from Pharmacia, with the exception of AMV reverse transcriptase, which was obtained from Seikagaku.

23pl NASBA® reaction mixture, including 5 p1 from the purification according to Boom et al. Clin. M-icrobiol. 28 (1990) 495-503) (final CORRECTED PAGE (RULE 91)

ISA/EP

WO 00/58505 PCT/EP99/07127 concentration in 25 pl reaction mixture: 40 mM Tris, pH 8.5, 12 mM MgC1;, 42 mM KC1, 15' v/v DMSO, 1 mM each dNTP, 2 mM each HTP, 0.2 pM primer 1, 0.2 pM primer 2 and 0.1-0.5 pM substrate probe) were incubated at 65 0 C for 5 minutes to make possible a destabilization of the secondary structures in the RNA. This was followed by cooling to 41'C for the primer annealing. The amplification was started by the addition of 2 pl enzyme mixture (0.1 pg/pl BSA, 0.1 units RHase H, units t7 RNA polymerase and 8 units AMV reverse transcriptase). The reaction was incubated at 41 0 C for 90 minutes. During the reaction, the fluorescence signals were measured in the ABI Prism 7700 sequence detector. The combination FAM/RAMRA was used as reporter/quencher.

Experiment A: (dNTP upper case letters: rNTP lower case letters) Primer 1: Primer 2: Substrate A: 5'-AAT TCT AAT ACG ACT CAC TAT AGG GTG CTA TGT CAC TTC CCC TTG GTT CTC TCA-3' 5'-GAA TCT CAT CAG TAG CGA GTG GGG GGA CAT CAA GCA GCC ATG CAA A-3' 5'-TAMRA-Tga auc gaa acg cga aag cgu cua gcg u-FAM- 3' Experiment B: Primer 1: 5'-AAT TCT AAT ACG ACT CAC TAT AGG GTG CTA TGT CAC TTC CCC TTG GTT CTC TCA-3' 5'-ACG TAG TTT CGG CCT TTC GGC CTC ATC AGC GTG CAG TGG GGG GAC ATC AAG CAG CCA TGC AAA-3' Primer 2: Substrate B: 5'-TAMRA-Tac gua guc cgu gcu-FAM-3' wo 00/58505 PCT/EP99/07127 Quantification: For the quantitative determination of the HIV-RNA, 4 external controls and 2 unknown samples as well as 2 negative controls were introduced into the amplification described above. By means of the standard, a standard curve was produced, and the concentration of the standard was: Q1 approx. 1,000,000 molecules (RNA) Q2 approx. 100,000 molecules (RNA) Q3 approx. 10,000 molecules (RNA) Q4 approx. 1,000 molecules (RNA) Experiments A and B led to the following result: the fluorescence, measured in the ABI PRISM 7700, of the reporter dye FAM increased according to the quantity of target molecule (RNA) used. It was shown that after t=15 minutes, with the highest standard molecule quantity used, the threshold value for a defined positive signal was reached (5x std. dev. of the background). The other standards reached the corresponding threshold value after t= 20, 24 and 26 minutes. The unknown samples reached their threshold value after approx. t=18 and t=23 minutes. Using the standard curve established by means of the standards, a molecule quantity of approx. 200,000 (t=18) and 15,000 (t=23) respectively resulted for the unknown samples. The negative controls did not reach the threshold value. This shows that a quantification of target molecules is possible using the technique described here.

Example 2 Universal recognition of any (full-size) amplified RNA targets (ribozyme motifs in reverse primer). The corresponding "universal ribozyme probe" was added to the NASBA amplification kit.

WO 00/58505 PCT/EP99/07127 At its 3' end, the reverse primer contains the usual target-specific sequence and in addition at its 5' end a sequence which codes for the general universal ribozyme motif: 5'-GCG TTT CGA TTC CHN NIHN, The transcript ends with the sequence NNN NNG GAA UCG AAA CGC The ribozyme probe contained the following sequence: 5'-GCG UC U AGC GGA AAC GCU ACU GAX GAG AUU CC (32-mer) cleavage site Two dyes 5'-Q and 3'-R (or 3'-Q and were linked to the ends.

