AU772124B2 - Compositions and methods for halogenation reactions - Google Patents

Description

WO 01/44447 PCT/EP00/12347 -1- COMPOSITIONS AND METHODS FOR HALOGENATION REACTIONS The present invention relates generally to methods, transgenic plants and transgenic microorganisms for the biosynthesis of halogenated natural products, where the halogenation is substrate and regiospecific. In one aspect, the present invention relates to the use of halogenated metabolites, produced by the method of the invention, for the protection of host organisms against pathogens, more particularly, to the protection of plants against phytopathogens. In this aspect, the invention provides transgenic plants with enhanced resistance to phytopathogens, and biocontrol organisms with enhanced biocontrol properties.

Biosynthesis of the over 2000 known naturally-occurring halogenated metabolites has long been regarded as a function of two classes of enzymes: the haloperoxidases and the non-heme haloperoxidases (Gribble GW 1994, The natural production of chlorinated compounds. Environ Sci technol 28:310-319; van Pee K-H [1996] Biosynthesis of halogenated metabolites by bacteria. Annu Rev Microbiol 50:375-99). Of the first group, the bromoperoxidases and chloroperoxidases all possess protoporphyrin IX as the hemecontaining prosthetic group. This group acts catalytically by reacting with hydrogen peroxide to form the hydroperoxide of the enzyme (compound which then reacts with the halide X= Br', CIl, or I) resulting in the formation of the enzyme bound intermediate EOX. It is unknown whether EOX is the halogenating agent or whether decomposition of EOX leads to an activated, short half-life halogenating agent X+ or derivative thereof HOX, X 2 or Xa). However, the lack of substrate specificity and lack of regiospecificity exhibited by this class of halogenases strongly argues that halogenation takes place outside the active site and is catalyzed by one of the decomposition products of EOX (Franssen MCR [1994] Halogenation and oxidation reactions with haloperoxidases.

Biocatalysis 10:87-111).

Non-heme haloperoxidases are of two types, those that possess vanadium, and those that possess a Ser/Asp/His catalytic triad characteristic of serine proteinases. The former group catalyze the vanadium and hydrogen peroxide-dependent formation of HOX which again results in halogenation outside the active site and a pronounced lack of substrate specificity (Franssen MCR [1994] Halogenation and oxidation reactions with haloperoxidases. Biocatalysis 10:87-111). The non-vanadium containing non-heme haloperoxidases are hypothesized to form an acetate ester at the site active Ser residue, WO 01/44447 PCT/EP00/12347 -2which is then converted to peracetic acid in the presence of hydrogen peroxide; peracetic acid oxidizes the halide ion to an activated halogenating species (Pelletier I, Altenbucher J, Mattes R [1995]. A catalytic triad is required by the non-heme haloperoxidase to perform halogenation. Biochim Biophys Acta 1250:149-157). Again, the result is a reaction which fails to proceed with either substrate specificity or regiospecificity van Pee K-H [1996] Biosynthesis of halogenated metabolites by bacteria. Annu Rev Microbiol 50:375-99).

Recently an additional class of halogenase genes has been described whose products exhibit the ability to carry out the regiospecific halogenation of a wide array of natural products (Hammer PE, Hill DS, Lam ST, Van Pee KH, Ligon JM [1997] Four genes from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. Appl Environ Microbiol 63:2147-2154.

The present invention describes methods of transferring a halogen to a substrate in a regiospecific manner comprising contacting the substrate with a regiospecific halogenase in the presence of an oxidant, a halogen donor, an electron transferase, and a reductant where if the transfer occurs in vivo the electron transferase is encoded by a heterologous nucleic acid molecule.

In particular, methods are described wherein the method according to the invention further comprises a FAD or FMN component, particularly FAD wherein the electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to FAD wherein the electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to the regiospecific halogenase wherein the electron transferase is a flavin reductase, ferrodoxin NADP reductase, ferredoxin, diaphorase-sufhydryl reductase or NADH-cyt-B5 reductase, NADPH-FMN reductase, NADPH-cyt-p450 reductase or nitrate reductase wherein the electron transferase comprises an amino acid sequence having at least identity to any one of the amino acid sequences according to SEQ ID NOs:19, 21, 23, 27, 29 or 31 wherein the electon transferase comprises an amino acid sequence of any one of SEQ ID NOs:19, 21, 23, 25, 29 or 31 P:\OPERKbm\17078-01 rsl.doc19/02/04 -3wherein the regiospecific halogenase is prnA, prnC, pyoluteorin halogenases pltA, pltD, and pltM, tetracycline halogenase cts4, hydrolase a, or balhimycin halogenase bha A wherein the regiospecific halogenase comprises SEQ ID NO: 1 wherein the regiospecific halogenase is a polypeptide comprising an amino acid domain according to any one of SEQ ID NOs:3, 5, 7, 9, 11, 13, 15 or 17.

Further are provided host cells expressing a heterologous nucleic acid molecule whose compliment hybridizes to any one of SEQ ID NOs. 18, 20, 22, 24, 26, 28, or 30 under the hybridization conditions of: 7% sodium dodecyl sulfate (SDS), 0.5M NaP0 4 ImM EDTA at 50 0 C with washing in 0.1X SSC, 0.1% SDS at 65 0

C;

and at least one heterologous nucleic acid molecule whose compliment hybridizes any one of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14 or 16 under the hybridization conditions of: 7% sodium dodecyl sulfate (SDS), 0.5M NaP04, ImM EDTA at 50 0 C with washing in 0.1X SSC, 0.1% SDS at 65 0 C, in particular wherein the host cell is a bacterial, fungal or plant cell host cell is a microbial cell the host cell further expresses nucleic acid sequences encoding prnB and prnD o: Further are provided 20 methods of producing pyrrolnitrin comprising growing the host cell as mentioned •hereinbefore methods of protecting a plant against a pathogen comprising treating the plant with said host cell, whereby pyrrolnitrin is produced by the host in amounts that inhibit the pathogen 25 methods as mentioned hereinbefore, further comprising collecting pyrrolnitrin from the host.

Further are provided plants comprising a host cell according to the invention methods of protecting a plant against a pathogen, comprising growing the plant as mentioned hereinbefore, whereby pyrrolnitrin is produced in the plant in amounts that inhibit the pathogen P:\OPER\Kbm\17078-01 rcsl.doc-19/02/04 -3Aseeds of the plant as mentioned hereinbefore methods of preventing fungal growth on a crop, comprising growing the plant according to the invention, wherein the plant is a crop plant methods for improving production of halogenated substrates by a host comprising expressing a heterologous nucleic acid molecule encoding electron transferase in a host wherein the host expresses at least one endogenous polypeptide having regiospecific halogenase activity.

oo WO 01/44447 PCT/EP00/12347 -4- In the present invention it was surprisingly found that regiospecific halogenases are able to transfer a halogen to a substrate in vitro but in order to do so they require an additional protein factor, an electron transferase. The discovery that an additional proteinaceous factor is required to effect halogenation in vitro by these enzymes was made through the purification of PrnA, a D-tryptophan halogenase that functions in the biosynthesis of pyrrolnitrin, a dichlorinated nitrophenylpyrrole antibiotic, by Pseudomonas fluorescens. Purification of this NADH- and flavin adenine dinucleotide (hereinafter "FAD")dependent halogenase was accompanied by a progressive decrease in halogenating activity. During ion exchange chromatography of extracts from P. fluorescens overexpressing PrnA, partially purified and inactive PrnA could be reactivated by addition of aliquots of chromatographic fractions from which PmA was absent. The factor responsible for reactivation herein designated P. fluorescens P2, was subsequently shown to be a protein on the basis of its heat and protease sensitivity. Purification of PrnA to homogeneity led to a complete loss of activity, which could be restored by addition of an electron transferase of the invention.

A second halogenase in the pyrrolnitrin pathway, PmC, exhibits sequence similarity with PrnA, albeit less sequence similarity to PmA than to the following regiospecific halogenases known to be involved in biosynthesis of halogenated natural products: pyoluteorin see, Nowak-Thompson B, Chaney N, Wing JS, Gould SJ, Loper JE, [1999] Characterization of the pyoluteorin biosynthetic gene cluster of Pseudomonas fluorescens J Bacteriol 181:2166-2174); chloroeremomycin (see, van Wageningen AM, Kirkpatrick PN, Williams DH, Harris BR, Kershaw JK, Lennard NJ, Jones M, Jones SJ, Solenberg PJ [1998] Sequencing and analysis of genes involved in the biosynthesis of a vancomycin group antibiotic. Chem Biol 5:155-162); balhimycin (see, Pelzer S, Sussmuth R, Heckmann D, Recktenwald J, Huber P, Jung G, Wohlleben W[1999] Identification and analysis of the balhimycin biosynthetic gene cluster and its use for manipulating glycopeptide biosynthesis in Amycolatopsis mediterranei DSM5908. Antimicrob Agents Chemother 43:1565-73 and Pelzer S, Reichert W, Huppert M, Heckmann D, Wohlleben W [1997] Cloning and analysis of a peptide synthetase gene of the balhimycin producer Amycolatopsis mediterranei DSM5908 and development of a gene disruption/replacement system. J Biotechnol 56:115-128); and chlorotetracycline (see, Dairi T, Nakano T, Mizukami T, Aisaka K, Hasegawa M, Katsumata R [1995] Conserved organization of genes for biosynthesis of chlortetracycline in Streptomyces strains. Biosci Biotechnol Biochem 59:1360-1361, and WO 01/44447 PCT/EP00/12347 Dairi T, Nakano T, Aisaka K, Katsumata R, Hasegawa M [1995]Cloning and nucleotide sequence of the gene responsible for chlorination of tetracycline. Biosci Biotechnol Biochem 59:1099-106). Similar to PmA, purification of PrnC was accompanied by a loss of halogenating activity, which could be restored by the addition of an electron transferase of the invention.

The pyrrolnitrin pathway had previously been shown to function in E. coli when the pyrrolnitrin operon encoding PrnA, PmB, PrnC and PmD (for nucleic acid sequence of the pyrrolnitrin operon please see 5.8 X/N, cited in US Patent No. 5,723,759 which is herein incorporated by reference in its entirety) was expressed. PrnA and PrnC function as halogenases; PrnB catalyzes rearrangement of the indolyl moiety of tryptophan to the aminophenylpyrrole, and PrnD oxidizes the aminophenyl moiety to a nitrophenyl substituent. Surprisingly in the present invention it was found that when an electron transferase of the invention, E. col flavin reductase (hereinafter "Fre") in this case, is overexpressed, in vivo production of pyrrolnitrin is significantly enhanced.

The presence of "P2 like activity" was established in E. co/i by addition of E. coli extract to purified inactive PrnA. The E. coi P2 like activity was then partially purified by ion exchange, hydroxyapatite, and gel permeation column chromatography. Column fractions containing the activity, and flanking inactive fractions were trypsinized and sequenced by mass spectrometry; the peptides identified in the inactive fractions were subtracted from those present in the active, E. coli P2 like activity containing fraction, and the remaining peptides referred to the E. coligenome database. From this, one nucleic acid sequence was uniquely identified, an NADH-dependent flavin reductase, (hereinafter "fre", Genbank accession 23486).

As will be described more specifically in the detailed description below, E. coli fre was then cloned and overexpressed, and overexpressing cells shown to possess increases in E. coli P2 like activity directly proportional to their increase in flavin reductase activity. fre was also co-transformed into E. colialong with the pyrrolnitrin operon on separate plasmids. Cells harboring both plasmids produced a significantly higher pyrrolnitrin or pyrrolnitrin metabolites than those harboring the pyrrolnitrin operon alone, confirming the identity of Fre as the accessory factor for PmA and PrnC, as well as indicating that, in E.

coli, flavin reductase activity is a major factor limiting pyrrolnitrin production.

In one embodiment of the invention a method of transferring a halogen to a substrate in a regiospecific manner comprising contacting the substrate with a regiospecific halogenase WO 01/44447 PCT/EP00/12347 -6in the presence of an oxidant, a halogen donor, an electron transferase, and a reductant where if the transfer occurs in vivo the electron transferase is heterologous to the host is provided.

In another embodiment of the invention a method of transferring a halogen to a substrate in a regiospecific manner comprising contacting the substrate with a regiospecific halogenase in the presence of an oxidant, a halogen donor, an electron transferase, a reductant and FAD or FMN, where if the transfer occurs in vivo, the electron transferase is heterologous to the host is provided. In a particularly preferred embodiment, the reaction results in the production of pyrrolnitrin.

In one preferred embodiment the electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to FAD or electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to the regiospecific halogenase.

In one preferred embodiment of the invention, the electron transferase amino acid sequence is at least 30% identical, preferably 40% identical, more preferably 50% identical, more preferably 60% identical, more preferably 70% identical, more preferably identical, or more preferably 90% identical to NADPH-FMN reductase, rat liver NADPH cytochrome P-450 reductase, spinach ferredoxin NADP reductase, cytochrome reductase, or nitrite reductase.

In one preferred embodiment of the invention, the regiospecific halogenase amino acid sequence is at least 30% identical, preferably 40% identical, more preferably 50% identical, more preferably 60% identical, More preferably 70% identical, more preferably identical, or more preferably 90% identical PrnA, PrnC, pyoluteorin halogenases PItA, pltD, and pItM from Pseudomonas fluorescens, tetracycline halogenase cts4 from Streptomyces aurofaciens hydrolase a from Amycolatopsis orientalis, orbalhimycin halogenase bha A from Amycolatopsis mediterranei.

In one preferred embodiment a host cell expressing a heterologous nucleic acid substantially similar to that of an electron transferase of the invention and expressing a heterologous nucleic acid encoding a regiospecific halogenase of the invention is provided.

In one preferred embodiment the host cell is a bacterial, fungal or plant cell.

In one preferred embodiment, a host cell expressing heterologous nucleic acid molecules encoding prnA, prnB, prnC, prnD and fre is provided.

WO 01/44447 PCT/EP00/12347 -7- In one preferred embodiment a method of producing pyrrolnitrin is provided by growing a host cell, which may include a plant cell, expressing heterologous nucleic acid molecules encoding prA, prnB, prnC, prnD and fre is provided.

In one preferred embodiment, a plant comprising a host cell expressing a heterologous nucleic acid substantially similar to that of an electron transferase of the invention and expressing a heterologous nucleic acid encoding a regiospecific halogenase of the invention is provided.

In one preferred embodiment, a plant expressing heterologous nucleic acid molecules encoding pmA, prnB, pmC, prD and an electron transferase of the invention is provided.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING SEQ ID NO:1 is the conserved amino acid motif present in regiospecific halogenases of the invention.

SEQ ID NO:2 is the nucleic acid sequence encoding PrnA from P. fluorescens.

SEQ ID NO:3 is the amino acid sequence of PrnA from P. fluorescens SEQ ID NO:4 is the nucleic acid sequence encoding PrnC from P. fluorescens SEQ ID NO:5 is the amino acid sequence of PrnC from P. fluorescens SEQ ID NO:6 is the nucleic acid sequence encoding PItA from P. fluorescens SEQ ID NO:7 is the amino acid sequence of PItA from P. fluorescens SEQ ID NO:8 is the nucleic acid sequence encoding PItD from P. fluorescens SEQ ID NO:9 is the amino acid sequence of PltdD from P. fluorescens SEQ ID NO:10 is the nucleic acid sequence encoding PItM from P. fluorescens SEQ ID NO:11 is the amino acid sequence of PItM from P. fluorescens SEQ ID NO:12 is the nucleic acid sequence encoding hydrolase A from A. orientalis SEQ ID NO:13 is the amino acid sequence of hydrolase A from A. orientalis SEQ ID NO:14 is the nucleic acid sequence encoding cts4 from S. aureofaciens SEQ ID NO:15 is the amino acid sequence of cts4 of S. aureofaciens SEQ ID NO:16 is the nucleic acid sequence encoding bhaA from A. mediterranei SEQ ID NO:17 is the amino acid sequence of bhaA from A. mediterranei SEQ ID NO:18 is the nucleic acid sequence encoding Fre from E. coli SEQ ID NO:19 is the amino acid sequence of Fre from E. coli SEQ ID NO:20 is the nucleic acid sequence encoding NADH cytochrome b5 reductase from rat.

WO 01/44447 PCT/EP00/12347 -8- SEQ ID NO:21 is the amino acid sequence of NADH cytochrome b5 reductase from rat.

SEQ ID NO:22 is the nucleic acid sequence encoding NADPH-cyt-p450-reductase from rabbit.

SEQ ID NO:23 is the amino acid sequence of NADPH-cyt-p450-reductase from rabbit.

SEQ ID NO:24 is the nucleic acid sequence encoding ferodoxin from S. oleracea.

SEQ ID NO:25 is the amino acid sequence of ferodoxin from S. oleracea SEQ ID NO:26 is the nucleic acid sequence encoding NADPH-FMN reductase from V.

Fischeri.

SEQ ID NO:27 the amino acid sequence of NADPH-FMN reductase from V. Fischeri.

SEQ ID NO:28 is the nucleic acid sequence encoding ferredoxin-NADP reductase from S.

oleracea SEQ ID NO:29 is the amino acid sequence of ferredoxin-NADP reductase from S. oleracea SEQ ID NO:30 is the nucleic acid sequence encoding nitrate reductase from A. parasiticus SEQ ID NO:31 is the amino acid sequence encoding nitrate reductase of A. parasiticus SEQ ID NO:32 is the primer for E.coliflavin reductase SEQ ID NO:33 is the primer for E.coli flavin reductase SEQ ID NO:34 is the plasmid pNOV523 SEQ ID NO:35 is the plasmid pNOV524 Production of Halogenated Natural Products In Vitro.

According to the present invention, halogenated natural products may be produced in vitro by reacting a regiospecific halogenase with a substrate in the presence of a halogen donor, an oxidant, a reductant, and an electron transferase of the invention.

A regiospecific halogenase of the invention is a halogenase that is capable of interacting with a halide, an oxidant, and a reducing system to catalyze the replacement of one or more carbon-hydrogen bond by one or more carbon-halogen bonds during a biological halogenation reaction and is substrate and/or regiospecific. Regiospecific means that carbon-halogen bonds are formed only at specific locations in a substrate.

Preferred regiospecific halogenases of the invention comprise those that include the following conserved motif and catalyze the replacement of at least one carbon-hydrogen bond by a carbon-halogen bond at a specific location.

WO 01/44447 PCT/EP00/12347 -9x1-W-x2-W-x3-l-P-x4 (SEQ ID NO:1) where X1 is G or T; X2 is V,L,T,F or M; X3 is any amino acid residue X4 is I,F,M or L In a preferred embodiment, the halogenases of the present invention comprise Tryptophan halogenases. Tryptophan halogenases of the invention include PrnA (SEQ ID NO:3 (see, protein accession AAB97504; Hammer PE, Burd W, Hill DS, Ligon JM, van Pee K, "Conservation of the pyrrolnitrin biosynthetic gene cluster among six pyrrolnitrinproducing strains." FEMS Microbiol Lett 1999 Nov 1;180(1):39-44) and regiospecific halogenases preferably having 90% identity, 80% identity, 70% identity, 60% identity, identity or 40 identity to SEQ ID NO:3. Percent identity between amino acid sequences as used throughout this application is determined by the BASTP 2.09 program available at http://www.ncbi.nlm.nih.gov/orf/bl2.html where the parameter settings are: blosum62 scoring matrix with a gap opening penalty of 7 and a gap extension penalty of 2 and x_dropoff of 50 and expect of 10.00 and wordsize of 3.

In another preferred embodiment the regiospecific halogenases of the invention comprise monochchloroaminopyrrolnitrin halogenases. Monochchloroaminopyrrolnitrin halogenases comprise PrnC (SEQ ID NO:5) having protein accession number AAB97506 and regiospecific halogenase preferably having 90% identity thereto, 80% identity thereto, identity thereto, 60% identity,50% or 40% identity thereto.

In a particularly preferred embodiment of the invention, the regiospecific halogenases of the invention comprise any that are 30% identical, prefereably 40% identical, more preferably 50% identical, more preferably 60% identical, more preferably 70% identical, more preferably 80% identical, more preferably 90% identical, more preferably identical, or more preferably 99% identical to any of prnA (SEQ ID NO:3), pmC (SEQ ID pyoluteorin halogenases pItA (SEQ ID NO:7), pltD (SEQ ID NO:9), and pltM (SEQ ID NO:11) from Pseudomonas fluorescens, tetracycline halogenase cts4 (SEQ ID NO:15) from Streptomyces aurofaciens, hydrolase a (SEQ ID NO:13) from Amycolatopsis orientalis, balhimycin halogenase bha A (SEQ ID NO:17) from Amycolatopsis mediterranei including those identified in the following table: WO 01/44447 WO 0144447PCTIEPOO/1 2347 Accession# Protein Name Organism Accession PFU74493_1 AAB97504 PrnA Pseudomonas fluorescens 134 AF161 184_1 AAD46365 PrnA Pseudomonas fluorescens

CHAO

AF161182 1 AAD46360 PrnA Pseudomonas aureofaciens AF161186 1 AAD46370 PrnA Burkholderia pyrrocinia AF1 61183_1 AAD46361 PrnA Burkholderia cepacia AF161 185_4 AAD46369 PrnA Myxococcus fulvus PFU74493 _3 AAB97506 PrnC Pseudomonas fluorescens 134 AF161183_3 AAD46363 PrnC Burkholderia cepacia AF161186_3 AAD46372 PrnC Burkholderia pyrrocinia AF161 185 2 AAD46367 PinG Myxococcus fulvus STMVCTS_3 BAA07389 cts4 Streptomyces aureofaciens tetracycline halogenase AF081 920 AAD24884 PltA Pseudomonas fluorescens AF081920 AAD24878 PltD Pseudomonas fluorescens AF081 920 AAD24882 PltM Pseudomonas fluorescens AOPCZA361_2 CAM1 1780 non-heme Amycolatopsis orientalis oxygenase/halogenase AMOXYAE_4 CAA76550 bhaA Amycolatopsis mediterranei U84350 AAB49297 hypothetical Amycolatopsis orientalis I hydroxylase a An electron transferase of the invention may comprise an electron transferase capable of transferring electrons from NADH or NADPH or ferredoxin or other reductant to FAD or FMVN, or an electron transferase capable of transferring electrons from NADH or NADPH or ferredoxin or other reductant to the halogenase by an NAD(P)Hdependent oxidoreductase or an oxidoreductase with other electron donors, such as the chioroplast photosystem, lactate, xanthine, etc.

WO 01/44447 PCT/EP00/12347 -11 Electron transferases of the invention may be determined by selecting electron transferases in which electron transfer can be detected by monitoring oxidation of NADH or NADPH or ferredoxin by the characteristic change in absorbance associated with oxidation of the reductant. This change (or increase in the rate of change) is dependent on the presence of FAD or FMN. Oxidation of NADH and NADPH may be detected by monitoring absorbance at 340 nm; oxidation results in a decrease in absorbance. Oxidation of ferredoxin may be detected by monitoring absorbance at 420 nm; oxidation results in an increase in absorbance. Electron transfer can also be detected by monitoring oxidation of NADH or NADPH by the characteristic decrease in fluorescence with excitation at 340 nm and emission at >380 nm. This decrease in fluorescence is dependent on the presence of FAD or FMN.

Electron transferases of the invention also may be determined by selecting electron transferases in which electron transfer to the regiospecific halogenase of the invention from NADH or NADPH can be identified by mixing the electron transferase with 50 micromolar NADH or 50 micromolar NADPH with or without 50 micromolar halogenase (the halogenase needs to be in the holoenzyme state, that is with all necessary cofactors, such as FAD, already bound) and observing an increase in the rate of oxidation of NADH or NADPH that is dependent on the halogenase; oxidation is measured by a decrease in absorbance at 340 nm or a decrease in fluorescence as described above.

Electron transferases of the invention may be determined by selecting electron transferases in which electron transfer to the halogenase from ferredoxin can be identified by mixing the electron transferase with 50 micromolar reduced ferredoxin with or without micromolar halogenase (the halogenase needs to be in the holoenzyme state, that is with all necessary cofactors, such as FAD, already bound) and observing an increase in the rate of oxidation of that is dependent on the halogenase; oxidation of ferredoxin is measured by an increased absorbance at 340 nm.

In a preferred embodiment of the invention, the electron transferase is least identical, preferably 40% identical, more preferably 50% identical, more preferably identical, more preferably 70% identical, more preferably 80% identical, more preferably identical or identical to any of the following: an E. coliflavin reductase comprising the amino acid sequence of SEQ ID NO:19 (described by Fieschi F, Niviere V, Frier C, Decout JL, Fontecave M. "The mechanism and substrate specificity of the NADPH:flavin oxidoreductase from Escherichia coli." J Biol Chem 1995 Dec 22;270(51 ):30392-400); diaphorase-sulfhydryl reductase purified according to Richarme, G. "Purification of a new WO 01/44447 PCT/EP00/12347 -12dihydrolipoamide dehydrogenase from Escherichia coli," J Baxteriol (1989 Dec.) 171(12): 680-5; NADH cytochrome-b5- reductase (SEQ ID NO:21) (described by Barber MJ, Quinn GB "High-level expression in Escherichia coli of the soluble, catalytic domain of rat hepatic cytochrome b5 reductase." Protein Expr Purif 1996 Aug;8(1):41-7); NADPH-cyt-P450 reductase (SEQ ID NO:23) from rabbit, ferredoxin-NADP reductase (SEQ ID NO:29) from S.

oleracea, ferredoxin (SEQ ID NO:25) from S. oleracea, nitrate reductase (SEQ ID NO:31) from A. parasiticus, and NAD(P)H-FMN reductase (SEQ ID NO:27) from V. fisheri (described by Zenno S, Saigo K "Identification of the genes encoding NAD(P)H-flavin oxidoreductases that are similar in sequence to Escherichia coli Fre in four species of luminous bacteria: Photorhabdus luminescens, Vibrio fischeri, Vibrio harveyi, and Vibrio orientalis."J Bacteriol 1994 Jun;176(12):3544-51);. Electron transferases of the invention may be used in extract or purified form.

In a particularly preferred embodiment, the electron transferase of the invention is least 30% identical, preferably 40% identical, more preferably 50% identical, more preferably 60% identical, ore preferably 70% identical, more preferably 80% identical, or more preferably 90% identical to any of SEQ ID NOs:21, 23, 25 ,27, 29, or 31 and tests positive for electron transfer in any one of the above described tests.

The choice of reductant such as a pyridine nucleotide, eg., reduced nicotinamide adenine dinucleotide or reduced nicotinamide adenine dinucleotide phosphate or reduced ferredoxin depends on the choice of electron transferase of the invention. In general all of the electron transferases of the invention have higher catalytic activity with one or the other pyridine nucleotide; but generally have some activity with the other pyridine nucleotide.

Thus, if desirable because of other considerations, the non-preferred pyridine nucleotide may be used in halogenation reactions with particular electron transferases. The preferred pyridine nucleotides of each electron transferase are as follows: NADPH is the preferred pyridine nucleotide for NADPH-cyt-P450 reductase and ferredoxin NADP reductase. NADH is the preferred pyridine nucleotide for E. coliflavin reductase, reductase, nitrate reductase and diaphorase sulfhydryl reductase.

Ferredoxin NADP reductase can also use reduced ferredoxin which may be generated by illumination of plants, of isolated chloroplasts or of photosystem I containing chloroplast fragments. Ferredoxin may also be reduced by ferredoxin dependent dehydrogenases such as pyruvate: ferredoxin oxidoreductase. (Horner DS, Hirt RP, Embley TM "A single eubacterial origin of eukaryotic pyruvate: ferredoxin oxidoreductase genes: WO 01/44447 PCT/EP00/12347 -13implications for the evolution of anaerobic eukaryotes." Mol Biol Evol 1999 Sep;16(9):1280- 91).

In a preferred embodiment, FAD may be included in the in vitro reaction to increase efficiency of the reaction. In a particularly preferred embodiment the reaction includes FAD and the selected regiospecific halogenase is PrA.

In an alternate embodiment, the invention comprises combining the halogenase, where the halogenase is a purified regiospecific halogenase of the present invention with the substrate, a halogen ion such as Cl- and with an active oxygen donor such as H202, KIO4, iodosobenzene, iodosobenzoate, tert-butyl hydroperoxide, benzoyl peroxide, cumene hydroperoxide, dicumyl peroxide, peroxy acetic acid or allied compounds. The active oxygen donors dispense with the need to supply 02 and reductant.

A substrate of the invention will depend on the selected regiospecific halogenase of the invention. Substrates of the invention may include tryptophan, indole, aminophenylpyrrole and derivatives there of and tetracycline, substrates for bhaA including all compounds of the balhimycin substrate classes B1-1, B1-2, B2-1, B2-2 and B3 (described by Pelzer S, Sussmuth R, Heckmann D, Recktenwald J, Huber P, Jung G, Wohlleben W[1999] Identification and analysis of the balhimycin biosynthetic gene cluster and its use for manipulating glycopeptide biosynthesis in Amycolatopsis mediterranei DSM5908. Antimicrob Agents Chemother 43:1565-73) A halogen donor useful in the present invention, may be supplied to the reaction as a salt of an inorganic or organic cation or as their respective acids. The halogen donor of the invention may provide a F, CI-, Br~ or I ion.

Reactions of the invention may be conducted in buffer with pH between 4 and temperature between 0 oC and 65 OC. The halogen donor may be added as a salt, eg.

chloride salts may include LiCI, NaCI, KCI, CsCI, MgCI 2 CaC12 NH 4 CI. Reaction times can vary from 1 min to 48 h. Optimal conditions are pH 7.5, temperature 30 reaction time of 12h.

Efficiency of catalysis in in vitro halogenations may be increased by covalently coupling the electron transferase to the halogenase, thus making electron transfer from the reductant to the halogenase a first order process rather than a second order process (with regard to the concentration of halogenase). The same result can be obtained by genetically engineering a fusion protein containing both an electron transferase and a regiospecific halogenase of the invention by fusing their coding regions in frame. The fusions can be WO 01/44447 PCT/EP00/12347 -14made with or without an intervening sequence coding for a short peptide sequence that separates the electron transferase and halogenase protein domains. Fusion proteins can be made in either of two orientations: N-terminus -electron transferase-(optional linker)halogenase -C-terminus; N-terminus -halogenase -(optional linker)-electron transferase -C-terminus In another embodiment of the invention, the protein components of the system comprising a regiospecific halogenase and electron transferase can be immobilized, as described further below and allowed to react with substrates to generate products. The halogenase and electron transferase can be used as individual enzymes that are coimmobilized or as a fusion protein in which the coding sequences for the two components are fused to generate a single protein with electron transferase and halogenase activities.

An additional enzyme and appropriate secondary reductant may be included in the system to regenerate NADH or NADPH: examples of such enzyme secondary reductant pairs include: alcohol dehydrogenase and ethanol, glucose-6-phosphate dehydrogenase and glucose-6-phosphate, aldehyde dehydrogenase and acetaldehyde, lipoamide dehydrogenase and reduced thiol such as lipoamide, dithiothreitol or mercaptosulfonic acid.

In this embodiment the enzymes (which would include enzymes of the NADH or NADPH regenerating system if such a system is used) may be immobilized by any of several processes. Examples include: placing the enzymes inside a container with a semipermeable membrane (dialysis membrane) that will allow passage of substrates and nucleotides but not enzymes; covalently attaching the enzymes to an insoluble matrix; binding the enzymes to a matrix via antibodies directed against the enzymes or antibodies directed against antigens fused to the enzymes; binding the enzymes to a matrix via biotin and a biotin-binding domain such as avidin. Polymerizing a matrix (such as a methacrylate polymer) around the enzymes.

The immobilized enzymes may then be exposed to a buffer containing reductant, secondary reductant (if NAD(P)H regenerating system is used), substrate and halide salt.

Organic solvents may be included to facilitate solubilization of substrates. Typical conditions comprise pH 4 to 10, 0 to 65 After sufficient halogenated product has been generated, the halogenated natural products are removed from the reaction mixture.

Production of Halogenated Natural Products in Heterologous Hosts.

Heterologous nucleic acid molecules encoding an electron transferases of the invention may be expressed in bacterial or fungal hosts to enable the production of the WO 01/44447 PCT/EP00/12347 halogenation of natural products with greater efficiency than might be possible from native hosts. For example, to enhance natural product production, a heterologous nucleic acid molecule encoding an electron transferase of the invention may be expressed in pyrrolnitrin producers such as Pseudomonas fluorescens, Burkholderia pyrrocinia, Myxococcus fulvus, Burkholderia cepacia Pseudomonas aureofaciens, pyoluteorin producers such as Pseudomonas fluorescens, vancomycin class antibiotic producing organisms such as various Amycolatopsis species such as A. orietalis A. mediterranei and the chlorotetracycline producer Streptomyces aureofaciens, or other antibiotic producing Streptomyces species Further, heterologous nucleic acid molecules encoding regiospecific halogenases and electron transferases can be co-expressed in bacterial or fungal hosts to enable or increase production of halogenated natural products. In some cases synthesis of the halogenated natural products of the invention will only require one biosynthetic step, the halogenation step and, therefore, the only heterologous nucleic acid molecules that will be expressed will be those comprising coding sequences for the halogenase and electron transferase of the invention. In other cases, one or more halogenation step will be part of a biosynthetic pathway resulting in the halogenated natural product. In this case multiple heterologus nucleic acid molecules will be expressed.

The term "heterologous nucleic acid molecule" as used throughout the present specification refers to a nucleic acid molecule not naturally associated with a host cell into which it is introduced, including genetic constructs, non-naturally occurring multiple copies of a naturally occurring nucleic acid molecule; and an otherwise homologous nucleic acid molecule operatively linked to a non-native nucleic acid molecule.

In its broadest sense, the term "substantially similar", when used throughout the present specification with respect to a nucleic acid molecule, means a nucleic acid molecule corresponding to a reference nucleotide sequence, wherein the corresponding nucleic acid molecule encodes a polypeptide having substantially the same structure and function as the polypeptide encoded by the reference nucleotide sequence, e.g. where only changes in amino acids not affecting the polypeptide function occur. Desirably the substantially similar nucleic acid molecule encodes the polypeptide encoded by the reference nucleotide sequence. The term "substantially similar" is specifically intended to include nucleic acid molecules wherein the sequence has been modified to optimize expression in particular cells. The percentage of identity between the substantially similar nucleic acid molecule and the reference nucleotide sequence desirably is at least 30%, preferably at least WO 01/44447 PCT/EP00/12347 -16more desirably at least 65%, more desirably at least 75%, preferably at least 85%, more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99% identical. Sequence comparisons are carried out using a Smith-Waterman sequence alignment algorithm (see e.g. Waterman, M.S. Introduction to Computational Biology: Maps, sequences and genomes. Chapman Hall. London: 1995. ISBN 0-412-99391-0, or at http://www-hto.usc.edu/software/seqaln/index.html). The local S program, version 1.16, is used with following parameters: match: 1, mismatch penalty: 0.33, open-gap penalty: 2, extended-gap penalty: 2.

A nucleic acid molecule "substantially similar" to a reference nucleotide sequence hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 50 0 C with washing in 2X SSC, 0.1% SDS at 50 0 C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 50°C with washing in 1X SSC, 0.1% SDS at 50 0 C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 50 0 C with washing in 0.5X SSC, 0.1% SDS at 50 0 C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 50*C with washing in 0.1X SSC, 0.1% SDS at 50 0 C, more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 1 mM EDTA at 50 0 C with washing in 0.1X SSC, 0.1% SDS at 65°C. The polynucleotide of the invention that hybridize under the above conditions preferably comprises at least 80 base pairs, more preferably at least 50 base pairs and particularly at least 21, and more particularly 18 base pairs.

Techniques for these genetic manipulations are specific for the different available hosts and are known in the art. For example, the expression vector pKK223 can be used to express heterologous genes in E. coli, either in transcriptional or translational fusion, behind the tac promoter. For the expression of operons encoding multiple open reading frames (hereinafter "ORFs"), the simplest procedure is to insert the operon into a vector such as pKK223 in transcriptional fusion, allowing the cognate ribosome binding site of the heterologous genes to be used. Techniques for overexpression in gram-positive species such as Bacillus are also known in the art and can be used in the context of this invention (Quax et al. In.: Industrial Microorganisms: Basic and Applied Molecular Genetics, Eds.

Baltz et al., American Society for Microbiology, Washington (1993)). Alternate systems for overexpression rely on yeast vectors and include the use of Pichia, Saccharomyces and Kluyveromyces (Sreekrishna, In: Industrial microorganisms: basic and applied molecular genetics, Baltz, Hegeman, and Skatrud eds., American Society for Microbiology, WO 01/44447 PCT/EP00/12347 -17- Washington (1993); Dequin Barre, Biotechnology 12:173-177 (1994); van den Berg et al., Biotechnology 8:135-139 (1990)).

Some of these halogenated natural products may be effective in the inhibition of growth of microbes, particularly phytopathogenic microbes. The halogenated natural products can be produced from organisms in which the halogenase and/or electron transferase have been overexpressed, and suitable organisms for this include gramnegative and gram-positive bacteria and yeast, as well as plants which will be described in more detail below. For the purposes of halogenated natural product production, the significant criteria in the choice of host organism are its ease of manipulation, rapidity of growth fermentation in the case of microorganisms), and its lack of susceptibility to the halogenated natural product being overproduced. These methods of halogenated natural product production have significant advantages over the chemical synthesis technology usually used in the preparation of halogenated natural products. Application of the methods described here would increase the efficiency and yield in production of halogenated natural products by fermentation and would be useful in introducing new halogen atoms at positions that previously were not present in the natural product and that would be difficult to achieve synthetically.

Some of the advantages over chemical synthesis are cheaper cost of production, and the ability to synthesize compounds of a preferred regiospecificity of halogenation.

Incorporation of an electron transferase can increase the efficiency and yield of halogenated products. In addition, novel halogenated products can be produced by addition of halogen to known natural products either by use of naturally occurring halogenases with desired substrate and regiospecificity or by use of engineered halogenases with novel substrate and regiospecificity It would be very difficult to use chemical means to halogenate many natural products for example, macrolides, polyketides and non-ribosomal peptides, with regiospecificity and enantiomeric specificity. The conditions required for halogenation of aryl or alkyl moieties would generally cause other changes in the structure of the natural product.

Halogenases can also produce enantiomerically pure products (in the case of halogenation of a pro-chiral carbon), as opposed to the racemic mixtures commonly generated by organic synthesis. The ability to produce stereochemically appropriate compounds is particularly important for molecules with many chirally active carbon atoms.

Halogenated natural products produced by heterologous hosts can be used for numerous WO 01/44447 PCT/EP00/12347 -18purposes including medical control of pathogens and/or infectious disease) as well as agricultural applications.

Where a production of a halogenated product requires more than one enzyme, the nucleic acid molecules encoding enzymes for biosynthesis of the halogenated product of interest may be expressed in a single organism. In one preferred embodiment, all required nucleic acid sequences encoding the enzymes for the natural product would be integrated into the chromosome of the organism as a single operon and controlled by a suitable regulatory element. In an alternate preferred embodiment the nucleic acid sequences could be carried on a plasmid with a selectable marker. Another alternate preferred embodiment comprises expressing the required nucleic acid sequences on two or more compatible plasmids or the required nucleic acid sequences could be distributed among the chromosome and one or more compatible plasmids. Expression of the nucleic acid molecules could be controlled by the native regulatory elements of the natural product biosynthetic nucleic acid coding sequences or by promoters chosen to allow more precise control of the expression of the nucleic acid sequences of the pathway. Optimally, the electron transferase nucleic acid sequences would be included in the operon along with those encoding the regiospecific halogenase (or halogenases) of the invention.

Alternatively, the electron transferase sequences may be expressed separately.

Another method of the invention for creating halogenated products comprises dividing nucleic acids molecules from the biosynthetic pathway between two or more separate organisms. The organisms may be grown separately with biosynthetic intermediates produced by one culture being transferred to another culture expressing subsequent steps in the pathway of biosynthesis. Alternately the organisms may be co-cultured with intermediates passing from one to another as required. In any of these applications each halogenase requires a suitable electron transferase co-expressed in the same organism and in the same subcellular location.

Novel halogenated products may be produced by introducing a halogenase into an organism that already expresses genes required to produce the nonhalogenated structure of interest. The halogenase may be engineered to have specificity for the specific site in the completed structure or it may have specificity for a component of the structure that is subsequently incorporated into the final structure in the native organism. For example, a halogenase may be engineered to specifically halogenate an amino acid that is subsequently incorporated into a peptide-containing antibiotic. The resulting product may then possess novel halogen modifications at positions not found in the natural product.

WO 01/44447 PCT/EP00/12347 -19- In any of the systems described above, significant advantages in efficiency of halogenation may be effected by fusion of the nucleic acid sequences coding for the electron transferase and the regiospecific halogenase such that a fusion protein is generated with both functionalities; such a fusion may result in higher efficiency of electron transfer from the reductant to the halogenase. The electron transferase nucleic acid sequences may be fused to either the 5' or the 3' end of the halogenase. A coding sequence for a short linking peptide (linker) may be incorporated into the fusion, separating the coding sequence for the electron transferase and halogenase protein domains; the length of the linker can vary from 1 to 30 amino acid residues in length.

