AU772357B2 - Method for detecting in vitro a target substance in a sample comprising the labelling of said substance with a reporter gene and the sequences required for expressing said reporter gene in vitro - Google Patents

Abstract

The invention concerns a method for detecting a target substance in a sample, characterised in that it comprises the following steps: (a) specifically labelling said substance with a reporter gene and with the sequences required for expressing said reporter gene in vitro; (b) in vitro transcription and translation of said reporter gene; (c) detecting in vitro the reporter protein coded by said reporter gene. The invention also concerns reagents and kits for implementing said method.

Description

METHOD OF DETECTION IN VITRO OF A TARGET SUBSTANCE IN A SAMPLE COMPRISING THE LABELLING OF SAID SUBSTANCE WITH A REPORTER GENE AND WITH THE SEQUENCES NECESSARY FOR THE EXPRESSION OF SAID REPORTER GENE IN VITRO.

The present invention relates to a method of detection in vitro of a target substance, notably a nucleic sequence but more generally any type of substance, in a sample. The search for target substances, notably for nucleic acid sequences, represents a primary goal in numerous research laboratories implicated in numerous fields of activity, and principally in the medical or agribusiness fields. In these fields, the search for target sequences is directed for example to: The diagnosis of a virus at the origin of diseases, such as AIDS (HIV) or hepatitis B (HBV).

The specific diagnosis of diseases of bacterial origin, such as tuberculosis or leprosy.

The diagnosis of mutations at the origin of genetic diseases or of cellular cancers.

The diagnosis of bacterial contamination in an agribusiness food chain.

The search for microorganisms implicated in the biological corrosion of pipes or of containers used in industrial processes.

25 The major difficulty of the diagnosis methods used in the prior art resides in the specificity, the sensitivity, the speed and the reproducibility of the detection test used. These difficulties generally come from the nature of the labeling used. In effect, the nature of the labeling of a substance is the 0% 0decisive factor in any subsequent detection permitting the following or the quantifying of said substance. Regardless of whether it concerns a human, animal diagnosis, or a vegetable, in agribusiness, therapy, pharmacology, research, in varied industrial processes etc., it is necessary to detect, follow and specifically qualify one or several target substances. In order for this H \Juanita\Kecp\patent\I5679.00 doc 12101/04 detection to be optimal, it is necessary to set up high performance and sensitive labeling techniques.

One of the specific techniques for labeling nucleic acids uses PCR amplification. The labeling of primers which can be used in PCR can be carried out in two ways, either by labeling of the primers, preferably at their ends or by internal marking of the amplified fragment.

The first type of labeling has the disadvantage of having a low specific o0 activity and consequently, limits the sensitivity of the later revelation. It is possible to fix a radioactive phosphate (32P) at the 5'end of the primers.

There will be one (32P) per primer. If biotin or a fluorochrome is fixed, it is possible to have at the most 3 to 4 labels per primer molecule.

If the radioactive nucleotides are incorporated in the amplicon, the specific activity is certainly more important, but it is necessary to manipulate more radioactivity. The current tendency is to replace the isotopic labeling methods with cold labeling (fluorophore, digoxigenine, biotin).

The fluorophores are sensitive to environmental changes: variations in the experimental conditions (pH, presence of oxidizing elements, can displace the emission wavelength. In addition, the phenomena of fluorescence extinction (or quenching) have largely been described. The incorporation of nucleotides labeled with a fluorophore or with digoxigenine or S 25 with biotin by polymerases is of low effectiveness because these nucleotides have a strong steric hindrance that disturbs the PCR polymerization reaction.

The radioactive labeling of proteins can be carried out by using amino :i acids labeled with an isotope, which implicates the manipulation of S 30 radioactivity. The labeling of proteins by an antigen/antibody reaction may for its part not be sensitive enough.

H:\awito\Keep\paten\ 15679.00 doc 12/01/04 The aim of the present invention is precisely to offer a sensitive method of detection of target substances not giving rise to the disadvantages hereinabove.

This goal is achieved thanks to a method of detection of a target substance in a sample, characterized in that it comprises the following steps: a) The specific labeling of said substance by a reporter gene and by sequences necessary for the expression of said reporter gene in vitro, b) The transcription and translation in vitro of said reporter gene, in a non cellular system of said reporter gene to give a reporter protein, which does not result in an expressed target-reporter fusion protein when the target protein is a target nucleic acid sequence, c) The detection in vitro of the reporter protein coded by said reporter gene.

The method of the invention is therefore based on labeling, consisting of combining with the target substance a DNA molecule constituting a reporter gene that can be expressed in vitro. The labeling therefore consists of combining with the target substance, a reporter gene placed under the control of sequences necessary for its expression.

The in vitro transcription promoters which can be used within the scope of the invention can notably correspond to the promoters of the phages T7, SP6, QP or X.

o• At step the protein encoded by the reporter gene is obtained in a 30 way so as to specifically identify the target substance.

.i The identification of the labeling which is the aim of the process of the invention is sensitive because it makes use of amplification \\mbfilshonrUah ta\Kcppaten\l15679-00.2 Qc 26/02/04 3a steps during steps of transcription (step of translation (step b) and of detection (step This amplification can correspond for example to a factor of 500 for the \\nielb-filcs'JhomcS\uanfta\Keep~paient\I 5679-00.2dc 26/02/04 transcription (Pokrovkaya and Gurevich, Analytical Biochemistry 220, 420-423 (1994).

The method of the invention is also specific in the test of detection of the protein at step Moreover the method of the invention can go through, after the transcription step, a step of amplification of the transcripts by all techniques known to a person skilled in the art such as 3 SR, NASBA (nucleic Acid io Sequence-based amplification), TMA (Transcription Mediated Amplification).

In the case where the target substance corresponds to a nucleic acid molecule, the amplification of the signal of revelation can begin during step of the method of the invention. A set of primers or of particular probes is used so as to specifically amplify a sequence and to combine in the presence of a specific oligonucleotide sequence a reporter gene that can be expressed in vitro. The reporter gene is expressed only if the target gene is present and amplified. As indicated above, amplification of the reporter gene or of the target gene is understood as PCR type reactions (polymerase chain reaction), NASBA (nucleic acid sequence-based amplification), SDA (strand displacement amplification), bDNA (branched DNA signal amplification), rolling circle, techniques derived from PCR (nested PCR, multiplex PCR).

:020The method of the invention moreover is fast and reproducible, because all of the reactions are carried out in vitro, which permits standardization of the detection. The method of the invention permits carrying out qualitative and quantitative detections.

The method of the invention is notable in that it can be applied to any type of substance. However, the invention is more particularly applied to chemical or biological substances, such as antibodies, fragments of antibodies, nucleotide fragments, genes, cellular receptors, peptides, Sproteins, amino acids, glycopeptides, lipids, glycolipids, sugars, H:\Uuaita\Kecp\paen\l15679.00.doc 12/01104 polysaccharides, etc. In a particular application, the target substance can be the reporter gene itself.