For the quantitative determination of HIV-RNA, 4 external controls and 2 unknown samples as well as 2 negative controls were introduced into the amplification described above. By means of the standard, a standard curve was produced, and the concentration of the standard was: Ql approx. 1,000,000 molecules (RNA) Q2 approx. 100,000 molecules (RNA) Q3 approx. 10,000 molecules (RNA) Q4 approx. 1,000 molecules (RNA) The experiment in example 2 led to the following result: the fluorescence, measured in the ABI PRISM 7700, of the reporter dye FAM increased according to the quantity of target molecule (RNA) used. It was shown that after t=12 minutes, with the highest standard molecule quantity used, the threshold value for a defined positive signal was reached (5x std. dev. of the background). The other standards reached the corresponding threshold value after t= 18, 22 and 25 minutes. The unknown WO 00/58505 PCT/EP99/07127 samples reached their threshold value after approx. t=18 and t=23 minutes. Using the standard curve established by means of the standards, a molecule quantity of approx. 100,000 (t=18) and 8,000 (t=23) respectively resulted for the unknown samples. The negative controls did not reach the threshold value. This shows that a quantification of target molecules is possible using the technique described here.

This example probe can by lengthened at one or both ends by more base-paired nucleotides.

Example 3 Specific recognition of an amplified target sequence: proximal to one of the primers.

The present specific example carried out by means of an NASBA supported detection of HIV (corresponding to USP 5,837,501).

Amplified segment of the HIV-RNA: agtggggggacatcaagcagctatgcaaa(c,t)gttaaaagatactatcaatgaggaagctgcagaat gggacagggtacatccagtacatgcagggcctattccaccaggccagatgagagaaccaaggggaagtg acatagca (only one strand is shown, the primer sequences are underlined). The proximal sequence is likewise highly preserved and includes the following section: agcagctatgGaaa(c,t)gttaaaaga The forward primer for the introduction of the T7 promoter sequence (upper case letters) and 1 point mutation (bold upper case letters): AATTCTAATACGACTCACTATAGGGagtggggggacatcaagcagctatgGaaa WO 00/58505 PCT/EP99/07127 The transcript product contains the GAAA ribozyme motif which is linked to the proximal HIV-specific sequence: GGGagcagctatgGaaa(c,t) gttaaaaga...

The process can be carried out in particular with the complementary ribozyme probe corresponding to the general test protocol.

For the quantitative determination of the HIV-RNA, 4 external controls and 2 unknown samples as well as 2 negative controls were introduced into the amplification described above. By means of the standard, a standard curve was produced, and the concentration of the standard was: Ql approx. 1,000,000 molecules (RNA) Q2 approx. 100,000 molecules (RNA) Q3 approx. 10,000 molecules (RNA) Q4 approx. 1,000 molecules (RNA) The experiment in example 3 led to the -following result: the fluorescence, measured in the ABI PRISM 7700, of the reporter dye FAM increased according to the quantity of target molecule (RNA) used. It was shown that after t=22 minutes, with the highest standard molecule quantity used, the threshold value for a defined positive signal was reached (5x std. dev. of the background). The other standards reached the corresponding threshold value after t= 24, 28 and 33 minutes. The unknown samples reached their threshold value after approx. t=18 and t=23 minutes. Using the standard curve established by means of the standards, a molecule quantity of approx. 400,000 (t=23) and 10,000 (t=28) respectively resulted for the unknown samples. The negative controls did not reach the threshold value. This shows that a quantification of target molecules is possible using the technique described here.

WO 00/58505 PCT/EP99/07127 Example 4 A. GAAA in rRlIA sections for the specific detection of bacteria species.

The most important pathogens transmitted by foodstuffs are listed in the tables above.

Unique sequence motifs (shaded) lie between positions 110 and 700 (according to E. coli numbering system). Highly preserved primers are known for 16S rRNA amplification: 110 f and 700r [Lane, D.J. (1991).