Halogenase and/or electron transferases of the invention can also be expressed in heterologous bacterial and fungal hosts to produce halogenated natural products with the aim of increasing the efficacy of biocontrol strains of such bacterial and fungal hosts.

Microorganisms which are suitable for the heterologous overexpression of anti-pathogenic halogenated natural products are all microorganisms which are capable of colonizing plants or the rhizosphere. As such they will be brought into contact with phytopathogenic fungi, bacteria and nematodes causing an inhibition of pathogen growth. These include gramnegative microorganisms such as Pseudomonas, Enterobacter and Serratia, the grampositive microorganism Bacillus and the fungi Trichoderma and Gliocladium. Particularly preferred heterologous hosts are Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas cepacia, Pseudomonas aureofaciens, Pseudomonas aurantiaca, Enterobacter cloacae, Serratia marscesens, Bacillus subtilis, Bacillus cereus, Trichoderma viride, Trichoderma harzianum and Gliocladium virens Expression in heterologous biocontrol strains requires the selection of vectors appropriate for replication in the chosen host and a suitable choice of promoter.

Techniques are well known in the art for expression in gram-negative and gram-positive bacteria and fungi, and are described elsewhere in this specification.

Production of Halogenated Products in Transgenic plants The halogenases and/or electron transferases of the invention are expressed in transgenic plants thus causing the biosynthesis of the selected halogenated natural products in the transgenic plants. In some cases, the halogenated natural products of the invention will only require one biosynthetic step, the halogenation step, and therefore, the only heterologous nucleic acid molecules that will be expressed will be those comprising coding sequences for the regiospecific halogenase and electron transferase of the WO 01/44447 PCT/EP00/12347 invention. In other cases, one or more halogenation steps will be part of a biosynthetic pathway resulting in the halogenated natural product. In this case multiple heterologous nucleic acid molecules will be expressed.

As used in this specification a "plant" refers to any plant or part of a plant at any stage of development. Therein are also included cuttings, cell or tissue cultures and seeds. As used in conjunction with the present invention, the term "plant tissue" includes, but is not limited to, whole plants, plant cells, plant organs, plant seeds, protoplasts, callus, cell cultures, and any groups of plant cells organized into structural and/or functional units.

Where the halogenated natural product has anti-pathogenic properties, transgenic plants with enhanced resistance to phytopathogenic fungi and bacteria are generated. For their expression in transgenic plants, the nucleic acid molecules encoding the halogenases and/or electron transferases of the invention and adjacent sequences may require modification and optimization.

Although in many cases nucleic acid molecule from other organisms can be expressed in plants at high levels without modification, low expression in transgenic plants may result from nucleic acid molecules having codons which are not preferred in plants. It is known in the art that all organisms have specific preferences for codon usage, and the codons from other organisms can be changed to conform with plant preferences, while maintaining the amino acids encoded. Furthermore, high expression in plants is best achieved from coding sequences which have at least 35% GC content, and preferably more than 45%. Microbial genes which have low GC contents may express poorly in plants due to the existence of ATTTA motifs which may destabilize messages, and AATAAA motifs which may cause inappropriate polyadenylation. In addition, nucleic acid molecules encoding halogenases or electron transferases of the invention can be screened for the existence of illegitimate splice sites which may cause mRNA truncation. All changes required to be made within the coding sequence such as those described above can be made using well known techniques of site directed mutagenesis, PCR, and synthetic gene construction using the methods described in the published patent applications EP 0 385 962, EP 0 359 472, and WO 93/07278. The preferred nucleic acid molecules of the invention may be unmodified, should these be expressed at high levels in target transgenic plant species, or alternatively may be nucleic acid molecules modified by the removal of destabilization and inappropriate polyadenylation motifs and illegitimate splice sites, and further modified by the incorporation of plant preferred codons, and further with a GC content preferred for expression in plants. Although preferred nucleic acid sequences may be adequately WO 01/44447 PCT/EPOO/12347 -21 expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et Nucl. Acids Res. 17: 477-498 (1989)).

For efficient initiation of translation, sequences adjacent to the initiating methionine may require modification. The sequences cognate to the selected nucleic acid molecules may initiate translation efficiently in plants, or alternatively may do so inefficiently. In the case that they do so inefficiently, they can be modified by the inclusion of sequences known to be effective in plants. Joshi has suggested an appropriate consensus translation initiator for plants (NAR 15: 6643-6653 (1987); SEQ ID NO:15) and Clontech suggests a further consensus translation initiator (1993/1994 catalog, page 210; SEQ ID NO:16).

These consensuses are suitable for use with the nucleic acid molecules of the invention.

The sequences are incorporated into the nucleic acid molecule construction, up to and including the ATG (whilst leaving the second amino acid of the selected nucleic acid molecule unmodified), or alternatively up to and including the GTC subsequent to the ATG (with the possibility of modifying the second amino acid of the transgene).

Expression of the nucleic acid molecules encoding the halogenases or electron transferases of the invention in transgenic plants is behind a promoter shown to be functional in plants. The choice of promoter will vary depending on the temporal and spatial requirements for expression, and also depending on the target species. Where the halogenated natural products are anti-pathogenic and protection of plants against foliar pathogens is desired, expression in leaves is preferred; for the protection of plants against ear pathogens, expression in inflorescences spikes, panicles, cobs etc.) is preferred; for protection of plants against root pathogens, expression in roots is preferred; for protection of seedlings against soil-borne pathogens, expression in roots and/or seedlings is preferred. In many cases, however, expression against more than one type of phytopathogen will be sought, and thus expression in multiple tissues will be desirable.

Although many promoters from dicotyledons have been shown to be operational in monocotyledons and vice versa, ideally dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters for expression in monocotyledons. However, there is no restriction to the provenance of selected promoters; it is sufficient that they are operational in driving the expression of the nucleic acid molecules of the invention. Preferred promoters which are expressed constitutively include the CaMV 35S and 19S promoters, and promoters from genes encoding actin or ubiquitin.

WO 01/44447 PCT/EP00/12347 -22- The nucleic acid molecules of the invention can also be expressed under the regulation of promoters which are chemically regulated. This enables the halogenated natural product to be synthesized only when the crop plants are treated with the inducing chemicals, and the halogenated natural product biosynthesis subsequently declines.

Preferred technology for chemical induction of gene expression is detailed in the published application EP 0 332 104 and US patent 5,614,395 (incorporated herein by reference). A preferred promoter for chemical induction is the tobacco PR-la promoter.

A preferred category of promoters is that which is wound inducible. Numerous promoters have been described which are expressed at wound sites and also at the sites of phytopathogen infection. Ideally, such a promoter should only be active locally at the sites of infection, and in this way the anti-pathogenic halogenated natural product only accumulates in cells which need to synthesize it to arrest growth of the invading pathogen.

Preferred promoters of this kind include those described by Stanford et a. Mol. Gen. Genet.

215: 200-208 (1989), Xu et al. Plant Molec. Biol. 22: 573-588 (1993), Logemann et al. Plant Cell 1: 151-158 (1989), Rohrmeier Lehle, Plant Molec. Biol. 22: 783-792 (1993), Firek et al. Plant Molec. Biol. 22:129-142 (1993), and Warner etal. Plant J. 3: 191-201 (1993).

Preferred tissue-specific expression patterns include green tissue specific, root specific, stem specific, and flower specific. Promoters suitable for expression in green tissue include many which regulate genes involved in photosynthesis and many of these have been cloned from both monocotyledons and dicotyledons A preferred promoter is the maize PEPC promoter from the phosphoenol pyruvate carboxylase gene (Hudspeth Grula, Plant Molec. Biol. 12: 579-589 (1989)). A preferred promoter for root specific expression is that described by de Framond (FEBS 290: 103-106 (1991); EP 0 452 269 [1479]) and a further preferred root-specific promoter is that from the T-1 gene provided by this invention. A preferred stem specific promoter is that described in patent application WO 93/07278 and which drives expression of the maize trpA gene.

Preferred embodiments of the invention are transgenic plants producing the halogenated natural product, pyrrolnitrin in a root-specific fashion. In an especially preferred embodiment of the invention the biosynthetic genes for pyrrolnitrin are expressed behind a root specific promoter to protect transgenic plants against the phytopathogen Rhizoctonia. Further preferred embodiments are transgenic plants producing antipathogenic halogenated natural products in a wound-inducible or pathogen infectioninducible manner.

WO 01/44447 PCT/EP00/12347 -23- In addition to the selection of a suitable promoter, constructions for halogenated natural product production in plants require an appropriate transcription terminator to be attached downstream of the heterologous halogenase and/or electron transferase nucleic acid molecules. Several such terminators are available and known in the art tml from CaMV, E9 from rbcS). Any available terminator known to function in plants can be used in the context of this invention.

Numerous other sequences can be incorporated into expression cassettes for halogenase and/or electron transferase nucleic acid molecules. These include sequences which have been shown to enhance expression such as intron sequences from Adh 1 and bronze 1) and viral leader sequences from TMV, MCMV and AMV).

The production of halogenated natural products in plants requires that the halogenated natural product biosynthetic nucleic acid molecule encoding the first step in the pathway will have access to the pathway substrate. For each individual halogenated natural product and pathway involved, this substrate will likely differ, and so to may its cellular localization in the plant. In many cases the substrate may be localized in the cytosol whereas in other cases it may be localized in some subcellular organelle. As much biosynthetic activity in the plant occurs in the chloroplast, often the substrate may be localized to the chloroplast and consequently the halogenases and electron transferases of the invention are best targeted to the appropriate organelle the chloroplast).

Subcellular localization of transgene encoded enzymes can be undertaken using techniques well known in the art. Typically, the DNA encoding the target peptide from a known organelle-targeted gene product is manipulated and fused upstream of the required halogenase and electron transferase nucleic acid molecules. Many such target sequence are known for the chloroplast and their functioning in heterologous constructions has been shown. In a preferred embodiment of this invention the nucleic acid molecules required for pyrrolnitrin biosynthesis are targeted to the chloroplast because the pathway substrate tryptophan is synthesized in the chloroplast.

In some situations, the overexpression of nucleic acids required for halogenated natural product production may deplete the cellular availability of the substrate for a particular pathway and this may have detrimental effects on the cell. In situations such as this it is desirable to increase the amount of substrate available by the overexpression of nucleic acid molecules which encode the enzymes for the biosynthesis of the substrate. In the case of tryptophan (the substrate for pyrrolnitrin biosynthesis) this can be achieved by overexpressing the trpA and trpB encoding nucleic acid molecules. A further way of WO 01/44447 PCTEP00/12347 -24making more substrate available is by the turning off of known pathways which utilize specific substrates (provided this can be done without detrimental side effects). In this manner, the substrate synthesized is channeled towards the biosynthesis of the halogenated natural product and not towards other compounds.

Vectors suitable for plant transformation are described elsewhere in this specification.

For Agrobacterium-mediated transformation, binary vectors or vectors carrying at least one T-DNA border sequence are suitable, whereas for direct transfer any vector is suitable and linear DNA containing only the construction of interest may be preferred. In the case of direct transfer, transformation with a single DNA species or co-transformation can be used (Schocher et aL. Biotechnology 4:1093-1096 (1986)). For both direct transfer and Agrobacterium-mediated transfer, transformation is usually (but not necessarily) undertaken with a selectable marker which may provide resistance to an antibiotic (kanamycin, hygromycin or methotrexate) or a herbicide (basta). The choice of selectable marker is not, however, critical to the invention.

Synthesis of a halogenated natural product in a transgenic plant will frequently require the simultaneous overexpression of multiple nucleic acid molecules encoding the halogenated natural product biosynthetic enzymes. This can be achieved by transforming the individual halogenated natural product biosynthetic nucleic acid molecules into different plant lines individually, and then crossing the resultant lines. Selection and maintenance of lines carrying multiple nucleic acid sequences is facilitated if each the various transformation constructions utilize different selectable markers. A line in which all the required halogenated natural product biosynthetic nucleic acid molecules have been pyramided will synthesize the halogenated natural product, whereas other lines will not.

This approach may be suitable for hybrid crops such as maize in which the final hybrid is necessarily a cross between two parents. The maintenance of different inbred lines with different heterologous nucleic acid molecules may also be advantageous in situations where a particular halogenated natural product pathway may lead to multiple halogenated natural products, each of which has a utility. By utilizing different lines carrying different alternative nucleic acid sequences for later steps in the pathway to make a hybrid cross with lines carrying all the remaining required nucleic acid molecules it is possible to generate different hybrids carrying different selected halogenated natural products which may have different utilities.

Alternate methods of producing plant lines carrying multiple nucleic acid sequences include the retransformation of existing lines already transformed with a halogenated WO 01/44447 PCT/EP00/12347 natural product biosynthetic nucleic acid molecule or molecules (and selection with a different marker), and also the use of single transformation vectors which carry multiple biosynthetic nucleic acid molecules, each under approriate regulatory control promoter, terminator etc.). Given the ease of DNA construction, the manipulation of cloning vectors to carry multiple biosynthetic nucleic acid molecules is a preferred method.

Another preferred method is to construct a fusion protein as described above of the halogenase of the invention with the electron transferase of the invention and express a nucleic acid encoding such a fusion protein in a transgenic plant of the invention. The nucleic acid molecule encoding the electron transferase may be fused to either the 5' or the 3' end of the halogenase encoding nucleic acid molecule. A linker may, optionally, be incorporated into the fusion, separating the electron transferase and halogenase protein domains. In a preferred embodiment the fusion protein comprises a linker composed of (Gly) 6 However, one skilled in the art will recognize that a linker of other suitable lengths and/or composition may also be selected.

In another preferred embodiment production of halogenated natural products in plants may be achieved by direct plastid transformation. Plastid expression, in which genes are inserted by homologous recombination into the several thousand copies of the circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% of the total soluble plant protein. In a preferred embodiment, the nucleotide sequence is inserted into a plastid targeting vector and transformed into the plastid genome of a desired plant host. Plants homoplasmic for plastid genomes containing the nucleotide sequence are obtained, and are preferentially capable of high expression of the nucleotide sequence.

Plastid transformation technology is for example extensively described in U.S. Patent Nos.

5,451,513, 5,545,817, 5,545,818, and 5,877,462 in PCT application no. WO 95/16783 and WO 97/32977, and in McBride et a. (1994) Proc. Natl. Acad. Sci. USA 91, 7301-7305, all incorporated herein by reference in their entirety. The basic technique for plastid transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the nucleotide sequence into a suitable target tissue, using biolistics or protoplast transformation calcium chloride or PEG mediated transformation). The 1 to 1.5 kb flanking regions, termed targeting sequences, facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome. Initially, point mutations in the chloroplast P:\OPERU(bm\17078-01 rsl.doc-19/02/04 -26- 16S rRNA and rpsl2 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab, Hajdukiewicz, and Maliga, P. (1990) Proc. Natl. Acad. Sci. USA 87, 8526-8530; Staub, J. and Maliga, P. (1992) Plant Cell 4, 39-45). The presence of cloning sites between these markers allowed creation of a plastid targeting vector for introduction of foreign genes (Staub, J. and Maliga, P.

(1993) EMBO J. 12, 601-606). Substantial increases in transformation frequency are obtained by replacement of the recessive rRNA or r-protein antibiotic resistance genes with a dominant selectable marker, the bacterial aadA gene encoding the spectinomycindetoxifying enzyme aminoglycoside-3'-adenyltransferase (Svab, and Maliga, P. (1993) Proc. Natl. Acad. Sci. USA 90, 913-917). Other selectable markers useful for plastid transformation are known in the art and encompassed within the scope of the invention.

In a particularly preferred embodiment of the invention inducible plastid production of pyrrolnitrin is achieved by direct chloroplast transformation offre, prnA, prnB, prnC, and prnD as an operon under control of the bacteriophage T7 promoter.

Inducible expression is achieved by crossing with plants possessing a nuclear construct encoding the T7 RNA polymerase engineered to possess a chloroplast transit peptide and under the control of the PR1 promoter, allowing BTH-inducible expression.

Production of halogenated natural products by the method of the invention may occur in a wide variety of plant cells, including those of gymnosperms, monocots, and 20 dicots. Although the gene can be inserted into any plant cell falling within these broad classes, it is particularly useful in but not limited to crop plant cells, such as rice, wheat, barley, rye, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.

0* Where an allele(s) for a regiospecific halogenase and/or electron transferase of the invention is obtained by direct selection in a crop plant or plant cell culture from which a crop plant can be regenerated, it is moved into commercial varieties using traditional breeding techniques without the need for genetically engineering the allele and transforming it into the plant.

P:OPERUIbm\17078-01 rc.doc-19/02/04 26A Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in Australia.

EXAMPLES

0* 00 0 •go *o *000*0 ooo o* oo **o oooo* *go *oo o**oo WO 01/44447 PCT/EP00/12347 -27- The following examples serve as further description of the invention and methods for practicing the invention. They are not intended as being limiting, rather as providing guidelines on how the invention may be practiced.

Example 1: In vitro halogenation reactions with PrnA A. Activation of PmA with E. coliflavin reductase. P2. Aspergillus nitrate reductase. and cvtochrome b5 reductase.

PrnA is purified by ion exchange chromatography from Pseudomonas fluorescens BL915deltaORF1-4 with plasmid pPEH14 (pmA) described in Kimer etal (Kirner, S. et al J Bacteriol 1998 Apr;180(7):1939-43). The purified enzyme has negligible activity without addition of the P2 prepared as described in the Background of the Invention above. Protein concentration or the preparation is 0.36 mg/ml.

The assay mixture is prepared containing HEPES buffer pH 7.5 (50 mM), glucose-6- Phosphate (14.3 mM), D-Trp (7 mM NaCI (7 mM). Aspergillus nigerCatalase is purchased from Sigma Chemical Co. (13 U/ml), bovine erythrocyte superoxide dismutase (hereinafter "SOD") is purchased from Sigma Chemical Co. (5 U/ml), Leuconostoc mesenteroides glucose-6-Phosphate dehydrogenase purchased from Sigma (5 U/ml), FAD (7 micromolar). Either a NADH dependent mixture or a NADPH mixture is used as indicated below. An NADH-dependent assay mixture is prepared by adding 12 mg of NADH to 4.5 ml of above described assay mixture. A NADPH-dependent assay mixture is prepared by adding 3 mg NADPH to 1 ml of the above described assay mixture.

The reactions 1-7, described below, are set up in polypropylene tubes in triplicate.

After mixing PrnA, the indicated assay mixture and electron transferase, samples are vortexed, then mixed by inversion at room temperature. Reactions are stopped 20.5 hours after initiation of the reactions by boiling for 2 min then the samples are prepared for HPLC analysis by ultrafiltation through Microcon 10 membranes (14000 x g for 30 min). The HPLC analysis is by Method Set PrnA1 (described below), the injection volume is microliter, and data are collected for the first 6 minutes.

Standards are prepared by mixing 5 or 10 microliter 7-CI-Trp (1 mM) with sufficient mM HEPES, pH 7.5 to bring the final volume to 200 microliter. D-Trp is eluted at -2 min and 7-CI-trp is eluted at 4.3 min, as indicated by the elution of the authentic D-Trp and 7-CI- Trp. The quantity of 7-CI-trp is determined by comparison to a standard curve. Reported activities are the net increase in 7-CI-Trp after addition of the electron transferase.

WO 01/44447 PCT/EP00/12347 -28- HPLC Analytical method PrnA1 Determination of 7-CI-Trp A Waters Alliance HPLC system with photodiode array detector is used. The Waters Alliance HPLC is equipped with a 4.6 x 50 mm column packed with C18-Silica, particle size 3 micrometer. A gradient elution method designated here as PrnA1 is used. Flow rates are 1 ml/min throughout and absorbance data are collected from 210 to 400 nm with a resolution of 1.2 nm and a sampling rate of 1/s. The system as pre-equilibrated with an 85:15 mixture of water:methanol. After injection of the sample the column is developed with a 6 min gradient from the starting conditions to a 40:60 water:methanol mixture. Then from to 7.0 min the concentration of methanol is increased to 100% in a linear gradient. The column is washed for 1 min with 100% methanol, then re-equilibrated. D-Trp eluted at -2 min and 7-CI-trp eluted at 4.3 min, as indicated by the elution of authentic D-Trp and 7-CI- Trp.

1. Activation of PmA by E. coli Flavin reductase E. coliflavin reductase, (abbreviated herein after as Fre), is purified by ammonium sulfate precipitation followed by hydrophobic chromatography, in a method based on the protocol of Fieschi et al (1995) J. Biol. Chem 270 30392-30400 which is herein incorporated by reference in its entirety. The flavin reductase purification follows the procedure of Fieschi through bacterial homogenization and ammonium sulfate fractionation. At which point flavin reductase activity is precipitated. The precipitate is collected by centrifugation, resuspended in 25 mM Tris/CI pH 7.5 0.5 M KCI 10% glycerol. The method of Fontcave et al J Biol Chem 1987 Sep 5;262(25):12325-31 which is herein incorporated be reference in its entirety is then followed to completion. The protein concentration of the of the collected purified Fre sample is 21 microgram/mi. Each reaction contains 20 microliter PrnA, 160 microliters of the NADH mixture described above and 20 microliter of Fre. The resulting net product formation was 21.46 1.02 nmol 7-CI-Trp.

2. Activation of PmA by P2 P2 is an electron transferase protein preparation from Pseudomonas fluorescens purified by ion exchange chromatography and described above in the Background of the invention. It has no PrnA activity. Protein concentration of the P2 sample is 4.8 mg/ml.

Each reaction contains 20 microliter PrnA, 160 microliter of NADH mixture and 20 microliter of P2. The resulting net product formation was 12.50 2.02 nmol 7-CI-Trp.

WO 01/44447 PCT/EP00/12347 -29- 3. Activation of PrnA by spinach nitrate reductase Recombinant FAD-domain of spinach nitrate reductase (hereinafter "SNIR) (18.6 micromolar). Each reaction contains 20 microliter PrnA, 160 microliter of NADH mixture and microliter of SNIR. The resulting net product formation was 0.048 0.73 nmol 7-CI- Trp.

4. Activation of PrnA by Aspergillus nitrate reductase Nitrate reductase from Aspergillus sp. (10 U/ml) was purchased from ICN. Each reaction contains 20 microliter PrnA, 160 microliter of NADH mixture and 20 microliter of Nitrate reductase. The resulting net product formation was 1.49 0.18 nmol 7-CI-Trp.

Activation of PmA by rat Recombinant soluble domain of rat hepatic cytochrome b5 reductase (11.7 micromolar) is obtained. Each reaction contains 20 microliter PmA, 160 microliter of NADH mixture and 20 microliter of cytochrome b5 reductase. Net product formation was 0.31 0.11 nmol 7-CI-Trp.

6. Activation of PrnA by diaphorase sulfhydryl reductase Diaphorase sulfhydryl reductase (200 U/ml) is purchased from United States Biochemicals. Each reaction contains 20 microliter PrnA, 160 microliter of NADH mixture and 20 microliter of diaphorase. Net product formation was 2.24 0.04 nmol 7-CI-Trp.

7. Activation of PrnA by rabbit NADPH- cyt-P450 reductase Rabbit liver NADPH-cyt-P450 reductase (0.069 mg/ml) is purchased from Sigma Chemical Co. Each reaction contains 20 microliter PrnA, 160 microliter of NADPH mixture and microliter of cytochrome P450 Reductase. The resulting net product formation was 3.35 0.23 nmol 7-CI-Trp.

Example 2: Activation of PrnA by E. coil flavin reductase; spinach ferredoxin NADP reductase, spinach ferredoxin NADP reductase spinach ferredoxin; and Photobacterium fischeri NAD(P)H:FMN reductase WO 01/44447 PCT/EP00/12347 The following components are used in examples 1-4 below: PrnA (described for Example 1 above) at 0.36 mg/ml, Assay Mixture containing HEPES (100 mM), glucose-6phosphate, disodium salt (50 mM), D-Trp (5 mM), NaCI (5 mM). Aspergillus niger catalase (39 U/ml), bovine erythrocyte superoxide dismutase (15 U/ml), Leuconostoc mesenteroides glucose-6-phosphate dehydrogenase (10 U/ml). NADH-(3 mg/ml) NADPH (3 mg/ml).

Each assay contains the assay mixture, either NADH (for samples containing Fre and the NAD(P)H:FMN reductase) or NADPH (for samples containing FNR or FNR and Fd), PrnA and the indicated electron transferase. Negative control samples are incubated in parallel; these substituted buffer for PrnA. Quantification standards are prepared by diluting 0, 1, 2 or 5 microliter of 7-CI-Trp standard (1 mM) in 100 microliter Assay Mixture, microliter NADH, 20 microliter PmA and 50 microliter buffer; the tubes were heated to 100 C prior to addition of PrnA, then heated an additional 2 min. Further processing is in parallel with the enzymatic reactions. All samples are mixed for 2 h at room temperature.

Reactions are stopped and samples processed as described above in Example 1, including using the HPLC Analytical method PrnA1 as described in Example 1.

1. Activity of PrnA with Fre: 100 microliter Assay Mixture, 50 microliter of NADH, microliter PrnA and 50 microliter of Fre (0.84 microgram/mi) are mixed as described above.

Net 7-CI-Trp produced was 8.44 nmol.

2. Activity of PrnA with ferrodoxin NADP reductase: 100 microliter Assay Mixture, microliter of NADH, 20 microliter PmA and 50 microliter of FNR (4.1 micromolar) are mixed as described above. Net 7-Cl-Trp produced was 4.22 nmol.

3. Activity of PrnA with ferrodoxin NADP reductase and ferrodoxin: 100 microliter Assay Mixture, 50 microliter of NADH, 20 microliter PrnA and 50 microliter of FNR (4.1 micromolar) and Fd (7 micromolar) are mixed as described above. Net 7-CI-Trp produced was 9.15 nmol.

4. Activity of PrA with Photobacterium fischeri NAD(P)H:FMN reductase: 100 microliters Assay Mixture, 50 microliter of NADH, 20 microliter PmA and 50 microliter of NAD(P)H:FMN reductase purchased from Roche (4 U/ml) are mixed as described above. Net 7-CI-Trp produced was 0.11 nmol.

Example 3: In vitro halogenation reactions with PrnC Fre, ferrodoxin NADP reductase, ferrodoxin amd NADPH FMN-reductase are tested for the ability to activate P. fluorescens PrnC that was depleted of endogenous electron WO 01/44447 PCT/EP00/12347 -31 transferase (P2) as described below. PrnC catalyzes chlorination of monodechloroaminopyrrolnitrin (MDA) to yield aminopyrrolnitrin (APRN).

The following materials are prepared for use in assays described below. Buffer 100 mM Tris/Cl, 1 mM EDTA. pH 7.5. Monodechloroaminopyrrolnitrin (MDA) 74.2 mM is prepared by culture of Pseudomonas fluorescens expressing PrnA and PrnB as described in (Kirner et al,1998) which is herein incorporated by reference in its entirety. The assay mix comprises FAD (5 L.M) and MDA (742 jgM) in buffer. NADH is dissolved in buffer at a concentration of 6 mg/ml. or NADPH is dissolved in buffer at a concentration of 6 mg/ml.

Extract #1 is a crude extract in buffer containing PrnC and the endogenous electron transferase P2 described above in example 1. PrC is expressed in P. fluorescens bacteria (pPEH/prnC /134Aprn) that had the chromosomal pr operon deleted but comprises a nucleic acid sequnce (SEQ ID NO: 4) encoding PrnC behind a tac promoter on plasmid pPEH-PrnC (Kirner et al, 1998). In this system the tac promoter results in constitutive expression of PrnC. Extract PrnC in Extract #1 is purified by mixing Extract #1 with an anion exchange resin then removing the resin by centrifugation. to deplete PrnC of P.

fluorescens P2 activity using 100 mM Tris/CI buffer.

The assays described below are run as follows; Extract #2 is mixed with the indicated electron transferase, assay mix and either NADH or NADPH as indicated. The native activity of PrnC prior to removal of the P2 activity is determined by a parallel sample in which extract #1 is mixed with assay mix and NADH. All samples are mixed by inversion overnight, then reactions are stopped by addition of 10 microliter KOH (6 M) followed by extraction with ethyl-acetate (1 ml). 0.6 ml of the organic soluble layer is removed to a separate tube and the solvent is removed by vacuum centrifugation. The residue is redissolved in 200 microliter of 60/40 H 2 0/CH 3 CN 100 microliter CH 3 CN. The samples are filtered through 0.2 pm nylon filters to remove particulate matter. Samples are analyzed by PmC_lso method described below. The 220 nm absorbance chromatogram is analyzed and integrated. PrnC activity is expressed as 100 times the ratio of the APRN peak area to the sum of the peak areas of APRN and MDA. Assuming equal extinction coefficients at 220 nm the calculated ratio is equivalent to the net conversion of MDA to APRN by halogenation.

HPLC Analytical method PmC Iso The HPLC instrument used is a Waters Alliance HPLC system with photodiode array detector and is equipped with a 4.6 x 50 mm column packed WO 01/44447 PCT/EP00/12347 -32with C18-Silica, particle size 3 micrometer. The HPLC method is an isoctratic elution method in which flow rate is 1.5 ml/min and solvent is a 58:42 ratio of water:acetonitrile.

Absorbance data are collected from 210 to 400 nm with a resolution of 2.4 nm and a sampling rate of 5/s. The system is pre-equilibrated for a minimum of 6 min prior to injection. Injection volume is 50 microliter, data collection time 6 min followed by an additional 6 min of isocratic elution before injection of the next sample. MDA is eluted at 2.16 min in this method and aminopyrrolnitrin (APRN) is eluted at 3.05 min.

Protein concentrations are determined by the BCA method using the standard procedures described by the vendor (Pierce).

1. PmC activity with E. coli Fre: 50 microliter of Extract #2 is mixed with 20 microliter of E. coliflavin reductase, (21 microgram/ml), 100 microliter assay mix, and 50 microliter NADH; mixing continues overnight followed by product analysis as described above.

Observed activity of 51.8% conversion of MDA to APRN.

2. PmC activity with spinach ferrodoxin NADP reductase: 50 microliter of Extract #2 is mixed with 20 microliter of spinach ferredoxin:NADP reductase (20.7 micromolar), 100 microliter assay mix, and 50 microliter NADH; mixing continues ovemight followed by product analysis as described above. Observed activity of 1.8% conversion of MDA to

APRN.

3. PrC activity with spinach ferrodoxin NADP reductase and spinach ferrodoxin: microliter of Extract #2 is mixed with 20 microliter of spinach ferredoxin:NADP reductase (20.7 micromolar) and spinach ferredoxin (Fd) (35 micromolar), 100 microliter assay mix, and 50 microliter NADH; mixing continues ovemight followed by product analysis as described above. Observed activity of 2.5% conversion of MDA to APRN.

4. PmC activity with NADPH FMN reductase: 50 microliter of Extract #2 is mixed with microliter of NAD(P)H:FMN reductase (10 U/ml) from Photobacterium fischeri, 100 microliter assay mix, and 50 microliter NADH; mixing continues overnight followed by product analysis as described above. Observed activity of 4.0% conversion of MDA to APRN.

Native activity of PrnC prior to removal of the P2 activity is determined by a parallel sample in which Extract #1 (50 microliter) is mixed with assay mix (100 microliter) and NADH (50 microliter); mixing continues overnight followed by product analysis as described above. Observed activity of 7.8% conversion of MDA to APRN.

Example 4: Halogenation in E. coli WO 01/44447 PCT/EPO0/12347 -33- Cloning of nucleic acid encoding E. coli flavin reductase.

The nucleic acid sequence encoding E.coliflavin reductase (hereinafter "fre') is PCR replicated from the E.colistrain XL-1 Blue (Stratagene) using the primers GCGCGAATTCATGACAACCTTAAGCTGTAAAGTGACC (SEQ ID NO: 32) and 3'GCGCCTGCAGTCAGATAAATGCAAACGCATCGCC (SEQ ID NO: 33). The nucleic acid molecule is then Topo cloned (Invitrogen transformed into E. coli XL-1 Blue (Stratagene) and transformants are selected by plating onto Luria broth (LB) solid medium supplemented with ampicillin. Several colonies are selected and analyzed by DNA sequencing to confirm their identity. Of these, one was found to possess a nucleic acid molecule comprising a sequence identical to that of the reported fre (Genbank accession 23486). A second possesses a nucleic acid sequence comprising a mutation at nucleotide 247 that resulted in a charged amino acid substitution of Lys83 to Glu83 (mutant hereinafter referred to as freE3.) B. Inducible overexpression of fre and the fre83mutant Inducible overexpression of fre and the freE 8 mutant is accomplished by cloning of wild-type fre and the substitution mutant freE8 into the EcoR1/Pstl sites of pKK223-3 (Pharmacia) under control of the tac promoter. After transformation cells comprising frepKK223-3, freE83- pKK223-3, and the empty vector pKK223-3 are grown in 6 mL LB +amp at 37C overnight, then diluted into 30 mL LB+amp, 5 mM IPTG (Fisher) for 5 hr and harvested by centrifugation. Bacterial pellets are suspended in 4.5 mL 50 mM HEPES pH 7.5, 1 mM EDTA plus 0.5 mL 5 mg/mL lysozyme for 15 min at 25C, subjected to two freeze-thaw cycles. After sonication for 1 min on ice, homogenates are centrifuged at 16K x g for min. The supernatants are then serially diluted with 50 mM Hepes pH 7.5, 1 mM EDTA to generate 8 samples with relative concentration ranging from 1 to 1/10000.

Each bacterial extract and diluted bacterial extract is assayed for complementation of PrnA activity by addition of 20 microliter of extract to a 180 microliter of a solution composed of 7.2 microgram PrA (0.36 microgram/microliter), 3.3 micromolar FAD, 3.3 mM NaCI, 1.67 mM D-Trp, 0.67 mg/ml NADH and 50 mM HEPES, pH 7.5. The reactions are incubated at C for 2 h. The reactions are stopped by heating to 100 °C for 2 min followed by centrifugation at 21000 x g for 5 min. The supernatant solutions are then filtered through kDa cutoff centrifugal ultrafiltration membranes. The filtrate is then assayed by reversephase HPLC to quantify conversion of D-Trp to D-7-chlorotryptophan using the analytical WO 01/44447 PCT/EP00/12347 -34method, described above in Example 1 for PmA1. Addition of extract from E. colicontaining the empty vector pKK223-3 resulted in 0.34 pmol 7-CI-Trp per min per microgram protein in the added extract Addition of extract from E. colicontaining freE 83 pKK223-3 resulted in 1.14 pmol 7-CI-Trp per min per microgram protein in the added extract. Addition of extract from E. coli containing fre- pKK223-3 resulted in 301 pmol 7-CI-Trp per min per microgram protein in the added extract.

Flavin reductase assays are carried out by addition of 10 microliter bacterial extract to 990 microliter 50 mM Hepes pH 7.5 containing 0.1 mg/ml NADPH and 9.5 micromolar riboflavin. If the activity is too high to permit observation of the first 20% of the reaction, the bacterial extract is diluted 1/10 in 50 mM HEPES buffer then assayed as above.

Conversion of NADH to NADP is then monitored spectrophotometrically at 340 nm.

Addition of extract from E. coli containing the empty vector pKK223-3 had a flavin reductase activity of 0.055 nmol per min per microgram protein in the added extract. Addition of extract from E. colicontaining freE 83 pKK223-3 had a flavin reductase activity of 0.157 nmol per min per microgram protein in the added extract. Addition of extract from E. coli containing fre- pKK223-3 had a flavin reductase activity of 25.4 nmol per min per microgram protein in the added extract. This demonstrates that changes in flavin reductase activity is proportional to changes in halogenation activity.

C. Co-expression of fre and the prn operon in E. coli.

The complete Pseudomonas fluorescens pyrrolnitrin operon (5.8 X/N, cited in US Patent No. 5,723,759 which is herein incorporated by reference above) in pKK223-3 (Pharmacia) was transformed in to E. coli. The fre sequence, including the Taq promoter, is transferred from pKK223-3 into the tetracycline marker of pACYC184 (NEB), which contains the compatible origin of replication p15A. This plasmid is then co-transformed with 5.8X/N and presence of both vectors are selected for by ampicillin and chloramphenicol. The host strain containing fre alone are also generated as a negative control. A 60mL culture of each line was grown at 370 with shaking at 200rpm for 48 hr. From each culture 5mL is extracted for plasmid analysis to confirm the presence of one or both plasmids. A 15 mL aliquot is used for protein and activity analysis. The remaining 40 mL of culture is extracted 2 times with 2 volumes of ethyl acetate. The ethyl acetate fractions are concentrated to dryness in vacuo and then brought up into 50 microliter 6:4 H 2 0/CH 3 CN and 60 microliter WO 01/44447 PCT/EP00/12347 MeOH. Twenty microliter of the resulting solutions are then analyzed by HPLC method Prn_BCD for aminopyrrolnitrin, and pyrrolnitrin described below.

HPLC Analytical method Pm BCD Determination of MDA. APRN and PRN.

The HPLC instrument is a Waters Alliance HPLC system with photodiode array detector and is equipped with a 4.6 x 50 mm column packed with C18-Silica, particle size 3 micromolar. The HPLC method is a gradient elution method. Flow rates are 1.2 ml/min through out and absorbance data are collected from 210 to 400 nm with a resolution of 2.4 nm and a sampling rate of 5/s. The system is pre-equilibrated with 65:35 ratio of water acetonitrile. Following sample injection the column is developed in a linear gradient from the starting conditions to a 40:60 ratio of water acetonitrile. Aminopyrrolnitrin is eluted at min and pyrrolnitrin at 6.6 min. Both aminopyrrolnitrin and pyrrolnitrin are measured by integrating peak areas in chromatograms measured at diagnostic wavelengths. For aminopyrrolnitrin 300 nm absorbance is used. For pyrrolnitrin, 250 nm absorance is used.

The results show that aminopyrrolnitrin accumulation was increased greater than fold, and pyrrolnitrin accumulation was increased greater than 4-fold, in E. coli cells coexpressing plasmids comprising fre and the pyrrolnitrin operon compared to cells expressing only the pyrrolnitrin operon.

Example 5: Halogenation by PrnA expressed in transgenic plants then purified and assayed in vitro.

Arabidopsis thaliana, ecotype Columbia, is transformed (by the Agrobacteriummediated transformation method) with the four nucleic acid molecules of the pyrrolnitrin operon, encoding PrnA, PmB, PrC PrnD, each behind the ubiquitin promoter as described below in Example 6.

The individual pyrrolnitrin nucleic acid molecules are PCR replicated with appropriate restriction sites from pCIB169 (US Patent No. 5,723,759) which contain a cosmid clone from P.fluorescens BL915, Genbank accession number is U74493. The nucleic acid molecules are subcloned and sequenced. The ubiquitin3 promoter and first intron Callis et al (1990).Journal of Biological Chemistry 265:12486-12493. and S. R. Norris et al (1993) Plant Molecular Biology. 21:895 -906.) are PCR replicated from the Arabidopsis genome to contain a 5'Kpnl and a 3' BamHI site. The ubiquitin promoter, nos terminator (Depicker et al (1982) Journal of Molecular and Applied Genetics 1:561-573.) and each individual WO 01/44447 PCT/EP00/12347 -36pyrrolnitrin nucleic acid molecule (see US Patent Nos. 5,723,759 and 5,955,348 each of which is herein incorporated by reference in its entirety) are cloned into a modified pSportl vector. A Kozak consensus -3ACC nucleotide triplet is added to each of PrnA, B and D just of the initial ATG. The PmC nucleic acid molecule is not modified. The initial GTG codon in PrnB is changed to an ATG codon. These modifications result in the vector set pPEH7826, 27, 28 and 29 (Pm A, B, C, D respectively). All other sequences are consensus to the wild type sequence. The PmAC doublet is constructed by inserting the Kpnl fragment from pCIB7826 into the Kpnl site of pCIB7828 (PmC) producing pCIB7830. The PrnBD doublet is produced by inserting the Kpnl fragment from pCIB7827 (PrnB) into the Kpnl site of pCIB7829 (PrnD) producing pCIB7831. The four nucleic acid molecule operon is created by inserting the Notl fragment from pCIB7830 into the Notl fragment of pCIB7831 producing pCIB7832. The Xbal fragment from pCIB7832 was inserted into the binary vector pCIB200 producing the transformation vector pCIB7819. The final vector is electroporated into agrobacterium and used for Arabidopsis transformation.

Arabidopsis thaliana is transformed by the method of N. Bechtold et al Bechtold et al (1993).C. R. Acad. Sci. Paris, Life Sciences 316:1194-1199).

Two transformed lines (3 and 12) and a nontransformed control line are grown and leaves (1g) harvested. The leaves are frozen in liquid N 2 powdered in a mortar and extracted with 6 ml of LS buffer (50 mM HEPES, pH 7.5, 5 mM NaCI). After centrifugation at 5000 x g for 15 min to pellet debris, the supernate is filtered through glass wool to remove residual particles.

PmA is immunopurified by mixing extract (3 ml) with an affinity matrix. The affinity matrix is prepared by mixing for 30 minutes, at room temperature, 100 microliters of rabbit antigoat-lgG-agarose (purchased from Sigma) with 50 microliters of goat anti-PrnA sera.