Labeled target substance is understood as any substance directly or indirectly associated with a reporter gene that can be expressed in vitro.

The reporter gene is a gene that can be transcribed and translated in vitro in the presence of sequences that regulate its expression. The protein that the reporter gene codes for can be detected at step by any technique known to a person skilled in the art. By way of example, the reporter gene can be the gene of the GFP (Green Fluorescent Protein) or that of the betalactamase (TEM-1). In the case of the GFP, it is the fluorescent emission that is measured. In the case of the beta-lactamase, it is the activity of this enzyme that is measured by incubating a fraction of the translation reaction in a buffer containing nitrocephine. Nitrocephine is a chromogenic betalactamine that has the property of changing color from yellow to red when it is hydrolyzed by a beta-lactamase. Any other reporter gene can be contemplated in the process of the invention, such as beta-galactosidase, beta-glucuronidase, luciferase, peroxidase or a microperoxidase, etc.

The reporter gene advantageously encodes for an enzyme. The specificity of the labeling of the target substance at step of the method of the invention can be carried out by any direct or indirect method known to a person skilled in the art.

For the direct method, it is understood that the target substance is directly combined with the gene and with the elements necessary for the expression of said reporter gene in vitro. It relates for example to the case described hereinafter of a recombinant nucleic acid molecule where the target 30 substance is a nucleic sequence included in said recombinant nucleic acid molecule equally including the reporter gene and the sequences necessary for its in vitro expression.

0 H:\uIlta\Keep\paemn\I 5679.00.doc 12/01/04 For the indirect method, it is understood that the target substance is combined with a reporter gene and with the sequences necessary for its expression in vitro, by the intermediary of a specific ligand of the target substance. This ligand is combined with the reporter gene and with the elements necessary for its expression in vitro. It is therefore the contacting of this ligand with the target substance which permits the carrying out of the specific labeling of the target substance. It relates for example to an antibody labeled by the reporter gene and the sequences necessary for its expression in vitro, which is capable of specifically recognizing a target substance to composed of an antigen. A target/ligand couple substance is understood as for example: an antigen/antibody, a nucleic sequence/a nucleic sequence, a probe, a receptor/a receptor ligand, etc.

In the indirect embodiment, the method of the invention consists at step of contacting the sample liable to contain the target substance with a ligand specific for this target substance, said ligand being labeled by a reporter gene and by the sequences necessary for the expression of said reporter gene in vitro. The remainder of the method includes as previously the steps and The labeling of the specific ligand of the target substance can be as previously a direct or indirect labeling.

According to the indirect method of the invention, the combination of the reporter gene and a target sequence corresponding to a protein allows several embodiments. In effect, the bonding of a nucleic acid molecule composed of a reporter gene and of the sequences necessary for its expression in vitro, on a protein can be carried out by techniques known to a person skilled in the art making use of bonding compounds such as: Streptavidine/biotin (Kipriyanov et al., (1995). Hum Antibodies Hybridomas 6 93-101) H:\Junnita\Keep\ptelt\1 5679.00.doc 12101104 A peptide corresponding to polylysine (Avrameas et al., (1998).

PNAS 95 5601-6; Curiel et al., (1992). Hum Gen Ther 3 147-54; Wu et al., (1991). J Biol Chem 266 14338-42; Kwoh et al., (1999). Biochim Biophys Acta 1444 171-90; Wu et al., (1994). J Biol Chem 269 11542-6 The p-azido-tetrafluoro-benzyl (Ciolina et al., (1999). Bioconjug Chem 10(1), 49-55).

The triple helices of DNA (Neves et al., (1999). FEBS Lett 453 41-5.

The method of the invention per direct marking finds several shapes of implementation which will be presented hereafter.

The method of the invention may be performed on any sample from a human, animal, vegetable, environmental, or any likely matter to be marked by a gene reporter having any information for its in vitro expression.

A preferred form of implementation of the process of the invention relates to nucleic detection of a sequence targets, advantageously by the 20 direct method.

The description hereafter thus relates to a method of in vitro detection of a nucleic sequence in a sample. This method includes/understands the following stages: a) preparation, starting from the sample of a recombining molecule of nucleic acid including/understanding in direction 5. towards a promoter of RNA polymerase, a gene reporter having the sequences necessary to its expression and possibly terminating a of RNA polymerase, the nucleic acid 30 sequence target being localised between two unspecified of these elements.

b) the transcription and the translation of the products of amplification obtained with the stage H:Vunta\Keepament15679-002.doc 26/02/04 8 c) the revelation of the activity of protein coded by the gene reporter, indicated the molecule reporter, obtained with the stage by any suitable means.

Various particular forms of specific detection of a substance targets correspondent with a nucleic sequence of acid by direct marking are quoted hereafter.

The method of the invention is adapted to detection of target sequences being able to correspond to a gene, a fragment of gene or with all other nucleic acid fragment.

The method of the invention offers the advantage of being able to specifically detect a target sequence in a sample to be analyzed and to later work directly on this target sequence.

The method of the invention is also notable in that it is quite particularly adapted to the detection of target nucleic acid sequences coding for a peptide or a protein not having identifiable activity in vitro.

According to a first preferred aspect of carrying out the method of the invention the preparation of the nucleic acid molecule of step is carried out by in vitro amplification of the target nucleic acid sequence.

It relates to an amplification by PCR or by techniques derived from PCR of the RT-PCR, nested PCR, multiplex PCR type or techniques different from PCR: NASBA (nucleic acid sequence-based amplification) or rolling circle or others.

30 In an aspect of carrying out the method of the invention, hereinafter Sdesignated "universal," the first step of the method is based on the carrying out of an amplification reaction of the target sequence, if it is \\ffibfileshomrSUuanitU(cp\patentI 15679-00.2 dc 2602/4 understood that it is present in the analyzed sample, with the aid of two primers designated sense and anti-sense as defined below: A sense primer including at least one part homologous to the s regions 5' of the target sequence, An anti-sense primer comprising at least one part homologous to the region 3' of the target sequence.

said primers permitting after amplification of the target nucleic acid 0io sequence, and after step the expression of the reporter gene.

The invention therefore also relates to a set of primers capable of being used at step of a method according to the invention characterized in that it comprises: A sense primer comprising at least one part homologous to the region 5' of the target sequence, An anti-sense primer, comprising at least one part homologous to the region 3' of the target sequence, said primers permitting after amplification of the target nucleic acid sequence, and after step the expression of a reporter gene.