16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics, E. Stackebrandt and M. Goodfellow, Eds. (New York: Willey), pp. 115-175].

B. Specific detection of sepsis pathogens.

In the above tables, the most important sepsis pathogens are also listed.

Unique sequence motifs (shaded) which can be used according to the invention lie between positions 110 and 530 (according to E. coli numbering system).

Highly preserved primers for 16S rRNA amplification are known: [Lane, D.J. (1991). 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics, E. Stackebrandt and M. Goodfellow, eds. (New York: Willey), pp. 115-175].

The sequence motifs contained in the 16S rRNA can be used for the processes according the invention so that processes for the detection of pathogens, in particular of sepsis pathogens and foodstuff germs, and kits provided for same are also made available within the framework of the present invention.

WO 00/58505 34 Tab. III: Dyes suitable as reporters/quenchers PCT/EP99/07127 651 rim ,E 674 nm Texas Red 583 am AaE603 rim (cl) Cl CH 0 Cl

C

CC 0 (Cl 6 HEX Xn=,A: 535nrm axfO,E-556nrm TET XM 1 521 nni 536 rim

JOE

XMA 527 rim Xn.. 548 aim

SO:

H

edans 336 am Xm.,E- 490 am dabcyl 453 rim ERSATZBLATT (REGEL 26) wo 00/58505 WO 0058505PCT/EP99/07127 35 ROX (6-ROX) ROX: 568 nm kmxE 595 rim 6-ROX: 575 nm X 4 1 xE602 rim

TAMRA

km.A 555 rim Xiai580 rim Ofigo-O CO H OO

C

okigo Fluorescein kml~A: 494 rim Xmo.E- 525 rim 6 FAM X..A 492 rim 4a.E 515 rim rhodaniine 6G Xmax.A: 518 rim Xn4543 nm CY3 Xo,:552 rim 4xE..565 rim EP-SATZ13LATT (REGE 26) WO 00/58505 WO 0058505PCT/EP9 9/07 127 Tab. 111 continuation) A (nm) E (nm) Dyes 349 448 AMCA 336 490 ADANS 495 503 BODIPY 493/503 505 513 BODIPY LF 494 515 6-FAN, Fluorescein 496 516 6-OREGON Green 488 521 536 TET 518 543 Rhodamine 6G (6-R6G) 531 545 BODIPY FL Br2 528 547 BODIPY R6G 527 548 6-JOE 535 552 BODIPY 530/550 535 555 HEX 552 565 Cy3 559 569 BODIPY 558/568 542 574 BODIPY TMR 542/574 546 579 560 580 NED 575 602 6-ROX 583 603 TEXAS Red 588 616 BODIPY TR 589/617 630 640 Light Cycler RED 640 625 640 BODIPY 630/650 646 660 BODIPY 650/665 651 674 700 710 Light Cycler Red 678 703 Cy 685 705 IRD 700 685 705 La Jolla Blue 743 767 Cy 7 787 807 IRD 41 REPLACEMENT PAGE (RULE 26)

Claims (30)

1. Process for the amplification and quantitative real-time detection of nucleic acids, characterized in that a) a primer is used to which a nucleic acid sequence is attached, which codes for the sequence motif 3' (motif A) in the transcript, b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during amplification, the relative concentration "Crel." being determined according to the following formula: 'Crel.=tp/tRef. where 25 tp corresponds to the time measured for the sample from the start of amplification to the reaching of the fluorescence threshold value and tRef. corresponds to time measured for a reference nucleic 30 acid of known concentration from the start of amplification to the reaching of the fluorescence threshold value.