Then the agarose beads are washed three times with 1 ml of LS buffer. After mixing the 3ml sample with the affinity matrix, unabsorbed material is removed from the beads by washing with LS buffer. A positive control sample is prepared by mixing 5 microliter of PrnA (0.36 microgram/microliter) purified from Pseudomonas fluorescens as described in Example 1 with 3 ml LS then treating in parallel with the plant extract samples.

200 microliters of assay buffer (50 mM HEPES pH 7.5, 5 mM D-Trp, 5 mM NaCI 5 IM FAD, 5 mM glucose 6-phosphate 2 mg/ml NADH 6.25 U/ml glucose 6-phosphate dehydrogenase 44 U/ml catalase 30 U/ml SOD and 20 microliter of Fre (21 microgram/ml) purified from E. coli as described in example 1 are added to the agarose WO 01/44447 PCT/EP00/12347 -37beads containing immunopurified PrnA, except for one sample each of lines 3 and 12.

Samples are then mixed overnight by inversion, filtered through Microcon-10 filters, then product assayed by HPLC method PmA1 (described above in Example 1) The injection volume of sample was 50 microliter. The following levels of 7-CI-Trp were found: positive control (exogenous PrnA added to non-transformed plant extract) 185 pmol, Line 3 Fre (two separate samples) 83 pmol and 113 pmol, Line 3 without Fre 0 pmol, Line 12 with Fre (two separate samples) 120 pmol and 64 pmol, Line 12 without Fre 0 pmol, nontransformed control 0 pmol.

These data demonstrate that transformed plants express PrnA in an active form whose activity was dependent on the addition of Fre.

Example 6 Halogenation in transgenic plants A. Cytoplasmic production of halogenated compounds in transgenic plants by transformation of nucleic acid encoding E. coliflavin reductase into plants comprising nucleic acid encoding PrnA, PrnB.PrnC and PrnD.

The nucleic acid sequence of SEQ ID NO:6, encoding flavin reductase from E.coli, is cloned into the vector pNOV019, to place the nucleic acid molecule under the control of the Arabidopsis ubiquitinl0 (UB10) promoter Callis et al (1990).Journal of Biological Chemistry 265:12486-12493. and S. R. Norris et al (1993) Plant Molecular Biology. 21:895 906.), and terminated with the nopaline synthase terminator from Agrobacterium (Depicker et al (1982) Journal of Molecular and Applied Genetics 1:561-573).

The binary vector system consisting of pNOV507 (KanR), 508, (Chlor") and 509, (Amp") is completed. The three vectors used to construct the pyrrolnitrin operon with the fre nucleic acid molecule and a herbicide resistance selectable marker are as follows. pNov507 (Kan

R

is the binary vector with the polylinker between the left and right borders replaced with a selection of unique restriction sites that are not found in any of the promoters, terminator, pyrrolnitrin, fre, or the selectable marker nucleic acid molecules. The other two vectors pNOV508 (ChlorR) and pNOV509 (AmpR) are vectors which contain a portion of the pNOV507 polylinker with additional restriction sites added for cloning the separate nucleic acid molecule cassettes for the pyrrolnitrin operon. These two vectors are construction or assembly vectors. The fre cassette along with the UB3-selectable marker cassette from pNOV111 are ligated together in pNOV509. This double cassette is then transferred into the binary vector, pNOV507, yielding the final vector pNOV510. This vector WO 01/44447 PCT/EP00/12347 -38is electroporated into Agrobacterium. The Arabidopsis thaliana lines that are transformed with PmA, PmB, PrC and PrnD nucleic acid molecules as described in Example 5 are transformed by the method of N. Bechtold et al Bechtold et al (1993).C. R. Acad. Sci.

Paris, Life Sciences 316:1194-1199).

All of the pyrrolnitrin pathway nucleic acid molecules in plants and various constructions are driven by the Arabidopsis ubiquitin3 (UB3) promoter Callis et al (1990) Joumal of Biological Chemistry 265:12486-12493. and S. R. Norris et al (1993) Plant Molecular Biology. 21:895 and terminated with the nos terminator from Agrobacterium. Homozygous Arabidopsis lines harboring prnA, pmB, pmC and prnD, and wild type Columbia, are transformed with pNOV510 by Agrobacterium infiltration by the method of N. Bechtold et al as described above. Seeds are collected, dried down and planted on soil. Transformed plants are identified by spraying the seedlings with the selective agent at 0.025% three times over eight days. Plant are then confirmed for presence and level of pyrrolnitrin by HPLC or gas chromotography-mass spectometry. Plant extracts may also or alternatively be confirmed for prA and/or prC activity as described above.

B. Cytoplasmic production of halogenated compounds in transgenic plants by cotransformation of E. coliflavin reductase and the pyrrolntrin operon Nucleic acid sequences encoding PmA, PrnB, PmC, and PrnD of the pyrrolnitrin pathway set forth in US Patent No. 5,723,759 and incorporated by reference above and SEQ ID NO:7 encoding E.coliflavin reductase are introduced into plants in a single t-DNA construct. Expression of each of the pyrrolnitrin biosynthetic nucleic acid molecules is driven by the UB3 promoter, whereas fre SEQ ID NO:7 is driven by UB10. All five nucleic acid molecules have been either conformed or altered to conform closely to a Kozak translational initiation sequence by possession of A at All of the nucleic acid molecules are terminated by the nos terminator. In a preferred embodiment, the final vector is constructed by assembling the UB3 promoter-cytosolic targeted pyrrolnitrin biosynthetic genes and the UB10-fre cassettes in a binary vector comprising the following: Right border- UB3-prnA-nos-UB3-pmC-nos-UB3-prnB-nos-UB3-prnD-nos-UB10-fre-nos-UB3-selectable marker-nos-Left Border. This vector is named pNOV523 (SEQ ID NO: 34).

WO 01/44447 PCT/EP00/12347 -39- In another embodiment, the cytosolic targeted pyrrolnitrin operon is created by ligating the Notl A/B doublet fragment from pCIB7830 into the C/D doublet vector pCIB7831. The operon is transferred into pNOV507 as an Xbal cassette. The Notl A/B doublet from pCIB10253 is ligated into the C/D doublet vector pCIB10254. This construction is also transferred to pNOV507 as an Xbal cassette.

The final vector contains the following: Right border-UB3-prnA-nos-UB3-prnB-nos- UB3-prnC-nos-UB3-pmD-nos-UB10-fre-nos-UB3-selectable marker-nos-Left Border.

This vector is then electroporated into Agrobacterium and used to transform Arabidopsis (Columbia), by Agrobacterium infiltration Bechtold et al (1993).C. R. Acad.

Sci. Paris, Life Sciences 316:1194-1199.) Seeds are collected, dried down and planted on soil. Transformed plants are identified by spraying the seedlings with the selective agent at 0.025% three times over eight days. Plants are then confirmed for presence and level of pyrrolnitrin by HPLC or gas chromatography-mass spectrometry.

C. Production of halogenated compounds in plastids of transgenic plants.

Nucleic acid constructs encoding prnA and B are engineered to express chloroplast transit peptides (Wong, E.Y. et al (1992) Plant Molecular Biology vol. 20: 81-93.), and placed together on a vector allowing selection on kanamycin. Transformation protocols are as detailed in previous examples Bechtold et al (1993).C. R. Acad. Sci. Paris, Life Sciences 316:1194-1199).

Construction of the plastid targeted pyrrolnitrin nucleci acid molecule vectors.

The individual pyrronitrin pathway nucleic acid molecules are PCR replicated from pCIB10230, 31, 32, 33 (Pm A, B, C, D respectively), to contain a 5' Nhel and 3' BamHI restriction sites. The nucleic acid molecules are Topo cloned into pCR2.1 (Invitrogen, US Office Carlsbad, CA 92008, catalogue number K2030-01) for sequence confirmation. The RuBPcase small subunit peptide transit sequence, is PCR replicated from the Arabidopsis cDNA library in pFL61 (Wong et al., 1992, Plant Mol Biol 20: 81-93). This nucleic acid sequence is ligated onto the 5' end of each pyrronitrin nucleic acid molecule in pPEH31, 29, and 28 (Prn A, B, C, D repsectively). This pPEH vector set contains the UB3-intron-nos cassette. The additional mature peptide is synthesized as complimentary oligos, annealed and ligated onto the 5' portion of the transit peptide pyrrolnitrin nucleic acid molecule construction. This produced the plastid targeted pyrrolnitrin nucleic acid molecule vectors pCIB10249, 50, 51 and 52 (Pm A, B, C, D respectively). The PrnAB doublet pCIB10253, was created by ligating the PmA containing Kpnl nucleic acid molecule cassette from WO 01/44447 PCT/EP00/12347 pCIB10249 into pCib10250. The PrnCD doublet, pCIB10254 was created by ligating the PrnC containing Xhol nucleic acid molecule cassette from pCIB10251 into pCIB10252.

Each doublet was transferred as an Xbal cassette into the Binary vector pCIB200(KanR).

The selectable marker scheme for plastid targeted vectors was: for the fre vector- Right Border-UB10-clp-fre-nos-UB3-selectable marker -nos-Left Border; for PmA/B vectorsRight Border- UB3-prnA-nos-UB3-prnB-nos--UB3-selectable marker-nos-Left Border and for PrnC/D vectorsRight Border-UB3-prnC-nos-UB3-prnD-nos-UB3-selectable marker-nos-Left.

The plastid targeted prnAB-fre vector is then electroporated into Agrobacterium and used to transform Arabadopsis columbia via the method of N. Bechtold et al. as described above. Seeds are collected dried down and planted in soil. Transformed plants are identified by spraying the seedlings with the selective agent and selfed to homozygosity.

Similarly, the plastid targeted prnCD/selectable marker vector is introduced into Arabadopsis as described above and the resulting transformants selfed to homozygosity.

The homozygous transformed plants comprising the plastid targeted prnABfre/selectable marker construct are then crossed with the homozygous plastid targeted prnCD/selectable marker plants. In another embodiment, the plastid targeted prnCD cassette is transferred into the binary vector comprising the UB10-plastid targeted fre cassette. This vector is known as pNOV524 (SEQ ID NO: 35). The vector pNOV524 is then electroporated into Agrobacterum and used to transform Arabidopsis columbia via the method of N. Bechtold et al. as described above. Both wildtype Arabidopsis and Arabidopsis previously transformed with pCIB10253 (comprising plastid targeted prnA/B) are transformed with pNOV524. Seeds are collected, dried down and planted in soil.

Transformed plants are identified by spraying the seedlings with the selective agent and selfed to homozygosity.

The resulting progeny are subject to the appropriate selective agent. Plants resistant to this selective agent regime possess fre and prnA, B, C, and D in the hemizygous state. One skilled in the art will recognize the many variations possible in this approach. In all cases, pyrrolnitrin expression is quantified by HPLC or gas chromatography.

Example 7: Halogenation by PrnC expressed in transgenic plant leaves supplied with

MDA

Western blot analyses of Columbia lines transformed with pNOV524 construct (comprising the plastid targeted prnC, prnD and fre) are performed following basta selection.

WO 01/44447 PCT/EP00/12347 -41 Additionally, western blot analyses of Arabidopsis lines transformed with pCIB10253 (comprising plastid targeted prnA and prnB) and subsequently transformed with pNOV 524 are performed following basta selection. Single leaves from each of the lines are homogenized in 1X protein sample buffer, boiled and separated by 10% SDS-PAGE.

Subsequently, the membrane is probed for the presence of prnC and prnD proteins with antibodies raised against prnC and pmD, respectively. Arabidopsis lines positive for prnC and prnD expression are identified. The same protein extracts are re-examined for the presence of the flavin reductase (fre) protein using a 10-20% gradient gel and subsequently probing the membrane with antibodies raised against fre. Lines positive for fre expression are identified.

Leaves, are taken from an Arabidopsis line positive for plastid-targeted prnC, prnD and fre expression and additionally from an Arabidopsis line that is negative for prC and prnD by western blot. The leaves are vacuum infiltrated with MDA while submerged in an 5mM MES (pH5.7); 400 mM Mannitol buffer, and left overnight at room temperature in the dark.

Subsequently, the buffer is extracted with ethylacetate, concentrated to dryness and analyzed on the HPLC (as described in the preceding Example 4).

The leaves from plants positive for prnC, pmD and fre convert MDA to APRN (approximately Conversion is detected within 3 hours of incubation time.

Furthermore, approximately 30% of the APRN is converted to pyrrolnitrin. In addition, the negative control, leaves from plants not expressing prC or prnD, show no conversion of MDA to either APRN or pyrrolnitrin.

The above cited referenced publications are all herein incorporated by reference in their entirety.

EDITORIAL NOTE APPLICATION NUMBER 17078/01 The following Sequence Listing pages 1 to 146 are part of the description. The claims pages follow on pages "42" to "44".

WO 01/44447 WO 0144447PCT/EPOO/12347 SE7JECE LISTING <110> Novartis AG <120> Compositions and Methods for Halogenation Reactions <130> Case S-31082A <140> <141> <150> US 60/228801 <151> 1999-12-15 <150> US 60/219343 <151> 2000-01-03 <160> <170> Patentln Ver. <210> 1 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: amino acid consensus domain <400> 1 Xaa Ala Ala Trp Xaa Ala Ala Trp Xaa Ala Ala Ile Pro Xaa Ala Ala <210> 2 <211> 1617 <212> DNA WO 01/44447 WO 0144447PCT/EPOO/12347 <213> Pseudomonas fluorescens <220> <221> COS <222> (1617) <400> 2 atg aac aag ccg atc aag aat. atc gtc Met Asn Lys Pro Ile Lys Asn Ile Val 1 5 gtg ggc ggc ggt act Val Gly Gly Gly Thr gcg 48 Ala ggc tgg atg Gly 'rrp Met gcctcg tac ctc Ala Ser Tyr Leu cgg gcc ctc caa cag Arg Ala Leu Gin Gin cag gcg 96 Gln Ala aac att Asn Ile ctc atc gaa tct gcg gcg atc cct cgg atc ggc gtg ggc Leu Ile Glu Ser Ala Ala Ile Pro Arg Ilie Gly Val Gly gaa gcg Glu Ala acc atc cca agt Thr Ile Pro Ser cag aag gtg Gin Lys Val ccg gag cgg gaa tgg Pro Giu Arg Glu Trp atg ccc caa gtg Met Pro Gin Val ttc ttc gat ttc cic ggg Phe Phe Asp Phe Leu Gly aac ggc gog ttc aag gcc Asn Gly Aia Phe Lys Ala ccc gac ccc tcg cgc gac Pro Asp Pro Ser Arg Asp 192 240 288 gcg atc aag ttc gtg Ala Ilie Lys Phe Val aat tgg aga aag tct Asn Trp, Arg Lys Ser WO 01/44447 WO 0144447PCT/EPOO/12347 gat cac tic Asp His Phe cat ttg tic ggc His Leu Phe Gly aac gig ccg aac igc Asn Val Pro Asn Cys 105 gac ggc gig 336 Asp Gly Val 110 tic cag cag 384 Phe Gin Gin ccg ct Pro Leu ccg atg Pro Met 130 cac tac tgg cig His Tyr Trp Leu aag cgc gaa cag Lys Arg Glu Gin gag tac gcg tgc Glu Tyr Ala Cys ccg cag ccc ggg Pro Gin Pro Gly cic gac ggc aag 432 Leu Asp Gly Lys cig Leu 145 gca ccg tgc cig Ala Pro CYS Leu gac ggc acc cgc Asp Gly Thr Arg aig tcc cac gcg Met Ser His Ala igg 480 Trp 160 gic 528 Val1 cac tic gac gcg His Phe Asp Ala cig gig gcc gac Leu Val Ala Asp tic ttg Phe Leu 170 gag gig Glu Val aag cgc tgg Lys Arg Trp gag cgc ggg gig Glu Arg Gly Val aac cgc gig gic Asn Arg Val Val gat Asp 185 gig gac Val Asp cgc cig 576 Arg Leu aac aac cgc ggc Asn Asn Arg Gly 195 tac aic icc aac Tyr Ile Ser Asn 200 cig cic acc aag gag Leu Leu Thr Lys Glu ggg Cgg acg 624 Gly Arg Thr ctg gag gcg gac cig tic aic gac tgc icc ggc atg cgg ggg cic ctg 672 WO 0144447PCT/EPOO/12347 WO 01/44447 -4- Leu Glu Ala Asp Leu Phe 210 atc aat oag gcg ctg aag Ile Asn Gin Ala Leu Lys 225 230 Ile Asp Cys 215 gaa coO tcC Giu Pro Phe Ser Giy Met Arg 220 Gly Leu Leu atc gac Ile Asp 235 atg toc Met Ser gao tao Asp Tyr ctg ego gac ago Leu Cys Asp Ser gtc goc agc goC Val Ala Ser Ala coo aac gac Pro Asn Asp gao gcg cgc Asp Ala Arg 255 tog gga tgg Ser Gly Trp 270 gat ggg gtc Asp Gly Vai oog tao aoo too Pro Tyr Thr Ser ato goo atg aao Ile Ala Met Asn aoo egg Thr Trp att oog Ile Pro aeg otg Met Leu ogg tto ggc ago Arg Phe Gly Ser ggo tao gtc tto Giy Tyr Val Ph-e 285 cg ago Ser Ser 290 oat to aco tog His Phe Thr Ser gao oag gcc aco goo gao tto ctc aaa Asp Gin Ala Thr Aia Asp Phe Leu Lys 300 tgg ggo oto tog Trp, Gly Leu Ser aat oag cog ctc aao oag atc aag tco Asn Gin Pro Leu Asn Gin Ile Lys Phe 315 ogg 960 Arg 320 gtO ggg ego aao aag Val Giy Arg Asn Lys 325 ogg gog Arg Ala Cgg gec aao aao tgc gto tog ato ggg i008 Trp Val Asn Asn Cys Vai Ser Ile Giy 330 335 WO 01/44447 WO 0144447PCT/EPOO/12347 ctg tcg teg Leu Ser Ser ttt ctg gag Phe Leu Giu cec ctg gaa tcg acg Pro Leu Glu Ser Thr 345 ctc gtg aag cac ttc Leu Val Lys His Phe ggg atc Gly Ile 350 tac ttc 1056 Tyr Phe ate tac Ile Tyr ttc gac Phe Asp 370 gcg ctt. tac eag Ala Leu Tyr Gin ccc Pro 365 gac acc tcg 1104 Asp Thr Ser ccg cgg ctg age Pro Arg Leu Ser gct ttc aac gcc Ala Phe Asn Ala ate gtc eac atg 1152 Ile Val H-is Met gac gac tgc egg Asp Asp Cys Arg gat ttc Asp Phe 390 gte caa gcg Val Gin Ala tat ttc acc acg tcg Tyr Phe Thr Thr Ser 400 1200 1248 cgc gat gac acg Arg Asp Asp Thr ttc tgg ctc gcg Phe Trp Leu Ala cgg cac Arg His gac ctg cgg ctc Asp Leu Arg Leu 415 tcg gac gcc Ser Asp Ala aaa gag aag gtt Lys Glu Lys Val cgc tac aag gcg Arg Tyr Lys Ala ggg ctg ccg Gly Leu Pro 430 1296 ctg ace acc Leu Thr Thr 435 acg tcg Thr Ser tte gac gat Phe Asp Asp 440 tcc acg tac tac gag ace ttc gac Ser Thr Tyr Tyr Glu Thr Phe Asp 445 1344 tac gaa ttc aag aat ttc tgg ttg aae ggc aac tac tae tge ate ttt 1392 WO 01/44447 WO 0144447PCT/EPOO/12347 Tyr Giu Phe Lys 450 gcc ggc ttg ggc Ala Gly Leu Gly 465 cga ccg gag tcg Arg Pro Giu Ser Asn Phe Trp Leu Asn Gly Asn Tyr 455 460 Tyr Cys Ile Phe atg ctg Met Leu 470 ccc gac cgg tcg Pro Asp Arg Ser ccg ctg ttg cag Pro Leu Leu Gin gag aaa gcc gag Giu Lys Aia Glu atg ttc gcc agc Met Phe Ala Ser atc cgg Ile Arg 495 1440 1488 1536 cgc gag gcc Arg Giu Ala cgt ctg cgc acc Arg Leu Arg Thr cig ccg aca aac tac gac tac Leu Pro Thr Asn Tyr Asp Tyr 510 ctg cgg Leu Arg ctg cgt gac ggc Leu Arg Asp Giy gcg ggg ctg tcg cgc Ala Gly Leu Ser Arg 525 ggc cag cgt Gly Gin Arg 1584 ggg CC Giy Pr 53 <210> <211> <212> <213> g 0 0 aag ctc Lys Leu gca gcg cag gaa agc ctg tag Ala Ala Gin Glu Ser Leu 535 1617 3 538

PRT

Pseudoinonas fluorescens <400> 3 WO 0144447PCT/EPOO/12347 WO 01/44447 Met Asn Lys Pro

I

Ile Lys Asn Ile Val Ile Val Gly Gly Gly Thr Ala 5 10 Gly TrP Met Ala Ala Ser Tyr Leu Val Arg Ala Leu 25 Asn Ile Thr Leu Ile Giu Ser Ala Ala Ile Pro Arg 40 Glu Ala Thr Ilie Pro Ser Leu Gin Lys Val Phe Phe 55 Ile Pro Giu Arg Giu Trp Met Pro Gin Val Asn Gly 70 75 Ala Ile Lys Phe Val Asn Trp Arg Lys Ser Pro Asp 90 Asp His Phe Tyr His Leu Phe Gly Asn Val Pro Asn 100 105 Pro Leu Thr His Tyr Trp Leu Arg Lys Arg Glu Gin 115 120 Pro Met Glu Tyr Ala Cys Tyr Pro Gin Pro Gly Ala 130 135 140 Leu Ala Pro Cys Leu Ser Asp Gly Thr Arg Gin Met 145 150 155 Ile Gly Val Gly Asp Phe Leu Gly Ala Phe Lys Ala Pro Ser Arg ASP Cys ASP Gly Val 110 Gly Phe Gin Gin 125 Leu Asp Gly Lys Ser His Ala WO 01/44447 PCT/EPOO/12347 His Phe Asp Ala His Leu Val Ala Asp Phe Leu Lys Arg Trp Ala Val 165 170 175 Giu Arg Gly Val Asn Arg Val Val Asp Giu Val Val Asp Val Arg Leu 180 185 190 Asn Asn Arg Gly Tyr Ilie Ser Asn Leu Leu Thr Lys Glu Gly Arg Thr 195 200 205 Leu Glu Ala Asp Leu Phe Ilie Asp Cys Ser Gly Met Arg Gly Leu Leu 210 215 220 Ile Asn Gin Ala Leu Lys Giu Pro Phe Ile Asp Met Ser Asp Tyr Leu 225 230 235 240 Leu Cys Asp Ser Ala Val Ala Ser Ala Val Pro Asn Asp Asp Ala Arg 245 250 255 Asp Gly Val Glu Pro Tyr Thr Ser Ser Ile Ala Met Asn Ser Gly Trp 260 265 270 Thr Trp Lys Ile Pro Met Leu Gly Arg Phe Gly Ser Gly Tyr Val Phe 275 280 285 Ser Ser His Phe Thr Ser Arg Asp Gin Ala Thr Ala Asp Phe Leu Lys 290 295 300 Leu Trp Gly Leu Ser Asp Asn Gin Pro Leu Asn Gin Ile Lys Phe Arg 305 310 315 320 WO 01/44447 pCTIEPOOI1 2 34 7 Val Gly Arg Asn Lys Arg Ala Trp Val Asn Asfl cys Val ser le Gly 325 330 335 Leu Ser Ser Cys Phe Leu Giu Pro Leu Giu Ser Thr Gly Ile Tyr Phe 340 345 350 Ilie Tyr Ala Ala Leu Tyr Gin Leu Val Lys His Ph-e Pro Asp Thr Ser 355 360 365 Phe Asp Pro Arg Leu Ser Asp Ala Phe Asn Ala Giu Ile Vai H4is Met 370 375 380 Phe Asp Asp Cys Arg Asp Phe Val Gin Ala His Tyr Phe Thr Thr Ser 385 390 39540 Arg Asp Asp Thr Pro Phe Trp Leu Ala Asn Arg His Asp Leu Arg Leu 405 410 415 Ser Asp Ala Ile Lys Glu Lys Val Gin Arg Tyr Lys Ala Gly Leu Pro 420 425 430 Leu Thr Thr Thr Ser Phe Asp Asp Ser Thr Tyr Tyr Glu Thr Phe Asp 435 440 445 Tyr Giu Phe Lys Asn Phe Trp Leu Asn Gly Asn Tyr Tyr Cys Ile Phe 450 455 460 Ala Gly Leu Gly Met Leu Pro Asp Arg Ser Leu Pro Leu Leu Gin His 465 470 475 480 WOO1/4 4 4 7 PCTIEPOO/1 2 34 7 Arg pro GJ.u Ser Ile Glu Lys Ala Glu Ala Met Phe Ala Ser Ile Arg 485 490 495 Arg Git' Ala Glu Arg Leu Arg Thr Ser Leu pro Thr Asfl 500 505 510 Let' Arg Ser Let' Arg Asp Gly Asp Ala Gly Let' ser Arg 515 520 525 Gly Gin Arg Gly Pro LyS Let' Ala Ala Gin Glu Ser Let' 530 535 <210> 4 <211> 1704 <212>

DNA

<213> PseudomfoflBs fluoreSCenS <220> <221>

CDS

,222> (1704) <400> 4 a a tgc atg act cag aag agc ccc gcg aac gaa cac gat agc atcctCgc 4 Met Thr Gin Lys Ser Pro Ala ASfl Git' His Asp Ser Asn His phe Asp 1 5 10 gta atc atc ctc ggc tcg ggc at~g tcc ggc acc cag atg ggg gCc atc 96 Val Ile Ile Leu Gly Ser Gly Met Ser Gly Thr Gin Met Gly Ala Ile WO 01/44447 WO 0144447PCT[EPOO/12347 11 ttg gcc Leu Ala caa cag ttt cgc gtg ctg atc atc gag Gin Gin Phe Arg Val Leu Ile Ilie Giu gag tcg tcg cac 144 Glu Ser Ser His acg tct ctt atg 192 Thr Ser Leu Met ccg cgg Pro Arg aac cgc Asn Arg acg teg Thr Ser ttc acg atc ggc Phe Thr Ile Gly gaa tcg tcg atc ccc Glu Ser Ser Ile Pro cgc tac ggc att ccg Arg Tyr Gly Ile Pro atc atc gct Ile Ile Ala gag ctc gac cac Giu Leu Asp His atc 240 Ile att 288 Ile ttt tat Phe Tyr acg caa cgt tac Thr Gin Arg Tyr gcg tcg agc acg Ala Ser Ser Thr aag cgc aac Lys Arg Asn ggc ttc gtg ttc Gly Phe Val Phe aag ccc ggc cag Lys Pro Gly Gin cac gac 33G His ASP ccg aag Pro Lys ttc acc cag tgc Phe Thr Gin Cys att ccc Ile Pro gag ctg Giu Leu ccg tgg ggg ccg 384 Pro Trp Gly Pro gag agc Giu Ser 130 cat tat tac cgg caa His Tyr Tyr Arg Gin 135 gac gtc gac gcc tac ASP Val Asp Ala Tyr 140 ttg ttg caa gcc 432 Leu Leu Gin Ala gcc att aaa tac ggc tgc aag gtc cac cag aaa act acc gtg acc gaa 480 PCT/EPOOII2347 WO 01/44447 -12- Ala 145 Ile Lys Tyr Gly Cys Lys Vai His Gin Lys Thr Thr Val Thr 150 155 tac cac gcc gat Tyr His Ala Asp gac ggc gtc gcg Asp Gly Val Aia gtg acc acc gcc cag Vai Thr Thr Ala Gin 170 gaa 528 Glu cgg ttc acc ggc Arg Phe Thr Gly 180 ctc gcg acc aag Leu Ala Thr Lys 195 cgg tac atg atc Arg Tyr Met Ile tgc gga gga cct Cys Gly Giy Pro cgc gcg Arg Ala 190 ccg 576 Pro ttc aag ctc Phe Lys Leu gaa gaa ccg tgt Glu Giu Pro Cys ttc aag acg 624 Phe Lys Thr cac tcg His Ser 210 cgc agc ctc tac Arg Ser Leu Tyr cac atg ctc ggg His Met Leu Giy aag ccg ttc gac Lys Pro Phe ASP gac Asp 225 atc ttc aag gtc Ile Phe Lys Val ggg cag cgc t99 cgc Gly Gin Arg Trp Arg 235 tgg cac gag Trp His Giu ggg acc Gly Thr 240 ttg cac cac atg ttc Leu His His Met Phe 245 gag ggc ggc tgg ctc tgg gtg att ccg ttc aac GlU Giy Giy TrP, Leu Trp Val Ile Pro Phe Asn 250 255 768 816 aac cac ccg cgg tcg acc aac aac ctg gtg agc gtc ggc ctg cag ctc Asn His Pro Arg Ser Thr Asn Asn Leu Val Ser Vai Gly Leu Gin Leu 260 265 270 WO 01/44447 WO 0144447PCT/EPOO/12347 -13gac ccg cgt gtc tac ccg aaa Asp Pro Arg Val Tyr Pro Lys 275 gat gag ttc etc geg egg ttc Asp Glu Phe Leu Ala Arg Phe 290 295 acc gac ate tec gea Thr Asp Ile Ser Ala 280 c ag Gin 285 cag gaa ttc 864 Gin Glu Pheceg agc ate ggg Pro Ser Ilie Gly cag ttc cgg gac Gin Phe Arg Asp gtg ccg gtg ege Val Pro Vai Arg tgg gtc aag acc Trp Val Lys Thr ege etg caa ttc Arg Leu Gin Phe 912 960 1008 tcg aae gee tgc Ser Asn Ala Cys ggc gac cgc tac Giy Asp Arg Tyr ctg atg ctg eac Leu met Leu His gcg aac Ala Asn 335 ggc ttc ate Gly Phe Ile ccg ctc tte tcc Pro Leu Phe Ser ggg etg gaa. aac Gly Leu Giu Asn ace gcg gtg Thr Ala Val 350 1056 acc atc Thr Ile gac ttc Asp Phe 370 cac gcg etc gcg geg His Ala Leu Ala Ala 355 tee eec gag ege ttc Ser Pro Giu Arg Phe 375 etc ate aag geg Leu Ile Lys Ala egc gae gac 1104 Arg Asp Asp gag tac ate gag egc Glu Tyr Ile Giu Arg 380 etg eag Leu Gin eaa aag 1152 Gin Lys ett ttg gac eac aae gac gac tte gte age tge tgc tac acg geg ttc 1200 WO 01/44447 PCT/EPOO/12347 -14- Leu Leu Asp His Asn 385 tcg gac tic cgc cta Ser Asp Phe Arg Leu Asp Asp Phe Val 390 tgg gac gcg tic Trp Asp Ala Phe Ser Cys Cys Tyr Thr Ala Phe 395 400 cac agg ctg igg gcg His Arg Leu Trp Ala 410 cag gcc cac gcg agg Gln Ala His Ala Arg ggc 1248 Gly acc atc cic Thr Ile Leu cag tic cgg ctc Gln Phe Arg Leu tic cgc 1296 Phe Arg gcg icg Ala Ser tat cic Tyr Leu 450 aac gac Asn Asp 465 aac gag ggc gac Asn Glu Gly Asp gat cac ctc gac Asp His Leu Asp gac cct ccg 1344 Asp Pro Pro gga tac cig tgc Gly Tyr Leu Cys gac aig gag gag ASP Mlet Glu Glu iac cag tig tic 1392 Tyr Gin Leu Phe gcc aaa gcc Ala Lys Ala gic gag gcc gtg Val Glu Ala Val gcc ggg cgc aag Ala Gly Arg Lys ccg 1440 Pro 480 gcc gai gag gcc gcg Ala ASP Glu Ala Ala 485 gcg cgg ait cac gcc Ala Arg Ile His Ala 490 cic ati gac gaa cga gac Leu Ile Asp Glu Arg Asp 495 1488 tic gcc aag ccg atg tic ggc tic ggg tac igc atc acc ggg gac aag 1536 Phe Ala Lys Pro Met Phe Gly Phe Gly Tyr Cys Ile Thr Gly Asp Lys 500 505 510 WO 01/44447 PCTEPOO/12 3 47 ccg cag ctc aac aac tcg aag Lac agc ctg ctg ccg gcg atg cgg ctg 1584 Pro Gin Leu Asn Asfl Ser Lys Tyr Set Leu Leu Pro Ala Met Arg Leu 515 520 525 atg tac tgg acg caa acc cgc gcg ccg gca gag gtg aaa aag Lac ttc 1632 Met Ty Tr Thr Gin Thr Arg Ala pro Ala GlU Val Lys Lys Tyr Phe 530 535 540 gac Lac aac ccg atg ttc gcg ctg ctc aag gcg tac atc acg acc cgc 1680 Asp Tyr Asn Pro Met Phe Ala Leu Leu Lys Ala Tyr Ile Thr Thr Arg 545 550 555 560 atc ggc ctg gcg ctg aag aag tag 1704 Ile Gly Leu Ala Leu Lys Lys 565 <210> <211> 567 <212>

PRT

<213> PseudomoflaS fluoresceiS <400> Met Thr Gln Lys Ser Pro Ala Asfi Glu His Asp Set Asn His Phe Asp 1 5 10 Val Ile Ile Leu Gly Ser Gly Met Set Gly Thr Gin Met Gly Ala Ile 25 PCT/EPOOI12347 WO 01/44447 -16- Leu Ala Lys Gin Gin Phe Arg Val Leu Ile Ile Giu Giu Ser Ser His 40 Pro Arg Phe Thr Ilie Gly Giu Ser Ser Ile Pro Giu Thr Ser Leu Met 55 Asn Arg Ilie Ile Ala Asp Arg Tyr Gly Ile Pro Glu Leu Asp His Ile 70 75 Thr Ser Phe Tyr Ser Thr Gin Arg Tyr Val Ala Ser Ser Thr Gly Ile 90 Lys Arg Asn Phe Gly Phe Val Phe His Lys Pro Gly Gin Giu His Asp 100 105 110 Pro Lys Giu Phe Thr Gin Cys Val Ile Pro Giu Leu Pro Trp Gly Pro 115 120 125 Giu Ser His Tyr Tyr Arg Gin Asp Val Asp Ala Tyr Leu Leu Gin Ala 130 135 140 Ala Ilie Lys Tyr Giy Cys Lys Val His Gin Lys Thr Thr Val Thr Giu 145 150 155 160 Tyr His Ala Asp Lys Asp Gly Val Ala Val Thr Thr Ala Gin Gly Giu 165 170 175 Arg Phe Thr Gly Arg Tyr Met Ile Asp Cys Gly Gly Pro Arg Ala Pro 180 185 190 WO 01/4444? PCT/EPO011 2 34 17 Leu Ala Thr Lys Phe Lys Leu Arg Glu Giu Pro Cys Arg phe LYS Thr 195 200 205 His Ser Arg Ser Leu Tyr Thr His Met Leu Gly Val Lys Pro Phe Asp 210 215 220 Asp Ie Phe Lys Val Lys Gly Gin Arg Trp Arg Trp, His Giu Gly 'rhr 225 230 235 240 LeuHisHisMetPhe Glu Gly Gly Trp Le, Trp Val Ile Pro Plie Asfl L u i s H s M t 2 4 5 2 5 0 2 5 Asf Hi Po Ag Sr hr sn Asn Leu Val. Ser Val. Gly Leu Gin Leu 2602627 Asp Pro Arg Val Tyr Pro Lys Thr Asp Ile Ser Ala Gin Gin Glu Phe 275 280 285 Asp Giu Phe Len Ala Arg Phe Pro Ser Ile Gly Ala Gin Pbe Arg Asp 290 295 300 Ala Val Pro Val Arg Asp Trp Val LYS Thr Asp Arg Leu Gin phe Ser 305 .310 315 320 Ser Asfl Ala CYs Val Gly Asp Arg Tyr Cys Leu M~et Leu His Ala Asfl 325 330 335 Gly Phe Ile Asp Pro Leu Phe ser Arg Gly Lenl Glu Asfl Thr Ala Val 340 345 350 WO 01/44447 pCTEPOOI1 2347 Thr lie His Ala Leu Ala Ala Arg Leu Ile Lys Ala LeU Arg Asp