:i In a first specific embodiment of the universal method of the invention, step includes the three following reactions (Figure la): the amplification of the target sequence with a pair of primers wherein the sense primer possess an RNA polymerase promoter and the anti-sense primer possess a 5' region homologous to the beginning 30 of the sequence of the reporter gene, and ooooo o° the contacting of the amplification products of the preceding reaction with the reporter gene optionally possessing an RNA H:UuanitaUKeep\patcnl\15679.00 doc 12/01/04 polymerase terminator for its transcription, a ribosome binding site for its translation, so as to hybridize said amplification products with said reporter gene, then the amplification of the products of step with a pair of primers, wherein the sense primer is similar to that of step and the anti-sense primer includes a part homologous to a region downstream of the reporter gene.

0io In this embodiment, the PCR reaction mixture contains the sample DNA, two sense and anti-sense primers, the reporter sequence, and a third primer homologous to a region downstream of the reporter gene. The first amplification of step and the second amplification of step can be carried out simultaneously or not.

As shown in Figure la attached, the first cycles of the PCR1 reaction permit the amplification of the target sequence. Once this sequence is present in a sufficient quantity in the reaction medium, it serves as a megaprimer and comes to be hybridized to the reporter sequence, which is thus amplified thanks to the third primer.

In a second embodiment of the universal method of the invention, step includes the two following reactions (Figure 1 b): S 25 the amplification of the target sequence with a pair of primers wherein the sense primer possess an RNA polymerase promoter and the anti-sense primer possess a 5' region homologous to the beginning of the sequence of the reporter gene, and the amplification of the products of step with a pair of primers wherein the sense primer is identical to that of step and the antisense primer is a mega-primer composed of the reporter gene optionally HUuanita\Keep\patert\ 15679.00 doc 12/01/04 possessing an RNA polymerase terminator for its transcription, a ribosome binding site for its translation.

In this embodiment, the anti-sense primer possess a 5' region s homologous to the beginning of the reporter sequence, which possess, as previously, all the information for its own translation. As indicated at Figure lb attached, the PCR reaction mixture contains the sample DNA, two sense and anti-sense primers and a mega-primer corresponding to the reporter sequence. The anti-sense primer is present in a less amount than the sense l0 primer. The first cycles of the PCR1 reaction permit the amplification of the target sequence. Once this sequence is present in sufficient quantity in the reaction mixture, it is amplified (PCR2) with the aid of the PCR1 sense primer and the mega-primer.

In a third embodiment of the universal method of the invention (Figure 1c), step includes the amplification reaction of the target sequence with a pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense primer possesses a 5' region including a sequence coding for a ribosome binding site, a reporter gene and optionally a transcription terminator.

In this embodiment represented in Figure Ic attached, the anti-sense *primer possesses a 3' region specific to the target sequence and a 5' region corresponding to a sequence coding for a ribosome binding site, a reporter l 25 gene and optionally a transcription terminator. The PCR reaction mixture .contains the sample DNA, two sense and anti-sense primers.

The invention equally relates to a labeling mixture for amplification for the carrying out of the embodiments described above. Such a mixture includes, the reactants necessary for carrying out the amplification cycles, -00 and therefore more particularly, the four deoxynucleotide triphosphates, the salts and the reactants that assure the optimal DNA polymerase activity, as well as the different types of primers described above.

HAJuanha\KMep\patcnl\I 5679.00 doc 12101/04 A labeling mixture for amplification more particularly adapted for the carrying out of step of the first embodiment of the universal method according to the invention includes: A pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense primer possesses a region homologous at the beginning of the sequence of the reporter gene.

The reporter gene optionally possessing an RNA polymerase terminator for its transcription, and a ribosome binding site for its translation, and A third primer homologous to a region downstream of the reporter gene.

A labeling mixture for amplification more particularly adapted to the carrying out of step of the second embodiment of the universal method according to the invention includes: A pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense promoter possesses a region homologous to the beginning of the sequence of the reporter gene, and :i i: A mega-primer composed of the reporter gene optionally possessing an RNA polymerase terminator for its transcription and a ribosome-binding site for its translation.

A labeling mixture for amplification more particularly adapted to the carrying out of step of the third embodiment of the universal method S 30 according to the invention comprises a pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense primer possesses a 5' region comprising a sequence coding for a ribosome binding site, a reporter gene and optionally a transcription terminator.

H: uaridta\Kep\patern\15679 00 doc 12/01/04 13 The invention therefore equally has for an aim a kit for the detection of a nucleic acid target sequence in a sample for use in accordance with the universal method previously described.

A kit for the detection of a nucleic acid target sequence in a sample according to the invention includes a set of primers defined above, a mixture necessary for the amplification, the triphosphate nucleotides, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, a cellular translation extract, the mixtures necessary for transcription, translation and optionally revelation of the reporter molecule, and optionally one or several substances permitting revelation of the activity of the reporter molecule.

A particular example of a kit according to the invention further comprises, one of the amplification mixtures above, a DNA dependent DNA polymerase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a DNA dependent RNA polymerase, a cellular translation extract, the mixtures necessary for amplification, transcription and translation and optionally one or several substances permitting revelation of the activity of the reporter molecule.

The method of the invention, at the level of step can equally be used based on the properties of the probes called "Padlock 2, 3, 4, WO 97/19193). This embodiment is more particularly adapted to the detection of target sequences possessing a point mutation.

The detection of target sequences using the "Padlock" probes therefore constitutes an alternative to the previously described embodiments of the socalled universal method of the invention.

30 The invention therefore equally relates to a method for in vitro detection of a target nucleic acid sequence in a sample characterized in that the preparation of the nucleic acid molecule of step is carried out by \knlbfilesThorNeuanita\Keep\paent\1 5679-00.2. dc 26/02/04 hybridization and ligation of a Padlock probe with the target sequence if it is present in the sample.

Said probe is composed at its 3' and 5' ends of segments separated by the complementary sequence of a reporter gene which possesses the complementary sequences of a promoter and possibly of an RNA polymerase terminator for its transcription, and the complementary sequence of a ribosome binding site for its in vitro translation, the sequences of said 3' and segments of the Padlock probe being complementary of the sought-after io target sequence in a manner so as to form with it a joined hybrid, and the end of the probe possessing a phosphate group so as to permit the circularization of the probe under the action of a ligase. There will preferably be used a nick-sealing ligase. In this way, in the absence of target sequence, the probe cannot be circularized.

Said probe can likewise be composed at its 5' and 3' ends of segments separated from 5' to 3' by the sequence of an RNA polymerase promoter, a ribosome binding site and the sequence of a reporter gene optionally with an RNA polymerase terminator.

The segments 3' and 5' of the Padlock probe are therefore defined by their being hybridized in a complementary and joined manner to a target sequence.

o: 25 The invention thus relates to also a likely Padlock probe to be used in a method characterized above in that segments 3' and 5' of the aforementioned Padlock probe are defined for hybridization in a complementary and jointed way on a target sequence.

oooo As previously indicated, the method of the invention based on the use of a padlock probe can advantageously be used for the in vitro detection of a :target nucleic acid sequence having a mutation. In this case, the preparation of the nucleic acid molecule of step is carried out by hybridization of a H.Uuanita\Xeep\palent\ 15679 00 doc 12/01/04 Padlock type probe with the target sequence if it is present, said probe corresponding to one of the two probes previously described with the following in particular: the sequences of said segments 3' and 5' of the Padlock probe are complementary to the sought-after target sequence in a matter so as to form with it a hybrid where the critical nucleotide liable to be mutated, is found at their junction when they are hybridized to the target sequence.