2. Process for the amplification and quantitative real-time detection of nucleic acids, characterized in that m:\specifications\090000\94000\94217resl maw.doc a) a primer is used to which a nucleic acid sequence is attached, which codes for the sequence motif CUGANGA-3' (motif B) in the transcript, b) the amplification is carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-GAAA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crei." being determined according to the following formula: Crel. tp/tRef. where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the S" fluorescence threshold value and tRef. corresponds to time measured for a reference nucleic 25 acid of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

3. Process for the amplification and quantitative real-time 30 detection of a nucleic acid containing the sequence motif (motif characterized in that a) the sequences of the primers used are chosen such that the sequence range of the nucleic acid which contains motif A is amplified, m:\specifications\090000\94000\94217resl maw.doc b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crei." being determined according to the following formula: Crel.=tp/tRef. where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the fluorescence threshold value and tRef. corresponds to the time measured for a reference nucleic acid of known concentration from the start of the amplification to the reaching of the fluorescence threshold value. 0 25 4. Process for the amplification and quantitative detection of a nucleic acid containing the sequence motif 5'-CUGANGA-3' (motif characterized in that a) the sequences of the primers used are chosen such that the sequence range of the nucleic acid which contains motif B is amplified, b) the amplification being carried out in the presence of an excess of a nucleic acid probe which contains the sequence motif 5'-GAAA-3' (motif a reporter m:\specifications\09000\94000\94217res1 maw.doc molecule and a quencher molecule being attached to each probe molecule, and c) the original concentration of the nucleic acid in the sample is determined by measuring the time-dependent change in fluorescence during the amplification, the relative concentration "Crei." being determined according to the following formula: Crel.=tp/tRef. where tp corresponds to the time measured for the sample from the start of the amplification to the reaching of the fluorescence threshold value and tRef. corresponds to the time measured for a reference RNA of known concentration from the start of the amplification to the reaching of the fluorescence threshold value.

5. Process according to claims 1 to 4, characterized in that the nucleic acid is RNA, DNA or a DNA/RNA chimera.

6. Process according to claims 1 to 5, characterized in that the nucleic acid sequence attached to the primer has a length of 1 to 40 nucleotides.

7. Process according to claims 1 to 6, characterized in that the nucleic acid probe is used in a concentration of 50 to 500 30 nM.

8. Process according to claims 1 to 7, characterized in that the nucleic acid probe has a length of 25 to 60 nucleotides.

9. Process according to claim 8, characterized in that the nucleic acid probe has a length of approx. 50 nucleotides. m:\specifications\090000\94000\94217res1 maw.doc Process according to claims 1 to 9, characterized in that the amplification process is an isothermal or cyclical amplification process.

11. Process according to claim 10, characterized in that the amplification process is selected from the group consisting of NASBA®, TMA, 3SR or PCR.

12. Process according to claims 1 to 10, characterized in that there is used, as reporter, a dye from the group consisting of FAM, HEX, TET, ALEXA, Texas Red, Light Cycler Red, IRD 700, CY- 7, IRD 41 or La Jolla Blue and, as quencher, a dye from the group consisting of TAMRA, CY-5,DABCYL and LCR.

13. Process for the detection of bacterial pathogens in a sample, characterized in that the sample is brought into contact with a probe which contains the sequence motif CUGANGA-3' (motif a reporter molecule and a quencher 20 molecule being attached to each sequence motif, the probe •containing a sequence suitable for hybridization with a section of the 16S rRNA, of the pathogens containing the sequence motif 5'-GAAA-3' (motif and the pathogens being detected by measuring the occurring fluorescence signal.

14. Process according to claim 13, characterized in that the pathogens are selected from the group consisting of E. coli, Salmonella, Staphylococcus, C. perfringens, Vibrio, B. cereus, C. botulinum, Campylobacter, Yersinia and Listeria.

15. Process according to claims 13 or 14, characterized in that the nucleic acid probe has a length of 25 to ooo nucleotides.

16. Process according to claim 15, characterized in that the nucleic acid probe has a length of approx. 50 nucleotides. m:\specifications\090000\94000\94217resl maw.doc

17. Process according to claims 13 to 16, characterized in that there is used as reporter, a dye from the group consisting of FAM, HEX, TEXT, ALEXA, Texas Red, Light Cycler Red, IRD 700, CY-7, IRD 41 or La Jolla Blue and, as quencher, a dye from the group consisting of TAMRA, CY-5, DABCYL and LCR.