ASP

355 360 365 Asp Phe Ser Pro Giu Arg Phe Giu Tyr Ile Glu Arg Leu Gln Gin Lys 370 375 380 Leu Leu Asp His Asn Asp Asp Phe Val Ser Cys Cys Tyr Thr Ala Phe 385 390 395 400 Ser Asp Phe Arg Leu Trp Asp Ala Phe His Arg Leu Trp Ala Val Gly 405 410 415 Thr Ile Leu Gly Gin Phe Arg Leu Val Gin Ala His Ala Arg Phe Arg 420 425 430 Ala Ser Arg Asfl Glu Gly Asp Leu Asp His Leu Asp Asn Asp Pro Pro 435 440 445 Tyr Leu Gly Tyr Leu Cys Ala Asp Met Glu Glu Tyr Tyr Gin Leu Phe 450 455 460 Asn Asp Ala Lys Ala Giu Val Giu Ala Val Ser Ala Gly Arg Lys Pro 465 470 475 480 Ala Asp Glu Ala Ala Ala Arg Ile His Ala Leu Ile Asp Giu Arg Asp 485 490 495 Phe Ala Lys Pro met Phe Gly Phe Gly Tyr Cys Ile Thr Gly Asp Lys 510 WO 01/44447 WO 0144447PCT/EPOOI12347 19 Pro Gin Leu Asn Asn Ser 515 Met Tyr Trp Thr Gin 'rhr 530 Lys Tyr Ser Leu Leu Pro 520 Arg Ala Pro Ala Glu Val 535 540 Ala Met Arg Leu 525 Lys Lys Tyr Phe Asp Tyr Asn Pro Met 545 Phe Ala Leu Leu Lys Ala Tyr 550 555 Ile Thr Thr Arg 560 Ilie Gly Leu Ala Leu LYS Lys 565 <210> 6 <211> 1350 <212> DNA <213> Pseudomonas fluorescens <220> <221> ODS <222> (1)..(1350) <400> 6 atg agc gat cat gat tat gat gta gtg Met Ser Asp His Asp Tyr Asp Val Val att. atc ggt ggc ggg Ile Ile Gly Gly Gly aaa gcc ggt gtc aaa Lys Ala Gly Val LYS ccg gcg 48 Pro Ala tgc gcg 96 Cys Ala ggt tcg acc atg gcc tcc tac ctg gca Gly Ser Thr Met Ala Ser Tyr Leu Ala 25 WO 01/44447 WO 0144447PCT/EPOO/12347 20 gig tic gaa Val Phe Glu aaa gaa cig tic Lys Glu Leu Phe cgc gag cat gtt Arg Glu His Val gag tcg ctg 144 Giu Ser Leu gta ccg Val Pro gcc acc act ccg gig Ala Thr Thr Pro Val 55 ctg ctg gaa. aic ggg gtg aig gaa aag Leu Leu Giu Ile Gly Val Met Glu Lys gag aaa gcc aac Glu Lys Ala Asri ccg aag aag itc ggc Pro Lys Lys Phe Gly gct gcc tgg acc tcg Ala Ala Trp Thr Ser gca gat icc ggc Ala Asp Ser Gly gaa gac Giu Asp aag atg ggc Lys Met Gly ttc cag ggg Phe Gin Giy cig gac cac Leu Asp His cag gaa ggg Gin Giu Gly 110 gat tic cgt Asp Phe Arg gcg gaa atc ctc tic Ala Giu Ile Leu Phe 105 aac gag cgc aag Asn Giu Arg Lys gtc gat Val Asp ati ct Ile Leu 130 gac ttc acg ASP Phe Thr ttc cac Phe His 120 gic gac cgc ggc Val Asp Arg Gly tic gac cgc 384 Phe Asp Arg cig gag cac gca Leu Giu His Ala tcg cig ggg gcc aag Ser Leu Gly Ala Lys 140 gic ttc cag ggc 432 Val Phe Gin Giy gig gag aic gci gac gic gag tti cic agc ccg ggc aat gic att gtc 480 WO 01/44447 WO 0144447PCT/EPOO/12347 -21 Val Glu Ile Ala Asp 145 Val Glu Phe Leu 150 aag cgc agc gig Lys Arg Ser Val Ser Pro Gly Asn Val Ile Val 155 160 aat gcc aag cig Asn Ala Lys Leu atc aag gcc aag Ile Lys Ala Lys aig gig 528 Met Val 175 ggc ttg 576 Gly Leu gtg gat gcc Val Asp Ala ggt cgc aac gig Gly Arg Asn Val ctg ctig ggc cgc cgg Leu Leu Gly Arg Arg cga gaa Arg Giu gac ccg gtc tic Asp Pro Val Phe cag tic gcg at Gin Phe Ala Ile tcc igg tic 624 Ser Trp Phe gac aac itc Asp Asn Phe 210 gac cgc aag Asp Arg Lys gcg acg caa agc Ala Thr Gin Ser gac aag gic gac 672 Asp Lys Val Asp aic ttc att cac Ile Phe Ile His tic Phe 230 ctg ccg aig acc Leu Pro Met Thr acc tgg gic igg Thr Trp, Val Trp cag 720 Gin 240 aic ccg aic acc Ile Pro Ile Thr cag aac tac acC Gin Asfl Tyr Thr 260 acc ati acc agc Thr Ile Thr Ser ggc gig git acg Gly Val Val Thr gaa gag tic tic Giu Giu Phe Phe 270 cag aag 768 Gin Lys 255 igg gaa B16 Trp Glu aac icc gac ctc acc tat Asn Ser Asp Leu Thr Tyr 265 WO 01/44447 WO 0144447PCT/EPOO/12347 -22 gcg gtg Ala Val cag gtc Gin Vai 290 ace cgg gaa aac Thr Arg Glu Asn ctg cat gac geg ctg Leu His Asp Ala Leu 280 aag gca tcg gag 864 Lys Ala Ser Giu 285 tao ggc atg aaa. 912 Tyr Gly Met Lys cgc ccg ttc aag Arg Pro Phe Lys gag gcg gac tac Giu Ala Asp Tyr gaa Giu 305 gte tgt ggc gao Val Cys Gly Asp ttc gtg ctg ate Phe Val Leu Ile gat gee gca cgg Asp Ala Ala Arg ttc 960 Phe 320 gtc gac Val Asp ccg ate Pro Ile tce age ggc gte Ser Ser Gly Val agc Ser 330 gtt gca etc aae Val Ala Leu Asn agt geg 1008 Ser Ala 335 gac ttt 1056 Asp Phe ego ate gee Arg Ile Ala ggc gao ate ate Gly Asp Ile Ile geg gtg aag aae Ala Val Lys Asn ago aag Ser Lys agt tto act cac Ser Phe Thr His gaa ggc atg ate Glu Gly Met Ile aat ggc ate 1104 Asn Gly Ile aag aac tgg Lys Asn Trp 370 tat gag tte atc Tyr Giu Phe Ile 375 aeg ote tat tao ego Thr Leu Tyr Tyr Arg 380 etg aao ate ete 1152 Leu Asn Ile Leu ttc ace gcg ttc gtt caa gac cca ego tac ego ctg gac ate ctg caa 1200 WO 01/44447 WO 0144447PCT/EPOO/12347 23 Phe Thr Ala Phe Val 385 Gin Asp Pro Arg Tyr 390 gtc tac age ggc aag Val Tyr Ser Gly Lys 410 Arg Leu Asp Ile Leu Gin 395 400 ttg ctg caa ggg Leu Leu Gin Gly aag atg cgc gaa Lys Met Arg Glu 420 cgc ctg gaa gtg Arg Leu Giu Val gac 1248 Asp atc ate get gcg gtt Ile Ile Ala Ala Val 425 gaa agc gac ccg Giu Ser Asp Pro cac etc 1296 His Leu tgg Trp cac aag His Lys 435 tac ctg ggc gac Tyr Leu Giy Asp cag gtt cet ace gee Gin Val Pro Thr Ala 445 aaa eec gcg 1344 Lys Pro Aia ttc taa Phe 450 1350 <210> 7 <211> 449 <212> PRT <213> Pseudomonas fluoreseens <400> 7 Met Ser Asp His Asp Tyr Asp Val Val Ile Ile Gly Gly Gly Pro Ala 1 5 10 Gly Ser Thr Met Ala Ser Tyr Leu Ala Lys Ala Gly Val Lys Cys Ala WO 01/44447 WO 0144447PCT/EPOO/12347 -24- 25 Val Phe Glu Lys Giu Leu Phe Glu Arg Glu His Val Gly Glu Ser Leu 40 Val Pro Ala Thr Thr Pro Val Leu Leu Glu Ile Gly Val Met Giu Lys 55 Ile Giu Lys Ala Asn Phe Pro Lys Lys Phe Gly Ala Ala Trp Thr Ser 70 75 Ala Asp Ser Gly Pro Glu Asp Lys Met Gly Phe Gin Gly Leu Asp His 90 Asp Phe Arg Ser Ala Giu Ile Leu Phe Asn Glu Arg Lys Gin Giu Gly 100 105 110 Vai Asp Arg Asp Phe Thr Phe His Val Asp Arg Gly Lys Phe Asp Arg 115 120 125 Ilie Leu Leu Giu His Ala Gly Ser Leu Gly Ala Lys Val Phe Gin Gly 130 135 140 Vai Gu Ile Ala Asp Val Giu Phe Leu Ser Pro Gly Asn Val Ile Val 145 150 155 160 Asn Ala Lys Leu Gly Lys Arg Ser Val Glu Ile Lys Ala Lys Met Val 165 170 175 Val Asp Ala Ser Gly Arg Asn Val Leu Leu Gly Arg Arg Leu Gly Leu WO 01/44447 WO 0144447PCT/EPOO112347 25 Arg Giu Lys 195 Asp Asn Phe 210 Tyr Ile Phe 225 180 185 Asp Pro Val Phe Asn Gin Phe Ala Ile His 200 205 Asp Arg Lys Ser Ala Thr Gin Ser Pro Asp 215 220 Ile His Phe Leu Pro Met Thr Asn Thr Trp, 230 235 190 Ser Trp Phe Lys Val Asp Val Trp Gin 240 Ile Pro Ilie Thr Giu Thr Ile Thr Ser Val Gly Val Val Thr Gin Lys 245 250 255 Gin Asn Tyr Thr Asn Ser Asp Leu Thr Tyr Giu Giu Phe Phe Trp Giu 260 265 270 Ala Val Lys Thr Arg Giu Asn Leu His Asp Ala Leu Lys Ala Ser Giu 275 280 285 Gin Val Arg Pro Phe Lys Lys Glu Ala Asp Tyr Ser Tyr Gly Met Lys 290 295 300 Giu Vai Cys Giy Asp Ser Phe Val Leu Ile Gly Asp Ala Ala Arg Phe 305 310 315 320 Val Asp Pro Ile Phe Ser Ser Gly Val Ser Val Ala Leu Asn Ser Ala 325 330 335 Arg Ile Ala Ser Gly Asp Ile Ile Giu Ala Val Lys Asn Asn Asp Phe WO 01/44447 WO 0144447PCT/EPOOI12347 -26 Ser Lys Ser 355 Ser Phe Thr His Giu Gly Met Ile Asn Gly Ile Lys Asn 370 Trp Tyr Glu Phe Ile Thr Leu Tyr Tyr 375 Leu Asn Ile Leu Thr Ala Phe Val Asp Pro Arg Tyr Leu Asp Ile Leu Leu Leu Gin Giy Val Tyr Ser Gly Arg Leu Giu Val Leu Asp 415 Lys Met Arg Ile Ile Ala Ala Val Giu Ser Asp Pro 425 Giu His Leu 430 Lys Pro Ala Trp His Lys 435 Tyr Leu Giy Asp Gin Val Pro Thr <210> 8 <211> 1641 <212> DNA <213> Pseudomonas fluorescens <220> <221> CDS WO 01/44447 WO 0144447PCT/EPOO/12347 -27 <222> (1)..(1641) <400> 8 gtg gtt Val Val atg aae gat gtg cag tet.

Met Asn Asp Val Gin Ser ggc aag Gly Lys 10 geg cca gag cat Ala Pro Giu His tac gac Tyr Asp att etc ttg gcg ggc aac agc atc age Ile Leu Leu Ala Gly Asn Ser Ile Ser 25 gtg ate atg etc Val Ile Met Leu gcc gcc tgc Ala Ala Cys ctg gcC Leu Ala ccc ccc Pro Pro cgg aac Arg Asn aag gtc egg Lys Val Arg gte ggt ttg ttg cgc aac cgg eag atg Val Giy Leu Leu Arg Asn Arg Gin Met 40 gcg aeg att. ccc tat ace tcg atg att Ala Thr Ile Pro Tyr Thr Ser Met Ile gac ctt ace ggt gag Asp Leu Thr Gly Giu 55 gag etg att gec gac GiU Leu Ile Ala Asp egc tat gge gtg ccg Arg Tyr Gly Val Pro 75 gaa ata aag aat ate Giu Ile Lys Asn Ile gee ege ace: egg Ala Arg Thr Arg gat ate eag cag aag Asp Ile Gin Gin Lys gtg atg ceg tet tee ggg gte Val Met Pro Ser Ser GIly Vai eag cge age egg geg gtg gac Gin Arg Ser Arg Ala Val Asp 110 aag aag aae: etc Lys Lys Asn Leu 100 ggg ttc ate tat cae Gly Phe Ilie Tyr His 105 WO 01/44447 WO 0144447PCT/EPOO/12347 -28 ctg ggc cag Leu Gly Gin 115 gcg ctg caa Ala Leu Gin ttc aac Phe Asn 120 gtg ccc tcc gag cat Val Pro Ser Giu His 125 ggc gag aac 384 Gly Giu Asn cat ctg His Leu 130 ggt tat Gly Tyr 145 tic agg ccc gat Phe Arg Pro Asp gat gee tat ctg ctg gcg gcg gcc atc Asp Ala Tyr Leu Leu Ala Ala Ala Ile 140 ggc gcg eag Gly Ala Gin gig gag atc gat aac Val Giu Ilie Asp Asn 1.55 agc cca gag Ser Pro Glu gig ctg Val Leu 160 gtc gag gac agc Val Giu Asp Ser gtc aag gta gct Val Lys Val Ala gea ctg ggg, Ala Leu Gly cgc tgg gte Arg Trp Val 175 gtg ctg gcg Val Leu Ala 190 act gcc gat Thr Ala Asp atg gtt gat ggc Met Val Asp Gly cag ggc ggc cag Gin Gly Gly Gin egg cag Arg Gin ctg gaa Leu Glu 210 ggc ctg gtc agc Gly Leu Val Ser get teg acg cag Ala Ser Thr Gin acc egg acc 624 Thr Arg Thr tic tee act cat atg Phe Ser Thr His Met 215 cte ggg Leu Gly gig gtg Ceg Val Val Pro 220 tic gat gag ige 672 Phe Asp Giu Cys gtg cag ggc gat itt eec gge eag igg cat gge ggc aet etg cat cac 720 WO 01/44447 WO 0144447PCT/EPOO/12347 -29- Val Gin Giy Asp Phe 225 gtg ttc gat ggg ggc Val Phe Asp Gly Gly Pro Gly Gin Trp His 230 tgg gtg ggg gtc atc Trp Vai Gly Val Ile 250 Giy Thr Leu His His 240 cag 768 Gin ccg ttc aac aac cat Pro Phe Asn ASfl His 255 cac tcg cgc His Ser Arg etc tge ccg Leu Cys Pro 275 aac cct ttg gtc age gtg Asn Pro Leu Vai Ser Val 260 265 agc atg gac ggc gac eag Ser Met Asp Giy Asp Gin 280 ctg gtt Leu Val tca ctg cgt Ser Leu Arg 270 gag gac 8i6 Giu Asp gte ctg gee Val Leu Ala gge etg atc gag 864 Giy Leu Ile Giu 285 ctg tac Leu. Tyr 290 gag tgg Giu Trp 305 gaa cgc Giu Arg ccc ggc etg ggg egg Pro Giy Leu Giy Arg 295 cac ctg tee ggc gcc egg c99 gtg cgc 912 His Leu Ser Giy Aia Arg Arg Vai Arg 300 gtg ctg cgc cag Vai Leu Arg Gin 310 ccg ccc cgg cag Pro Pro Arg Gin tat cgc acg gcg Tyr Arg Thr Aia ctc 960 Leu 320 cgc tgc Arg Cys atg tte gac gag Met Phe Asp Giu gge Giy 330 gcc geg age aac Ala Aia Ser Asn gat ctg 1008 Asp Leu ~335 gcc ctg i056 Ala Leu ttg ttc tcg cgc Leu Phe Ser Arg 340 aag etg tcc aat gct Lys Leu Ser Asn Aia 345 gcg gaa ctg gtt ctg Ala Giu Leu Val Leu 350 WO 01/44447 WO 0144447PCT/EPOO/12347 30 gcg cac Ala His gcc ctg Ala Leu 370 ctg atc aag gcg Leu Ile Lys Ala gcg cac agc ggt gac Ala His Ser Gly Asp 360 cgc agc ccg 1104 Arg Ser Pro aat gat ttt gtc Asn Asp Phe Val acc cag gac agc Thr Gin Asp Ser atc agc ttg agt 1152 Ile Ser Leu Ser cgg atc gcc tta Arg Ile Ala Leu gct tat gtg tcg Ala Tyr Val Ser cgc gac ccc Arg Asp Pro tgg aat gcc ttc Trp Asn Ala Phe cgt gtc tgg ctg Arg Val Trp Leu cag tcg att gcc Gin Ser Ile Ala gag ttg 1200 Glu Leu 400 gcc acc 1248 Ala Thr 415 gac ccg 1296 Asp Pro atc acc gcg Ile Thr Ala cga gtg ttc Arg Val Phe aag atc aac gat Lys Ile Asn Asp ttt gcc aag gac Phe Ala Lys Asp gat gaa atc gac Asp Giu Ile Asp cag Gln 440 ctc gca gag gac Leu Ala Glu Asp ggt Gly 445 ttc tgg Phe Trp atg 1344 Met cct ctg Pro Leu 450 tat cgg ggg tac aag Tyr Arg Giy Tyr Lys 455 gat att Asp Ile ctc aac act Leu Asn Thr 460 acg ctg ggc Thr Leu Gly ctt 1392 Leu tgt gat gac gtc aaa agc gcc aag gtc tot gct gcg cac gcg gcg agc 1440 WO 01/44447 WO 0144447PCT/EPOO/12347 31 Cys Asp Asp Val Lys 465 Ser Ala Lys Val 470 ctt gcc aac gc Leu Ala Asn Ala Ser Ala 475 Ala His Ala Ala Ser 480 agc atc ttt gag Ser Ile Phe Ala ttt gtt cag act Phe Val Pro Pro att ttt 1488 Ile Phe 495 ttg aga 1536 Leu Arg gat ttt gat Asp Phe Ala aat aa gct cgt Pro His Ala Arg tat aaa atg aaa Tyr Gin Leu Thr aag ata Lys Leu gag atc tgg tgg Ala Leu Trp Trp atg atg Leu Met aaa gtg Gin Val aaa taa gag gta 1584 Pro Ser Giu Val gga agg Gly Arg 530 ctg att tta tat aga Leu Ile Phe Tyr Arg 535 tac tta aga aaa aat Ser Phe Arg Lys Pro 540 taa atg aga aag 1632 Ser Leu Arg Lys gag agt tga 1641 Giu Ser 545 <210> <211> <212> <213 9 546

PRT

Pseudomonas fiuoresaens <400> 9 WO 01/44447 WO 0144447PCT/EPOO/12347 32 Val Val Met Asn Asp Val Gin Ser Gly Ala Pro Glu Ile Leu Leu Ala Gly Asn Ser Ile Ser Val Ile Met Leu His Tyr Asp Ala Ala Cys Arg Gin Met Leu Ala Arg Asn Lys Val Arg Val Gly Leu Leu Arg Pro Pro Phe Giu Asp Leu Thr Giy Giu Ala Thr Ile Pro Tyr Thr Ser Met Ile Leu Ile Ala Asp Arg Tyr Gly Val Pro 70 Glu Ile Lys Asn Ala Arg Thr Arg Asp Ile Gin Gin Lys Val 90 Met Pro Ser Ser Giy Val Lys Lys Asn Giy Phe Ile Tyr His 105 Gin Arg Ser Arg Ala Vai Asp il0 Gly Giu Asn Leu Giy Gin Ala Leu Gin Phe Asn Val 115 120 Pro Ser Giu His Leu Phe Arg 130 Pro Asp Ile Asp Ala 135 Tyr Leu Leu Ala Ala Ala Ile 140 Tyr Gly Ala Gin Leu Val Giu Ile Asp Asn Ser Pro Giu Vai Leu 160 150 155 WO 01/44447 WO 0144447PCT/EPOO/12347 33 Val Giu Asp Ser Gly Val Lys Val Ala 165 Ala Leu Gly Arg Trp Val 175 Thr Ala Asp met Val Asp Gly Ser Gin Gly Gly Gin Val Leu Ala Arg Gin Ala 195 Gly Leu Val Ser Gln Ala 200 Ser Thr Gin Lys Thr Arg Thr 205 Leu Giu 210 Phe Ser Thr His Leu Gly Val Val Phe Asp Glu Cys Gin Gly Asp Phe Pro Gly Gin Trp His 230 Gly 235 Gly Thr Leu His His 240 Val Phe Asp Gly Trp Val Giy Val Pro Phe Asn Asn His Gin 255 His Ser Arg Leu Cys Pro 275 Pro Leu Val Ser Leu Val Ser Leu Arg Giu Asp 270 Leu Ile Glu Ser Met Asp Gly Asp 280 Gin Val Leu Ala Leu Tyr 290 Pro Gly Leu Gly Arg His Leu Ser Gly Ala Arg Arg Val Arg Trp Val Leu Arg Gin Pro Pro Arg Gin Val 310 315 Tyr Arg Thr Ala Leu WO 01/44447 WO 0144447PCT/EPOO/12347 34 Giu Arg Arg Cys Leu Met Phe Asp Glu Gly Ala Ala Ser Asn Asp Leu 325 330 335 Leu Phe Ser Arg Lys Leu Ser Asn Ala Ala Glu Leu Val Leu Ala Leu 340 345 350 Ala His Arg Leu Ile Lys Ala Ala His Ser Gly Asp Tyr Arg Ser Pro 355 360 365 Ala Leu Asn Asp Phe Val Leu Thr Gln Asp Ser Ilie Ile Ser Leu Ser 370 375 380 Asp Arg Ile Ala Leu Ala Ala Tyr Val Ser Phe Arg Asp Pro Giu Leu 385 390 395 400 Trp Asn Ala Phe Ala Arg Val Trp, Leu Leu Gin Ser Ile Ala Ala Thr 405 410 415 Ile Thr Ala Arg Lys Ile Asn Asp Ala Phe Ala Lys Asp Leu Asp Pro 420 425 430 Arg Val Phe Asp Giu Ile Asp Gin Leu Ala Giu Asp Gly Phe Trp Met 435 440 445 Pro *Leu Tyr Arg Gly Tyr Lys Asp Ilie Leu Asn Thr Thr Leu Gly Leu 450 455 460 Cys Asp Asp Val Lys Ser Ala Lys Val Ser Ala Ala His Ala Ala Ser 465 470 475 480 WO 01/44447 WO 0144447PCT/EPOO/12347 35 Ser Ilie Phe Ala Glu Leu Ala Asn Ala 485 Ser Phe Val Pro 490 Tyr Gin Leu Thr ASP Phe Ala Lys Leu Lys 515 Pro His Ala Arg Pro Ile Phe 495 Thr Leu Arg 510 Ser Glu Val Ala Leu Trp Trp Leu Met Gin Val Pro 525 Gly Arg 530 Giu Ser 545 Leu Ilie Phe Tyr Arg 535 Ser Phe Arg Lys Pro 540 Ser Leu Arg Lys <210> <211> <212> <213> <220> <221> <222> 1510

DNA

Pseudonionas fluorescens

CIDS

(1)..(1509) <400> atg aat cag tac gac gtc att atc atc ggt agt ggt atc gcc ggc gCg 48 Met Asn Gin Tyr Asp Val Ile Ile Ile Gly Ser Gly Ile Ala Gly Ala 1 5 10 WO 01/44447 WO 0144447PCT/EPOO/12347 36 ctig aco ggc Leu Thr Gly gtc ctc gog aag Val Leu Ala Lys ggg ctg aac gtt Gly Leu Asn Val ctg atc oto 96 Lea Ile Leu gcg aoa cog 144 Ala Thr Pro gao tog Asp Ser gaa agc Giu Ser cag cac cca cga Gin His Pro Arg tcc gtc ggo gaa Ser Val Gly Giu ggt ttt otg otg ogt Gly Phe Leu Leu Arg ttg ctc toa aag Leu Leu Ser Lys tco gao ato cct 192 Phe Asp Ile Pro gaa Giu ato gcc tao oto tog cac 000 Ilie Ala Tyr Leu Ser His Pro 70 gac aag Asp Lys ato cag cac gtc Ile Gin His Val ggt 240 Gly tog ago goc tgo ggg Ser Ser Ala Cys Gly ato aag otg ggo Ile Lys Leu Gly agt ttt goo tgg Ser Phe Ala Trp oat oaa 288 His Gin otg aag 336 Leu Lys gag aac gog Glu Asn Ala tog too coo gao Ser Ser Pro Asp Ott gtg gc oog Leu Val Ala Pro gtg cog Val Pro atg att.

Met Ile goc oat ott ttc Ala His Leu Phe cag gao atc gao tat Gin ASP Ile Asp Tyr 125 ccc gc Phe Ala otg 384 Leu goo ctg aaa oao ggc Ala Leu Lys His Gly goc gaa. too aga cag aao atc aag ato 432 Ala Glu Ser Arg Gin Asn Ile Lys Ile WO 01/44447 WO 0144447PCT/EPOO/12347 37 tcg ate agc etc Ser Ile Ser Leu aac gac gac ggg gtc Asn Asp Asp Gly Val 150 gcc geg ttc ate at Ala Ala Phe Ile Ile gag gtg gea ttg tc Giu Val Ala Leu Ser 155 aac 480 Asn 160 gee gee eec gte Ala Ala Pro Val.

gac get. gct gc Asp Ala Ala Ala cag ggc 528 Gin Gly 175 ctg gcg 576 Leu Ala tct ceg ett Ser Pro Leu ege caa ctg ggc Arg Gin Leu Gly cgc aec ace gaa Arg Thr Thr Glu ace gac Thr Asp gaa gat Glu Asp 210 tge tca ttc ttc Cys Ser Phe Phe cae atg etc aat His Met Leu Asn aag age tac 624 Lys Ser Tyr gee etg get ceg Ala Leu Ala Pro tee ege act egt Ser Arg Thr Arg eec ate gaa ctg 672 Pro Ile Giu Leu aag age ace ttg Lys Ser Thr Leu eac ate tte gaa His Ile Phe Giu gge tgg ttg tgg Gly Trp Leu Trp gte 720 Val 240 ate eec tte aae aae Ile Pro Phe Asn Asn 245 eae eeg eag gge ace His Pro Gin Gly Thr 250 aat eag ttg tge age ate 768 Asn Gin Leu Cys Ser Ile 255 WO 01/44447 WO 0144447PCT/EPOO/12347 38 ggc ttc cag Gly Phe Gin aac aac gcc Asn Asn Ala aag tac cgt Lys Tyr Arg 265 ccc acc gag Pro Thr Glu gcg ccg gag 816 Ala Pro Giu 270 atc gag Ile Glu ttt cgc Phe Arg 275 aaa ctg ctg aaa Lys Leu Leu Lys 280 aag tac ccg gcc atc Lys Tyr Pro Ala Ile 285 ggc gaa cac Gly Giu His ttc aag Phe Lys 290 gat gcg gtc aat gcc Asp Ala Vai Asn Ala 295 cgg gag tgg atc tac gcg ccg cgc atc Arg Glu Trp Ile Tyr Ala Pro Arg Ile 300 tac cgc agc Tyr Arg Ser gtg caa Val Gin 310 aat gtc ggg gat cgc Asn Val Giy Asp Arg 315 ttC tgc ctg ctg ccg Phe Cys Leu Leu Pro 320 caa gcc aca ggg ttt Gin Ala Thr Gly Phe 325 acc ttc gag tcc atc Thr Phe Glu Ser Ile 340 atc gac ccg ctg ttc Ile Asp Pro Leu Phe 330 ctc agg ctg gcc ccc Leu Arg Leu Ala Pro 345 tcc agg ggg ttg atc acc Ser Arg Gly Leu Ile Thr 335 aag gtg ctg gac gcc gcc Lys Val Leu Asp Ala Ala 350 960 1008 1056 cgc agc Arg Ser cgc tgg caa cgg Arg Trp Gin Arg cag ttc atc gaa Gin Phe Ile Glu gtc gag cgc cat 1104 Val Giu Arg His tgc ctg aac gcg gtg gcg acc aat gac cag tig gtc tcc tgc tcc tat 1152 Cys Leu Asn Ala Val Ala Thr Asn Asp Gin Leu Val Ser Cys Ser Tyr WO 01/44447 WO 0144447PCT/EPOO/12347 -39gaa. gcc ttc agc gac Glu Ala Phe Ser Asp 385 cac ctg tgg aac His Leu Trp Asn tgg cat cgg gtc tgg 1200 Trp His Arg Val Trp, 400 caa aag ctg ctg cac 12.18 Gin Lys Leu Leu His 415 ctc agc ggc tcc Leu Ser Gly Ser ctg ggc agt gcc Leu Gly Ser Ala gac ctg gaa Asp Leu .Glu agt ggc gac gcc Ser Gly Asp Ala cag ttc Gin Phe gat gca Asp Ala ctt gag 1296 Leu Glu gcg gtg Ala Val agc ctg Ser Leu 450 ttc cct ggc tgc Phe Pro Gly Cys tcc ctg gac tcg Ser Leu Asp Ser ccc gcc tac gaa. 1344 Pro Ala Ty'r Glu ttc agg cag tcg Phe Arg Gin Ser cag gtc atg caa Gin Val Met Gin gcc agg gag caa. 1392 Ala Arg Glu Gin agg ccg gtg gcc Arg Pro Val Ala acc gcc aac gcg Thr Ala Asn Ala cat gag ctg atc His Glu Leu Ilie tca cgg ata. tcc Ser Arg Ile Ser 495 aag 1440 Lys 480 aat 1488 Asn gag cac Glu His gaa. gcc gag Glu Ala Glu 485 ttg ttg ccc ctg ggc tat Leu Leu Pro Leu Gly Tyr 490 WO 01/44447 WO 0144447PCT/EPOO/12347 40 cgt ttc atc ctc aaa gtc tga a Arg Phe Ile Leu Lys Val 500 1510 <210> 11 <211> -502 <212> PRT <213> Pseudomonas fluorescens <400> 11 Met Asn Gin 1 Tyr Asp Vai Ile Ile Ile Gly Ser 5 10 Gly Ilie Ala Giy Ala Leu Thr Giy Ala Vai Leu Ala Lys Ser Giy Leu Asn Val Leu Ilie Leu Asp Ser Ala Gin His Pro Arg Phe Ser Val Gly Glu Ala Ala Thr Pro Glu Ser Gly Phe Leu Leu Arg Leu Leu Ser Lys Arg 55 Phe Asp Ile Pro Ilie Ala Tyr Leu His Pro Asp Lys Ile Ilie Gin His Vai Gly Ser Phe Ala Trp His Gin Ser Ser Ala Cys Ile Lys Leu Giy Phe GlU Asn Ala Pro Ser Ser Pro Asp His Leu Val Ala Pro Pro Leu Lys WO 01/44447 WO 0144447PCT/EPOO/12347 41 Val Pro Glu 115 Met Ile Ala 130 Glu Ser Ile 145 Ala Ala Pro Ser Pro Leu 100 105 Ala His Leu Phe Arg Gin Asp Ile Asp Tyr 120 125 Leu Lys His Gly Ala Glu Ser Arg Gin Asn 135 140 Ser Leu Asn Asp Asp Gly Val Giu Val Ala 150 .155 Val Lys Ala Ala Phe Ile Ile Asp Ala Ala 110 Phe Ala Leu Ile Lys Ile Leu Ser Asn 160 Ala Gin Gly 175 Gly Leu Ala 190 Gin Leu Gly Thr Thr Glu Thr Asp Thr Cys Ser Phe Phe Thr His Met 195 200 Glu Asp Ala Leu Ala Pro Leu Ser Arg Thr 210 215 Phe Lys Ser Thr Leu His His Ile Phe Glu 225 230 Ile Pro Phe Asn Asn His Pro Gin Gly Thr 245 250 Gly Phe Gin Phe Asn Asn Ala Lys Tyr Arg Leu Asn Vai Lys Ser Tyr 205 Arg Ser Pro Ile Giu Leu 220 Glu Gly Trp Leu Trp Val 235 240 Asn Gin Leu Cys Ser Ile 255 Pro Thr Glu Ala Pro Giu WO 01/44447 WO 0144447PCT/EPOO/12347 42 260 Ile Giu Phe Arg 275 Phe Lys Asp Ala 265 Lys Leu Leu Lys Lys 280 Val Asn Ala Arg Glu 295 290 Asn Tyr 270 Tyr Pro Ala Ile Gly Giu His 285 Trp Ile Tyr Ala Pro Arg Ile 300 Asp Arg Phe Cys Leu Leu Pro 315 320 Arg Ser Val Gin Asn VJal Gly 310 Thr Gly Phe Ile Asp Pro Leu 325 Ala Phe Ser Arg 330 Gly Leu Ile Thr 335 Thr Phe Giu Ser Ile Leu Arg 340 Arg Ser Asn Arg Trp Gin Arg 355 Leu Ala 345 Glu Gin Pro Phe Lys Val Leu Asp Aia Ala 350 Ile Glu Vai Giu Arg His 365 Cys Leu Asn Ala Val Ala Thr Asn Asp Gin Leu Val Ser Cys Ser Tyr 370 375 380 Giu Ala Phe Ser Asp Phe His Leu Trp Asn Val Trp His Arg Val Trp 385 390 395 400 Leu Ser Gly Ser Asn Leu Gly Ser Ala Phe Leu Gin Lys Leu Leu H-is 405 410 415 Asp Leu Glu His Ser Gly Asp Ala Arg Gin Phe Asp Ala Ala Leu Giu WO 01/44447 WO 0144447PCT/EPOO/12347 -43- 42 1 430 Ala Val Arg 435 Phe Pro Gly Cys Leu 440 Ser Leu Asp Ser Ala Tyr Glu Ser Leu 450 Ala Arg 465 Phe Arg Gin Ser Cys Gin Val Met Gin Gin Ala Arg Giu Gin Pro Val Ala GiU Thr Ala Asn Ala 470 His Glu Leu Ile Glu His Giu Ala Giu Leu Leu Pro Leu Gly 485 490 Tyr Ser Arg Ile Ser Asn 495 Arg Phe Ile Leu Lys Val 500 <210> <211> <212> <213> 12 1476

DNA

Amycolatopsis orientalis <220> <221> CDS <222> (1)..(1476) <400> 12 atg tcg gtc gaa gat ttc gat gtt gtg gtg gcg ggc ggc ggg ccg ggt 48 Met Ser Val Giu Asp Phe Asp Val Val Val Ala Gly Gly Gly Pro Gly WO 01/44447 WO 0144447PCT/EPOO/12347 -44 ggt tcg acg Gly Ser Thr gcc acc ctg gtg Ala Thr Leu Val atg cag gga cac Met Gin Gly His cgg gte ctg 96 Arg Val Leu etg ctg Leu Leu ctg ccc Leu Pro aaa gag gte ttc LYS Giu Val Phe cgg tac cag atc Arg Tyr Gin Ile ggt gag tcg ctg 144 Gly Giu Ser Leu gee acg gtg eac Ala Thr Val His gte tgc cgg atg Val Cys Arg Met etc ggc gtc geg gac 192 Leu Gly Val Ala Asp ctg gcg aat tee Leu Ala Asn Ser tte ccg ate aaa Phe Pro Ile Lys ggc ggc aeg tte Gly Gly Thr Phe ege 240 Arg gcc 288 Ala tgg ggc gcc egt Trp Gly Ala Arg ccg gag ccg tgg aeg Pro Glu Pro Trp Thr cac ttc ggg atc His Phe Gly Ile aag atg gcg Lys Met Ala ggc tcg acg tcg cac Gly Ser Thr Ser His 100 ate etg etg aag aac Ile Leu Leu Lys Asn 120 tat cag gtc gag Tyr Gin Val Glu gcg aag 336 Ala Lys ttc gac gac Phe Asp Asp 115 gcc aag age aag ggc Ala Lys Ser Lys Gly 125 gtc gtc gtg 384 Val Val Val WO 01/44447 WO 0144447PCT/EPOO/12347 45 cgg gaa Arg Glu 130 ggc tge tcg gte Gly Cys Ser Val aac gac gtc gtg Asn Asp Val Val gag gac ggc gag egg gtc 432 Glu Asp Gly Glu Arg Val ace gge gcg cge tac Thr Gly Ala Arg Tyr 145 gac gcg gac gge aac Asp Ala Asp Gly Asn gcg cac gaa gtc Ala His Glu Val tcg 480 Ser 160 aeg 528 Thr gcc cgg ttc gtg Ala Arg Phe Val gac gcg tcg ggc Asp Ala Ser Gly aac aag Asn Lys 170 age egg etc Ser Arg Leu aag gtc aac Lys Val Asn teg egg aac tac Ser Arg Asn Tyr teg gag Ser Glu 185 tte ttc cgc Phe Phe Arg cte geg 576 Leu Ala ctg ttc Leu Phe ggc aac Gly Asn 210 tat ttc gag ggt Tyr Phe Glu Gly gge aaa Gly Lys 200 cgg etg cc Arg Leu Pro ccg gtg Leg 624 Pro Val Ser atc etg agc gtc Ile Leu Ser Val ttc gac agc ggc tgg Phe Asp Ser Gly Trp 220 ttc tgg tac ate 672 Phe Trp Tyr Ile ccc ctg agc gae acg Pro Leu Ser Asp Thr 225 gac gec gac aag atc Asp Ala Asp Lys Ile ace age gte gge Thr Ser Val Gly geg gte gtg cgc cgg Ala Val Val Arg Arg 235 gag 720 Glu 240 eag ggc gac egc gag Gin Gly Asp Arg Giu aag gee etc aac ace ttg 768 Lys Ala Leu Asn Thr Leu WO 01/44447 WO 0144447PCT/EPOOII2347 -46 atc gcc gaa Ile Ala Glu ccg ctg atc tcg Pro Leu Ile Ser tac ctc tcg aac Tyr Leu Ser Asn gcg ace agg 816 Ala Thr Arg 270 gtg acc Val Thr tac cag Tryr Gin 290 acc ggc agg tac ggc Thr Gly Arg Tyr Giy 275 cag gac agc tac tgg Gin Asp Ser Tyr Trp, 295 gaa ctg cgg gig cgc Glu Leu Arg Vai Arg 280 cgg ccc ggg atg gic Arg Pro Giy Met Val 300 aag gac tac tcg 864 Lys Asp Tyr Ser 285 cig gtc ggc gac 912 Leu Val Gly Asp gee gcg tgc ttc gtg gac Ala Ala Cys Phe Val Asp 305 310 acc tac agc gcg ctg etc Thr Tyr Ser Ala Leu Leu 325 ccg gig tic tcc Pro Val Phe Ser icc ggg gig cac Ser Gly Val His 315 aic aac agc gte Ile Asn Ser Val ctg gcg 960 Leu Ala 320 etc gcg 1008 Leu Ala 335 geg gee egg Ala Ala Arg ggc gac Gly Asp ege cgc Arg Arg ctc gac Leu Asp 340 gag aag acc geg Glu Lys Thr Ala cig aac gag tic gag Leu Asn Glu Phe Glu geg cgc tat 1056 Ala Arg Tyr 350 ttc tat cag 1104 Phe Tyr Gin gag Glu 355 tac ggc gic tic tac Tyr Gly Val Phe Tyr 360 gag tic etc gte tcc Giu Phe Leu Val Ser 365 WO 01/44447 WO 0144447PCT/EPOO/12347 47 atg aac Met Asn 370 gtc aac gag gaa Val Asn Giu Glu tcg tat ttc tgg Ser Tyr Phe Trp 375 atc gag tcg ttc Ile Glu Ser Phe cag gcc Gin Ala 380 aag aag gtc acg 1152 Lys Lys Val Thr aac cag agc acc Asn Gin Ser Thr gag ctg atc Giu Leu Ile gtg tcg tcc Vai Ser Ser aac agt gcc Asn Ser Ala ggc gag Gly Glu 405 acc gcg ctg acg Thr Ala Leu Thr gcc gcc gac cgg atc Ala Ala Asp Arg Ile 410 gac aag atg gcg acg Asp Lys Met Aia Thr 430 ggc ggg 1200 Gly Gly 400 gcc gcg 1248 Ala Ala 415 ggc gac 1296 Gly Asp gaa ttc gcc gcc gcc gtc Giu Phe Ala Ala Ala Val 420 425 ggc gac gac Gly Asp Asp 435 atg gtg ccg atg Met Val Pro Met ttc aag tcg acc gtg gtc aag cag gcg 1344 Phe Lys Ser Thr Val Val Lys Gin Ala 440 445 cag atg aag gcg ctg ctc ggc gag gac 1392 Gin Met Lys Ala Leu Leu Gly Glu Asp 460 atg cag Met Gin 450 gag gcg ggc cag Giu Ala Gly Gin gaa ccc gag ctg ccg Giu Pro Giu Leu Pro 470 ctg ttc Leu Phe ccc ggc ggc Pro Gly Gly 475 ctg gtg act tcg ccc 1440 Leu Val Thr Ser Pro 480 gac ggg atg aag tgg ctg ccg cac cac ccg gcc tga Asp Gly Met Lys Trp Leu Pro His His Pro Ala 1476 WO 01/44447 WO 0144447PCT/EPOO/12347 48 <210> <211> <212> <213> 485 13 491

PRT

Amycolatopsis orientalis <400> 13 Met Ser Val Giu Asp Phe Asp Val Val Val 1 5 10 Ala Gly Gly Gly Ser Thr Leu Leu Glu Ala Thr Leu Val Met Gin Gly His Gly Pro Gly Arg Val Leu Glu Ser Leu Lys Glu Val Phe Arg Tyr Gin Ile Leu Pro so Ala Thr Val His Val Cys Arg Met Gly Val Ala Asp Leu Ala Asn Ser Phe Pro Ile Lys Arg Gly Gly Thr Phe Arg Ser Ala Trp Gly Ala Arg Glu Pro Trp Thr Phe His Phe Gly Ile Lys Met Ala Gly 100 Ser Thr Ser His Ala Tyr Gin 105 Val Glu Arg Ala Lys 110 WO 01/44447 WO 0144447PCT/EPOO/12347 -49 Phe Asp Asp Ile Leu Leu 115 Arg Giu Gly Cys Ser Val 130 Thr Gly Ala Arg Tyr Thr Lys Asn Ala 120 Asn Asp Val 135 Asp Ala Asp Lys Ser Lys Gly Val Val Val 125 Val Glu Asp Gly Glu Arg Val 140 Gly Asn Ala His Glu Val Ser Arg Phe Val 150 Ile Asp Ala 165 155 Asn Lys Ser Gly Ser Arg Leu 160 Tyr Thr 175 Lys Val Asn Gly Ser Arg Asn Tyr Ser Glu 180 185 Leu Phe Gly Tyr Phe Giu Gly Gly Lys Arg 195 200 Gly Asn Ile Leu Ser Val Ala Phe Asp Ser 210 215 Pro Leu Ser Asp Thr Leu Thr Ser Val Gly 225 230 Asp Ala Asp Lys Ile Gin Gly Asp Arg Giu 245 250 Ile Ala Glu Cys Pro Leu Ile Ser Glu Tyr 260 265 Phe Phe Arg Ser LeU Ala 190 Leu Pro Glu Pro Val Ser 205 Gly Trp, Phe Trp Tyr Ile 220 Ala Val Val Arg Arg Glu 235 240 Lys Ala Leu Asn Thr Leu 255 Leu Ser Asn Ala Thr Arg 270 WO 01/44447 WO 0144447PCT/EPOO/12347 50 Val Thr Thr Gly Arg Tyr Gly Glu Leu 275 280 Arg Val Arg Lys Asp Tyr Ser 285 Tyr Gin 290 Gin Asp Ser Tyr Trp Arg Pro 295 Gly Met Val Leu Val Gly Asp 300 Ala Cys Phe Val Asp Pro Val Phe Ser Ser Gly Vai His Leu Ala 320 Thr Tyr Ser Ala Leu Ala Ala Arg Ser 330 Ile Asn Ser Val Leu Ala 335 Gly Asp Leu Arg Arg Glu 355 Glu Lys Thr Ala Leu Asn 345 Glu Phe Glu Ala Arg Tyr 350 Phe Tyr Gin Tyr Gly Val Phe Tyr 360 Glu Phe Leu Val Ser 365 Met Asn 370 Gin Asn 385 Val Asn Glu Glu Gin Ser Thr Asp 390 Ser TPyr 375 Phe Trp Gin Ala 380 Ile Glu Ser Phe Val Glu 395 Lys Lys Vai Thr Leu Ile Gly Giy 400 Arg Ile Ala Ala 415 Val Ser Ser Gly Giu Thr Ala Leu Thr Ala Ala Asp 405 Asn Ser Ala Glu 420 Phe Ala Ala Ala Val Asp Lys Met Ala Thr Gly Asp 430 WO 01/44447 WO 0144447PCT/EPOO/12347 -51 Gly Asp Asp Met Val Pro Met Phe Lys Ser Thr 435 440 Met Gin 450 Ala Glu 465 Glu Ala Gly Gin Val Gin Met Lys Ala 455 Pro Glu Leu Pro Leu Phe Pro Gly Gly 470 475 Val Val Lys Gin Ala 445 Leu Leu Gly Glu Asp 460 Leu Val Thr Ser Pro 480 Asp Gly Met Lys Trp Leu Pro His His Pro Ala 485 490 <210> <211> <212> <213> <220> <221> <222> 14 1359