Thus, when the method of the invention is applied to the demonstration io of the presence of a mutation at the level of a target sequence, as shown in Figure 2b, the segments 3' and 5' of the "Padlock" probe are defined in such a manner that the critical nucleotide, liable to be mutated, is found at their junction when they are hybridized to the target sequence. In case of mispairing, the ligase will not be able to bond the two ends and the circularization of the probe will not be able to occur.

The invention therefore also relates to a Padlock probe capable of being used in the above method, characterized in that the sequences of said segments 3' and 5' of the Padlock probe are complementary to a target sequence having a nucleotide capable of being mutated in a manner so as to form with it a hybrid where said nucleotide is found at their junction when they are hybridized to the target sequence.

Advantageously, in the method of the invention based on the use of a 25 padlock probe, after circularization, the probe is used as a matrix for its replication by a rolling circle. The replication by a rolling circle is carried out with the aid of a primer complementary to the padlock probe in order to initiate the replication by DNA polymerase, in such a way as to produce a DNA matrix possessing a linking of reporter genes with all the signals necessary for its in vitro expression (that is from 5' to a repetition of the following element RNA polymerase promoter, ribosome binding site, reporter gene and optionally RNA polymerase terminator), or the complement of that I sequence according to the probe chosen then the complementary strand of HAJuanita\eeppatent\ 5679 00 doc 12/01/04 that DNA matrix is synthesized starting from a second oligonucleotide primer in such a way to make this matrix double stranded.

This preparation step increases the sensitivity of the detection thanks to numerous copies of the reporter gene produced starting from a single target molecule A particularly preferred embodiment of the method of the invention based on the padlock probes consists of carrying out directly at step the io transcription of the reporter gene on the Padlock probe after its circularization and the synthesis of the complementary strand with the aid of a primer complementary to the padlock probe complementary to the target.

This embodiment includes the preparation at step of a padlock probe corresponding to those previously described permitting either the detection of a nucleic acid sequence or the detection of a mutation on a nucleic acid sequence. This padlock probe is created in such a fashion that the direct transcription of the reporter gene by RNA polymerase can only take place if the padlock probe was previously circularized following its hybridization on the target nucleotide sequence. In this case, there is not any rolling circle amplification, but only the synthesis of the complementary strand of the padlock probe with the aid of a primer complementary to the padlock

S.

probe complementary to the target, and optionally ligation then direct :transcription of the reporter gene of the padlock probe by RNA polymerase.

The invention relates as well to kits for the implementation of the method of the invention using a padlock probe.

Such a kit is characterized in that it includes a probe as described o30 previously, a DNA dependent DNA polymerase, a nick-sealing ligase, the S00°..

triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for So..

initiating the replication, a primer permitting the synthesis of the second strand of DNA, a DNA dependent RNA polymerase, the mixtures necessary H:Uuanitn\Keep\paent\I5679 OOdoc 12/01/04 for the ligation, replication, transcription, translation and the revelation of the reporter molecule.

A first example of a kit according to the invention more particularly includes: One of two probes of Padlock type previously described. The sequences of said segments 3' and 5' of the Padlock probe are complementary to the sought-after target sequence in such a manner as to form with it a jointed hybrid, and the 5' end of the probe possesses a phosphate group in such a way as to permit the circularization of the probe under the action of a ligase.

A DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for initiating the rolling circle replication, a primer permitting the synthesis of the second strand of the DNA matrix generated by a rolling circle, a DNA dependent RNA polymerase, the mixtures necessary for the ligation, labeling, replication, transcription, translation and revelation of the reporter molecule.

A second example of a kit according to the invention more particularly comprises: o' 25 One of two Padlock type probes previously described. The sequences of said segments 3' and 5' of the Padlock probe are complementary to the sought-after target sequence in such a manner as to form with it a hybrid where the critical nucleotide ::liable to be mutated, is found at their junction when they are 30 hybridized to the target sequence, and the 5' end of the probe possesses a phosphate group in a fashion so as to permit the :circularization of the probe under the action of a ligase.

*:goo: H:Uuanita\Kp\patcnt\5679.00 doc 12/01/04 A DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate deoxynucleotides, the triphosphate nucleotides, a primer for initiating the rolling circle replication, a primer permitting the synthesis of the second strand of the DNA matrix generated by a rolling circle, a DNA dependent RNA polymerase, the mixtures necessary for the ligation, for the labeling, for the replication, for the transcription, for the translation and for the revelation of the reporter molecule.

A third type of kit for the particularly preferred embodiment of the above method of the invention using a padlock probe comprises: One of the Padlock type probes described previously permitting either the detection of a nucleic acid sequence or the detection of a mutation on a nucleic acid sequence.

A DNA dependent DNA polymerase, a ligase, the triphosphate deoxynucleotides, the triphosphate nucleotides, a primer for synthesizing the complementary strand of the circularized padlock probe, a DNA dependent RNA polymerase, the mixtures necessary for ligation, labeling, replication of the DNA, transcription, translation, and optionally revelation of the reporter molecule, and optionally one or several substances permitting revelation of the activity of the reporter molecule.

The method of the invention can equally be implemented in the scope 0 25 of an isothermic amplification also designated CIA for "Continuous Isothermic Amplification" of the type described in international patent application PCT No. W096/01327.

In this method of carrying out the method of the invention, the sought- 30 after target nucleic acid sequence is isolated from a nucleic acid sample at step by specific isothermic amplification with the aid of a DNA dependent DNA polymerase and of two specific primers of the target sequence, wherein at least one is composed of a 3' part which can be specifically hybridized to H:\Juanita\Kcp\patcnt\15679.00 doc 12/01/04 the target sequence and of a 5' part composed of at least one inverted repeated sequence in order to form at a suitable temperature a structure called a "hairpin." The fusion temperature of the double-stranded hairpin structure is preferably less than or equal to the fusion temperature of the part of the primer specifically hybridizing with the target sequence. The difference between the two fusibn temperatures is for example about 10 0 C. Moreover, one of the primers carries the sequence of a DNA dependent RNA polymerase transcription promoter, such as the RNA polymerase promoter of the phage T7 and the other primer carries a reporter gene possessing at its io end a ribosome-binding site.

In this embodiment of the invention, a gene coding for a microperoxidase can be cited more particularly as a reporter gene.

According to an advantageous embodiment, the two primers possess an inverted repeated sequence in order to form at a suitable temperature a hairpin structure. The inverted repeated sequences of the two primers can be identical or different. It is preferred that they be different to avoid hybridization between them.