18. Kit for carrying out the process according to claim 1, characterized in that it comprises a) an amplification primer to which a nucleic acid sequence is attached, which codes for the sequence motif 5'-GAAA-3' in the transcript, b) a further amplification primer, c) enzymes and reagents for carrying out the amplification, d) a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as 20 well as optionally e) apparatus and auxiliaries necessary for carrying out S:the reaction. Se 19. Kit for carrying out the process as previously described, characterized in that it comprises a) an amplification primer to which a nucleic acid l* asequence is attached, which codes for the sequence motif 5'-CUGANGA-3' in the transcript, 30 b) a further amplification primer, c) enzymes and reagents for carrying out the amplification, d) a nucleic acid probe which contains the sequence motif 5'-GAAA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally m:\specifications\090000\94000\9421 7res maw.doc 43 e) apparatus and auxiliaries necessary for carrying out the reaction. Kit for carrying out the process as previously described, characterized in that it comprises a) two amplification primers, b) enzymes for carrying out the amplification, c) a nucleic acid probe which contains the sequence motif 5'-CUGANGA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally d) apparatus and auxiliaries necessary for carrying out the reaction.

21. Kit for carrying out the process as previously described, characterized in that it comprises a) two amplification primers, 20 b) enzymes for carrying out the amplification, a nucleic acid probe which contains the sequence motif 5'-GAAA-3', a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally d) apparatus and auxiliaries necessary for carrying out the reaction.

22. Kit according to claims 18 to 21, characterized in that the nucleic acid is RNA, DNA or a DNA/RNA chimera.

23. Kit according to claims 18 to 22, characterized in that e. o the nucleic acid sequence attached to the primer has a length of 1 to 40 nucleotides. m:\specifications\090000\94000\94217resl maw.doc

24. Kit according to claims 18 to 23, characterized in that the nucleic acid probe is used in a concentration of 50 to 500 nM.

25. Kit according to claims 18 to 24, characterized in that the nucleic acid probe has a length of 25 to 60 nucleotides.

26. Kit according to claim 25, characterized in that the nucleic acid probe has a length of approx. 50 nucleotides.

27. Kit according to claims 18 to 26, characterized in that the amplification process is an isothermal or cyclical amplification process.

28. Kit according to claim 27, characterized in that the amplification process is selected from the group consisting of NASBA®, TMA, 3SR or PCR.

29. Kit according to claim 28, characterized in that it is a 20 kit for carrying out a NASBA®, the enzymes displaying the activity of reverse transcriptase, T7 RNA polymerase and RNase H.

30. Kit according to claim 29, characterized in that the enzymes for carrying out the NASBA® are reverse transcriptase, T7 RNA polymerase and RNAse H.

31. Kit for carrying out the process as previously described, characterized in that it comprises a probe with a sequence 30 suitable for the hybridization with a section of the 16S rRNA of the pathogens containing the sequence motif 5'-GAAA-3' (motif which contains the sequence motif 5'-CUGANGA-3' (motif a reporter molecule and a quencher molecule being attached to each probe molecule, as well as optionally further apparatus and auxiliaries necessary for carrying out the reaction. m:\specifications\090000\94000\94217resl maw.doc

32. Kit according to claims 18 to 31, characterized in that the reporter is a dye from the group consisting of FAM, HEX, TET, ALEXA, Texas Red, Light Cycler Red, IRD 700, CY-7, IRD 41 or La Jolla Blue and the quencher a dye from the group consisting of TAMRA, CY-5, DABCYL, and LCR.

33. A process according to anyone of claims 1 to 17 substantially as hereinbefore described with reference to the examples.

34. A kit according to any one of claims 18 to 32 substantially as hereinbefore described with reference to the examples. Dated this second day of March 2004 Artus Gesellschaft fur Molekularbiologische Diagnostik und 20 Entwicklung mbH Patent Attorneys for the Applicant: F B RICE CO *5 m:\specifications\090000\94000\94217resl maw.doc