DNA

Streptornyces aureofaciens

CDS

(1359) <400> 14 atg ttc cac cgg gao ggo gag gag ccg Met Phe His Arg Asp Gly Giu Glu Pro gac cog aao gag ac Asp Pro Asn Glu Thr ago cag 48 Ser Gin ttc cgc atc ccc tog ato gtc ggc aac Phe Arg Ile Pro Ser Ile Val Gly Asn 25 gcg gcc cao ttc ttc Ala Ala His Phe Phe cgo cag 96 Arg Gin WO 01/44447 WO 0144447PCT/EPOO/12347 52 gac acc Asp Thr gcc cgg Ala Arg tcc tac atg ttc Ser TPyr Met Phe cac gcc gcg gtg cgc His Ala Ala Val Arg ggc tgc gac 144 Gly Cys Asp cag tac tac cgg Gin Tyr Tyr Arg gtg gag aac atc gag Val Ciu Asn Ile Glu gac gac ggc ggg 192 Asp Asp Gly Gly gtg acc gtc tcc ggc Val Thr Val Ser Gly gac ggc agc acc Asp Gly Ser Thr cgg gcc cgc tac Arg Ala Arg Tyr ctg 240 Leu ttg 288 Leu gtc gac gcc agc Val Asp Ala Ser ttc cgc tcg ccg Phe Arg Ser Pro gca cgg cag ttg Ala Arg Gin Leu cgg gag gag Arg Giu Giu agc cgg ctc aag Ser Arg Leu Lys cac gcc cgc tcg His Ala Arg Ser ttc acc 336 Phe Thr cac aig His Met gag ctt Giu Leu 130 gtc gga. gtg gac gcg Val Gly Val Asp Ala 115 cgc ccg ccg gtg ccg Arg Pro Pro Val Pro gac gac cac gtg Asp Asp His Val atg ccg gcc 384 Met Pro Ala tgg aac Trp Asn gac ggg acg Asp Giy Thr 140 atg cac cac atc 432 Met His His Ile ttc gag cgc ggc tgg atg tgg atc atc ccg ttc aac aac cac ccc ggg 480 WO 01/44447 WO 0144447PCT/EPOO/12347 53 Phe Giu Arg Gly Trp Met Trp Ile Ile Pro 145 150 Phe Asn Asn His Pro Gly 155 160 gcc acc aac ccg Ala Thr Asn Pro tgc agc gtc ggc Cys Ser Val Gly cag ctc gac gag Gin Leu Asp Giu cgc cgc 528 Arg Arg 175 tcc cac 576 Ser His tac ccc gcc Tyr Pro Ala ccg gac ctg acg Pro Asp Leu Thr gag gag gag ttc GlU Glu Glu Phe gtg gac Val Asp gtg cgc Val Arg 210 ttc ccg gcg gtg Phe Pro Ala Val cgg cag ttg aag Arg Gin Leu Lys gcc cgc agc 624 Ala Arg Ser gag tgg gtg cga Giu Trp Val Arg gac cgc atg cag Asp Arg Met Gin tcc tcg agc cgg 672 Ser Ser Ser Arg acg gtc ggc gag cgc Thr Val Gly Glu Arg 225 tgc ctg Cys Leu atg tcg Met Ser cac gcg gcc ggc ttc His Ala Ala Gly Phe atc 720 Ile 240 gac ccg ctc ttc Asp Pro Leu Phe ctt cgc ggc ctg tcc Leu Arg Gly Leu Ser acc tgc gag atc Thr Cys Glu Ile atc aac 768 Ile Asn 255 ttc gcg 816 Phe Ala gcg ctg tcc tgg Ala Leu Ser Trp 260 cgg ctg atg gcc gcg Arg Leu Met Ala Ala 265 ctg cgc gag gac gac Leu Arg Giu Asp Asp 270 WO 01/44447 WO 0144447PCT/EPOO/12347 54 gtc gag Val Glu tgg aac Trp Asn 290 ttc gcc tac gtg Phe Ala Tyr Val gag gaa ctg gag cag Glu Glu Leu Glu Gin 280 ctg ctg gac 864 Leu Leu Asp gac aag ctg gtc Asp Lys Leu Val aac Asn 295 aac tcc ttc atc Asn Ser Phe Ile ttc tcg cac tac 912 Phe Ser His Tyr ccg ctg tgg aac tcg Pro Leu Trp Asn Ser 305 ttc cgg atc tgg gcc tcg Phe Arg Ile Trp Ala Ser gcc agc Ala Ser gtg atc 960 Val Ile 320 acc ggc 1008 Thr Gly ggc ggc aag cgc Gly Gly Lys Arg ctc aac gca ctg Leu Asn Ala Leu agg acc Arg Thr aag gag Lys Glu gac gac agc Asp Asp Ser tgc cag gcg ctig Cys Gin Ala Leu gac aac ccg tac Asp Asn Pro Tyr ggc ctg 1056 Gly Leu tgg tgt Trp Cys gac ttc tac Asp Phe Tyr gag gcc Glu Ala ttc gac Phe Asp ctc acc gag 1104 Leu Thr Glu ctg tgc Leu Cys 370 gag gcc gtg gac gee Glu Ala Val Asp Ala 375 ggg cac acc acg gcc Gly His Thr Thr Ala gag gag gcc gcg 1152 Glu Glu Ala Ala cgg ctg ctg gag cag cgg gtc cgc gag tcg gac tgg atg ctg ccg gcc 1200 WO 01/44447 WO 0144447PCT/EPOO/12347 55 Arg Leu Leu Glu Gin Arg Val Arg Glu Ser Asp 385 390 395 Trp Met Leu Pro Ala 400 ctg ggc ttc aac Leu Gly Phe Asn gao ccc gac acc cac Asp Pro Asp Thr His 405 atc aac cog aog Ile Asn Pro Thr gcg gac 1248 Ala Asp 415 ccg gag 1296 Pro Glu aag atg aic Lys Met Ile atc gog gag tgg Ile Ala Glu Trp acc ggt cac cac Thr Gly His His atc cgt Ile Arg ctg ctg gcc gcc ago Leu Leu Ala Ala Ser 440 goc gag gag gtc Ala Glu Glu Val gcg gcg atg 1344 Ala Ala Met cgg gtc aag cog taa 1359 Arg Val Lys Pro 450 <,210> <211> 452 <212> PRT <213> Streptomyces aureofaciens <400> Met Phe His Arg Asp Gly Glu Glu Pro Asp Pro Asn Giu Thr Ser Gin 1 5 10 Phe Arg Ile Pro Ser Ile Val Gly Asn Ala Ala Hi-s Phe Phe Arg Gin WO 01/44447 WO 0144447PCT/EPOO/12347 56 Asp Thr Asp Ala Arg Gin Val Thr Val Val Asp Ala Arg Glu Glu 25 Ser Tyr Met Phe His Ala Ala Val Arg Tyr Gly Cys Asp 40 Tyr Tyr Arg Val Glu Asn Ile Glu Phe Asp Asp Gly Gly 55 Ser Gly Ala Asp Gly Ser Thr Val Arg Ala Arg Tyr Leu 70 75 Ser Gly Phe Arg Ser Pro Leu Ala Arg Gin Leu Gly Leu 90 Pro Ser 100 Arg Leu Lys His His Met Val Gly Val Asp Ala Ile Asp 115 120 Glu Leu Arg Pro Pro Val Pro Trp Asn 130 135 Phe Giu Arg Gly Trp, Met Trp Ile Ile 145 150 Ala Thr Asn Pro Leu Cys Ser Val Gly 165 Tyr Pro Ala Arg Pro Asp Leu Thr Pro His Ala Arg Ser Ile Phe Thr 110 Asp His Val Asp Met Pro Ala 125 Asp Gly Thr Met His His Ile 140 Pro Phe Asn Asn His Pro Gly 155 160 Ile Gin Leu Asp Glu Arg Arg 170 175 Glu Glu Glu Phe Arg Ser His WO 01/44447 WO 0144447PCT/EPOO/12347 57 Val Asp Arg 195 Val. Arg Glu 210 Thr Val Gly 225 Asp Pro Leu Ala Leu Ser 180 185 190.

Phe Pro Ala Val Gin Arg Gin Leu Lys Gly Ala Arg Ser 200 205 Trp Val Arg Thr Asp Arg Met Gin Tyr Ser Ser Ser Arg 215 220 Glu Arg Trp Cys Leu Met Ser His Ala Ala Gly Phe Ile 230 235 240 Phe Leu Arg Giy Leu Ser Asn Thr Cys Giu Ile Ile Asn 245 250 255 Trp Arg Leu Met Ala Ala Leu Arg Glu Asp Asp Phe Ala 260 265 270 Phe Ala Tyr Val Giu Giu Leu Giu Gin Gly Leu Leu Asp Val Giu Arg 275 280 Trp Asn Asp Lys Leu Val Asn Asn Ser 290 295 Pro beu Trp Asn Ser Ala Phe Arg Ilie 305 310 Giy Gly Lys Arg Ile Leu Asn Ala Leu 325 Asp Asp Ser His Cys Gin Ala Leu Asp 285 Phe Ile Ser Phe Ser His Tyr 300 Trp Ala Ser Ala Ser Vai Ile 315 320 Thr Arg Thr Lys Giu Thr Gly 330 335 Asp Asn Pro Tyr Pro Gly Leu WO 01/44447 WO 0144447PCT/EPOOI12347 58 350 Leu Thr Glu Trp Cys Pro 355 Leu Cys Giu 370 Leu Asp Phe Tyr Lys Glu Ala Phe Asp 360 Gly His Thr Thr Ala Ala Val Asp Giu Giu Ala Ala Leu Leu Giu Gin Arg Val Arg Glu Ser Asp 390 395 Trp Met Leu Pro Leu Gly Phe Asn Pro Asp Thr His His Ile 410 Asn Pro Thr Ala Asp 415 Lys Met Ilie Arg Ilie Ala Glu Trp 420 Ala Thr Gly His His Arg Pro Giu 425 430 Ala Glu Giu Val Arg Ala Ala Met 445 Ile Arg Glu 435 Leu Leu Ala Ala Ser 440 Arg Val Lys Pro .450 <210> <211> <212> <213> <220> 16 1476

DNA

Amycolatopsis mediterranei WO 01/44447 WO 0144447PCT/EPOOI12347 -59- <221> CDS <222> (1476) <400> 16 atg tcg gtc gaa Met Ser Val Glu 1 gac tte gac gtg gtg Asp Phe Asp Val Val 5 gcg gge ggc ggg Ala Gly Gly Gly ccg ggt 48 Pro Gly gtg ctg 96 Val Leu ggt Leg acg Gly Ser Thr gec acg ctg Ala Thr Leu gtg gce Val Ala atg cag gga cac Met Gin Gly His etg etg Leu Leu aaa gag gtt tte Lys Glu Val Phe egg tat cag ate Arg Tyr Gin Ile gag teg ctg 144 Glu Ser Leu ctg Leu ccc gec acg gtg cac Pro Ala Thr Val His ctg gcc aat gcc ggg Leu Ala Asn Ala Gly ggc gtg Gly Val tgc cgg atg Cys Arg Met gge ate tee gac 192 Gly Ile Ser Asp tte eeg atc aag Phe Pro Ile Lys gge ggc acg etc egc 240 Gly Gly Thr Phe Arg tgg ggc gee egg Trp Gly Ala Arg ccg gag ceg tgg acg Pro Glu Pro Trp Thr Leg acg tcg cae gee Ser Thr Ser His Ala eac ttc His Phe ggc ate teg gee 288 Gly Ile Ser Ala aag atg gee gge Lys Met Ala Gly tac eag gte gag Tyr Gin Val Glu egg geg Arg Ala egg 336 Arg WO 01/44447 WO 0144447PCT/EPOO/12347 ttc gac gag atg ctg ctg aac Phe Asp Glu Met Leu Leu Asn 115 gcc aag cgc aag ggc Ala Lys Arg Lys Gly 125 gtg gic gtg 384 Val Val Val ogg gag Arg Glu 130 acc ggt Thr Gly 145 ggg tgc gcg gtc Gly Cys Ala Val acc gat Thr Asp 135 gtg gtg gaa gac ggc gag cgg gtc Val Val Glu Asp Gly Glu Arg Val 140 gcg cgg tac acc Ala Arg Tyr Thr 150 gat ccc gac ggc acc Asp Pro Asp Gly Thr 155 gag cgg gaa gtg tog Glu Arg Glu Val Ser 160 gcg cgg ttc gtg atc Ala Arg Phe Val Ile 165 gac gcg tcg ggc aac Asp Ala Ser Gly Asn 170 aag agc cgg Lys Ser Arg cto tao acc Leu Tyr Thr 175 agc ctc gcg Ser Leu Ala 190 aag gtc ggo ggt Lys Val Gly Gly 180 ctg tto ggt tac Leu Phe Gly Tyr 195 tog cgg aac tat tcg gag ttc ttc cgc Ser Arg Asn Tyr Ser Glu Phe Phe Arg 185 ttc gag ggt ggc Phe Glu Gly Gly 200 aag cgg ctg ccc Lys Arg Leu Pro gag cog gto too Glu Pro Val Ser 205 ggg aac Gly Asn 210 ato otg Ile Leu agt gtg gc Ser Val Ala 215 ttc gao ago ggc tgg Phe Asp Ser Gly Trp 220 ttc tgg tao ato 672 Phe Trp, Tyr Ile WO 01/44447 WO 0144447PCT/EPOOI12347 61 Ctg agc gac acg Leu Ser ASP Thr ctg acc agc gtc Leu Thr Ser Val 230 cag ggt gac cgg Gin Gly Asp Arg ggC gcg Gly Ala 235 gtg gtg cgc cgg Val Val Arg Arg gag 720 Glu 240 gac gcc gag aag Asp Ala Glu Lys aag gcc ctc aac Lys Ala Leu Asn acg ctg Thr Leu 255 atc gcc gag Ile Ala Glu ccg ctg atc tcg Pro Leu Ile Ser tac ctc gcg gac Tyr Leu Ala Asp acc cgg 816 Thr Arg gtg acg Val Thr ggc cgg tac ggg Gly Arg Tyr Gly ctg cgc gtc cgc Leu Arg Val Arg gac tac tee 864 Asp Tyr Ser tac cag Tyr Gin 290 cag gag ace tac Gin Giu Thr Tyr egg ccg Arg Pro ggc atg Gly Met ctg gte ggc gac 912 Leu Vai Gly Asp gcg tgt ttc gtg Ala Cys Phe Val ceg gtg ttc tc Pro Val Phe Ser ggt gtg cac ctg Gly Val His Leu gcg 960 Ala 320 ace tac age gcg Thr Tyr Ser Ala ggc gac etg gac Gly Asp Leu Asp etc gcg gce cgg Leu Ala Ala Arg ate aae agc gtc- Ile Asn Ser Val ctc gee 1008 Leu Ala 335 egg tat 1056 Arg Tyr gag aag acc gcg ctg Giu Lys Thr Ala Leu aac gag tte gag ctg Asn Giu Phe Glu Leu WO 01/44447 WO 0144447PCT/EPOO/12347 62 350 cgc cgt Arg Arg atg aac Met Asn 370 gag tac ggc gtg ttc Glu Tyr Gly Val. Phe 355 gag ttc ctc gtg Glu Phe Leu Val tcc ttc tac cag 1104 Ser Phe Tyr Gin 365 aag aag gtc acg 1152 Lys Lys Val Thr gtg aac gag gag Val Asn Glu Giu tac ttc tgg cag Tyr Phe Trp Gin aac cag agc acc Asn Gin Ser Thr gac gtc Asp Val 390 acc gcg Thr Ala gag tcg ttc Giu Ser Phe gag ctg atc ggc Giu Leu Ile Gly gga 1200 Gly 400 gtg tcg tcc ggg Val Ser Ser Gly ctg acg Leu Thr gcc gac cgc aic Ala Asp Arg Ile gcc gcg 1248 Ala Ala 415 ggg gac 1296 Gly Asp cgc agt. gcc Arg Ser Ala ttc gcc gcg gcg Phe Ala Ala Ala gac gag atg gcg Asp Giu Met Ala ggc gac Gly Asp atg cag Met Gin 450 atg gtg ccg atg Met Val Pro Met aag tcg acg gtg Lys Ser Thr Val cag cag Gin Gin gcg 1344 Ala gaa gcg ggc cag gtg Giu Ala Gly Gin Val 455 cag atg Gin Met aag gcg ctg Lys Ala Leu 460 ctc ggc gag gac 1392 Leu Gly Glu Asp WO 01/44447 WO 0144447PCT/EPOO/12347 63 gaa ccc gag ctg Glu Pro Glu Leu ccc ctg ttc ccc ggt Pro Leu Phe Pro Gly 470 ctg cct cac cac cct Leu Pro His His Pro 490 ggc ctg gtg aec tcg ccc 1440 Gly Leu Val Thr Ser Pro 475 480 gaa cgg atg aag tgg Giu Arg Met Lys Trp 485 gcg tga Ala 1476 <210> 17 <211> 491 <212> PRT <213> Axycoiatopsis mediterranei <400> 17 Met Ser Val Giu Asp Phe Asp Val Val Val Ala Gly Gly Gly Pro Gly Gly Ser Thr Ala Thr Leu Val Ala Met Gin Gly His Arg Val Leu Glu Ser Leu Leu Leu Glu Lys Glu Val Phe Pro Arg Tyr Gin Ilie Leu Pro Ala Thr Val His Gly Val 55 Cys Arg Met Leu Ilie Lys Arg Gly 75 Gly Ile Ser Asp Leu Ala Asn Ala Gly Phe Pro Gly Thr Phe Arg WO 01/44447 WO 0144447PCT/EPOO/12347 64 Trp Gly Ala Arg Pro Glu Pro Trp Thr Phe His Phe 90 Lys met Ala Gly Ser Thr Ser His Ala Tyr Gin Val 100 105 Phe Asp Glu Met Leu Leu Asn Asn Ala Lys Arg Lys 115 120 Arg Glu Gly Cys Ala Val Thr Asp Val Val Giu Asp 130 135 140 Thr Gly Ala Arg Tyr Thr Asp Pro Asp Gly Thr Giu 145 150 155 Ala Arg Phe Val Ile Asp Ala Ser Gly Asn Lys Ser 165 170 Lys Val Gly Gly Ser Arg Asn Tyr Ser Glu Phe Phe 180 185 Leu Phe Gly Tyr Phe Glu Gly Gly Lys Arg Leu Pro 195 200 Gly Asn Ile Leu Ser Val Ala Phe Asp Ser Gly Trp, 210 215 220 Pro Leu Ser Asp Thr Leu Thr Ser Val Giy Ala Val 225 230 235 Gly Ile Ser Ala Glu Arg Ala Arg 110 Gly Val Val Val 125 Gly Giu Arg Val Arg Giu Val Arg Leu Tyr Thr 175 Arg Ser Leu Ala 190 Giu Pro Val Ser 205 Phe Trp Tyr Ile Val Arg Arg Glu 240 WO 01/44447 WO 0144447PCT/EPOO/12347 65 Asp Ala Giu Lys Gin Gly Asp Arg Giu 250 Lys Ala Leu Asn Thr Leu 255 Ile Ala Glu Val Thr Thr 275 Pro Leu Ile Ser Tyr Leu Ala Asp Ala Thr Arg 270 Asp Tyr Ser Gly Arg Tyr Gly Leu Arg Val Arg Tyr Gin 290 Gin Glu Thr Tyr Arg Pro Gly Met Leu Val Gly Asp Ala Cys Phe Val Pro Val Phe Ser Ser Gly Val His Leu Ala 315 320 Thr Tyr Ser Ala Leu Ala Ala Arg Ile Asn Ser Gly Asp Leu Arg Arg Giu 355 Met Asn Val 370 Gin Asn Gin 385 Asp 340 Giu Lys Thr Ala Asn Glu Phe Glu Val Leu Ala 335 Leu Arg TPyr 350 Phe Tyr Gin Tyr Gly Val Phe Asn Glu Giu Ser 375 Tyr 360 Glu Phe Leu Val Tyr Phe Trp Gin Ala 380 Lys Lys Val Thr Ser Thr Asp Val Glu Ser Phe Vai Glu Leu Ile Gly Gly 390 395 400 WO 01/44447 WO 0144447PCT/EPOO/12347 66- Val Ser Ser Gly Glu Thr Ala Leu Thr 405 Ala Ala Asp Arg Ile 410 Ala Ala 415 Arg Ser Ala Phe Ala Ala Ala Asp Giu Met Ala Gly Gly Asp 430 Gly Asp Asn 435 Met Val Pro Met Phe Lys Ser Thr Val 440 Val Gin Gin Ala 445 Leu Gly Glu Asp Met Gin 450 Glu Ala Gly Gin Val Gin 455 Met Lys Ala Ala Giu Pro Glu Leu Pro Leu Phe Pro Giy Gly 465 470 475 Giu Arg Met Lys Trp Leu Pro His His Pro Ala 485 490 <210> 18 <211> 702 <212> DNA <213> Escherichia coli Leu Val Thr Ser Pro 480 <220> <221> CDS <222> (702) <400> 18 atg aca acc tta agc tgt aaa gtg acc tcg gta gaa. gct ate acg gat 48 WO 01/44447 WO 0144447PCTIEPOOI12347 67 Met Thr Thr Leu 1 Ser Cys Lys Val Thr 5 Ser Val Glu Ala Ile Thr Asp 10 acc gta tat Thr Val Tyr gtc cgc atc gtg Val Arg Ile Val cca gac Pro Asp gcg geC ttt Ala Ala Phe tct ttt cgt 96 Ser Phe Arg aaa cgt ccg 144 Lys Arg Pro gct ggt Ala Gly ttc tca Phe Ser tat ttg atg gta Tyr Leu Met Val atg gat gag cgc Met Asp Glu Arg gac Asp atg gct tcg acg Met Ala Sei Thr gat gaa aaa ggg Asp Glu Lys Gly atc: gag ctg cat 192 Ile Glu Leu His ggc gct tct gaA Gly Ala Ser Glu aac ctt tac gcg Asn Leu Tyr Ala gca. gtc atg gac Ala Val Met Asp cgc 240 Arg atc ctc aaa gat Ile Leu Lys Asp cat caa atc gtg gtc His Gin Ile Val Val att ccc cac gga gaa gcg 286 Ile Pro His Gly Giu Ala tgg ctg cgc Trp Leu Arg gat gat gaa gag cgt Asp Asp Giu Glu Arg 100 tct tat gcc cgc tcg Sex Tyr Ala Arg Ser 120 atg att ttg att Met Ile Leu Ile gcg ggc ggc 336 Ala Gly Gly 110 ttg gcg cgt 384 Leu Ala Arg acc ggg ttc Thr Gly Phe 115 att ttg ctg aca. gcg Ile Leu Leu Thr Ala 125 WO 01/44447 WO 0144447PCT/EPOOI12347 68 aac cca Asn Pro 130 aac cgt gat atc acc att tac tgg ggc Asn Arg ASP Ile Thr Ile Tyr Trp Gly 135 ggg cgt gaa gag cag 432 Gly Arg Glu Giu Gin 140 cat ctg tat gat ctc tgc His Leu Tyr Asp Leu Cys 145 150 ggt ctg caa gtg gtg ccg Gly Leu Gin Val. Val Pro .165 gag ctt gag gcg Giu Leu Giu Ala ctt tcg ttg Leu Ser Leu gtg gtt gaa Val Val Glu ccg gaa. gcg Pro Glu Ala aag cat cct 480 Lys His Pro 160 ggc tgg cgt 528 Gly Trp Arg 175 cac ggt acg 576 His Gly Thr 190 ggg cgt act ggc acc Gly Arg Thr Gly Thr 180 gtg tta acg gcg gta ttg cag gat Val Leu Thr Ala Val Leu Gin Asp 185 ctg gca gag Leu Ala Giu 195 cat gat atc tat att gcc gga cgt ttt gag atg gcg aaa 624 His Asp Ile Tyr Ile Ala Gly Arg Phe Giu Met Ala Lys 200 205 att gcc Ile Ala 210 cgc gat ctg ttt tgc Arg Asp Leu Phe Cys 215 agt gag cgt aat gcg Ser Giu Arg Asn Ala 220 cgg gaa gat cgc -672 Arg Giu Asp Arg c tg Leu 225 ttt ggc gat gcg ttt gCa ttt atc tga 702 Phe Gly Asp Ala Phe Ala Phe Ilie 230 WO 01/44447 WO 0144447PCT/EPOO/1 2347 69 <210> 19 <211> 233 <212> PRT <213> Escherichia coli <400> 19 Met Thr Thr Leu Ser Cys Lys Val Thr Val Glu Ala Ile Thr Asp Thr Val Tyr Arg Val Arg Ile Val Pro Asp Ala Ala Phe Ser Phe Arg Ala Gly Gin Tyr Leu Met Val Val Met Asp Glu Arg Lys Arg Pro Phe Ser met Ala Ser Thr Pro Asp Glu Lys Gly Ile Glu Leu His Gly Ala Ser Glu Ile Asn Leu Tyr Ala Lys 75 Ala Val Met Asp Arg Glu Ala Ile Leu Lys Asp Gin Ile Val Vai Asp Ile Pro His Gly Trp Leu Arg Asp 100 Thr Gly Phe Ser 115 Asp Glu Glu Arg Pro Met 105 Tyr Ala Arg Ser Ile Leu Ile Leu Ile Ala Gly Gly 110 Leu Thr Ala 125 Leu Ala Arg WO 01/44447 WO 0144447PCT/EPOO/12347 70 Asn Pro 130 Asn Arg Asp Ile Thr Ile Tyr 135 Trp Gly Gly 140 Arg Giu Glu Gin Leu Tyr Asp Leu Glu Leu Giu Ala Ser Leu Lys His Gly Leu Gin Val Pro Val Val Glu Pro Glu Ala Gly Trp, Arg 175 Gly Arg Thr Leu Ala Giu 195 Thr Val Leu Thr Val Leu Gin His Asp Ile Tyr Ala Gly Arg Phe Asp His Gly Thr 190 Glu Met Ala Lys 205 Arg Giu Asp Arg Ile Ala 210 Leu Phe 225 Arg Asp Leu Phe Ser Glu Arg Asn Ala 220 Gly Asp Ala Phe 230 Ala Phe Ile <210> <211> 906 <212> DNA <213> rat <220> <221> CDS <222> WO 01/44447 WO 0144447PCTIEPOO/12347 -71 <400> atg ggg gcc cag ctg agc acg ttg agc Met Gly Ala Gin Leu Ser Thr Leu Ser 1 5 gtg gta ctc tcc Val Val Leu Ser ccg gtc 48 Pro Val tca ccg 96 Ser Pro tgg ttc gtc Trp Phe Val tac agc ctc ttc atg Tyr Ser Leu Phe Met ctg ttt cag cgc Leu Phe Gin Arg gcc atc Ala Ile gac aag Asp Lys ctc gag aac ccc Leu Giu Asn Pro gac atc Asp Ile aag tac cct Lys Tyr Pro cgg ctc atc 144 Arg Leu Ile gag att atc agc Gu Ile Ile Ser gac act cgg cgc Asp Thr Arg Arg cga ttt gca ctc 192 Arg Phe Ala Leu tcg ccc cag cac Ser Pro Gin His ctg ggc ctt cct.

Leu Gly Leu Pro ggc cag cac atc tac 240 Gly Gin His Ile Tyr Ctc tcc acc agg Leu Ser Thr Arg gtg tct agt gat Val Ser Ser Asp 100 gat ggc aac ttg Asp Giy Asn Leu gtc att cgt ccc tac acc cct 288 Vai Ile Arg Pro Tyr Thr Pro gat gac aag ggc ctt Asp Asp Lys Gly Leu 105 gtg gac ttg gtg gtc aag Vai Asp Leu Val Val Lys 11 0 gtt 336 Val1 WO 01/44447 WO 0144447PCT/EPOO/12347 -72 tac ttc Tyr Phe gac acg cat ccc Asp Thr His Pro ttt cca gct gga Phe Pro Ala Gly ggg aaa at~g tct 384 Gly Lys Met Ser 125 gaa ttc cgg ggc 432 Giu Phe Arg Giy cag tac ct~g Gin Tyr Leu 130 gaa aac atg Giu Asn Met att gga gac ac Ile Gly Asp Thr att Ile 140 aat ggg ct~a ctg Asn Gly Leu Leu gtc tac cag ggc aaa Val Tyr Gin Gly Lys aag ttc gcc at~c Lys Phe Ala Ile cgt 480 Arg 160 gca gac aag aag Ala Asp Lys Lys aac cct gtt gt~c Asn Pro Val Val acg gtg aag tct Thr Val Lys Ser gta ggc 528 Val Gly 175 atic cga 576 Ile Arg atg atit gca Met Ile Ala gga Gly 180 ggg aca ggc atc Giy Thr Giy Ile cca atg ctg cag Pro Met Leu Gin gcc gt~c Ala Val gcc aac Ala Asn 210 aag gac ccg aac Lys Asp Pro Asn cac act gtg tgc His Thr Val Cys tat Tyr 205 ct~g ctc tt~c 624 Leu Leu Phe cag tcc gag aaa Gin Ser Glu Lys atic ct~g ctig cgg Ilie Leu Leu Arg gag ctg gag gaa 672 Giu Leu Glu Glu ctg agg aac gaa cat tct Leu Arg Asn Giu His Ser tct cgc Ser Arg tt~c aag ctc Phe Lys Leu tgg tac aca gtg gac 720 Trp Tyr Thr Vai Asp WO 01/44447 WO 0144447PCT/EPOO/12347 -73 aaa gcc ccc gat Lys Ala Pro Asp tgg gac tat agc Trp Asp Tyr Ser ggc ttc gtg aat Gly Phe Val Asn gag gag 768 Glu Giu 255 ata ctg 816 Ile Leu atg atc agg Met Ile Arg cat ctt cca cct His Leu Pro Pro ggg gag gag aca Gly Glu GlU Thr atg tgt Met Cys ccc cca ccg atg Pro Pro Pro Met cag ttt gcc tgt Gin Phe Ala Cys cca aac ctg 864 Pro Asn Leu gag cgt GlU Arg 290 gtg ggc cat ccc aag Val Gly His Pro Lys 295 gag cga Glu Arg tgc ttc acc Cys Phe Thr 300 ttc tga Phe <210> 21 <211> 301 <212> PRT <213> rat <400> 21 Met Gly Ala Gin Leu Ser Thr Leu Ser Arg Val Val Leu Ser Pro Val 1 5 10 Trp Phe Val Tyr Ser Leu Phe Met Lys Leu Phe Gin Arg Ser Ser Pro 25 WO 01/44447 WO 0144447PCT[EPOO/12347 -74- Ala Ilie Thr Leu Giu Asn Pro Asp Ile Lys Tyr Pro Leu Arg Leu Ile 40 Asp Lys Giu Ilie Ile Ser His Asp Thr Arg Arg Phe Arg Phe Ala Leu 55 Pro Ser Pro Gin His Ile Leu Gly Leu Pro Ile Gly Gin His Ile Tyr 70 75 Leu Ser Thr Arg Ilie Asp Gly Asn Leu Val Ile Arg Pro Tyr TIhr Pro 90 Val Ser Ser Asp Asp Asp Lys Giy Leu Val Asp Leu Vai Val Lys Val 100 105 110 Tyr Phe Lys Asp Thr His Pro Lys Phe Pro Ala Gly Gly Lys Met Ser 115 120 125 Gin Tyr Leu Giu Asn Met Asn Ile Gly Asp Thr Ile Giu Phe Arg Giy 130 135 140 Pro Asn Gly Leu Leu Val Tyr Gin Giy Lys Gly Lys Phe Ala Ilie Arg 145 150 155 160 Ala Asp Lys Lys Ser Asn Pro Val Val Arg Thr Val Lys Ser Val Giy 165 170 175 Met Ile Ala Gly Gly Thr Giy Ilie Thr Pro Met Leu Gin Val Ile Arg 180 185 190 WO 01/44447 WO 0144447PCT/EPOO/12347 Ala Val Leu Lys Asp Pro Asn 195 Asp His Thr Val Cys Tyr Leu Leu Phe 200 205 Ala Asn 210 Gin Ser Giu Lys Ile Leu Len Arg Pro Gin Leu Giu Glu 220 Arg Asn Giu His Ser Arg Phe Lys rrp Tyr Thr Val Lys Ala Pro Asp Trp Asp Tyr Ser Gly Phe Val Met Ile Arg Met Cys Giy 275 His Leu Pro Pro Gly Glu Glu Thr Asn Giu Giu 255 Leu Ile Leu 270 Pro Asn Leu Pro Pro Pro Met Gin Phe Ala Cys Giu Arg 290 <210> 2 <21i> 2( <212> Dl <213> R~ Vai Gly His Pro Giu Arg Cys Phe Thr Phe 300 049 41A ibbit <220> <221> CDS WO 01/44447 WO 0144447PCT/EPOO/12347 76 <222> (2049) <400> 22 ctg atc aac atg Leu Ile Asn Met 1 gcg gac tcc cac ggg Ala Asp Ser His Gly 5 cag gag gcg tcg gtc Gin Glu Ala Ser Val acc ggc gcc acc Thr Gly Ala Thr atg cct 48 Met Pro gtg gtt 96 Val Val gaa gcg gcg Glu Ala Ala ttc agc atg acg Phe Ser Met Thr ctg ttc Leu Phe aag aaa Lys Lys ctc atc gtg ggg Leu Ile Val Gly atc acc tac tgg Ile Thr Tyr Trp ctc ttc aga 144 Leu Phe Arg aag gag gaa gtg Lys Glu Glu Val gag ttc acc aag Giu Phe Thr Lys cag gec ccg aeg 192 Gin Ala Pro Thr tcg tca gtg aag Ser Ser Val Lys agc agc ttc gtg Ser Ser Phe Val aag atg aag aag acg 240 Lys Met Lys Lys Thr ggc cgg aac atc Giy Arg Asn Ile gtg gtc ttc tac ggc Val Val Phe Tyr Gly cag acg ggc acc Gin Thr Gly Thr cac cgc tac ggg His Arg Tyr Giy 110 gcc gag 288 Aia Glu atg cgg 336 Met Arg gag ttt gcc aac Glu Phe Ala Asn 100 cgc ctg tcc aag gat gcc Arg Leu Ser Lys Asp Aia 105 WO 01/44447 WO 0144447PCT/EPOO112347 77 ggc atg Gly Met gcc gac ccc gag Ala Asp Pro Glu gag tac gac ctg gcc Glu Tyr Asp Leu Ala 120 ctg gcc gtc ttc tgc Leu Ala Val Phe Cvs gac ctg agc agc 384 Asp Leu Ser Ser 125 atg gcc acc tac 432 Met Ala Thr Tyr ctg ccc gag atc aac aac Leu Pro Giu Ile Asn Asn 130 gag ggg gac ccc Glu Gly Asp Pro ac c Thr 150 gac aac gcc cag Asp Asn Ala Gin ttc tac gac tgg Phe Tyr Asp Trp ctg 480 Leu 160 cag gag acc gac Gin Glu Thr Asp gac ctc tcg ggg Asp Leu Ser Gly aag tac gcg gtg Lys Tyr Ala Val ttt ggc 528 Phe Gly 175 tac gtg 576 Tyr Val ctc ggg aac Leu Gly Asn acc tac gag cac Thr Tyr Glu His aac gcc atg ggc Asn Ala Met Gly gac cag Asp Gin atg ggc Met Gly 210 ctg gag cag ctt ggc Leu Glu Gin Leu Gly .200 gcc cag cgc atc Ala Gin Arg Ile ttc Phe 205 gag ctg ggc 624 Giu Leu Gly gac gat gat gca aac Asp Asp Asp Ala Asn 215 ctg gag gag gac ttc Leu Glu Glu Asp Phe 220 atc acg tgg cgg 672 Ile Thr Trp Arg gag cag ttc tgg ccg gcg gtg tgc gag cac ttc ggt gtg gag gcc aca 720 WO 01/44447 WO 0144447PCT/EPOO/12347 78 Giu Gin Phe Trp Pro Ala Val Cys Glu His 225 230 Gly Val Glu Ala Thr 240 gga gag gag too Gly Glu Giu Ser agc att ogg cag tac Ser Ile Arg Gin Tyr 245 ctc gtg ttg cac Leu Val Leu His aoa gao 768 Thr Asp 255 aag agc 816 Lys Ser ato gac gtg Ile Asp Val aag gtg tao cag Lys Val Tyr Gin gag atg ggc ogc Glu Met Gly Arg tac gag Tyr Giu acg gtc Thr Vai 290 cag aaa coo ccc Gin Lys Pro Pro gat goc aag aat Asp Ala Lys Asn ttc otg gcc 864 Phe Leu Ala aco aco aac cgg Thr Thr Asn Arg ctg aac cag ggc Leu Asn Gin Gly gag cgc cac ctc 912 Glu Arg His Leu cac ctg gag ctg His Leu Giu Leu ato tog gao tco Ile Ser Asp Ser atc agg tat gag Ile Arg Tyr Giu tot 960 Ser 320 ggg gao cac gtg Gly Asp His Vai cag ctg ggg gag Gin Leu Giy Glu 340 got gtg tat cog goc aao Ala Val Tyr Pro Ala Asn 325 330 atc otg ggt goc gao otg Ile Leu Gly Ala Asp Leu 345 gao tot gcc oto Asp Ser Ala Leu gao gtc gtc atg ASP Val Val Met 350 gtc aac 1008 Val Asn 335 too otg 1056 Ser Leu WO 01/44447 WO 0144447PCT/EPOO/12347 79 aac aac Asn Asn act tcC Thr Ser 370 gat gag gag tcc Asp Giu Giu Ser aag aag cac cca Lys Lys H-fis Pro ttc ccc tgc ccc 1104 Phe Pro Cys Pro 365 atc: acc aac ccg 1152 Ile Thr Asn Pro tac cgc acg gcc Tyr Arg Thr Ala acc tac tac ctg gac Thr Tyr Tyr Leu Asp 380 cgc acc aac gtg Arg Thr Asn Val tac gag ctg gcc cag Tyr Glu Leu Ala Gin 395 tac gcc gcc gac Tyr Ala Ala Asp ccc 1200 Pro 400 gct gag cag gag cag Ala Glu Gin Glu Gin 405 ctg cgc aag atg gcc Leu Arg Lys Met Ala 410 tca tcc tcg Ser Ser Ser ggc gag ggc 1248 Gly Glu Giy 415 aag gag ctg Lys Glu Leu gcC atc ctc Ala Ilie Leu 435 ctg agc tgg gtg gta Leu Ser Trp Val Val 425 gag gcg cgg agg cac atc ctg 1296 Giu Ala Arg Arg His Ile Leu 430 caa gac tac ccg tcc ctg cgg ccg ccc atc Gin Asp Tyr Pro Ser Leu Arg Pro Pro Ile 440 445 gac cac ctg 1344 Asp His.Leu tgt gag Cys Giu 450 ctg ctg ccc cgg otg Leu Leu Pro Arg Leu 455 cag gcg ogo tac tao tcc atc goc too 1392 Gin Ala Arg Tyr Tyr Ser Ilie Ala Ser 460 tcc tcc aag gtc cac ccc aac toc gtg oac atc tgc gcc gtg gcc gtg 1440 WO 01/44447 WO 0144447PCT/EPOO/12347 Ser Ser Lys Val His 465 Pro Asn Ser Val His 470 Cys Ala Val Ala gag tac gag acc Glu Tyr Glu Thr gcc ggc cgc ctc Ala Gly Arg Leu aac aaa ggc gtg gcc Asn Lys Gly Val Ala agc 1488 Ser tgg ctg Cgg Trp Leu Arg aag gag ccg gcc Lys Glu Pro Ala gag aat Glu Asn ggC ggC Gly Gly gcc ctg 1536 Ala Leu gtg ccc Val Pro acc acg Thr Thr 530 ttc gtg cgc aag Phe Val Arg Lys cag ttc cgc ctg Gln Phe Arg Leu ttc aag gcc 1584 Phe Lys Ala ccg gtc atc atg Pro Val Ile Met ggc ccc ggc acc ggc Gly Pro Gly Thr Gly 540 gtg gcc ccc ttc 1632 Val Ala Pro Phe a tc I le 545 ggc ttt atc cag Gly Phe Ile Glri gag cgg gcc tgg ctg Glu Arg Ala Trp Leu cgg cag Arg Gin 555 cgg cgc Arg Arg cag ggc aag Gln Gly Lys gaa 1680 Glu 560 gac 1728 Asp gtg ggc gag acg Val Gly Glu Thr ctg tac tac ggc Leu Tyr Tyr Gly gcg gcc Ala Ala tac ctg tac cgc Tyr Leu Tyr Arg 580 gag gag ctc gcc ggc Glu Glu Leu Ala Gly 585 ttc caa aag gac ggc Phe Gln Lys Asp Gly 590 acg ctc 1776 Thr Leu WO 01/44447 WO 0144447PCT/EPOO/12347 81 agc cag Ser Gln gtg cag Val Gin 610 aac gtg gcc ttc Asn Vai Ala Phe tcc cgc gag cag gcc Ser Arg Glu Gin Ala 600 aag gtc tac 1824 Lys Val Tyr cac ttg ctg agg His Leu Leu Arg gac aag gag cac Asp Lys Glu His tgg cgg ctc atc 1872 Trp Arg Leu Ilie gag ggg ggc gcc Glu Gly Gly Ala atc taC gtg tgc Ile Tyr Val. Cys ggg gac Gly Asp 635 atc gtg Ile Val.