A schematic representation of the method of the invention based on an isothermic amplification is presented in Figure 3 attached. Among the different pairs of primers which can be used in this embodiment of the method of the invention, the pair of preferred primers, designated A, can be more 25 particularly cited as follows: go• •i A sense primer composed, from 5' to of a the inverted complementary sequence of an RNA polymerase promoter, of the sequence of said RNA polymerase promoter, and of a 30 specific sequence capable of being hybridized upstream of the o••oo target sequence, An anti-sense primer composed, from 5' to of a ribosomebinding site, of a reporter gene, of the inverted complementary H:\Juanita\Keep\patcnr\1 5679.O.doc 1201/04 sequence of said reporter gene and of said ribosome binding site, and of a specific sequence capable of being hybridized downstream from the target sequence, at least one of said primers optionally including a restriction site.

The invention also relates to a set of primers that can be used in the above method, characterized in that it comprises: A sense primer including at least one part homologous at the region to the target sequence.

An anti-sense primer, comprising at least one part homologous at the 3' region to the target sequence.

said primers permitting after amplification of the target nucleic acid sequence and after the step the expression of a reporter gene, and at least one of said primers comprising, at the 5' region, a repeated inverted sequence.

The isothermic amplification is carried out with the following reaction medium: The matrix nucleic acid molecule possessing the target sequence, The four triphosphate deoxynucleotides, The salts and reactants assuring an optimal activity of the DNA 25 polymerase, A DNA dependent DNA polymerase, A pair of primers specific to the target sequence to amplify and comprising the repeated inverted sequences defined above.

The DNA dependent DNA polymerase can be thermostable or mesophilic. Advantageously, a mesophilic DNA polymerase with a strand :displacing activity is used, such as for example the Klenow fragment of the DNA polymerase I of E. coli. The adding of this DNA dependent DNA H:iuanira\Keep\pazent\l5679.00.doc 12/01/04 polymerase is carried out at the beginning of the reaction and after the two first steps of heating necessary for the denaturation of the DNA before of the implementation of the isothermic amplification.

Step of the method of the invention consists: of heating the reaction mixture above in a manner to separate the DNA strands, then of cooling in order to permit the hybridization of the primers, and of using the temperature suitable for elongation by DNA polymerase. These steps of heating, of hybridization and of elongation are repeated a second time before obtaining a single-stranded target sequence whose ends are composed of inverted repeated sequences. This recombinant nucleic acid molecule has, at the same time, a role as a matrix and as a primer thanks to the hairpin structure at each one of its ends. Contrary to what is known with PCR, the amplification takes place here in a spontaneous fashion and at a constant temperature. The temperature is chosen in a manner permitting: Equilibrium of the inverted repeated sequences between the linear and hairpin forms.

The elongation of the primers by the DNA polymerase.

As shown in Figure 3 attached, the amplification products rapidly attain a significant size, which can limit the elongation. The primers defining the size of the amplified fragment are chosen to optimize the amplification of the target sequence associated with a reporter gene.

A preferred operation of step of isothermic amplification according to the invention is as follows: i) Heating a reaction mixture comprising the nucleic acid sample in which the target sequence is possibly present, the four triphosphate deoxynucleotides, salts and reactants assuring an optimal DNA polymerase activity, a DNA dependent DNA polymerase if it is thermophilic, (if H: uanita\Kcp\palcnt\ 5679.00.doc 12/01/04 not iii), a pair of primers specific for the target sequence to amplify and including the inverted repeated sequences, in a manner to separate the DNA strands, then ii) Cooling it to permit hybridization of the primers, and iii) Adding DNA polymerase if it is mesophilic, iv) Placing the reaction mixture at a temperature suitable for the elongation by DNA polymerase.

v) Repeating a second time the steps of heating hybridization (ii) adding of the DNA polymerase if it is mesophilic (iii) and elongation (iv) in order to obtain a target sequence whose ends are composed of inverted repeated sequences.

vi) Letting the amplification reaction be carried out with the products of the previous step as matrix and primer, at a constant temperature chosen in a manner so as to permit: Equilibrium of the inverted repeated sequences between the linear and hairpin forms.

Elongation of the primers by DNA dependent DNA polymerase.

Moreover, the amplification products can be specifically cut by a restriction enzyme, during or after the amplification reaction of the target sequence combined with the reporter gene of step The restriction site is 25 preferably situated at the level of one of the primers and more preferably in a loop of a hairpin, more precisely in two inverted repeated sequences of one of the primers.

The choice of the primers and of the cutting site of the enzyme will be defined for an effective transcription of the reporter gene, in such a way that this cutting does not alter the later transcription of the reporter gene.

iIt H:\Juanita\ep\patet\ 5679.00.doc 12/01/04 In the case of the pair of preferred primers A described previously, the cutting site can be situated on the two primers and thus be identical or different on each of the primers.

The invention therefore equally has for an aim a set of primers as defined above capable of being used in the previous method characterized in that at least one of the two primers comprises a restriction site. If the two possess a restriction site, they can be identical or different.

Preferably, the restriction site present on at least one of the primers is situated in a loop of a hairpin, more precisely between two repeated inverted sequences of one of the primers.

The invention also relates to the reaction mixture for the carrying out of the isothermic amplification method of the invention above comprising the four triphosphate deoxynucleotides, salts and reactants assuring an optimal activity of the DNA polymerase, a DNA dependent DNA polymerase, a pair of primers specific for the target sequence to amplify and comprising at 5' the inverted repeated sequences containing the reporter sequences.

*ooo The invention also relates to a kit for the implementation of the method of detection of a target sequence in a DNA sample comprising a set of primers as defined above, an amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for the transcription, for the translation and for the revelation of the reporter molecule.

:Outside of the specific examples of the kit previously described where the target substance is a target nucleic acid sequence, the invention relates to 30 kits for the implementation of the method of the invention, regardless of the S" target substance, such a kit is characterized in that it comprises at least a reporter gene, the mixtures necessary for transcription, for translation and for the revelation of the protein encoded by the reporter gene.

HAUuanita\Keeppaten\1 5679-00.2.dc 26/02/04 It is also possible to combine in a single tube several detections according to the method of the invention. In this case, different reporters are used to detect each of the target substances.

It is also possible to use the same reporter for several target substances. A positive result thus uniquely indicates the presence of one or the other of the target substances.

The transcription and translation reaction (step b) can be broken down into two distinct steps or simultaneous. In the latter case, the transcription and translation reactions are carried out simultaneously. On the other hand, the breaking down of the steps permits an easier optimization of the yields of each step, and thus produces more significant quantities of the reporter protein, which is especially useful in the case of enzymes of low specific activity.

The separation between the transcription and translation also permits avoiding the problems of degradation of the DNA matrix by the nucleases if they were prepared by PCR. In effect, the constituents of the transcription reaction are slightly contaminated by nucleases, contrary to the translation extracts.

:l.-2:Moreover, the use of different cellular translation extracts according to the origin of the reporter gene permits optimization of the translation. In effect, the phase of translation of the transcript of step is advantageously carried out with a cellular extract of the same origin or of an origin close to that of the reporter gene. There can be cited by way of example the use of a translation extract prepared starting from eukaryotic cells for the translation of a eukaryotic reporter gene. In another illustrative case, the translation extract is prepared starting from extremophilic organisms for the translation of a reporter gene from the same organism or from another extremophilic I~ organism of the same type (thermophiles, halophiles, acidophiles, H:Juanita\Keep\paent\15679.00.doc 12/01/04 These specific extracts permit an increase in the effectiveness of the translation. But they can also be carried out with a standard extract such as for example an E. coli extract.

The process of the invention is thus notable in that it makes use of an adequacy between the expression punctuation of the transcripts and the translation extracts used. These extracts are also characterized in that either they do not contain the sought-after property, or they contain it but it is not detectable in the conditions of the test carried out for detecting the soughtafter function. It relates for example to the use of a translation extract containing a mesophilic beta-galactosidase activity permitting translation of an mRNA of a thermophilic beta-galactosidase and the detection of the activity of this latter at high temperature, which eliminates the mesophilic betagalactosidase activity.

A particular embodiment of the process of the invention consists of using at step a translation extract that is in fact a mixture of several translation extracts. It can also relate for example to a translation extract of E coli overexpressing a chaperon protein A mixed with a translation extract of E.

coli overexpressing a chaperon protein B. Any type of mixture is contemplated so long as it corresponds to the characteristics described *above. In the same manner, it is possible to use a translation extract in which **are added one or several tRNAs specific of one or several codons. The 25 translation extracts thus obtained thereby permit translation of the mRNA comprising these specific codons, such as for example the translation of an mRNA containing an amber codon by adding in the translation extract a suppressor tRNA.

The treatment of step with a translation extract can also be carried out with a standard translation extract what ever the origin of the sample as for example an extract of E coli and/or any other cellular extract(s) H.Uumnia\Keep\patent\5679.00.dc 1201/04 supplemented or not by molecules of interest such as those, for example, indicated previously (tRNA, chaperon...).

It is equally possible to add to the translation extract of step one or several substances favoring a refolding or a more effective maturation of the expressed proteins, such as for example chaperons, detergents, sulfobetaines, membrane extracts, etc.

According to a particular embodiment of step the identification of the activity of the protein encoded by the reporter gene, also designated "reporter molecule" is carried out by contacting the reporter molecule with one or several substrates capable of identifying its activity.

Any type of specific substrate can be contemplated by a person skilled in the art in order to highlight the presence of the activity of the protein encoded by the reporter gene. A person skilled in the art will be able for example to refer to works such as Methods In Enzymology or Annual Review of Biochemistry, in which a large number of methods to study enzyme activity and of preparation of substrate have been described.

S"The measurement of the activity of the protein of step can be read directly in a fluorimeter if the reporter is for example GFP or by a colorimeter if the reporter is for example beta-lactamase. The readers are adapted for the revelation of the reporter. One can equally contemplate measurements by absorbance, viscosity, mass spectrometry etc... It can also be contemplated to carry out a reading continuously of the reporter activity, if the latter lends itself to it.

S .i A particular application of the process of the invention consists of 30 administrating the target substance labeled by the reporter gene and the sequences necessary for its expression, for example to an organisms or in a process, then searching for, by the pursuit of the steps of the invention up to H:\uanita\Keep\patent\ 5679-.2.doc 26/02/04 step of the method of the invention, in a sample withdrawn from said organism or from said process, the protein encoded by said reporter gene.

The method of the invention can also advantageously be automated, notably if the number of samples to analyze is high. The samples containing the target substances are thus placed on a support that can correspond to biochips or microtitration plates that can contain several dozens to several thousands of sites. These supports are placed on an automatic machine for: The preparation of the target substances (step a), The adding of the transcription and translation reactants (step The revelation of the reporter molecule (step c).

Consequently, the invention relates to a device comprising an arrangement of one or several supports, of robots and of a reader of said supports for the carrying out of the steps of the method described previously.

The invention equally concerns a process of labeling a substance corresponding to step of the method of the invention described above.

The invention therefore also concerns a substance labeled by a reporter gene and the elements necessary for the in vitro expression of said reporter gene capable of being obtained by this labeling process.

Seb The invention finally concerns the use of a reporter gene and the elements necessary for the in vitro expression of said reporter gene as a label of a target substance.

Other advantages and features of the invention will appear form the examples of carrying out the invention that follow.

S

Example I: Labeling by PCR and detection.

1) The gene coding for microperoxidase 8 (MP8) was cloned in the expression vector pET26b+.

H.\Juanita\Ketp\paxat\15679.O doc 12/01/04 For this, two partially complementary oligonucleotides MICRO1 and MICRO2 were hybridized thus producing a double-stranded DNA fragment with compatible protruding ends respectively with a restriction Ndel site at the ATG side of the gene and with a Xhol site at the other end. This DNA fragment was inserted in the vector pET26b+ digested by Ndel and Xhol. In this way, the obtained plasmid contains the gene coding for the MP8 under the control of the promoter of the T7 RNA polymerase and its terminator situated on both sides.

Sequence MICRO1: Sequence MICRO2: Double-stranded DNA fragment: Compatible Compatible Ndel Xhol TATG TGC GCA CAA TGT CAT ACA GTA GAA TAA TAA C 3' AC ACG CGT GTT ACA GTA TGT CAT CTT ATT ATT GAGCT Met Cys Ala Gin Cys His Thr Val Glu Stop Stop 25 2) This plasmid then served as matrix during the following PCR: plasmid: about 100 ng *pETS' primer: 10 pmol pET3' primer: 10 pmol Taqpol (Appligene): 2 U 30 DNTP: 200pM each Mix Taqpol Appligene: 1X pET5' AGATCTCGATCCCGCGAAATTAATACG pET3' CAAAAAACCCCTCAAGACCCGTTTAG o g H:Uuanira\Keep\pacnt\1567900doc 12/01/04 The amplification cycles carried out are the following: 3 mn at 940, (30s at 940, 30s at 600, 1 mn at 720) 30 times, 3 mn at 720 This PCR permits amplification of a fragment containing, from 5' to the promoter of the T7 RNA polymerase, the ribosome-binding site, the MP8 gene and the transcription terminator of the T7 RNA polymerase. The PCR product was purified by phenol chloroform extraction and precipitated with ethanol.