gct cgg aac Ala Arg Asn atg 1920 Met 640 ggg 1968 Gly gcc agg gac gtg Ala Arg Asp Val.

aac acc ttc tac Asn Thr Phe Tyr gcc gag Ala Giu gcc atg gag Ala Met Glu gcg cag gcc gtg Ala Gin Aia Val gac tac gtg aag aag ctc Asp Tyr Val Lys Lys Leu 665 670 atg acc 2016 Met Thr aag ggc cgc tac Lys Giy Arg Tyr 675 tcc ctg gac gtg Ser Leu Asp Val 680 tgg agc tag Trp, Ser 2049 <210> <211> <212> <213> 23 682

PRT

Rabbit WO 01/44447 WO 0144447PCT/EPOO/12347 -82 <400> 23 Leu Ile 1 Glu Ala ksn Met Ala Asp Ser His 5 Ala Ala Leu Phe Ser Lys Lys Lys Leu Gin Giu Ala Ser Ile Val Gly Leu 40 Glu Val Pro Glu Gly Asp Thr Gly Ala Thr Met Pro 10 Val Phe Ser Met Thr Asp Val Val 25 Ile Thr Tyr Trp Phe Leu Phe Arg Phe Thr Lys Ile Gin Ala Pro Thr Glu Ser Ser Ser Val Lys Glu Ser Ser Phe Val Giu Lys 70 75 Gly Arg Asn Ile Vai Val Phe Tyr Gly Ser Gin Thr 90 Glu Phe Ala Asn Arg Leu Ser Lys Asp Ala His Arg 100 105 Gly Met Ala Ala Asp Pro Glu Giu Tyr Asp Leu Ala 115 120 Leu Pro Glu Ile Asn Asn Ala Leu Ala Val Phe Cys 130 135 140 Gly Giu Gly Asp Pro Thr Asp Asn Ala Gin Asp Phe Met Lys Lys Thr Gly Thr Ala Glu Tyr Gly Met Arg 110 Asp Leu Ser Ser 125 Met Ala Thr Tyr Tyr Asp Trp Leu WO 01/44447 WO 0144447PCT/EPOO/12347 83 145 150 155 160 Gin Giu Thr Asp Val Asp Leu Ser Gly Val Lys Tyr Ala Val Phe Gly 165 170 175 Leu Gly Asn Lys Thr Tyr Glu His Phe Asn Ala Met Gly Lys Tyr Val 180 185 190 Asp Gin Arg Leu Giu Gin Leu Gly Ala Gin Arg Ile Phe Giu Leu Gly 195 200 205 Met Gly Asp Asp Asp Ala Asn Leu Giu Giu Asp Phe Ile Thr Trp Arg 210 215 220 Giu Gin Phe Trp Pro Ala Val Cys Glu His Phe Gly Val Glu Ala Thr 225 230 235 240 Gly Glu Giu Ser Ser Ile Arg Gin Tyr Giu Leu Val Leu His Thr Asp 245 250 255 Ile Asp Val Ala Lys Val Tyr Gin Gly Giu Met Gly Arg Leu Lys Ser 260 265 270 Tyr Glu Asn Gin Lys Pro Pro Phe Asp Ala Lys Asn Pro Phe Leu Ala 275 280 285 Thr Val Thr Thr Asn Arg Lys Leu Asn Gin Gly Thr Glu Arg His Leu 290 295 300 Met His Leu Giu Leu Asp Ile Ser Asp Ser Lys Ile Arg Tyr Giu Ser WO 01/44447 WO 0144447PCT/EPOO/12347 -84 305 Giy Asp His Gin Leu Gly Asn Asn Leu 355 Thr Ser Tyr 370 Pro Arg Thr 385 Ala Giu Gin Lys Glu Leu Ala Ilie Leu 435 Cvs Glu Leu 310 315 320 Val Ala Val Tyr Pro Ala Asn Asp Ser Ala Leu Val Asn 325 330 335 Giu Ilie Leu Gly Ala Asp Leu Asp Val Val Met Ser Leu 340 345 350 Asp Giu Giu Ser Asn Lys Lys His Pro Phe Pro Cys Pro 360 365 Arg Thr Ala Leu Thr Tyr Tyr Leu Asp Ile Thr Asn Pro 375 380 Asn Val Leu Tyr Giu Leu Ala Gin Tyr Ala Ala Asp Pro 390 395 400 Giu Gin Leu Arg Lys Met Ala Ser Ser Ser Gly Giu Gly 405 410 415 Tyr Leu Ser Trp Val Val Glu Ala Arg Arg His Ile Leu 420 425 430 Gin Asp Tyr Pro Ser Leu Arg Pro Pro Ile Asp His Leu 440 445 Leu Pro Arg Leu Gin Ala Arg Tyr Tyr Ser Ile Ala Ser 455 460 Val His Pro Asn Ser Val His Ilie Cys Ala Val Ala Val 450 Ser Ser Lys WO 01/44447 WO 0144447PCT/EPOO/12347 465 470 475 Giu Tyr Giu Thr Lys Ala Gly Arg Leu Asn Lys 485 490 Trp Leu Arg Ala LYS Giu Pro Ala Gly Giu Asn 500 505 Val Pro Met Phe Val Arg Lys Ser Gin Phe Arg 515 520 Thr Thr Pro Val Ile Met Val Gly Pro Gly Thr 530 535 480 Gly Val Ala Thr Ser 495 Gly Gly Arg Ala Leu 510 Leu Pro Phe LYS Ala 525 Val1Ala Pro Phe Ile Gly Phe Ile Gin Glu Arg Ala Trp, Leu Arg Gin Gin Gly Lys Giu 545 550 555 560 Val Gly Glu Thr Leu Leu Tyr Tyr Gly Cys Arg Arg Ala Ala Glu Asp 565 570 575 Tyr Leu Tyr Arg Glu Glu Leu Aia Gly Phe Gin Lys Asp Giy Thr Leu 580 585 590 Ser Gin Leu Asn Val Ala Phe Ser Arg Glu Gin Ala Gin Lys Val Tyr 595 600 605 Val Gin His Leu Leu Arg Arg Asp Lys Giu His Leu Trp Arg Leu Ile 610 615 620 His Giu Gly Gly Ala His Ile Tyr Val Cys Gly Asp Ala Arg Asn Met WO 01/44447 WO 0144447PCT/EPOOII2347 86 Ala Arg ASP Ala Met Glu Val Gin Asn Thr Phe Tyr 645 His Ala Gin Ala Val Asp 660 665 Asp Ile Val Ala 650 Tyr Val LYS LYS 640 Glu Leu Gly 655 Leu Met Thr 670 Lys Gly Arg 675 Tyr Ser Leu Asp Val Trp Ser 680 <210> 24 <211> 444 <212> DNA <213> Spinacia oleracea <220> <221> CDS <222> .(444) <400> 24 atg gca gca acc acc Met Ala Ala Thr Thr aca aca atg atg Thr Thr Met Met ggc atg gcc acc acc Gly Met Ala Thr Thr ttt. gtc 48 Phe Val aac acc 96 Asn Thr cca aaa ccc caa gca Pro Lys Pro Gln Ala cca cca atg atg Pro Pro Met Met 25 gcg gcg ctt cca tcc Ala Ala Leu Pro Ser WO 01/44447 WO 0144447PCT/EPOO/12347 -87ggc cgo tot ttg ttc gga Gly Arg Ser Leu Phe Gly otc aag Leu Lys 40 aoc ggt agc cgt Thr Gly Ser Arg ggo gga agg atlg 144 Gly Giy Arg Met acc ggt aao gta 192 Thr Gly Asn Val aca atg Thr Met gct gcc tac aag Ala Ala Tyr Lys acc ttg gta aca Thr Leu Val Thr ttt caa tgc cca gac Phe Gin Cys Pro ASP gat gtt tac atc Asp Val Tyr Ile gat got got gaa Asp Ala Ala Glu gaa 240 Glu toa 288 Ser gaa ggo att gao ttg Giu Giy Ile Asp Leu cot tao toa tgo Pro Tyr Ser Cys aga got Arg Ala ggg tog tgo Gly Ser Cys tgo goo gga aag ctt aag aca ggt Cys Ala Gly Lys Leu Lys Thr Giy 100 ttt ttg gat gao gat cag ato gat Phe Leu Asp Asp Asp Gin Ile Asp 115 120 ott aao caa gat Leu Asn Gin Asp cag agt 336 Gin Ser gaa gga tgg gtt Glu Gly Trp Val aoo tgt got 384 Thr Cys Ala got tac Ala Tyr 130 oot gtt agt gat gtt aot att gag aoo oao Pro Vai Ser Asp Val Thr Ile Giu Thr His 135 140 aag gaa gag gag 432 Lys Giu Glu Giu ott aot gcc taa Leu Thr Ala WO 01/44447 WO 0144447PCT/EPOO/12347 88 <210> <211> <212> <213> 147

PRT

Spinacia. oleracea <400> Met Ala Ala Thr Thr Thr Thr Met Met Gly 1 5 10 Met Ala Thr Thr Phe Val1 Pro Lys Pro Gly Arg Ser Gin Ala Pro Pro Met Met 25 Ala Ala Leu Pro Ser Asn Thr Gly Arg Met Leu Phe Gly Leu Thr Gly Ser Arg Gly.

Pro Thr Thr Met Ala Ala Tyr Lys Thr Leu Val Thr Gly Asn Val Phe Gln Cys Pro Asp Asp Val Tyr Ile Leu Asp Ala Ala Glu Glu s0 Gly Ser Cys Ser Ser Glu Gly Ile Asp Leu Pro Tyr Ser Cys Arg Ala 90 Cys Ala Gly Lys 100 Leu Lys Thr Gly Ser Leu Asn Gin Asp Asp Gln Ser WO 01/44447 WO 0144447PCT/EPOO/12347 -89 Phe Leu Asp Asp Asp Gin Ile Asp Giu 115 120 Gly Trp Vai Leu Thr Cys Ala 125 Glu Thr His Lys Giu Giu Giu 140 Ala Tyr 130 Pro Vai Ser Asp Val Thr Ile 135 Leu Thr Ala 145 <210> 26 <211> 711 <212> DNA <213> Vibrio fischeri <220> <221> <222>

CDS

<400> 26 atg cca atc aat tgc aaa. gta. aag tct Met Pro Ile Asn Cys Lys Val Lys Ser atc gag cca ttg gct tgt Ile Glu Pro Leu Ala Cys aat. 48 Asn act ttt cga Thr Phe Arg ggc caa tac Gly Gin Tyr att tta. ctt cac cca gaa.

Ile Leu Leu His Pro Giu 25 cta acg gtt gtt atg ggt Leu Thr Val Val Met Giy cag cct gtL gct. ttL aaa gca 96 Gin Pro Val Ala Phe Lys Ala gaa. aaa gac aaa. cgc cca ttC 144 Giu Lys Asp Lys Arg Pro Phe WO 01/44447 WO 0144447PCT/EPOO/12347 90 tca atc Ser lie att ggt Ilie Gly atg aaa Met Lys gca agt agt cct Ala Ser Ser Pro tgt cgc cac gaa ggt Cys Arg His Giu Gly 55 aat gct tat gcC gga Asn Ala Tyr Ala Gly gaa att gag tta cat 192 Giu Ile Giu Leu His gcc gca gag Ala Ala Giu gaa gtg gtt gaa Giu Val Val Glu tca 240 Ser

BO

cct 288 Pro tcg gca Ser Ala cta gaa acg ggt ggt gat Leu Giu Thr Gly Gly Asp att tta att gat Ile Leu Ile Asp cat ggt gaa His Gly Glu tgg atc cgt gaa Trp Ile Arg Glu agc gat cgt tca Ser Asp Arg Ser tta ttg 336 Leu Leu att gct Ilie Ala ggt aca ggt ttt Gly Thr Gly Phe tac gta cgt tca Tyr Val Arg Ser ctt gat cac 384 Leu Asp His tgt Cys cgt Arg 145 att agc caa cag att Ile Ser Gin Gin Ilie 130 gat gaa tgc caa ctg Asp Glu Cys Gin Leu 150 aaa cca att tac Lys Pro Ile Tyr tac tgg ggt ggt 432 Tyr Trp Giy Gly tat gca aaa gca gaa Tyr Ala Lys Ala Giu 155 tta gag agc att. gct 480 Leu Giu Ser Ile Ala 160 WO 01/44447 WO 0144447PCT/EPOO/12347 -91 caa gcg cat agc Gin Ala His Ser cat att acg ttt gtg His Ile Thr Phe Val gtg gtt gag aaa Val Val Giu Lys agt gaa 528 Ser Giu 175 gcc gat 576 Ala Asp ggc tgg aca Gly Trp Thr aaa acg ggt aat Lys Thr Gly Asn tta gaa gcg gta Leu Glu Ala Val ttt aac Phe Asn eta gca gat atg Leu Ala Asp Met att tac atc gca Ile Tyr Ilie Ala ggt cgc ttt gaa. 624 Gly Arg Phe Giu 205 aaa caa gcg aag 672 Lys Gin Ala Lys atg gct Met Ala 210 ggt gca gca cgt Gly Ala Ala Arg cag tic Gin Phe ace act Thr Thr gaa Giu 220 aaa gag Lys Giu 225 <210> 27 <211> 23 <212> PR' <213> Vi] cag ctg tit ggt Gin Leu Phe Gly 230 gat gca ttc gca tt Asp Ala Phe Ala Phe 235 ate iaa Ile 6

T

brio fiseheri <400> 27 Met Pro Ile Asn Cys Lys Val Lys Ser Ile Glu Pro Leu Ala Cys Asn 1 5 10 WO 01/44447 WO 0144447PCT/EPOO/12347 92 Thr Phe Arg Ile Leu Leu His Pro Giu Gin Pro Vai Ala Phe Lys Ala 25 Gly Gin Tyr Leu Thr Val Val Met Gly Giu Lys Asp Lys Arg Pro Phe.

40 Ser Ile Ala Ser Ser Pro Cys Arg His Giu Giy Giu Ile Giu Leu His 55 Ilie Giy Ala Ala Giu His Asn Ala Tyr Ala Gly Giu Val Val Giu Ser 70 75 Met Lys Ser Ala Leu Giu Thr Gly Giy Asp Ile Leu Ile Asp Ala Pro 90 His Giy Glu Ala Trp Ile Arg Giu Asp Ser Asp Arg Ser Met Leu Leu 100 105 110 Ilie Ala Gly Gly Thr Gly Phe Ser Tyr Vai Arg Ser Ile Leu Asp His 115 120 125 Cys Ile Ser Gin Gin Ile Gin Lys Pro Ile Tyr Leu Tyr Trp Giy Giy 130 135 140 Arg Asp Giu Cys Gin Leu Tyr Ala Lys Ala Giu Leu Giu Ser Ile Ala 145 150 155 160 Gin Ala His Ser His Ile Thr Phe Val Pro Val Val Giu Lys Ser Giu 165 170 175 WO 01/44447 WO 0144447PCT/EPOO/12347 -93 Gly Trp Thr Gly Lys Thr Gly Asn 180 Leu GiU Ala Val Lys Ala Asp 190 Arg Phe Giu Phe Asn Ser Leu Ala Asp Met Asp 195 200 Ile Tyr Ile Phe Thr Thr Ala Gly 205 Met Ala 210 Gly Ala Ala Arg Giu Gin 215 Giu Lys Gin Aia Lys 220 Lys Glu Gin Leu Phe Gly Asp Ala Phe Ala Phe Ile 225 230 235 <210> 28 <211> 1110 <212> DNA <213> Spinacia oieracea <220> <221> CDS <222> (1110) <400> 28 atg acc acc gct gtc acc gcc gct gtt Met Thr Thr Ala Val Thr Ala Ala Val tct ttc ccc tct acc aaa acc 48 Ser Phe Pro Ser Thr Lys Thr gtc att tcc cct gac aaa atc 96 Val Ile Ser Pro Asp Lys Ile acc tct ctc tcc gcc cga age tcc tcc Thr Ser Leu Ser Ala Arg Ser Ser Ser 25 WO 01/44447 WO 0144447PCTEPOOI1 2347 94 agc tac aaa Ser Tyr Lys aag gtt cct tig Lys Val Pro Leu tac tac agg aat gta Tyr Tyr Arg Asn Val 40 ict gca act ggg 144 Ser Ala Thr Gly gtg gag gca cct 192 Val Glu Ala Pro aaa atg Lys Met gga ccc aic Gly Pro Ilie agg gcc Arg Ala cag atc gcc tct Gin Ile Ala Ser cct gct cct gct Pro Ala Pro Ala gta gag Val Giu aaa cat tca aag aaa atg gag Lys His Ser Lys Lys Met Giu gaa 240 Giu aga 288 Arg ggc att aca gig Giy Ilie Thr Val aag itt aag cct aag acc cci tac gt Lys Phe Lys Pro Lys Thr Pro Tyr Val tgt ctt. ctt aac acc aaa att act Cys Leu Leu Asn Thr Lys Ile 'rhr 100 igg cac atg git itt icc cat gaa Trp His Met Val Phe Ser His Giu 115 120 ggg gat gat gca ccc Gly Asp Asp Ala Pro 105 gga gag atc cci tac Gly Gu Ile Pro Tyr 125 gag acc 336 Glu Thr aga gaa ggg 384 Arg Giu Gly caa icc Gin Ser 130 gtt ggg gti att Val Giy Val Ile gat ggg gaa gac aag aai Asp Giy Glu Asp Lys Asn 140 gga aag ccc 432 Gly Lys Pro cat aag ttg aga ttg tac tcg atc gcc agc agi gci cti ggi gat tit 480 WO 01/44447 WO 0144447PCT/EPOO/12347 95 His Lys Leu Arg Leu Tlyr Ser Ile Ala Ser Ser Ala Leu Gay Asp Phe ggt gat gct aaa tct Gly Asp Ala Lys Ser 165 aat gac gct gga gag Asn Asp Ala Gly Glu 180 gtt tcg ttg tgt gta Val Ser Leu Cys Val 170 acg atc aag gga gtc Thr Ile Lys Gly Val 185 aaa cga ctc atc Lys Arg Leu Ile tac acc 528 Tyr Thr 175 tgc tcc aac Cys Ser Asn ttc ttg tgt Phe Leu Cys 190 gac ttg aaa Asp Leu Lys 195 ccc ggt gct gaa gtg Pro Gly Ala Glu Val 200 aag tta aca gga cca gtt gga aag Lys Leu Thx Gly Pro Val Gly Lys 205 gag atg Glu Met 210 ctc atg ccc aaa gac Leu Met Pro Lys Asp 215 cct aac gcg aca att atc atg ctt gga Pro Asn Ala Thr Ile Ile Met Leu Gly 220 gga acg ggg att gct Gly Thr Gly Ile Ala 230 cct ttc cgt tca ttc Pro Phe Arg Ser Phe 235 ttg tgg aag atg ttc Leu Trp, Lys Met Phe 240 ttc gaa aag cat gat Phe Glu Lys His Asp 245 ttg ggt gta ccc aca Leu Gly Val Pro Thr 260 gat tac aag ttt aac ggc ttg gct tgg ctt ttc Asp Tyr Lys Phe Asn Gly Leu Ala Trp Leu Phe 250 255 agc agt tct ctt ctc tac aaa gag gaa ttt gag Ser Ser Ser Leu Leu Tyr Lys Glu Glu Phe Glu 265 270 WO 01/44447 WO 0144447PCT/EPOO/12347 96 aag atg Lys Met aag gaa aag get eca Lys Giu Lys Ala Pro 275 gac aac ttc agg ctg Asp Asn Phe Arg Leu 280 gat ttt gca gtg 864 Asp Phe Ala Val 285 tac att caa acc 912 Tyr Ile Gin Thr age aga gag Ser Arg Glu 290 caa act aac Gin Thr Asn aaa ggg gag aag Lys Gly Giu Lys atg gca caa tac Met Ala Gin Tyr gtt gag eta tgg gaa Vai Giu Leu Trp Glu 315 atg ttg aag aaa Met Leu Lys Lys gat 960 Asp 320 aat act tat gte Asn Thr Tyr Val atg tgt ggt etc Met Cys Gly Leu aag gga atg gaa aag Lys Gly Met Giu Lys 330 gca gaa ggc att gat Ala Giu Gly Ile Asp 350 gga att 1008 Gly Ile 335 tgg att 1056 Trp Ile gac gac att Asp Asp Ile a tg Met 340 gtt tea ttg get Val Ser Leu Ala gaa tae aag Glu Tyr Lys 355 agg cag ttg aag aag gca Arg Gin Leu Lys Lys Ala 360 gaa eaa tgg aac gtt gaa gte 1104 Giu Gin Trp Asn Val Giu Val 365 tac ta Tyr 1110 WO 01/44447 WO 0144447PCT/EPOO/12347 97 <210> 29 <211> 369 <212> PRT <213> Spinacia oleracea <400> 29 Met Thr Thr Ala Val Thr Ala Ala Val Ser 1 5 10 Phe Pro Ser Thr Lys Thr Thr Ser Leu Ser Ala Arg Ser Ser Ser 25 Val Ile Ser Pro Asp Lys Ile Ser Tyr Lys Lys Vai Pro Leu Tyr 40 Tyr Arg Asn Lys Met Gly Pro Ilie Arg Ala Gin Ile Ala Ser 55 Val Ser Ala Thr Gly Asp Val Glu Ala Pro Lys Lys Met Glu Glu Pro Tyr Val Gly Arg Pro Ala Pro Ala Lys Val Glu Lys His Gly Ile Thr Val Lys Phe Lys Pro Lys Thr Cys Leu Leu Asn 100 Thr Lys Ile Thr Asp Asp Ala Pro Gly Glu Thr 110 Trp His Met Val Phe Ser His Glu 120 Gly Glu Ile Pro Tyr Arg Glu Gly 125 WO 01/44447 WO 0144447PCT/EPOO/12347 98 Gin Ser Val Gly Val Ile Pro Asp Gly 130 135 His Lys Leu Arg Leu Tyr Ser Ile Ala 145 150 Gly Asp Ala Lys Ser Val Ser Leu Cys 165 Asn Asp Ala Gly Glu Thr Ile Lys Gly 180 185 Asp Leu Lys Pro Gly Ala Glu Val Lys 195 200 Glu Met Leu Met Pro Lys Asp Pro Asn 210 215 Thr Gly Thr Gly Ile Ala Pro Phe Arg 225 230 Phe Giu Lys His Asp Asp Tyr Lys Phe 245 Leu Gly Val Pro Thr Ser Ser Ser Leu 260 265 Lys Met Lys Glu Lys Ala Pro Asp Asn 275 280 Glu Asp Lys Asn Gly Lys Pro 140 Ser Ser Ala Leu Gly Asp Phe 155 160 Val Lys Arg Leu Ile Tyr Thr 170 175 Val Cys Ser Asn Phe Leu Cys 190 Leu Thr Gly Pro Val Gly Lys 205 Ala Thr Ile Ile Met 220 Ser Phe Leu Trp Lys 235 Asn Gly 250 Leu Ala Trp Leu Gly Met Phe 240 Leu Phe 255 Leu Tyr Lys Glu Glu Phe Glu 270 Phe Arg Leu Asp Phe Ala Val 285 WO 01/44447 WO 0144447PCT/EPOO/12347 99 Ser Arg 290 Giu Gin Thr Asn Lys Giy Giu Lys Tyr Ile Gin Thr Met Aia Gin Tyr Val Giu Leu Trp Met Leu Lys Lys *Asn Thr Tyr Val Tyr Met Cys Gly Leu 325 Gly Met Giu Asp Asp Ile Giu Tyr Lys 355 Val Ser Leu Aia Ala Giu Giy Ile Lys Giy Ile 335 Asp Trp Ile 350 Vai Giu Val Arg Gin Leu Lys Lys 360 Aia Giu Gin Trp Asn 365 <21i> 2580 <212> DNA <2i3> Aspergilius parasiticus <220> <221> CDS <222> (i)..(2580) <400> atg gca acc atc acg gag gtt cgg acg gat gcg ctc gtc cca act gac 48 Met Aia Thr Ile Thr Giu Val Arg Thr Asp Aia Leu Vai Pro Thr Asp WO 01/44447 WO 0144447PCT/EPOO/12347 -100 ctc gtc ctt Leu Val Leu aeg aaa gac Thr Lys Asp aca ggt cag atc Thr Gly Gin Ile att caa agc gaa Ile Gin Ser Giu atc tcg 96 Ile Ser ctg tcc gat atc cct Leu Ser Asp Ile Pro 40 ctg cca cca cca Leu Pro Pro Pro tca aaa cgg ccg Ser Lys Arg Pro aca gaa.

Thr Glu gtg ctg agc gta gat aaa Val Leu Ser Vai Asp.Lys 55 gga acc cca gat agc cat gtt ccg Giy Thr Pro Asp Ser His Val Pro cgt Arg gat cct cga ctc aic Asp Pro Arg Leu Ile 70 aga tta acg ggt gt Arg Leu Thr Gly Vai 75 cat ccg ttt aac gt His Pro Phe Asn Val gag cca cct ctt aca Giu Pro Pro Leu Thr gat ctg tat aaa gaa Asp Leu Tyr Lys Glu 90 cga aat cat ggc cca Arg Asn His Gly Pro 105 ggg ttt tta aca tcg ccg Gly Phe Leu Thr Ser Pro gtc cct cat gtc aag gat Vai Pro His Val Lys Asp 110 gag ctc ttc Glu Leu Phe tat Tyr 100 gaa. gat atc Giu Asp Ile cct cac tgg gaa att act Pro His Trp Glu Ile Thr atc gaa gga ctg Ile Glu Gly Leu 125 gta gag aag 384 Val Glu Lys WO 01/44447 WO 0144447PCT/EPOO/12347 -101 cct ttg Pro Leu 130 acg gcg Thr Ala 145 gta cta aac ttc Val Leu Asn Phe cga caa gtg ttg Arg Gin Val Leu 135 gta tigt gca ggc Val Cys Ala Gly cag cag Gin Gin 140 tac gac caa ata 432 Tyr Asp Gin Ile ccc atc acc Pro Ile Thr cga cgc aaa gag Arg Arg Lys Glu caa 480 Gin 160 cta 528 Leu aac att gta cgt Asn Ile Val Arg acg aaa ggt ttt Thr Lys Gly Phe tgg gga tcc gcg Trp Gly Ser Ala tcg act gcc Ser Thr Ala ttc act ggc cca Phe Thr Gly Pro ctg gcg gat atc Leu Ala Asp Ile cgc agt 576 Arg Ser ggc aaa Gly Lys aag ctg Lys leu 210 ctg cgt caa gcg Leu Arg Gin Ala tac gtc tgt atg Tyr Val Cys Met gga gcg gat 624 Gly Ala Asp ccc aat ggt cac Pro Asn Gly His ggc aca ctc att Gly Thr Leu Ile aaa ttg aac tgg gcc 672 Lys Leu Asn Trp Ala 220 gac ccc aac agg Asp Pro Asn Arg atc atg Ile Met ctt gca Leu Ala aaa atg aac ggg Lys Met Asn Gly gag 720 Glu 240 tct ctt cgc cca gat Ser Leu Arg Pro Asp cat ggt cgt ccg ctg His Gly Arg Pro Leu agg gcc gtc gtg ccc ggt 768 Arg Ala Vai Val Pro Gly WO 01/44447 WO 0144447PCT/EPOO112347 102 caa ata Gin Ile gga gga Gly Gly 260 cga agt gtc aag Arg Ser Val Lys ctg aag agg ctg Leu Lys Arg Leu atc ttg acc 816 Ile Leu Thr 270 cgc gtc tta 864 Arg Val Leu gat gca cca Asp Ala Pro 275 agc gat aac tgg tac Ser Asp Asn Trp Tyr 280 cat atc aat His Ile Asn gac aac Asp Asn 285 cca aca Pro Thr 290 atg gtc tcg ccc gat Met Val Ser Pro Asp 295 atg gca Met Ala tca aat Ser Asn cga aat tgg tgg 912 Arg Asn Trp Trp gat gag cgg gat gcg Asp Giu Arg Asp Ala 310 att tat gac cta aac Ile Tyr Asp Leu Asn 315 acc aac tcc gcc gtt 960 Thr Asn Ser Ala Val 320 gga tat Gly Tyr cct caa aac Pro Gln Asn 325 aat gag gtc Asn Glu Val tta aat Leu Asn 330 atc ctg gag gcc Ile Leu Giu Ala gcc 1008 Ala gtc ata Val Ile tac tgt Tyr Cys 340 cag agg ata gct Gin Arg Ile Ala tac gct ggt ggg ggc cgt TPyr Ala Gly Gly Gly Arg 345 350 aaa ggc aaa. tct tgg aga Lys Gly Lys Ser Trp Arg 3.65 agg gtt 1056 Arg Val acc agg gta Thr Arg Val 355 gaa ata tcc cta gac Glu Ilie Ser Leu Asp 360 ttg gcg 1104 Leu Ala WO 01/44447 WO 0144447PCT/EPOO/12347 103 gat atc Asp Ie 370 gaa tat gcc gaa Glu Tyr Ala Glu gac aag tat cgt Asp Lys Tyr Arg 375 atg tac tgg cgc Met Tyr Trp Arg gat ttc gaa ggc gag ctt 1152 Asp Phe Glu Gly Giu Leu 380 gga ggc aaa gta gat Gly Gly Lys Val Asp 390 gaa Glu 395 act tgc ttc tgc Thr Cys Phe Cys 1200 1248 tgt ttt tgg tct cta Cys Phe Trp Ser Leu 405 agc atc gcc atc Ser Ile Ala Ile gag ctt gag aac Glu Leu Giu Asn agt gat Ser Asp 415 gcc atc ctt gta aga gcc atg Ala Ile Leu Val Arg Ala Met 420 gat atg tac tgg tcc gtt ctc Asp Met Tyr Trp Ser Val Leu 435 gat gaa Asp Giu 425 gca ttg ggc Ala Leu Gly gtg cag cct cgc Val Gin Pro Arg 430 cct tgg ttc cgg Pro Trp Phe Arg 445 1296 1344 atg atg aac aac Met Mdet Asn Asn gtt aca att acg aag gaa aac ggg aac ttg aga Val Thr Ile Thr Lys Glu Asn Gly Asn Leu Arg ttc gag cac cct acc Phe Glu His Pro Thr 460 1392 cct agt atg.cct Pro Ser Met Pro gga tgg atg gaa cgc Gly Trp, Met Glu Arg 475 gtc aaa aaa gct Val Lys Lys Ala ggg 1440 Gly 480 ggt gac ccg acg aat Gly Asp Pro Thr Asn ggt aac tgg gga gaa aga cac gaa gga gag gag Gly Asn Trp Gly Glu Arg His Glu Gly Glu Glu 1488 WO 01/44447 WO 0144447PCT/EPOO/12347 104 ccg acg gag Pro Thr Giu gag ccc gtg caa Glu Pro Val Gin att aat atg aag Ile Asn Met Lys aaa gac ggg 1536 Lys Asp Gly 510 tcc tgt gat 1584 Ser Cys Asp cca agc Pro Ser gag aag Glu Lys 530 acg att agt ttt Thr Ile Ser Phe gaa ttc aag gag Glu Phe Lys Glu cca tgg ttc atc Pro Trp Phe Ile aat gga gaa gtg Asn Giy Giu Val gat ggt caa gca 1632 Asp Giy Gin Ala ctt gaa ggc cac Leu Giu Giy His ggc gga cgg cag Gly Gly Arg Gin att atc tcc tct Ile Ile Ser Ser gcc 1680 Ala 560 gca 1728 Ala ggt cag gac gtc Gly Gin Asp Val gag gaa ttc ctt Giu Giu Phe Leu att cat agc. gag Ile His Ser Glu aag gcg atg Lys Ala Met cct gag tac cat Pro Giu Tyr His gga acg acg gat ccg Gly Thr Thr Asp Pro 590 gaa ggc 1776 Glu Gly ttg ata gca Leu Ile Ala 595 ctc aag gat gat gca Leu Lys Asp Asp Ala 600 tca tcc tcc acc gat gaa att cgc 1824 Ser Ser Ser Thr Asp Giu Ile Arg 605 WO 01/44447 WO 0144447PCT/EPOO/12347 105eca gtg Pro Val 610 ttc etc caa tca Phe Leu Gin Ser cgg tet tgg aca Arg Ser Trp Thr 615 gat aca cga ata Asp Thr Arg Ile aag gca Lys Ala 620 aca ttg aaa gaa 1872 Thr Leu Lys Glu aaa gac ata tca Lys Asp Ile Ser ttt Phe 635 agt ttc aaa Ser Phe Lys eac gaa gat caa His Giu Asp Gin ttg ggt tta cca.

Leu Gly Leu Pro ggc cag cat ett Gly Gin His Leu ttg gaa .1920 Leu Giu 640 atg ate 1968 Met Ile 655 tca tae 2016 Ser Tyr aaa gte ctc Lys Val Leu aga tea tcc aac Arg Ser Ser Asn gaa gee ate ate Giu Ala Ilie Ile ace ccg Thr Pro tet gaa ace age Ser Giu Thr Ser aaa ggg act gtg Lys Gly Thr Val ttg etg gtt 2064 Leu Leu Val aaa gta tae Lys Val Tyr 690 ttt gea aca Phe Ala Thr ace teg gea gge Thr Ser Ala Gly aag atg aeg atg 2112 Lys Met Thr Met etg gat agg ctg eca Leu Asp Arg Leu Pro 710 ttg gge Leu Giy tee gtg Ser Val gte Val 715 gaa. tat ett gga Giu Tyr Leu Gly aat 2160 Asn 720 gga ega gtt etc ata agt ggc aag gag egc Giy Arg Val Leu Ile Ser Gly Lys Giu Arg eat gtt egg teg ttt aag 2208 His Val Arg Ser Phe Lys WO 01/44447 WO 0144447PCT/EPOO/12347 -106 atg att tgt Met Ile Cys gga Gly 740 gga ace ggt ate Gly Thr Gly Ile ccg atc ttg cag Pro Ile Leu Gin gtc ttg cgc 2256 Val Leu Arg 750 gte etc aat 2304 Val Leu Asn gcc gtg Ala Val cag gac cat caa Gin Asp His Gin gat Asp 760 cet ace tct tgt Pro Thr Ser Cys gga aac aga Gly Asn Arg 770 cag gag gaa Gin Glu Glu ate ctt.

Ile Leu cgc egg Arg Arg gag ctc gac ggc 2352 Glu Leu Asp Gly atg geg tee gae Met Ala Ser Asp aga agg tgt aat Arg Arg Cys Asn ata Ile 795 ata cac act Ile His Thr aaa geg ceg gac Lys Ala Pro Asp tgg act ggc ege Trp, Thr Giy Arg gga egc ata tee Gly Arg Ile Ser eta tee 2400 Leu Ser 800 gaa gag 2448 Giu Giu 815 etg att 2496 Leu Ile etc eta aag Leu Leu Lys tgt ggt ceg Cys Gly Pro 835 tac gcg gct eca Tyr Ala Aia Pro gat gag agt atg Asp Giu Ser Met gct egg agg ata Ala Arg Arg Ile 845 eca gee atg gaa gaa teg Pro Aia Met Glu Giu Ser 840 etg ttg geg 2544 Leu Leu Ala WO 01/44447 WO 0144447PCT/EPOO/1 2347 -107 gaa gga tgg aaa gaa tca gac ctt cac ttt ttc tga Giu Gly Trp Lys Glu Ser Asp Leu His Phe Phe 850 855 860 2580 <210> 31 <211> 859 <212> PRT <213> Aspergillus parasiticus <400> 31 Met Ala Thr Ile Thr Glu Val Arg Thr 1 5 Ala Leu Val Pro Thr Asp Leu Val Leu Thr Gly Gin Ile Ile Gin Ser Giu Glu Ile Ser Thr Lys Asp Leu Ser Asp Ile Pro Leu Pro Pro Pro Lys Arg Pro Thr Giu Val Leu Ser Val Asp Lys Gly Thr Pro Ser His Val Pro Asp Pro Arg Leu Arg Leu Thr Gly His Pro Phe Asn Glu Pro Pro Leu Thr Asp Leu Tyr Lys Glu Gly Phe Leu Thr Ser Pro Glu Leu Phe Tyr Vai Arg Asn His Gly Pro Val Pro His Vai Lys Asp WO 01/44447 WO 0144447PCT/EPOO/12347 108 100 105 110 Giu Asp Ile Pro His Trp Giu Ile Thr Ile Glu Gly Leu Val Giu Lys 115 120 125 Pro Leu Val Leu Asn Phe Arg Gin Val Leu Gin Gin Tyr Asp Gin Ile 130 135 140 Thr Ala Pro Ile Thr Leu Val Cys Ala Gly Asn Arg Arg Lys Giu Gin 145 150 155 160 Asn Ile Val Arg Lys Thr Lys Gly Phe Ser Trp Gly Ser Ala Gly Leu 165 170 175 Ser Thr Ala Leu Phe Thr Gly Pro Leu Leil Ala Asp Ile Leu Arg Ser 180 185 190 Gly Lys Pro Leu Arg Gin Ala Lys Tyr Val Cys Met Giu Gly Ala Asp 195 200 205 Lys Leu Pro Asn Gly His Tyr Gly Thr Leu Ile Lys Leu Asn Trp Ala 210 215 220 Leu Asp Pro Asn Arg Gly Ile Met Leu Ala His Lys M'et Asn Gly Glu 225 230 235 240 Ser Leu Arg Pro Asp His Gly Arg Pro Leu Arg Ala Val Val Pro Gly 245 250 255 Gin Ile Gly Gly Arg Ser Vai Lys Trp Leu Lys Arg Leu Ile Leu Thr WO 01/44447 WO 0144447PCT/EP00112347 -109- 260 265 270 Asp Ala Pro Ser Asp Asn Trp Tyr His Ile Asn Asp Asn Arg Val Leu 275 280 285 Pro Thr Met Val Ser Pro Asp Met Ala Ser Asn Asn Arg Asn Trp Trp 290 295 300 His Asp Giu Arg Asp Ala Ile Tyr Asp Leu Asn Thr Asn Ser Ala Val 305 310 315 320 Gly Tyr Pro Gin Asn Asn Glu Val Leu Asn Ile Leu Giu Ala Arg Ala 325 330 335 Val Ie Tyr Cys Gin Arg Ile Ala Tyr Ala Gly Giy Giy Atg Arg Val 340 345 350 Thr Arg Vai Gu Ile Ser Leu Asp Lys Gly Lys Ser Trp Arg Leu Ala 355 360 365 Asp Ile Giu Tyr Ala Giu Asp Lys Tyr Arg Asp Phe Giu Gly Giu Leu 370 375 380 Phe Gly Giy Lys Val Asp Met Tyr Trp Arg Giu Thr Cys Phe Cys Trp 385 390 395 400 Cys Phe Trp, Ser Leu Ser Ile Ala Ile Pro Giu Leu Glu Asn Ser Asp 405 410 415 Ala Ile Leu Val Arg Ala Met Asp Glu Ala Leu Gly Val Gin Pro Arg WO 01/44447 WO 0144447PCT/EPOO/12347 -110- 420 425 430 Asp Met Tyr Trp Ser Val Leu Gly Met Met Asn Asn Pro Trp Phe Arg 435 440 445 Val Thr Ile Thr Lys Glu Asn Giy Asn Leu Arg Phe Giu His Pro Thr 450 455 460 His Pro Ser Met Pro Thr Giy Trp Met Giu Arg Val Lys Lys Ala Gly 465 470 475 480 Gly Asp Pro Thr Asn Gly Asn Trp, Gly Giu Arg His Giu Gly Giu Giu 485 490 495 Pro Thr Giu Pro Giu Pro Val Gin Asp Ile Asn Met Lys Lys Asp Giy 500 505 510 Pro Ser Arg Thr Ilie Ser Phe Giu Giu Phe Lys Giu Asn Ser Cys Asp 515 520 Giu Lys Pro Trp Phe Ile Val Asn Gly Giu Val 530 535 Phe Leu Giu Gly His Pro Giy Giy Arg Gin Ser 545 550 555 Gly Gin Asp Val Ser Giu Giu Phe Leu Ala Ile 565 570 Lys Ala Met Met Pro Giu Tyr His Ile Gly Thr 525 Asp Gly Gin Ala Ile Ile Ser Ser Ala 560 His Ser Giu Thr Ala 575 Thr Asp Pro Giu Giy WO 01/44447 WO 0144447PCT/EPOO/12347 580 585 590 Leu Ile Ala Leu Lys Asp Asp Ala Ser Ser Ser Thr Asp Giu Ile Arg 595 600 605 Pro Val Phe Leu Gin Ser Arg Ser Trp Thr Lys Ala Thr Leu Lys Giu 610 615 620 Arg Lys Asp Ile Ser Trp Asp Thr Arg Ilie Phe Ser Phe Lys Leu Giu 625 630 635 640 His Giu Asp Gin Thr Leu Gly Leu Pro Val Gly Gin His Leu Met Ile 645 650 655 Lys Val Leu Asp Arg Ser Ser Asn Asn Glu Ala Ile Ile Arg Ser Tyr 660 665 670 Thr Pro Ile Ser Giu Thr Ser Gin Lys Gly Thr Val Asp Leu Leu Vai 675 680 6.85 Lys Val Tyr Phe Ala Thr Ala Thr Ser Ala Gly Gly Lys Met Thr Met 690 695 700 Ala Leu Asp Arg Leu Pro Leu Gly Ser Val Val Glu Tyr Leu Gly Asn 705 710 715 720 Giy Arg Val Leu Ile Ser Gly Lys Giu Arg His Val Arg Ser Phe Lys 725 730 735 Met Ile Cys Gly Gly Thr Gly Ile Thr Pro Ile Leu Gin Val Leu Arg WO 01/44447 WO 0144447PCT/EPOO/12347 -112- Ala Val Val 755 Gin Asp His Gin Pro Thr Ser Cys Val Val Leu Asn 765 Giu Leu Asp Gly Gly Asn 770 Arg Gin Giu Giu Ile Leu Arg Arg Met Ala Ser Asp Arg Arg Cys Asn Ile His Thr Leu Lys Ala Pro Asp Ser 805 Trp Thr Gly Arg Gly Arg Ile Ser Giu Giu 815 Leu Leu Lys Giu Tyr Ala Ala Pro Giu 820 825 Asp Giu Ser Met Val Leu Ile 830 Leu Leu Ala Cys Giy Pro Pro Ala Met Giu Giu Ser 835 840 Ala Arg Arg Giu Gil <210> <211> <212> <213> <220> <223> ~Trp Lys Giu Ser Asp Leu His Phe Phe 1 855 32 37