3) The product of the PCR reaction was transcribed under the following conditions: PCR product: 100 g T7RNA polymerase (NEB): 300U T7 RNA polymerase mix (NEB): 1X MgCl 2 20 mM DTT: 20 mM NTP: 2 mM each 3h at 37 4) Some translations were carried out starting from 0, 2.75 and 11 jg of RNA under the following conditions: 43.8 pg of translation extract 0, 2.75 and 11 mg of RNA 2.75, 11 mg of RNA) water qsp 60 pl 25 3 h at 37 The measuring of the microenzyme activity was carried out according to the following protocol described by Hirayama et al.

Two standard ranges were carried out: one in the presence of 10 jl 30 of translation control (without RNA) for the points where 10 il of translation are measured. The results obtained are reported in the table 1 below, expressed in units of luminescence.

*o*oooo H:Juanita\Keep\paiern\15679 OO dc 12/01/04 Table 1 Sample 0 control 0.1 ng purified MP8 1 ng purified MP8 ng purified MP8 100 ng purified MP8 Translation with 2.75 pg of RNA Translation with 11 pg of RNA 10 tl of translation 1760 2368 5248 49088 1530144 2784 6752 The standard range obtained permits estimation of the quantity of MP8 produced at 0.14 ng with a translation of 2.75 tg showing that the PCR product can be demonstrated by the method which is the object of the invention.

Example II: Detection of a target DNA by padlock, and rolling circle 1) The following oligonucleotide was prepared: Homologous to the target Complementary promoter strand T7

CTATAGTGAGTCGTATTAATTTTTATTATTCTACTGTATGACATTGTGCGCACATATGTA

Complementary strand of the MP8 gene TATCTCCTTCTTAAAGTTAAACCCGTCGATCATAAGGCTTGG 3' Complementary Homologous to the target Strand of the rbs 2) The plasmid used as target contains the following sequence:

CTGTGGGGAATCCTGCTGAACCAAGCCTTATGATCGACGG

This sequence is recognized by the padlock probe above.

H:UuanitaTKecp\paent\I 5679.00 doc 12/01/04 3) The ligation reaction is carried out as follows: Linearized target plasmid: 2 pg Ampligase mix (Epicenter): 1X Ampligase: 10 U Padlock oligo: 0.2 pmol Water qsp: 50 pl The following temperature cycles are then carried out: 3 mn at 94 at 94 0 10s at 55 0, 1 mn30 at 650) 30 times.

4) The rolling circle amplification was done according to the following protocol: Ligation reaction: 10 p1 PADRCMP8 oligo: 10 pmol DNTP: 384 pM Klenow polymerase: 5 U Water qsp 25 pl 2h at 37 The PADRCMP8 oligonucleotide has the following sequence: TTTAACTTTAAGAAGGAGATATAC. It is complementary to a part of the padlock probe and therefore serves as a primer to the rolling circle.

5) Synthesis of the complementary strand 50 pmol of PADPCR5' oligonucleotide was added as well as 5 nmol of 25 dNTP.

This oligonucleotide is complementary to the strand amplified by rolling circle.

The reaction mixture was heated 5 mn at 100 OC then allowed to cool in order to permit the hybridization of the oligonucleotide to the rolling circle.

5U of Klenow DNA polymerase and 5U of restriction enzyme Asel were then added. After incubation 2h at 37 double-stranded DNA molecules were obtained. An Asel site being present just upstream of the promoter H:Uuniira\Yep\patern\15679.0.doc 1201/04 sequence, the cutting by Asel permits shortening the multimers and thus will favor transcription.

The oligonucleotide PADPCR5' has the following sequence: 5' TTCAGCAGGATTCCCCACAG 6) Transcription The transcription of the amplification product was carried out under the following conditions: Above reaction product: 10 ~1 T7 RNA polymerase (NEB): 150 U T7 RNA polymerase mix (NEB): 1X MgCI2: 2 mM DTT: 20 mM NTP: 2 mM each 12 h at 370 7) Translation: The translation was carried out as described in the previous example.

8) Measuring: The measuring of the activity of the microenzyme was carried out with 10 pil of translation according to the following protocol described by Hirayama et al. (Hirayama O et al., 1997, Analytical Biochem., 247, p237-241): The negative control is a complete 25 experiment where the target plasmid was replaced by water at step 3. The translation and the measuring were done twice with different reaction mixes.

The results obtained are reported in Table 2 below and are expressed S* in units of luminescence.

o* Table 2 Sample Experiment 1 Experiment 2 H,\Juanta\Kccp\patent\I 5679 OOdoc 101/04 H:Vuaiita\Kcp~paucnt\l 5679.O0.doc 1 2101/04 BIBLIOGRAPHIC REFERENCE 1) Landegren, Samiotaki, Nilsson, Malmgren, H. and Kwiatkowski, M. (1996). Detecting genes with ligases. METHODS: A Companion to Methods in Enzymology 9, 84-90.

2) Landegren, U. and Nilsson M. (1997). Locked on target: strategies for future gene diagnostics. Ann. Med. 29, 585-590.

3) Nilsson Malmgren, Samiotaki, Kwiatkowski, M. Chowdhary, B.P. and Landegren, U (1994). Padlock Probes: Circularizing oligonucleotides for localized DNA detection. Science 265, 2085-2088.

4) Nilsson Krejc, Koch, Kwiatkowski, MI, Gustavsson, P. and Landegren, U. (1997). Padlock probes reveal single-nucleotide differences, parent of origin and in situ distribution of centromeric sequences in human chromosomes 13 and 21. Nature Genetics 16, 252-255.

*0 **0 oo oo H: \uanita\Keep\paernt\1567900 doc 12/01/04

Claims (1)