DNA

Artificial

I

~rime r WO 01/44447 WO 0144447PCT/EPOO/12347 -113- <220> <221> misc-feature <222> <400> 32 gcgcgaattc atgacaacct taagctgtaa agtgacc <210> 33 <211> 34 <212> DNA <213> Artificial <220> <223> primer <220> <221> misc-feature <222> (34) <400> 33 gcgcctgcag tcagataaat gcaaacgcat cgcc <210> 34 <211> 26019 <212> DNA <213> synthetic <220> <221> promoter <222> (233)..(1582) <220> <221> Intron WO 01/44447 WO 0144447PCT/EPOO/12347 <222> (1583).. (1958) <220> <221> gene <222> (1969) (3585) <223> PrnA <220> <221> terminator <222> (3603) .(3877) <220> <221> promoter <222> (3888) (5237) <220> <221> Intron <222> (5238).. (5613) <220> <221> gene <222> (5624) .(7327) <223> PrnC <220> <221> terminator <222> (7338) .(7612) <220> <221> promoter WO 01/44447 WO 0144447PCT/EPOO/12347 -115- <222> (7636) .(8985) <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> I nt ron (8986).. (9361) gene (9372) .(10457) PrnB termina tor (10464).. -(10738) promoter (10749) .(12098) Intron (12099) (12474) gene (12485) (13576) PrnD terminator WO 01/44447 WO 0144447PCT/EPOO/12347 -116- <222> (13583)..(13857) <220> <221> promoter <222> (13942)..(14942) <220> <221> gene <222> (14948)..(15649) <223> fre <220> <221> terminator <222> (15655)..(15936) <220> <221> promoter <222> (15949)..(17285) <220> <221> Intron <222> (17283)..(17679) <220> <221> gene <222> (17696)..(18238) <223> selectable marker <220> <221> terminator WO 01/44447 WO 0144447PCT/EPOO/12347 -117- <222> (18245)..(18526) <400> 34 tggggaaccc ccL tttaaat tatcctgtca tctagtcgta gagccaagtc agtagtaaga cctgaacatc gaaatttaag tatattcttc caacattttt caaggcccaa caacaacaac aacatagatt acatacagat aggtttagag gataagt ttc agtagattag taatcaacat tatgattgct ttttttgaac ggaaaagtat cctaatccaa tggaaaatat ctgatatctt ggttttgggc cctttcgtct tctcgcgact tgtggttggc atccgattat aacactgata cgttttgcga tcataaacgc acagagaaga ttattttagc ctcttggact ttctatgtta tttgttttga ctgttttttt aaaaaaagat t Latcatgaa cttctaatta ttttggaatt cttattttaa aatcttttat gaaattaaaa tattcttaat tttttcctta atacaaaaag ccaccaccat gacacgtatc cc ttttt ttg ttttggtttg ttttctgact ctctctttca atgcacatac tctaataaac gtttaaactg tcggtctcac cattgtggaa gagagagtgt aaagagaaag tgtgaattgt cctgaaaacc gttattatct ttttaagaag aaagaaaata aaaaagagaa ttaacttttc aaaccaaaaa ttagtcaatg gccaagtttt gaaaaatctc gggttgggtt ttgattaaat aaaaatagaa aggatgtttc atatgattcc ttttggctaa cgatataaag cttcaatctc aggtata tt C aaatggacga gctcttttct aaggcgggaa tagagcggcc gaaagtcttg gagatacatg agttccgagt tccgcctctt ggcatttaat gggcttaata ttgc tgttaa ataacaatta aagaaa taaa ttaaaaatta gattgttcta gtagatactt gataaattaa atatatagta aaccaagaca tcttctatag aaatgtcagt tacttgagtc ttcctttagt agatatttta aagaccttcg tcccaaagcc tctgattctt acggataaac ctCtagg ttta acgacaatct gcctcgaggt agttggtggt aattgtcggg ctgtagcaga gaatacttcCL ctcgcgggtt acgcaggcct aaaaaaaaaa ctttaattgt aacttggatc ggtccttttt aaaaatactc ttttttcttt atcaagaaga ttagtattct tagtcttaat aaaagaaaga gaagcagatg ggtcttttaa ttcgtgataa ttctcattaa tgtggaaga t taaagcgatc tttgtttttg cttttcacgc cccgccaata gatCtatcgt accggatttg aatgtaacag caacaaaaa C agagtgagga tcaatcctca tattccggtt gaaataaatt agggaattaa agactaaaaa aaaaaaaaaa cccaacaatt aaatttggta tctttattag taaactatca ctatatatat ggaaagaatc aattatttga taatggatga aaacgcacgg taatcctcaa tagaaaagac aataattcat tctgcaaatc attcgtatct 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 gatctccaat ttttgttatg Cggattattg aatcttttgt ataaattgct tttgacaata WO 01/44447 WO 0144447PCT/EPOO/12347 -118ttgttcgttt agtgtttaca tattcaattt tccgtttctc ctgattggtt atcaagaata gtccgggccc atcggcgtgg ataccggagc gtgaattgga aacgtgccga ggcttccagc ctggcaccgt cacctggtgg gatgaggtgg gaggggcgga atcaatcagg gcggtcgcca tcgatcgcca ggctacgtct ctctggggcc aagcgggcgt ctggaatcga cccgacacct t tcgacgact ccgttctggc cagcgctaca gagacc ttcg gccggc ttgg atcgagaaag cgtcaatcca tctgtgtaat ttgtgttttc tttggtgttg tctacttgtt tcgtcatcgt tccaacagca gcgaagcgac gggaatggat gaaagtctcc actgcgacgg agccgatgga gcctgtccga ccgacttctt tggacgttcg cgctggaggc cgctgaagga gcgccgtgcc tgaactcggg tctcgagcca tc tcggacaa gggtcaacaa cggggatcta cgttcgaccc gccgggattt tcgcgaaccg aggcggggct actacgaatt gcatgctgcc ccgaggcgat gcttctaaat ttcttgcttg tttgttcgat ttttgatttc ctattgtttt gggcggcggt ggcgaacat t catcccaagt gccccaagtg cgacccctcg cgtgccgctt gtacgcgtgc cggcacccgC gaagcgc tgg cctgaacaac ggacctgttc acccttcatc caacgacgac atggaccztgg tttcacctcg tcagccgctc ctgcgtctcg cttcatctac gcggc tgagc cgtccaagcg gcacgac ctg gccgctgacc caagaatttc cgaccggtcg gttcgccagc tttgtcctga attgtgaaat tctctctgtt tcttacggct atttcaggtg actgcgggct acgctcatcg ttgcagaagg aacggcgcgt cgcgacgatc acccactact tacccgcagc cagatgtccc gccgtcgagc cgcggctaca atcgactgct gacatgtccg gcgcgcgatg aagattccga cgcgaccagg aaccagatca atcgggctgt gcggcgcttt gacgctttca cactatttca cggctctcgg accacgtcgt tggttgaacg ctgccgctgt atccggcgcg ttactaagat taggattttc ttaggtttct gatccaccat ggatggccgc aatctgcggc tgttcttcga tcaaggccgc acttctacca ggc tgcgcaa ccggggcact acgcgtggca gcggggtgaa tctccaacct ccggcatgcg actacctgct gggtcgagcc tgctgggccg ccaccgccga agttccgggt cgtcgtgctt ac cagc tcgt acgccgagat ccacgtcgcg acgccatcaa tcgacgattc gcaactacta tgcagcaccg aggccgagcg atcgattcgt aaggacgatc tatgt ttaga tatatgttcg gaacaagccg ctcgtacctc gatccctcgg tttcctcggg gatcaagttc tttgttcggc gcgcgaacag cgacggcaag cttcgacgcg ccgcgtggtc gc tcaccaag ggggctcctg gtgcgacagc gtacacc tcc gttcggcagc cttcctcaaa cgggcgcaac tctggagccc gaagcacttc cgtccacatg cgatgacacg agagaaggt t cacgtac tac ctgcatcttt accggagtcg tctgcgcacc 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 WO 01/44447 WO 0144447PCT/EPOO/12347 -119agce tgccga cgcggccagc aggatcce atcctgttgc taataattaa cgcaattata tatcgcgcgc aagtcteata taagaacaga acatcttatt ttaagctctt tcttcttcta cccaactgtt acaacaaaaa aga tt ttate cagatcttct tagagttttg gtttcettat attagaatct aacatgaaat ttgcttattc tgaacttttt agtatataca tccaaccacc aatatgacac atettccttt tgggcttttg cgtctttttc cgactctctc caaactacga gtgggecgaa gaatttcccc cggtcttgcg catgtaatgc catttaatac ggtgtcatct aacgccattg gaagagagag ttagcaaaga ggacttgtga tgttacctga tttgagttat ttttttttta a aga taaaga atgaaaaaaa aat tattaac gaattaaacc tttaattagt tttatgccaa t aaaagaaaa t taatgggtt ccttattgat aaaagaaaaa ac a tagga t gtatcatatg ttttgttttg g tt tgega ta tgactcttca tttcaaggta ctacctgcgg gctcgcagcg gatcgttcaa atgattatca atgacgttat gcgatagaaa atgttactag tggaagaaag agtgtgagat gaaagagtte attgtteegc aaaccggeat tatctggget agaagttgct aaataataac gagaaaagaa ttttcttaaa aaaaagattg caatggtaga gttttgataa ateteatata gggttaaeea taaattette tagaaaaa tg gtttctactt attcctteet gctaaagata taaagaagac atctcteeca tattttctga tege tgegtg caggaaagcc aeatttggea tctaatttct ttatgagatg acaaaatata atcegggaat tcttgagttg acatgaattg cgagtetgta etc ttgaata ttaatctege taataacgea gttaaaaaaa aattaettta ataaaaactt aattaggtc ttctaaaaaa tacttttttt attaaatcaa tagtattagt agacatagtc ta tagaaaag teagtgaage gagteggte t ttagtttcgt ttttattctc cttcgtgtgg aagcctaaag ttctttttgt acggegacgc tgtagtggaa ataaagtttc gttgaattac ggtttttatg gegegeaaac tgggtaeegg gtggtaatgt tcgggcaaea gcagaagagt cttettcaat gggtttattc ggeetgaaat aaaaaaggga attgtagact ggatcaaaaa tttttcecaa Lactcaaatt tcttttcttt gaagataaae attetetata ttaatggaaa aaagaaat ta agatgtaatg tttaaaaacg gataataatc attaatagaa aagataataa egatctctgc ttttgattcg ggggetgteg cgcaecttgg ttaagattga gttaageatg attagagtcc taggataaat atttggagcc aaeagagtag aaaatectga gaggagaaat ecteatatat cggttcaaca aaatteaagg attaacaaea aaaaaaaeat aaaaaacata caattaggtt tggtagataa attagagtag tateataatc tatattatga gaatcttttt tttgaggaaa gatgacctaa caeggtggaa etcaae tgat aagaeggtt t ttcatccttt aaatc tc tcg tatctgatct 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 WO 01/44447 WO 0144447PCT/EPOO/12347 120ccaatttttg cgttt.cgtca ttacatctgt aatttttgtg ttctctttgg tggtttctac cgcgaacgaa caccc agatg gtcgcacccg catcatcgct gcaacgttac gcccggCCag ggggccggag taaatacggc cggcgtcgcg cggaggacct caagacgcac cttcaaggtc gggcggc tgg gagcgtcggc ggaat tcgat gccggtgcgc cgaccgctac gctggaaaac cgacgacgac ggaccacaac ggacgcgttc ggcccacgcg ccctccgtat cgccaaagcc ttatgtggat atccagcttc gtaatttctt ttttctttgt tgttgttttg ttgttctatt cacgatagca ggggccatc t cggttcacga gatcgctacg gtcgcgtcga gagcacgacc agccattatt tgcaaggtcc gtgaccaccg cgcgcgcCgC tcgcgcagcc aaggggcagc ctctgggtga ctgcagctcg gagttcctcg gactgggtca tgcctgatgc accgcggtga ttctcccccg gacgacttcg cacaggctgt aggttccgcg ctzcggatac gaggtcgagg tattgaatct taaattttgt gcttgattgt tcgattctct atttctcztta gttttatttc atcac ttcga tggccaaaca tcggcgaatc gcattccgga gcacgggcat cgaaggagtt accggcaaga accagaaaac cccagggcga tcgcgaccaa tctacacgca gctggcgctg ttccgttcaa acccgcgtgt cgcggttcc agaccgaccg tgcacgcgaa c cat cc acgc agcgcttcga tcagctgctg gggCggtCgg cgtcgcgcaa tgtgcgcgga ccgtgagtgc t ttgtataaa cctgattact gaaattagga ctgttttagg cggcttttga aggtggatc cgtaatcatc acagtttcgc gtcgatcccc gctcgaccac taagcgcaac cacccagtgc cgtcgacgc taccgtgacc acggttcac gttcaagctc catgc tcggg gcacgagggg caaccacccg ctacccgaaa gagcatcggg cctgcaattc cggcttcatc gctcgcggCg gtacatcgag ctacacggcg caccatcctc cgagggcgac catggaggag cgggcgcaag ttgcttttga aagatatcga ttttcaagga tttcttatgt tttggtatat accatgactc ctcggctcgg gtgctgatCa gagacgtctc atcacgtcgt ttcggcttcg gtcattcccg tacttgttgc gaataccacg ggccggtaca cgcgaagaac gtcaagccgt accttgcacc cggtcgacca acc gaca tc t gctcagttcc tcgtcgaacg gacccgctct cgcctcatca cgcctgcagc ttctcggact gggcagttcc ctcgatcacc tactaccagt ccggccgatg caatattgt t ttcgtagtgt cgatctattc ttagatccgt gttcgctgat agaagagccc gcatgtccgg tcgaggagtc ttatgaaccg tttattcgac tgttccacaa agc tgccgtg aagccgccat ccgataaaga tgatcgactg cgtgtcgctt tcgacgacat acatgttcga acaacctggt ccgcacagca gggacgccgt cctgcgtcgg tctcccgggg aggcgc tgcg aaaagctttt tccgcctatg ggc tcgtgca tcgacaacga tgttcaacga aggccgcggc 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 WO 01/44447 WO 0144447PCT/EPOO/12347 121 gcgqattcac gccctcattg acgaacgaga ctgcatcacc gcggctgatg caacccgatg gaagtagccg gtttcttaag attacgttaa ttatgattag caaac tagga gccgcctcga ttgagttggt atgaattgtc agtctgtagc cttgaatact aatctcgcgg a ta acgcagg taaaaaaaaa ttactttaat aaaaacttgg ttaggtcctt c taaaaaata cttttttttc taaatcaaga gtattagtat acatagtctt tagaaaagaa agtgaagcag gtcggtcttt agtttcgtga ggggacaagc tactggacgc ttcgcgctgc ctcgagggat attgaatcct gcatgtaata agtcccgcaa taaattatCg ggtaCcggat ggtaatgtaa gggcaacaaa agaagagtga tcttcaatcc gtttattccg cctgaaataa aaaagggaat tgtagactaa atcaaaaaaa tttcccaaca ctcaaatttg ttttctttat agataaacta tc tcta tata aatggaaaga agaaattatt atgtaatgga taaaaacgca taataatcct cgcagctcaa aaacccgcgc tcaaggCgta cccccgaatt gttgccggtc attaacatgt ttatacattt cgcgcggtg t ttggagccaa cagagtagta aatcctgaac ggagaaattt tcatatattc gt tcaacatt attcaaggcc taacaacaac aaaaacatag aaaaCataca attaggttta gtagataagt tagagtagat tcataatcaa tattatgatt atcttttttg tgaggaaaag tgacctaatc cggtggaaaa caactgatat cttcgccaag caactcgaag gccggcagag Ca tcacgacc tccccgatcg ttgcgatgat aatgcatgac aatacgcgat catctatgtt gtctcataaa agaacagaga atcttatttt aagctcttgg ttcttctatg ttttttgttt caactgtttt aacaaaaaaa attttatcat gatcttctaa gagttttgga ttccttattt tagaatcttt catgaaatta gcttattctt aactttttcc tatatacaaa caaccaccac tatgacacgt cttccttttt ccgatgttcg tacagcc tgc gtgaaaaagt cgcatcggCC ttcaaacatt tatcatctaa gttatttatg agaaaacaaa actagatccg cgccattgtg agagagagag agcaaagaga acttgtgaat ttacctgaaa tgagttatta tttttttaag gataaagaaa gaaaaaaaga ttattaactt attaaaccaa taattagtca tatgccaagt aaagaaaaat aatgggttgg ttattgatta aagaaaaata cataggatgt atcatatgat ttgttttggc gcttcgggta tgccggcgat acttcgacta tggcgctgaa tggcaataaa tttctgttga agatgggttt atatagcgcg ggaattagcg gaagaaagtc tgtgagatac aagagttccg tgttCCgcct accggcattt tctgggctta aagttgctgt ataataacaa gaaaagaaat ttcttaaaaa aaagattgtt atggtagata tttgataaat ctcatatata gt taaccaag aattcttcta gaaaaatgtc ttctacttga tcct Lcctt t taaagatatt 7140 7200 7260 7320 7380 7440 7500 7560 7620 7680 7740 7800 7860 7920 7980 8040 8100 8160 8220 8280 8340 8400 8460 8520 8580 8640 8700 8760 8820 8880 ttattctcat taatagaaaa gacggttttg ggcttttggt ttgcgatata aagaagacct WO 01/44447 WO 0144447PCT/EPOO/12347 122tcgtgtggaa gcctaaagcg ctttttgttt tgtataaatt tgattactaa aattaggatt gttttaggtt gcttttgatt gtggatccac ccgtggcggc accgtaacaa gcctgccctg tcctggggtc cggtgctgct tgacggtctg aagcgcacct tgaccgtcga agc tggaagc cgccgcaggt agagctacct ggggctcgca tgcttcccgc gcgcgctcga cagccc tcga cggagcgggc ccagcatgct cgc tcgacga aataaagttt tgttgaatta gggtttttat ga taataat t atctctgcaa ttgattcgta gcttttgaca gatatcgat t t tcaaggacg tcttatgttt tggtatatgt cat ggaacgc ctgcgatccg ggacg tgccc cggctggggt gctcaagcgc cgacctggca gaaccccacg gctcgagagc gctgttcgat ctatctgcag cttctacgat cggccccggt atcggacgac gtacagggcg cgaggpgcga gcgggtcttc gtacgaagtc cggtgagctg atcctgaagc cttaagattg cgttaagcat gattagagtc catcctttcg atctctcgcg tctgatctcc atattgttcg cgtagtgttt atctattcaa agatccgttt t cgctga ttg accttggacc c tgcaggcgc ggtatcgtcg ttcgtcgaag cacggacatg cgcgcgacca gcggccgacg gtgcgcatct gtgtccctgc aaaa tggtcg gagctgcgcc gccgtagaga caaacttatc gtctacgctc gcggtcggta aaggtcctgc gggcaaagcg ctcacgctga ttggatcccc aatcctgttg gtaataatta ccgcaattat tctttttctg actctctctt aatttttgtt tttcgtcaat acatctgtgt ctctttggtg gtttctactt gggtaggcgt gcgcgctcgt gcctgctgcg ccgccgccgc agcccgcgga acctgccgcc cgcagcgcag cga tggcggc ggtcgcccga aatcgatcgt ccttctacga tgcccctctt gagaattcaa ggttctccgg cgcgggacga tgcgcttccg gccccgaaat cgtatgccgc cgaa tt tccc ccggtcttgc acatgtaatg acatttaata actcttcaat tcaaggtata atgtggatta ccagcttcta aatttcttgc ttctttgttc ttgttttgat gttctattgt attcgcggcc tctgcaactg cgagttcctt gatgcgggac ggtggtgccc gcgcgagacg ctacaccggg cctcgaggcg gttcgcgcaa ctacgcgtac accgattcga cgtgctggag agagacgtac ggagccggcg gcacgtccgg ggcgcc tcac cggcagcggg gcggtcccgc cgatcgttca gatgattatc catgacgtta cgcgatagaa ctctcccaaa ttttctgatt ttgaatcttt aattttgtc ttgattgtga gattctctct ttctcttacg tttatttcag acccacgctg ccgggcctga ccggtgcgcg atcgggttct gggcttgagt ctcctgcatg ctgcccgacg gccatcgcgt aggtgcgacg cgcttcatct gtcgggggcc cacgtcctct ctgccctatg ctcatcgacc gctgggctga ctcaaattgg gggtacgcgc gtccgcgccg aacatttggc atctaatttc tttatgagat aacaaaatat 8940 9000 9060 9120 9180 9240 9300 9360 9420 9480 9540 9600 9660 9720 9780 9840 9900 9960 10020 10080 10140 10200 10260 10320 10380 10440 10500 10560 10620 10680 WO 01/44447 WO 0144447PCT/EPOO/12347 -123agcgcgcaaa t tgggtaccg ggtggtaatg gtcgggcaac agcagaagag acttcttcaa cgggtttatt aggcctgaaa aaaaaaaggg aattgtagac tggatcaaaa ctttttccca atactcaaat ttcttttctt agaagataaa tattctctat cttaatggaa gaaagaaatt cagatgtaat ttttaaaaac tgataataat cattaataga gaagataata gcgatctctg tttttgattc attgcttttg taagatatcg attttcaagg gtttcttatg atttggtata ctaggataaa gat ttggagc taacagagta aaaaatcctg tgaggagaaa tcctcatata ccggttcaac taaattcaag aattaacaac taaaaaaaca aaaaaaacat acaattaggt ttggtagata tattagagta ctatcataat atatattaig agaatctttt atttgaggaa ggatgaccta gcacggtgga cctcaactga aaagacggtt attcatcctt caaatctctc gtatctgatc acaatattgt attcgtagtg acgatctatt tttagatccg tgttcgctga ttatcgcgcg caagtctcat gtaagaacag aacatcttat tttaagctct ttcttcttct att ttt t ttg gcccaactgt aacaacaaaa tagattttat acagatcttc ttagagtttt agtttcctta gattagaatc caacatgaaa attgcttatt ttgaactttt aagtatatac atccaaccac aaatatgaca tatcttcctt ttgggctttt tcgtcttttt gcgactctct tccaattttt tcgtttcgtc tttacatctg caatttttgt tttctctttg ttggtttcta cggtgtcatc aaacgcca tt agaagagaga tttagcaaag tggacttgtg atgttacctg ttttgagtta tttttttttt aaagataaag ca tgaaaaaa taattattaa ggaattaaac ttttaattag ttttatgcca ttaaaagaaa ct taatgggt tccttattga aaaaagaaaa caccatagga cgtatcatat tttttgtttt ggtttgcgat ctgactcttc ctttcaaggt gt tatgtgga aatccagctt tgtaatttct gttttctttg gtgttgtttt cttgttctat tatgttacta gtggaagaaa gagtgtgaga agaaagagtt aattgttccg aaaaccggca ttatctgggc aagaagttgc aaaataataa agagaaaaga cttttcttaa caaaaagatt tcaatggtag agttttgata aatctcatat tgggttaacc ttaaattctt atagaaaaat tgtttctact gattcct tcc ggctaaagat ataaagaaga aat ctCt ccc atattttctg ttattgaatc ctaaattttg tgcttgattg ttcgattctc gatttctctt tgttttattt ga tccggga a gtcttgagtt tacatgaatt ccgagtctgt cctcttgaat tttaatctcg ttaataacgc tgttaaaaaa caattacttt aataaaaact aaat taggtc gttctaaaaa atactttttt aattaaatca atagtattag aagacatagt ctatagaaaa gtcagtgaag tgagtcggtc tttagtttcg attttattct ccttcgtgtg aaagcctaaa attctttttg t tt tgta taa tcctgattac tgaaattagg tctgttttag acggcttttg caggtggatc 10740 10800 10860 10920 10980 11040 11100 11160 11220 11280 11340 11400 11460 11520 11580 11640 11700 11760 11820 11880 11940 12000 12060 12120 12180 12240 12300 12360 12420 12480 WO 01/44447 WO 0144447PCT/EPOO/12347 124 caccatgaac cgacgcaacc ggacaagccg ggggcgggcC gcgga tcaag ccagtgcgtt cggggcgcgt cggc tccccg cgactttatg gaacttctac actcaagctc cgcgtggttc gctgtcacgc cggcgggtgc tgtgacgccg gggcggcatc cgcggggtac caagtacgac cgcaagtgag ataaagtttc gttgaattac ggtttttatg gcgcgcaaac tccggaccgc ccgcggccgc gtt tgtatga aaagaatgtt attggactga gaattaaata ttcaccaact gacattcaat acgcgcc tgg accgagt tga gtggtgatgg gacgggtgca cacatccccg cagccgacgt ctgccgc tgc cacctgcact gacgcgcagc ttcgacgatt gg tgccggga gcgctcggcc gtcatgaccg gtgagcgaag ctgctccgcg gacgticaaaa aagctcgtgc cggtgaagct ttaagat tga gttaagcatg attagagtcc tagga taaa t gctctagtgc ctcgaggtac ac tgatgatc ttgtgtatca acacgagtgt acaagaataa tgatacaaaa tggatcaagc ccgcgagctg cgctcttcgg accgccactg tccagtgccc gccataacca tggtcaccgc acccgctgcc tcgcgttcga acgcaacccc ggcgccagtg tcgacttcac tgaacatgtc tcgccctgga gcaagaacg t cgaccgactt tctggaacgg tcaagtaccg tggatccccc atcctgttgc taataattaa cgcaattata tatcgcgcgc gatcgctttt catcaggata taggaccgga ttcttgttac taaatatgga atcgagtcac gtcattatcc gagcgtcaag gtacgtcgcg ccgtccgtgc ctcgcacc tg gtttcaccac ggcggtgcgc cgagcgatac cgaaatctcc gacgaccacg ggtgcacgca gccggaggtt cgtggaccgg gcagatgaac cggagacgtc catgcacatg cgtgctgttc aatgaagccg ggcgttctat gaatittcccc cggtcttgcg catgtaatgc catttaatac ggtgtcatct ttaattaatt ttcttgctta taagttccct attgttatta ccaggcccca caaaccactt tatgcaaatc aagcgtccct atgcgc tcca gtggcgtggc ggcgcgaacc tggcggtacg cagc tggagc ggctacgtgt gcggccgatg gcggtcttgc ctcccgatct gagtcgctgg tacttcggcc ctgcacttcg aaatacaagc ctcatctcga gggc tgcaga gacggcggcg cgaggc tggg ga Lcgt tcaa atgattatca atgacgttat gcgatagaaa atgttactag ttaagctttc agatgtitgaa tcttcatagc atgaaaaaat aataagatcc gcct tt ttta aataatcata cgggcgcgta acgagc tcaa gcggagccac tggc tgacgg acgaacaggg cggtgccgcg gggtctggta tcgacaacgg ggatcgtcga cggccttcga ccctggcggg ccctcggcat atggctaccc tgctccagtg tcaagaaggt ccaggcaggc gcgcgtacag tcgaccgcgt acatttggca tctaatttct ttatgagatg acaaaatata atccgggaat tagaggccgg ctctatggag gaacttattc attattggtc attigatatat acgagacttg caaaaatatc 12540 12600 12660 12720 12780 12840 12900 12960 13020 13080 13140 13200 13260 13320 13380 13440 13500 13560 13620 13680 13740 13800 13860 13920 13980 14040 14100 14160 14220 14280 WO 01/44447 WO 0144447PCT/EPOO/12347 125 caataacact gttacttttc aaaaaacaaa caatgcagtg aaa taaaacg gatcttatga agtggttgca tcaacctaaa acgtgtcatt aattcagatt cggaaccatg atatcgtgtc ggtagtgatg agggtttatc ggaccgcatc gcgcgatgat ccgctcgatt gggcgggcgt gcatcctggt tactggcacc ctatattgcc taatgcgcgg atttccccga gtcttgcgat tgtaatgcat tttaatacgc tgtcatctat caagtctcat gtaagaacag aaaaaattaa caagaaattc aaggaaaaga ggacccacgg ataatgctaa cgaccgttag gccggcacac aataaggcaa ttattattag tcttccttct tcaatttctc acaaccttiaa cgca tcgtgc ga tgagcgcg gagc tgcata ctcaaagatc gaagagcgtc ttgctgacag gaagagcagc ctgcaagtgg gtgttlaacgg ggacgttttg gaagatcgcc tcgttcaaac gattatcatc gacgttattt ga tagaaaac gttactagat aaacgccatt agaagagaga aagaaatgga actgatttta aataaagcac ttcaattatt aaaaatataa aaattgtggt acgagtcgtg ttagccaaaa ctattgcttc tcttctataa aaaatcttaa gc tgtaaagt cagacgcggc acaaacgtcc ttggcgcttc atcaaatcgt cgatgatttt cgttggcgcg atctgtatga tgccggtggt cggtattgca agatggcgaa tgtttggcga atttggcaat taatttctgt atgagatggg aaaatatagc ccgggaatta gtggaagaaa gagtgtgaga taatttcaca taagcccact gaagaattct gccaattttc a tcgt aacga tgtcgacgag tttatcaact acaactttgc accgccttag aacaataccc aaactttctc gacctcggta cttttctttt gttctcaatg tgaaatcaac ggtcgacatt gattgcgggc taacccaaac tctctgcgag tgaacaaccg ggatcacggt aattgcccgc tgcgtttgca aaagtttctt tgaat tacgt tttttatgat gcgcaaacta gcggccgcct gtcttgagtt tacatgaatt atatgttata tgcattagat agaaaatacg agctccaccg tcgttaaatc tcagtaataa caaagcacaa gtgtaaacaa ctttctcgtg aaagagctct tcaattctct gaagctatca cgtgctggtc gcttcgacgc ctttacgcga ccccacggag ggcaccgggt cgtgatatca cttgaggcgc gaagcgggct acgcitggcag gatctgtttt tttatctgag aagattgaat taagcatgta' tagagtcccg ggataaatta cgaggtaccg ggtggtaatg gtcgggcaac cgataaagaa aaatggcaaa aaatacgctt tatatttaaa tcaacggc tg acggcgtcaa atacttttcc cgctcaatac acctagtcgt tcttcttcac ctaccgtgat cgga taccgt agtatttgat cgga tgaaaa aagcagtcat aagcgtggct tctcttatgc ccatttactg tttcgttgaa ggcgtgggcg agcatgatat gcagtgagcg gatcccccga cctgttgccg ataattaaca caattataca tcgcgcgcgg gatttggagc taac agagt a aaaaatcctg 14340 14400 14460 14520 14580 14640 14700 14760 14820 14880 14940 15000 15060 15120 15180 15240 15300 15360 15420 15480 15540 15600 15660 15720 15780 15840 15900 15960 16020 16080 WO 01/44447 WO 0144447PCT/EPOO/12347 126 aacatcttat tttaagctct ttcttcttct attttttttg gcccaactgt aacaacaaaa tagattttat acagatettc ttagagtttt agtttcctta gattagaatc caacatgaaa attgcttatt ttgaac tttt aagtatatac atccaaccac aaatatgaca tatcttcctt ttgggctttt tcgtcttttt gcgactc tc i tccaattt tcgtttcgtc tttacatctg caatttttgt tttctctttg titggtttcta cccagaacga caccatcgtc accgcaggag ttiagcaaag tggacttgtg atgttacctg ttttgagtta tttttti aaagataaag catgaaaaaa taattattaa ggaattaaac ttttaattag ttttatgcca ttaaaagaaa cttaatgggt tccttattga aaaaagaaaa caccatagga cgtatcatat tttttgttt ggtttgcgat ctgactcttc ctttcaaggt gttatgtgga aatccagctt tgtaatttct gttttctg gtgttgtttt cttgttctat cgcccggccg aaccactaca tggacggacg agaaagagtt aattgttccg aaaaccggca ttatctgggc aagaagttgc aaaataataa agagaaaaga c tt tc taa caaaaagatt tcaatggtag agtttgata aatctcatat tgggttaacc ttaaattctt atagaaaaat tgtttctact gattccttcc ggctaaagat a taaagaaga aatctctccc a tatttt c ig ttattgaatc ctaaattttg tgcttgattg ttcgattctc gatttctct tgttttattt acatccgccg tcgagacaag acctcgtccg ccgagtctgt cctcttgaat ttaatctcg ttaataacgc tgttaaaaaa caattactt aataaaaact aaattaggtc gttctaaaaa atactttt aattaaatca atagtattag aagacatagt ctatagaaaa gtcagtgaag tgagtcggtc tttagtttcg attttattct ccttcgtgtg aaagcc iaaa attctttttg ttttgtataa tcctgatiac tgaaat tagg tctgttttag acggcttttg caggtggatc tgccaccgag cacggtcaac tctgcgggag agcagaagag acttcttcaa cgggtatt aggcctgaaa aaaaaaaggg aattgtagac tggatcaaaa ctttttccca atactcaaat ttctttctt agaagataaa tattctctat cttaatggaa gaaagaaatL cagatgtaat ttttaaaaac tgataataat cattaataga gaagataata gcgatctctg t tttigattc attgctttg taagatatcg attttcaagg gttcttatg atttggtata tgttggggat gcggacatgc ttccgtaccg cgctatccct igaggagaaa tccicatata ccggttcaac taaattcaag aattaacaac taaaaaaaca aaaaaaaca t acaattaggt ttggiagata tattagagia ctatcataat atatattatg agaatc t ii atttgaggaa ggatgaccta gcacggtgga ccicaactga aaagacggt t attcatcct caaatctcic gtatctgatc acaatattgt attcgtagtg acgatctat tttagatccg tgttcgctga ctaccatgag cggcggtctg agccgcagga ggc tcgtcgc 16140 16200 16260 16320 16380 16440 16500 16560 16620 16680 16740 16800 16860 16920 16980 17040 17100 17160 17220 17280 17340 17400 17460 17520 17580 17640 17700 17760 17820 17880 WO 01/44447 WO 0144447PCT/EPOO/12347 -127 cgaggtggac ctacgactgg gggctccacg ggtcgctgtc tgccccccgc tttctggcag gatcccccga cctgttigccg ataattaaca caattataca tcgcgcgcgg tgctctagag tctgttgccc atgtgttatt ccagccaaca catcagtccg tcgaagggcc ctc tggagct tccaagccgt cagttcgtag gtgcccgctt gaccccacaa accaggccgc acgcgggtgg tcccggtgcg ttctcccata atcaggacc t agcgacaccg aggcgcgaca ggcgaggtcg acggccgagt ctctacaccc a tcgggc tgc ggcatgctgc ctggacttca atttccccga gtcttgcgat tgtaatgcat tttaatacgc tgtcatctat gcgcgcccc t gtctcactgg aagttgtcta gctccccgac ggacggtcga ccctagtcca ttcttcaggg cgaatctgag agcgcgccgt gttcctgaaa ggccctagcg tgcctcgcaa aatccgatcc agctgaaata tgaatttcgt ggcaacggga attccaggtg ggcattcctc ccggcatcgc cgaccgtgta acctgctgaa ccaacgaccc gggcggccgg gcctgccggt tcgttcaaac gattatcatc gacgttattt ga tagaaaac gttactagat agggagcttc tgaaaagaaa agcgtcaatt cggcagctcg cctgcaggca tgggcttttt ccgacaatcg ccttaatcac gcgtcccgag tgccagtaaa tttgcaatgc ctcttcgcag gcacatgagg gtcgaacatc gtagtggtcg cgttttcttg cccaacgcgg ggccttcgtg ctacgcgggc cg tctccccc gtccctggag gagcgtgcgc cttcaagcac accgccccgt atttggcaat taatttctgt atgagatggg aaaatatagc ccgggaattg tgcagacgcg aaccacccca tgtttacacc gcacaaaatc tgcaagctca ctcctcgtgc gatctcgcgg aattgtcaat cgatactgag gcgctggctg accaggtcat gcttcgccga cggaaggttt cgtcgggccg ccagcaaaca ccacggtcca tcggacgtga taataccggc ccctggaagg cgccaccagc gcacagggct atgcacgagg gggaactggc ccggtcctgc aaagtttctt tgaa ttacg t tttttatgat gcgcaaac ta ggtacccaat tcgacgtcat gtacattaaa acaatatatc accactcgat cgtagtgtac tcgtaaacgg aaatcctgca tttaatcctc cgaagcaagt ctgaaccccc cat tgac cc a cctgctcgcg ccagcttgag tcggcgacag gcac gac ga t ggacgcggaa agcccatcgc cattgatcga cacgcaacgc ggacgggac t tcaagagcgt cgctcggata atgacgtggg ccgtcaccga aagattgaat taagca tgta tagagtcccg ggataaatta tccggaccgc atggatccga aacgtccgca ctgccaccag acaggcagcc gtaa tcgat t acccgaacat cgtcggccgc tgtttatcgg gcgtcgagca agccggaac t ggcgtgttcc ccacttcttc cgggtacggc cttgcggtac ttcctcgtcg gcggtgcagc cgtcgcctgt ccagcccagg 17940 18000 18060 18120 18180 18240 18300 18360 18420 18480 18540 18600 18660 18720 18780 18840 18900 18960 19020 19080 19140 19200 19260 19320 19380 19440 19500 19560 19620 19680 tcctggcaaa gctcgtagaa cgtgaaggtg atcggctcgc cgataggggt gcgcttcgcg WO 01/44447 WO 0144447PCT/EPOO/12347 128 tactccaaca taggtgatct gggattttct cgcatcgtgt tgcttcgtgt tcgccggcgg ttcgccaaac gcgggcaggg tggacca tcg gcgatggttt ttccggtcaa gcaatgtgcc ttatcggcaa cgaatcttgc gcctgagagc tcgttgcgcc ctcccaatca gatatcctcc gcttctccca tcccaggtcg atacagctcg ggccagatcg atagggacaa gataatcttt ctcactcatg aggcagcttt ccctttatac atatacctta ttttttcaat cagtatttaa cctgctgcca tcacgtcctt tgttgcgcgt ccggccacgg gtttcagcaa tttttcgctt ctgccgcctc cagggggagc agccgacgga cggcatcctc acgtccgatt cttattcctg tgaagtcggt cctgcacgaa caaaacactt acatctaggt ggcttgatcc ctgatcgacc agatcaataa ccgtgggaaa cgcggatctt ttattcagta tccgatatgt tcagggcttt agcagattgc ccttccagcc cggctgtccg gcaggagaca tccggtgata agatacccca caccagttcg gttgacgtgg ggtgaacagg cgcaatatcg cgcggcctgc cttggtcgtc ctgttcgaga cagttgcacg ctggaaggtt ggcggaaaac cattcaccct atttgacccg cccgtagacc taccagcgac gatgcggaag actaaaacaa ccagtaagtc ggacgcagaa agccacttac agacaagttc taaatggagt agtaatccaa cgatggagtg gttcatcttc tccagccatc atagcatcat tcatttttaa ttccttccgt ttctcatttt agaagctaat tcatcgtcgg aaaatgacct gcagagcggg aacaaggaaa ttggcctcgc atagttcctc cgacgcgaac ctgtcgcgct tcgcggggcg cccgcgtcga ccttgcggga cctggtgcc t gtctggccgt cccttgccca aagtcggtgc ttcatccagt aaaaaatagc ggcaatgtca tttgccatct ctcttcgggc gtcttcttcc ttcggctaag aaagagcctg atactcttcc atgccgt tca gtccttttcc atataggttt atcttttacg agccattta t tataacaaga cccgcagctc tgttttgcag ccgtgtcgtt gctgcatttc tgacctgttt gcgtgtcga t gctccacggc cgatcttggc cacgcatgac tcagttcttg ttgccccgac tggtgtccag ccttctcgta aatacttgcc gctcctgctt aaaatatiaat tcgacatact taccacttgt ttcacaaaga ttttccgtct cagttttcgc cggctgtcta atgcactccg gagcaaagga aagtgcagga cgttccacat tcattttctc cagcggtatt tatttccttc cgaac tccaa gacgccggtg cgcctcgcgc tggcatcgct cttgatctgc tgccaggtcc ggtcatcgac ggccgatggc cgtagcttgc ggtgcggctt cctgtatgcc tcacgccggg ataatccacc cttggtattc gtgggcctcg gtcgccggca attttatttt gttcttcccc ccgccctgcc tgttgctgtc ttaaaaaatc aatccaca tc agctattcgt catacagctc cgccatcggc cctttggaac cataggtggt ccaccagctt tttcgatcag ctcttttcta ttcactgttc 19740 19800 19860 19920 19980 20040 20100 20160 20220 20280 20340 20400 20460 20520 20580 20640 20700 20760 20820 20880 20940 21000 21060 21120 21180 21240 21300 21360 21420 21480 WO 01/44447 WO 0144447PCT/EPOO/12347 -129cttgcattct gcgtataaca acttactgat agctgtccct catcagcgct gcttctcaac cgggcaacag Lcaggccgca aaatggacga cgtatgacag cgctggggcg gctggccgct cgcagcgaat agtcgctgtc acataaaaca taaggttatt ctatagatat cgatatcttc tctgcctcct tagagtaatt acctcaaatg ctatgccaag cgacggccga ggtcgc tgaa ggctga tcgc ccatttttgg ccgcgt tagc cacgcgcaca ggttaaaaga tttctgcctg aaaaccttaa tagtatcgac ttagtgtatg cctgttcagc atctctgctc ccggtacgca cccgcattat gtcgg taacc acagtggggc tctccggaag tcttatgagc gta tgaatcc tgagcggcat gttctcaaaa ctatcaataa g tcc tgggtt attgataagc tatataaaag catcctcttc ctgtaaaggt gttcgctggg aatgcccaag agtgaagggc tgtcga tgcc ccatcccgtt ggtgaggccg gggccgggag gggcgcagcc caggttagcg tggacagccc ataccagaaa ggagccgatt atggtgtttt tactgacggg tcactgccgt ccagaaaatc gggcgt tggc tcgcgcatac tatgtcgggg acggttgttg ctgctgtcac cgcc tgaagg aacc Lgaatc tcgg tggagc gttggagtca tcaagcatta gcgctgccta atatattatc atcctcttcg ccaattctcg tttatcgcac gtaaaaattg aggccgccac agcacctgcg actgccccga ttcgcggccg ggttcgagaa ctggt Laaaa gtggccgaaa ctcaaatgtc acagcttttt ttgaaaccac tgaggtgctc gtggtgcgta aaaacatggc attgatatgg ctcaacacga agccgggcag ctaaatcgcg cgcacgtatt cc tt tgacg t gaaagctgca tgaggcagca tgcatgacaa ttacccaatt gtccatgcaa tgccttgccc ttatcagtat tct tggtagc ttttcatacc ccccgaacac ccggccccgc ccaggccgcc gcacgtcaat tcccggcaat aggggcgcag gggggggcac acaaggttt a aacgggcgga aataggtgcg caaagttgtt aattatgggt cagtggc ttc acggcaaaag aactgcagtt ccatgaatgg ttttacgtca tgacg Lcatc ccagcgctgg cggtgaacgc ggtgatatgg cgtaatcagc cctggcacgg agtca tcggg atgatagaat gtttttatgc cctgaaatcc tgtcaatata tttttaaata tcggtataat gagcacggca catgaagtcc gccctcactg gcttccgggc ggcaaggact cccc tggggg cccccttcgg taaatattgg aacccttgca cccctcatct ttcaaagttg gatgctgcca tgtgtctatc caccgccgga cacttacacc cgt tggatgc cttaaaaaac gtctgcgcgg ctgttttacg actatggcga atgacggatg aagcgatata ctgggacgga cattatctga ttacaagcta tttgcccatt ttacatacgg ttcaaggcaa tggcgcttca cttacctatc cccgcgacca gtgaatgccc cccggcacct gtcgcgc tcg gccagcgctg gatgggaggc cgtgcgcggt tttaaaagca aatgctggat gtcagcactc 21540 21600 21660 21720 21780 21840 21900 21960 22020 22080 22140 22200 22260 22320 22380 22440 22500 22560 22620 22680 22740 22800 22860 22920 22980 23040 23100 23160 23220 23280 WO 01/44447 WO 0144447PCT/EPOO/12347 130 tgcccctcaa caataccgca aatcaggcgt gcctgcccct gcccctcatc cggtgtctcg gccagcccag ttgctcgtcg ggggacgtgc gctctgccct cgatcttcgc cggtgagcca gctcgcggac gcaggtaggc cgtctggaag cagccatccg gattcccgtt cgggtgggcc ctacacgaac aaatcgctat gggagaaagg gagcttccag cttgagcgtc aacgcggcct gcgttatccc cgccgcagcc aaggccgcca aagcccgtag tacatggctc cctttctcgg gtgtcaagga gggc act tat tttcgccgat catctgtcaa tgtcagtgag cacacggctt cggcgagggc gtgatgtact ttggcaatca cgggcggacc cagcagggcg gagtttcagc gtgctcatag cgacaggctc gcagtacacc cttgccctca gagcaccgcc tacttcacct cctttggcaa aatgaccccg cggacaggta ggggaaacgc gatttttgtg ttttacggtt ctgattctgt gaacgaccga gagaggccga cgggc tgc ta tgctgtagtg tccttcaacg tcgcgcccct ccccaggctt ttgcgaggct cgccgcgccg ggccaagttt cgacggcgtt aaccagcccg tcaccagctc cgcgcacccc acgcccatca aggatcgtgg aggccgccca tccacgacgc a tgccggccg ttgataggtg tctgttacgc aggtgcgaat atcctgcccg aatcctgtat aagcagggtt tccggtaagc ctggtatctt atgctcgtca cctggccttt ggataaccgt gcgcagcgag gcgcggccgt cgggcgtctg agtgggttgc ttcctgacaa catctgtcag gtccacatca ggccagctcc ggtgagtcgg tccgcgaggt tctggcgcgt gtgagcgtcg cgcgaagtcg ccggccgttt tgacct tgcc catcaccgaa ggcggcccag ccgtgatttt ccgccgcctt ggctgccctt cggcggtagc aagggacagt gctgacgccg atcgtgegaa atgcagcgga ggcagggtcg tatagtcctg ggggggcgga tgctggcctt attaccgcct tcagtgagcg gaggcttgga acgcggtgga gctccggcag cgagcctcct tagtcgcgcc tctgtgggaa acgtcgccgg cccc tcaagt atccacaacg ttgcagggcc caaaggcgct ctcttcttga tagcggctaa aagctcgtcc ccgcgccgtg gtcgccattg gtagccctgg ttcctcaatc cctggttggc cggccagcct gaagaaggaa ttggatacac aaaggatgga aaagcgccac gaacaggaga tcgggtt tcg gcctatggaa ttgctcacat ttgag tgagc aggaagcgga cgc tagggca aagggggagg cggtcc tga t tttcgccaat cctcaagtgt actcgcgtaa ccgaaatcga gtcaacgtcc ccggcggccg atagacggcc cggtcttgcc tggagcgca t aaaagtcatg tgcttctctt cgcgggtcgt atgcgggcca ccgacggcca gctcttcgtt ttggtttcat cgcagagcag cacccgc tcg caaggaaagt tataccgaaa gcttcccgaa gcgcacgagg ccacctctga aaacgccagc gttctttcct tgataccgct agagcgccag gggcatgaaa ggatgttgtc c aa tcg tcac ccatcgacaa 23340 23400 23460 23520 23580 23640 23700 23760 23820 23880 23940 24000 24060 24120 24180 24240 24300 24360 24420 24480 24540 24600 24660 24720 24780 24840 24900 24960 25020 25080 WO 01/44447 WO 0144447PCT/EPOO/12347 131 tcaccgcgag cggcccgcaa cgctgtcgcC gcgcat tgac cggccgttte ggtaggcgag cgtcgtcggc cgtcgagcag accgttccgc gggcggcacg taaacataat gcggaggctg cactgtcgcg gcgcgatctg tgcgttggtg gcggccaatc tccctgctcg cagcggcgag ggcCtgctcc ggcgtccccg catctgcggt.