1. 9.. to 11, characterized in that the kit comprises a set of primers according to claim 12, a mixture necessary for the amplification, the triphosphate nucleotides, a DNA dependent RNA polymerase, a cellular translation extract, the mixtures necessary for transcription, for translation, and optionally for the *o99 9 revelation of the reporter molecule, and optionally one or several 30 substances permitting revelation of the activity of a reporter molecule. 14) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to claim 7, characterized in that the H:Uu~nit\Kecp\patcnt\I 5679 .2.doc 26102/D4 preparation of the nucleic acid molecule of step is carried out by hybridization and ligation of a Padlock type probe with the target sequence. 15) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to claim 14, characterized in that said probe is composed in 3' to 5' of segments separated by the complementary sequence of a reporter gene which possesses the sequences complementary to a promoter and optionally of an RNA polymerase terminator for its transcription, and the complementary sequence of a ribosome binding site for its translation in vitro. 16) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to claim 14, characterized in that said probe is composed in 5' and 3' of segments separated from 5' to 3' by the RNA polymerase promoter sequence, of a ribosome-binding site and of the sequence of a reporter gene optionally with an RNA polymerase terminator. 17) A Padlock probe when used in a method according to any one of claims 14 to 16, characterized in that the sequences of said segments 3' and 5' of the Padlock probe are defined by being able of hybridization in a complementary and joined manner to a target sequence. 0% 18) A Padlock probe when used in a method according to any one of claims 14 to 16, characterized in that the sequences of said segments 3' and 5' of the Padlock probe are complementary to a 30 target sequence having a nucleotide capable of being mutated so as to form with it a hybrid where said nucleotide is found at their junction when they are hybridized to the target sequence. H:Uuanita\Kcp\patcnl\ 15679-0.2 doc 26/02/04 19) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to any one of claims 14 to 18, characterized in that after circularization, the probe is used as a matrix for its replication by rolling circle. Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to claim 19, characterized in that the rolling circle replication is carried out with the aid of a primer complementary to the padlock probe complementary to the target in order to initiate the replication by DNA polymerase, in such a fashion to produce a DNA matrix possessing a linking of reporter genes with all the signals necessary for its expression in vitro, and in that the complementary strand of this DNA matrix is synthesized starting with a second oligonucleotide primer so as to make this matrix double-stranded. 21) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to any one of claims 14 to 18, characterized in that at step the transcription of the reporter gene on the 20 Padlock probe is carried out directly after its circularization and the synthesis of the complementary strand with the aid of a primer complementary to the padlock probe complementary to the target. 22) A kit when used in the method according to claims 19 to 21, characterized in that the kit comprises a probe according to any one of claims 17 or 18, a DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for initiating replication, 30 a primer permitting the synthesis of the second DNA strand, a DNA dependent RNA polymerase, the mixtures necessary for ligation, for replication, for transcription, for translation and for the revelation of the reporter molecule. HAJuanfta\KccppatcnI 679-0.2 doc 26102/04 23) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to any one of claims 7 or 8, characterized in that the target nucleic acid sequence is isolated from a nucleic acid sample at step by specific isothermic amplification, with the aid of a DNA dependent DNA polymerase and of two specific primers of the target sequence, wherein at least one is composed of a 3' part which can be specifically hybridized to the target sequence and of a 5' part comprising at least one inverted repeat sequence for forming at a suitable temperature a so called "hairpin" structure. 24) Method of diagnosis in vitro of a target nucleic acid sequence in a sample according to claim 23, characterized in that the two primers possess an inverted repeat sequence in order to form at a suitable temperature a hairpin structure, said inverted repeat sequences of the two primers capable of being identical or different. Method of diagnosis in vitro of a target nucleic acid sequence in 20 a sample according to any one of claims 23 or 24, characterized in that the step of isothermic amplification comprises the following steps: i) heating a reaction mixture comprising the nucleic acid sample in which the target sequence is possibly present, the four triphosphate deoxynucleotides, the salts and reactants assuring an optimal activity of the DNA polymerase, a DNA dependent DNA polymerase if it is thermophilic (if not iii), a pair of primers specific for the target sequence to amplify and comprising the reversed repeat sequences, in a manner so as to separate the DNA strands, then, ii) cooling in order to permit the hybridization of the primers, and iii) adding the DNA polymerase if it is mesophilic, then HAJuanika\Kecp~patent\I 5679-.2.doc 26/02/04 iv) placing the reaction mixture at (sufficient) appropriate temperature for the elongation by DNA polymerase; v) repeating a second time, the steps of heating hybridization of adding the DNA polymerase if it is mesophilic (iii), and elongation (iv) in order to obtain a target sequence wherein the ends are composed of reversed repeat sequences, vi) leaving the amplification reaction to be carried out with as matrix and primer the products of the previous step, at a constant temperature chosen in such a manner as to permit: the balance of the reversed repeated sequences between the linear form and the hairpin form, the elongation of the primers by DNA dependent DNA polymerase. 26) A set of primers when used in the method according to any one of claims 23 to 25, characterized in that the set of primers comprises: 20 a sense primer comprising at least one part homologous to the 5' region of the target sequence, an anti-sense primer, comprising at least one part homologous to the 3' region of the target sequence said primers permitting after amplification of the target nucleic acid sequence, and after the step the expression of a reporter gene, and at least one of said primers comprising a inverted repeated sequence. 27) Method of diagnosis in vitro of a target nucleic acid sequence in 30 a sample according to any one of claims 23 to 25, characterized oO o i in that the amplification products can be specifically cut by a restriction enzyme, during or after the amplification reaction of the target sequence. HAJuanita\Keep~patent\I 5679-00.2.dc 26/02/04 28) A set of primers according to claim 26, when used in the method according to claim 27, characterized in that at least one of the two primers contains a restriction site, if the two possess a restriction site, the latter being identical or different. 29) A set of primers according to claim 28 when used in the method according to claim 27, characterized in that the restriction site present on at least one of the primers is situated in a loop of a hairpin, more precisely between two repeated repeat sequences of one of the primers. A kit when used for the implementation of the method of diagnosis of a target sequence in a sample according to one of claims 23 to 25 or 27, characterized in that it comprises: a set of primers according to any one of claims 26 or 28 or 29, an amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for transcription, for translation, and for the revelation of the reporter 20 molecule. :i 31) The use of a reporter gene and of the elements necessary for its expression in vitro in a non-cellular system for the specific labeling of a target substance in a sample, said labeling being done in order to ensure that if the target substance is a traget nucleic acid sequence, the transciption and the translation of said reporter gene gives a reporter protein, which does not result in an expressed target-reporter fusion protein. o 32) A kit when used for the implementation of the method of o"i diagnosis of a target substance according to any one of claims 1 to 6, characterized in that it comprises at least a reporter gene, the ways permitting to associate said reporter gene with a target substance, said ways being such as to ensure that if the target H:\uaniu\Keppatent\15679-00.2.do 26/02104 substance is a target nucleic acid sequence, the transcription and the translation of said reporter gene will not lead to a reporter fused protein coded by said target nucleic acid sequence, and the mixtures necessary for the transcription, for the translation and for the revelation of the reporter protein encoded by the reporter gene. 33) A substance labeled by a reporter gene and the elements necessary for the expression in vitro of said reporter gene according to claim 1, said labeling being done in order to ensure that if the target substance is a target nucleic acid sequence, the transcription and the translation of said reporter gene gives a reporter protein which does not result in an expressed target- reporter fusion protein. 34) A method according to any one of the preceding method claims, substantially as hereinbefore described with reference to the examples and/or figures. 35) A set of primers according to any one of claims 12, 26, 28 or 29, substantially as hereinbefore described with reference to the examples and/or figures. 36) A kit according to any one of claims 13, 22, 30 or 32, substantially as hereinbefore described with reference to the examples and/or figures. 20 oo o a. H:\Jumniht\Kccppatent\I 5679-00.2.doc 26/02/04 37) A padlock probe according to claim 17 or claim 18, substantially as hereinbefore described with reference to the examples and/or figures. Dated this 26th day of February 2004. PROTEUS By their Patent Attorneys GRIFFITH HACK Fellows Institute of Patent and Trade Mark Attorneys of Australia H:Vuanita\Keep\ptcntI 5679-00.2.doc 26/02/04