cagcgcctgc tctcggcacc Cgcccgcttg cagtttgcgt gatcactgta atgtccacca gtccggaggc ctcgacgctg gttcactcga caatttgcct ttgctcgtct aacgctgcgt.

agcggagcc t tcaagcacgg gccgaaaaac gcgcccggtc ctgaagctgc gaatgcgtat ttcctgaagt g tc g tcaga c ttcggctgca acttatcagt cagacgtgaa tcggcatcgg acgacgtcac gcgcacctgt cgc tggccgg ccgga cc ggc gt tcaacgg t ccccaacagt ccgcctcgca gcgtgccggc gggcattccC gat tc tccgc gccagtaaag cgtctacgcc actttgtcat gataaagaat acccaacata cctgattatg cgcccactat gctgggcgcg cgccagatc t tcgtcgaag gccgccgcgC gaagtagctg gaggaagcga atggatgcgc gatcagaaat cagcatggct cgccggctgc gacctcgttc gcttgacact ccgcgcgttc cccCtgatcg ccggtgctgc ggcattctgc ctgtcggatc gcgtctatcg tcgccggcat.

attgtcatca agctgcgcgt gcgccatcgc gagcgccagt tcggccagtg tgaaccccca aacaggtcca ttatcactga aatcggacca taattctgag cgggcctcct, tggcgc tgta gtttcgggcg 25140 25200 25260 25320 25380 25440 25500 25560 25620 25680 25740 25800 25860 25920 25980 26019 <210> <211> <212> <213> <220> <221> <222> <220> <221> <222> 20119

DNA

synthetic promoter (229)..(1960) exon (1962)..(2160) WO 01/44447 WO 0144447PCT/EPOO/12347 -132- <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> misc-feature (2160).. (2228) plastid targeting domain gene (2260)..(3960) PrnC terminator (3966) (4241) promoter (4245) .(5971) exon (5984).. (6182) misc-feature (6183).. (6251) plastid targeting domain gene (6282).. (7373) WO 01/44447 WO 0144447PCT/EPOO/12347 133 <223> prnD <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <220> <221> terminator (7379) (7639) promoter (7739) .(8739) exon (8745) .(8943) misc-feature (8944).. (9012) plastid targeting domain gene (9037) (9743) fre terminator (9755).- (10036) promoter WO 01/44447 WO 0144447PCT/EPOO/12347 -134- <222> (10049).. (11385) <220> <221> <222> <220> <221> <222> <220> <221> <222> I nt ron (11383) (11779) gene (11796) (12338) terminator (12345) (12626) <400> tggggaaccc ccttttaaat tatcc tgtca tctagtcgta caagtctcat gtaagaacag aacatcttat tttaagctct ttcttcttct attttttttg gcccaactgt aacaacaaaa tagattttat acagatcttc ttagagtttt tgtggttggc atccgattat aacactgata cgttttgcga aaacgccatt agaagagaga t ttagcaaag tggacttgtg atgttacctg ttttgagtta tttttttttt aaagataaag ca tgaaaaaa taattattaa.

ggaat taaac atgcacatac tctaataaac gtttaaactg tcgcactaga gtggaagaaa gagtgtgaga agaaagagt t aattgttccg aaaaccggca ttatctgggc aagaagttgc aaaataataa agagaaaaga cttttcttaa caaaaagatt aaatggacga gctcttttct aaggcgggaa gcggccgcc t gtcttgagtt tacatgaatt ccgagtctgt cctcttgaat tttaatctcg ttaataacgc tgttaaaaaa caattacttt aataaaaact aaattaggtc gttctaaaaa acggataaac cttaggttta acgacaatct cgaggtaccg ggtggtaatg gtcgggcaac agcagaagag acttcttcaa cgggtttatt aggcctgaaa aaaaaaaggg aattgtagac tggatcaaaa ctttttccca atactcaaat cttttcacgc cccgccaata gatctatcgt gatttggagc taacagagta aaaaatcctg tgaggagaaa tcctcatata ccggttcaac taaattcaag aattaacaac taaaaaaaca aaaaaaaca t acaattaggt ttggtagata 120 180 240 300 360 420 480 540 600 660 720 780 840 900 agtttcctta ttttaattag tcaatggtag atactttttt ttcttttctt tattagagta WO 01/44447 WO 0144447PCT/EPOO/12347 -135 gattagaatc caacatgaaa attgcttatt ttgaactttt aagtatatac atccaaccac aaatatgaca tatcttcctt ttgggctttt tcgtcttttt gcgactctct tccaattttt tcgtttcgtC tttacatctg caatttttgt tttctctttg ttggtttcta ttttatgcca ttaaaagaaa cttaatgggt tccttattga aaaaagaaaa caccatagga cgtatcatat tttttgtttt ggtttgcgat ctgactcttc ct ttcaaggt gttatgtgga aatccagctt tgtaa t ttc t gttttctttg gtgttgtttt cttgttctat agttttgata aatctcatat tgggt taacc ttaaattctt a tagaaaaat tgtttctact gattccttcC ggctaaagat ataaagaaga aatctctccc atattttctg ttattgaatc ctaaattttg tgcttgattg ttcgattctc gatttctctt tgttttattt aattaaatca atagtattag aagacatagt ctatagaaaa gtcagtgaag tgagtcggtc tttagtttcg attttattct ccttcgtgtg aaagcctaaa at tc tttttg ttttgtataa tcctgattac tgaaattagg tctgttttag acggcttttg caggtggatc agaagataaa tattctctat c ttaatggaa gaaagaaatt cagatgtaat ttttaaaaac tgataataat cattaataga gaagataata gcgatctctg tttttgattc at tgc t t tg taagatatcg attttcaagg gtttcttatg ctatcataat atatattatg agaatctttt atttgaggaa ggatgaccta gcacggtgga cctcaactga aaagacggtt attcatcctt caaatctctc gtatctgatc acaa tat tgt attcgtagtg acgatctatt tttagatccg 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1976 2024 2072 2120 2170 2230 2290 2350 2410 aag aag aac aat ggc ttc ctc tat gct ctc ttc Lys Lys Asn Asn Gly Phe Leu Tyr Ala Leu Phe 15 ctc tcc ggc tca ggc cac tat ggt cgc tcc ttt Leu Ser Gly Ser Gly His Tyr Gly Arg Ser Phe 30 ctc cgc tgc ctt ccc agc cac ccg caa ggc taa Leu Arg Cys Leu Pro Ser His Pro Gin Gly 45 cat cac aag caa cgg cgg aag agt taa ctg cat His His Lys Gin Arg Arg Lys Ser Leu His ttggaaagaa gaagtttgag actctctctt accttcctga gtcgcgtcaa ctgcatgcag gctagcatga ctcagaagag gcaatcactt cgacgtaatc atcctcggct cgggcatgtc tcttggccaa acaacagttt cgcgtgctga tcatcgagga atttggtata tgttcgctga a gtc aca caa aga gta Val Thr Gin Arg Val 1 cgc tac tat ggt tgc Arg Tyr Tyr Gly Cys caa cgg act taa gtc Gin Arg Thr Val caa cga cat tac ttc Gin Arg His Tyr Phe gca ggt g tggcctccga Ala Gly ccttaccgat tctgcaggag ccccgcgaac gaacacgata cggcacccag atgggggcca gtcgtcgcac ccgcggttca WO 01/44447 WO 0144447PCT/EPOOI12347 -136cgatcggcga acggcattcc cgagcacggg acccgaagga attaccggca tccaccagaa ccgcccaggg cgctcgcgac gcctctacac agcgctggcg tgattccgtt tcgacccgcg tcgcgcggtt tcaagaccga tgc tgcacgc tgaccatcca ccgagcgctt tcgtcagctg tgtgggcggt gcgcgtcgcg acctgtgcgc aggccgtgag ttgacgaacg agccgcagct cgcaaacccg tgctcaaggc aatttccccg ggtcttgcga atgtaatgca atttaatacg atcgtcgatc ggagctcgac cattaagcgc gttcacccag agacgtcgac aactaccgtg cgaacggttc caagt tcagg gcacatgctc ctggcacgag caacaaccac tgtctacccg cccgagcatc ccgcctgcaa gaacggc ttc cgcgctcgcg cgagtacatc ctgctacacg cggcaccatc caacgagggc ggacatggag tgccgggcgc agacttcgcc caacaactcg cgcgccggca gtacatcacg atcgttcaaa tgattatcat tgacgttatt cgatagaaaa cccgagacgt cacatcacgt aacttcggct tgcg tcatt c gcctacttgt accgaatacc accggccggt ctccgcgaag ggggtcaagc gggaccttgc ccgcggtcga aaaaccgaca ggggctcagt ttctcgtcga atcgacccgc gcgcgcctca gagcgcctgc gcgttctcgg ctcgggcagt gacctcgatc gagtactacc aagccggccg aagccgatgt aagtacagcc gaggtgaaaa acccgcatcg catttggcaa Ctaatttctg tatgagatgg caaaatatag ctcttatgaa ccgcatcatc gctgatcgct cgttttattc tcgtgttcca ccgagctgcc tgcaagccgc acaccgataa acatgatcga aaccgtgtcg cgttcgacga accacatgtt ccaacaacct tctccgcaca tccgggacgc acgcctgcgt tcttctcccg tcaaggcgct agcaaaagct acttccgcct tccggctcgt acctcgacaa agttgttcaa atgaggccgc tcggct tcgg tgctgccggc agtacttcga gcctggcgct taaagtttct ttgaattacg gtttttatga cgcgcaaact gacgcaacgt caagcccggc gtgggggccg cattaaatac agacggcgtc c tgcggagga C ttcaagacg catcttcaag cgagggcggc ggtgagcgtc gcaggaattc cgtgccggtg cggcgaccgc ggggc tggaa gcgcgacgac tttggaccac atgggacgcg gcaggcccac cgaccctccg cgacgccaaa ggcgcggatt gtactgcatc gatgcggctg c tacaacccg gaagaagtag taagattgaa ttaagcatgt ttagagtccc aggataaatt tacgtcgcgt caggagcacg gagagccatt ggctgcaagg gcggtgacca cctcgcgcgc cactcgcgca gtcaaggggc tggctctiggg ggcctgcagc gatgagttcc cgcgactggg tactgcctga aacaccgcgg gacttctccc aacgacgact ttccacaggc gcgaggttcc tatctcggat gccgaggtcg cacgccctca accggggaca atgtactgga atgttcgcgc ggatcccccg tcctgttgcc aataat taac gcaattatac atcgcgcgcg 2470 2530 2590 2 650 2710 2770 2830 2890 2950 3010 3070 3130 3190 3250 3310 3370 3430 3490 3550 3610 3670 3730 3790 3850 3910 3970 4030 4090 4150 4210 WO 01/44447 WO 0144447PCT/EPOO/12347 -137 gtgtcatcta ctcataaacg aacagagaag cttattttag gctcttggac cttctatgtt ttttgttttg actgtttttt caaaaaaaga tttatcatga gttttggaat ccttatttta gaatctttta tgaaattaaa ttattcttaa ctttttcctt tatacaaaaa accaccacca tgacacgtat tccttttttt cttttggttt t t tttc tgac tctctctttc tttttgttat tcgtcaatcc atctgtgtaa tttgtgtttt c tt tgg tgt t tgttactaga ccattgtgga agagagagtg caaagagaaa ttgtgaattg acctgaaaac agttattatc tttttaagaa taaagaaaat aaaaaagaga attaactttt taaaccaaaa attagtcaat tgccaagttt agaaaaatc t tgggttgggt attgattaaa gaaaaataga taggatgttt catatgattc gttttggcta gcgatataaa tcttcaatct aaggtatatt gtggattatt agcttctaaa tttcttgctt ctttgttcga gttttgattt tccgggaatt agaaagtctt tgagatacat gagttccgag ttccgcctct cggcatttaa tgggctitaat gttgctgtta aataacaatt aaagaaataa cttaaaaatt agattgttct ggtagatact tgataaatta catatatagt taaccaagac ttcttctata aaaatgtcag ctacttgagt cttcctttag aagatatttt gaagaccttc ctcccaaagc ttctgattct gaatcttttg ttttgtcctg gattgtgaaa ttctctctgt ctcttacggc ccgctcgagg gagttggtgg gaattgtcgg tctgtagcag tgaatacttc tctcgcgggt aacgcaggcc aaaaaaaaaa actttaattg aaacttggat aggtcctttt aaaaaatact aatcaagaag attagtattc atagtcttaa gaaaagaaag tgaagcagat cggtctttta tttcgtgata attctcatta gtgtggaaga c taaagcgat ttttgttttt tataaattgc attactaaga ttaggatttt tttaggtttc ttttgatttg taccggattt taatgtaaca gcaacaaaaa aagagtgagg ttcaatcctc ttattccggt tgaaataaat aagggaatta tagactaaaa caaaaaaaaa tcccaacaat caaa tt tggt ttctttatta ataaactatc tctatatata tggaaagaat aaattatttg gtaatggatg aaaacgcacg ataatcctca atagaaaaga Caataattca ctctgcaaat gattcgtatc ttttgacaat tatcgattcg caaggacgat ttatgtttag gtatatgttc ggagccaagt gagtagtaag tcctgaacat agaaatttaa atatattctt tcaacatttt tcaaggccca acaacaacaa aaacatagat aacatacaga tag gtitaga agataagttt gagtagatta ataatcaaca ttatgattgc cttttttgaa aggaaaagta acctaatcca gtggaaaata actgatatct cggtt ttggg tcctttcgtc ctctcgcgac tgatctccaa attgttcgtt tagtgtttac ctattcaatt atccgtttct gctgattggt 4270 4330 4390 4450 4510 4570 4630 4690 4750 4810 4870 4930 4990 5050 5110 5170 5230 5290 5350 5410 5470 5530 5590 5650 5710 5770 5830 5890 5950 6004 ttctacttgt tctattgttt tatttcaggt gga tca gtc aca caa aga gta aag WO 01/44447 WO 0144447PCT/EPOO/12347 138- Ser Val Thr Gin Arg Val Lys aag aac aat Lys Asn Asn tcc ggc tca Ser Giy Ser cgc tgc ctt Arg Cys Leu cac aag caa His Lys Gin ggc ttc Gly Phe ggc cac Gly His ctc tat gct ctc Leu Tyr Ala Leu tat ggt cgc tcc Tyr Gly Arg Ser 95 ttc cgc tac tat ggt tgc ctc Phe Arg Tyr Tyr Giy Cys Leu 80 ttt caa cgg act taa gtc ctc Phe Gin Arg Thr Val Leu 100 ccc agc cac ccg Pro Ser His Pro 105 cgg cgg aag agt Arg Arg Lys Ser 120 caa Gin ggc taa caa cga cat tac ttc cat Giy Gin Arg His Tyr Phe His 11i11 taa ctg cat gca Leu His Ala 125 g gtgtggcctc cgattggaaa gaggtcgcgt tcaagaagcg tcgcgatgcg cgtgcgtggc acc tgggcgc accac tggcg tgcgccagct gatacggcta tctccgcggc ccacggcggt acgcactccc aggttgagtc accggtactt tgaacctgca acgtcaaata acatgctcat tgttcgggct agccggacgg tctatcgagg gatcgttcaa gaagaagttt caactgcatg tccctcgggc ctccaacgag gtggcgcgga gaacctggct gtacgacgaa ggagccggtg cgtgtgggtc cgatgtcgac cttgcggatc gatctcggcc gctggccctg cggccccctc cttcgatggc caagctgcic ctcgatcaag gcagaccagg cggcggcgcg ctgggtcgac acat ttggca gagactctct caggctagca gcgtacgacg ctcaaggaca gccacggggc gacgggcgga cagggccagt ccgcgcgggg tggtacggct aacggcgact gtcgagaact ttcgaactca gcgggcgcgt agcatgctgt taccccggcg cagtgtgtga aaggtgggcg caggccgcgg tacagcaag t cgcgtcgcaa ataaagtttc cttaccttcc tgaacgacat caaccacgcg agccgaccga gggccgtggt tcaaggacgg gcgttcacat cgcgtcagcc ccccgctgcc ttatgcacct tctacgacgc agctcttcga ggttcggtgc cacgcgcgct ggtgcgtcat cgccggtgag gcatcctgcg ggtacgacgt acgacaagct gtgagcggtg ttaagattga tgaccttacc tcaattggat cctggccgcg gttgacgctc gatggaccgc gtgcatccag ccccggccat gacgttggtc gc tgcacccg gcacttcgcg gcagcacgca cgattggcgc cggga tcgac cggcctgaac gaccgtcgcc cgaaggcaag ccgcgcgacc caaaatctgg cgtgctcaag agga tccccc atcctgttgc gattctgcag caagcgagcg agc tggtacg t tcggccgtc cactgctcgc tgcccgtttc aaccaggcgg accgccgagc ctgcccgaaa ttcgagacga accccggtgc cagtggccgg ttcaccgtgg atgtcgcaga ctggacggag aacgtcatgc gacttcgtgc aacggaatga taccgggcgt gaatttcccc cggtct tgcg 6052 6100 6148 6192 6252 6312 6372 6432 6492 6552 6612 6672 6732 6792 6852 6912 6972 7032 7092 7152 7212 7272 7332 7392 7452 WO 01/44447 WO 0144447PCT/EPOO/12347 139atgattatca atgacgttat gcgatagaaa atgttactag taattttaag gcttaagatg tcccttcttc tattaatgaa ccccaaataa cacttgcctt aaatcaataa tcacaatatg ccacttgcat attctagaaa ttttcagc Ec aacgatcgtt acgagtcagt caactcaaag tttgcgtgta cttagctttc tacccaaaga ttctctcaat aac aat ggc Asn Asn Gly 135 tctaatttct ttatgagatg acaaaatata a tccgggaat ctttctagag ttgaactcta atagcgaact aaaatattat gatccattga ttttaacgag tcatacaaaa ttatacgata tagataaatg atacgaaata caccgtatat aaatctcaac aataaacggc cacaaatact aacaacgctc tcgtgaccta gctcttcttc tctctctacc gttgaattac ggtttttatg gcgcgcaaac tccggaccgc gccggCcgcg tggaggtttg tattcaaaga tggtcattgg tatatgaatt acttgttcac atatccaata aagaagttac gcaaaaaaaa cgcttcaatg ttaaaaaata ggctggatct gtcaaag tgg tttcctcaac aatacacgtg gtcgtcctcg ttcacaattc gtgatcggat gttaagcatg attagagtcc taggataaat tgc tc tagtg gccgcctcga tatgaac tga atgttttgtg actgaacacg aaa taacaag caacttgata acactaaaaa ttttccaaga acaaaaagga cagtgggacc aaacgataat tatgacgacc ttgcagccgg ctaaaaataa tcattttatt tcttttcttc agatttcaat ca gtc aca Val Thr Ltc cgc tac Phe Arg TPyr taataattaa cgcaattata tatcgcgcgc agaccgatcg ggtaccatca tgatctagga tatcattctt agtgttaaat aataaatcga caaaagtcat attaaaagaa aattcactga aaagaaataa cacggttcaa gctaaaaaaa gttagaaatt cacacacgag ggcaattagc attagctatt cttcttcttc catgtaa tgc catttaatac ggtgtcatct cttttttaat ggatattctt ccggataagt gttacattgt atggaccagg gtcaccaaac tatcctatgc atggataatt ttttataagc agcacgaaga ttat tgccaa tataaatcgt gtggttgtcg tcgtgtttat caaaaacaac gcttcaccgc tataaaacaa 7512 7572 7632 7692 7752 7812 7872 7932 7992 8052 8112 8172 8232 8292 8352 8412 8472 8532 8592 8652 8712 8765 8813 8861 8909 8953 ttc ctc tat gct ctc Phe Leu Tyr Ala Leu 140 ttctcaaaat cttaaaaact caa aga gta. aag aag Gin Arg Val Lys Lys 130 tat ggt tgc ctc tcc Tyr Gly Cys Leu Ser 145 act taa gtc ctc cgc Thr Val Leu Arg cat tac ttc cat cac His Tyr Phe His His 175 ggc tca ggc cac tat ggt cgc tcc ttt caa cgg Gly Ser Gly His Tyr Gly Arg Ser Phe Gin Arg 150 155 160 tgc ctt ccc agc cac ccg caa ggc taa caa cga Cys Leu Pro Ser His Pro Gin Gly Gin Arg 165 170 aag caa cgg cgg aag agt taa ctg cat gca ggt g tggcctccga WO 01/44447 WO 0144447PCT/EPOO/12347 -140 Lys Gin Arg Arg Lys Ser LeU His Ala Gly ttggaaagaa gaagtttgag actctctctt gtcgcgtcaa agaagctatc tcgtgctggt ggctrtcgacg cctttacgcg tccccacgga cggcaccggg ccgtgatatc gcttgaggcg ggaagcgggc tacgctggca cgatctgttt atttatctga gtttcttaag attacgttaa ttatgattag caaactagga gccgcctcga ttgagttggt atgaattgtc agtctgtagc cttgaatact aatctcgcgg ataacgcagg taaaaaaaaa ttactttaat aaaaacttgg ttaggtcctt ctgcatgcag acggataccg cagtatttga ccggatgaaa aaagcag tca gaagcgtggc ttctcttatg accatttact cttticgttga Lggcgtgggc gagcatgata tgcagtgagc gctagcggat attgaatcct gcatgtaata agtc cc gcaa taaattatcg ggtaccggat ggtaatgtaa gggcaacaaa agaagagtga tcttcaatcc gtttattccg cctgaaataa aaaagggaa t tgtagactaa atcaaaaaaa tttcccaaca gctagcacat tatatcgtgt tggtagtgat aagggtttat tggaccgcat tgcgcgatga cccgctcgat ggggcgggcg agcatcctgg gtactggcac tctatattgc gtaatgcgcg cccccgaa tt gttgccggtc attaacatgt ttatacattt cgcgcggtgt ttggagccaa cagagtagta aatcctgaac ggagaaattt tcatatattc gttcaacatt attcaaggcc taacaacaac aaaaacatag aaaacataca attaggttta accttcctga gacaacctta ccgcatcgtg ggatgagcgc cgagctgcat cctcaaagat tgaagagcgt tttgctgaca tgaagagcag tctgcaagtg cgtgttaacg cggacgtttt ggaagatcgc tccccgatcg ttgcgatgat aatgcatgac aatacgcgat catctatgtt gtctcataaa agaacagaga atcttatttt aagctcttgg ttcttctatg ttttttgttt caactgtttt aacaaaaaaa attttatcat gatcttctaa gag tt ttgga ccttaccgat agctgtaaag ccagacgcgg gacaaacgtc at tggcgctt catcaaatcg ccgatgattt gcgttggcgc catctgtatg gtgccggtgg gcggtattgc gagatggcga ctgtttggcg ttcaaacat tatcatctaa gttatttatg agaaaacaaa actagatccg cgccattgtg agagagagag agcaaagaga acttgtgaat ttacctgaaa tgagttatta tttttttaag gataaagaaa gaaaaaaaga ttattaactt tctgcaggag tgacctcggt ccttttcttt cgttctcaat ctgaaatcaa tggtcgacat tgattgcggg gtaacccaaa atctctgcga ttgaacaacc aggatcacgg aaa ttgcccg atgcgtttgc tggcaataaa t ttc tgttga agatgggttt atatagcgcg ggaattagcg gaagaaag tc tgtgagatac aagagttccg tgttccgcct accggcatt t tctgggctta aagt tgctgt ataataacaa gaaaagaaat ttcttaaaaa 9013 9073 9133 9193 9253 9313 9373 9433 9493 9553 9613 9673 9733 9793 9853 9913 9973 10033 10093 10153 10213 10273 10333 10393 10453 10513 10573 10633 10693 attaaaccaa aaagattgtt WO 01/44447 WO 0144447PCT/EPOO/12347 -141 ctaaaaaata ctcaaatttg gtagataagt cttttttttc taaatcaaga gtattagtat acatagtctt tagaaaagaa agtgaagcag gtcggtcttt agtttcgtga ttattctcat tcgtgtggaa gcctaaagcg ctttttgttt tgtataaatt tgattactaa aattaggatt gttttaggtt gc ttt tgat t gtggatctgt caccgaggcg ggtcaacttc gcgggagcgc cgcgggcccc ctccccccgc cctggaggca cgtgcgcatg caagcacggg gccccgtccg tggcaataaa tttctgttga ttttctttat agataaacta tctctatata aatggaaaga agaaattatt atgtaatgga taaaaacgca taataatcc t taatagaaaa gataataatt atctctgcaa ttgattcgta gcttttgaca gatatcgatt ttcaaggacg tct~tatg tt t tggtatatgt tggggatcta gacatgccgg cgtaccgagc tatccctggc tggaaggcac caccagcgga cagggcttca cacgaggcgc aactggcatg gtcctgcccg gtttcttaag attacgttaa tagagtagat tcataatcaa tattatgatt atcttttttg tgaggaaaag tgacctaatc cggtggaaaa caactgatat gacggttttg catcctttcg atctctcgcg tctgatctcc atattgttcg cgtagtgttt atctattcaa agatccg LCL tcgctgattg ccatgagccc cggtctgcac cgcaggaacc tcg tcgccga gcaacgccta cgggactggg agagcgtggt tcgga ta tgc acgtgggttt tcaccgagat attgaatcct gcatg taata ttccttattt tagaatcttt catgaaatta aactttttcc tatatacaaa caaccaccac tatgacacgt c ttcct t tt t ggcttttggt tctttttctg actctctctt aatttttgtt tttcgtcaat acatctgtgt tttttgtgtt ctctttggtg gtttctactt agaacgacgc catcgtcaac gcaggagtgg ggtggacggc cgactggacg c tccacgc tc cgctgtcatc cccccgcggc c Lggcagc tg cccccgaatt gttgccggtc attaacatgt taattagtca tatgccaagt aaagaaaaat aatgggttgg ttattgatta aagaaaaata cataggatgt atcatatgat ttgttttggc ttgcgatata actcttcaat tcaaggtata atgtggatta ccagcttcta aatttcttgc ttctttgttc ttgttttgat gttctattgt ccggccgaca cactacatcg acggacgacc gaggtcgccg gccgagtcga tacacccacc gggctgccca atgctgcggg gacttcagcc tccccgatcg ttgcgatgat aatgcatgac atggtagata tttgataaat ctcatatata gLtaaccaag aattcttcta gaaaaatgtc ttctacttga tccttccttt taaagatatt aagaagacc t ctctcccaaa ttttctgatt t tga atctt t aattttgtcc ttgattgtga gattctctct ttctcttacg tttatttcag tccgccgtgc agacaagcac tcgtccgtct gcatcgccta ccgtgtacgt tgctgaagtc acgacccgag cggccggctt tgccggtacc ttcaaacatt tatcatctaa gttatttatg 10753 10813 10873 10933 10993 11053 11113 11173 11233 11293 11353 11413 11473 11533 11593 11653 11713 11773 11833 11893 11953 12013 12073 12133 12193 12253 12313 12373 12433 12493 WO 01144447 WO 0144447PCT/EPOO/12347 142 agatgggttt atatagcgcg ggaat tgggt agacgcgtcg caccccagta ttacaccaca caaaa tcacc aagctcacgt ctcgtgctcg ctcgcggaaa tgtcaatttt tactgagcga ctggctgctg aggtcatcat tcgccgacct aaggtttcca cgggccgtcg gcaaacagca cggtccagga gacgtgaagc taccggccat ggctcgccga tcgtcggccc atgaccttgt gagcgggccg aaggaaagc t gcctcgctga gttcctcgcg cgcgaacgct ttatgattag caaactagga acccaattcc acgtcatatg cattaaaaac atatatcctg actcgataca agtgtacgta taaacggacc tcc tgcacgt aatcctctgt agcaagtgcg aacccccagc tgacccaggc gctcgcgcca gcttgagcgg gcgacagctt cgacgatttc cgcggaagcg ccatcgccgt tgatcgacca taggggtgcg gcagctcgac tt tgcagcgc tgtcgtttgg gcatttcctt cctgttttgc tgtcgatggt ccacggcggc agtcccgcaa taaattatcg ggaccgctgc gatccgatct gtccgcaatg ccaccagcca ggcagcccat atcgatttcg cgaacatctc cggccgctcc ttatcggcag tcgagcagtg cggaac tgac gtgttccacc cttcttcacg gtacggctcc gcggtacttc ctcgtcgatc gtgcagcagc cgcctgtagg gcccaggtcc cttcgcgtac gccggtgtag ctcgcgcggg catcgctcgc gatctgctgc caggtcctcg catcgacttc cga tggcgcg ttatacattt cgcgcggtgt tctagaggcg gttgcccgtc tgttat Laag gccaacagct cagtccggga aagggcccac tggagctttc aagccgtcga ttcgtagagc cccgcttgtt cccacaaggc aggccgc tgc cgggtggaat cggtgcgagc tcccatatga aggacctggc gacaccgatt cgcgacaggc tggcaaagct tccaacacct gtgatcttca attttcttgt atcgtgtccg ttcgtgtgtt ccggcggttt gccaaacctg ggcagggcag aatacgcgat catctatgtt cgcccctagg tcactggtga ttgtctaagc ccccgaccgg cggtcgacct tagtccatgg ttcagggccg atctgagcct gcgccgtgcg cctgaaatgc cctagcgttt ctcgcaactc ccgatccgca tgaaatagtc atttcgtgta aacgggacgt ccaggtgccc attcctcggc cgtagaacgt gctgccacac cgtccttgtt tgcgcgtggt gccacggcgc tcagcaacgc ttcgcttctt ccgcctcctg ggggagccag agaaaacaaa actagatccg gagcttctgc aaagaaaaac gtcaatttgt cagctcggca gcaggcatgc gctttttctc acaatcggat taatcacaat tcccgagcga cagtaaagcg gcaatgcacc ttcgcaggc t catgaggcgg gaacatccgt gtggtcgcca tttcttgcca aacgcggtcg cttcgtgtaa gaaggtgatc cagttcgtca gacgtggaaa gaacagggca aatatcgaac ggcctgcttg ggtcgtcata ttcgagacga ttgcacgctg 12553 12613 12673 12733 12793 12853 12913 12973 13 033 13093 13153 13213 13273 13333 13393 13453 13513 13573 13633 13693 13753 13813 13873 13933 13993 14053 14113 14173 14233 14293 tcgcgctcga tcttggccgt agcttgctgg accatcgagc cgacggactg gaaggtttcg WO 01/44447 WO 0144447PCT/EPOO/12347 143cggggcgcac gcgtcgatca tgcgggattg ggtgccttgg tggccgtcct t tgcccaaat tcggtgcgct atccagtaaa aaatagctcg aatgtcatac gccatctttc ttcgggcttt ttcttcccag ggctaagcgg gagcctgatg ctcttccgag ccgttcaaag cttttcccgt taggttttca ttttacgcag catttattat aacaagacga gctttttcaa aaaccacaat ggtgctccag gtgcgtaacg acatggcaac gatatggcca aacacgattt cgggcagtga gcatgacggt gttcttgcct ccccgactca tgtccagata tctcgtactt acttgccgtg cctgcttgtc atataatatt acatactgtt cacttgtccg acaaagatgt tccgtcttta ttttcgcaat ctgtctaagc cactccgcat caaaggacgc tgcaggacct tccacatcat ttttctccca cggtat t ttt ttccttcctc actccaattc agttgttttc tatgggtgat tggcttctgt gcaaaagcac tgcagt tcac tgaatggcgt tacgtcactt cgtcatcgtc gcggcttgcg gtatgccttc cgccggggca atccacctta ggtattccga ggcctcggcc gccggcatcg ttattttctc cttccccgat ccctgccgct tgctgtctcc aaaaatcata ccacatcggc tattcgtata acagc tcgat catcggcctc t tggaacagg aggtggtccc ccagcttata cgatcagttt ttttctacag actgttcctt aaagttggcg gctgccaact g tc tatcagc cgccggacat ttacaccgct tggatgccgg aaaaaactca tgcgcggaaa atggtttcgg cggtcaaacg atgtgccctt tcggcaatga atcttgccct tgagagccaa ttgcgccaca ccaatcaggc atcctccctg tctcccaaga caggtcgccg cagctcgcgc cagatcgtta gggacaatcc aatcttttca actcatgagc cagctttcct tttataccgg taccttagca tttcaattcc tatttaaaga gca t tctaaa tataacatag tactgattta tgtccctcct cagcgctatc tctcaacccg gcaacagccc ggccgcagtc tggacgaaca catcc tcggc tccgattcat attcctgatt agtcggtccc gcacgaatac aacacttgat tctaggtact ttgatcccca atcgaccgga tcaataaagc tgggaaaaga ggatc t ttaa ttcagtaagt gatatgtcga gggctttgt t agattgctcc tccagccata ctgtccgtca ggagaca ttc ggtgatattc Laccccaaga accttaaata tatcgacgga gtgtatgatg gttcagctac tctgctctca gtacgcacca gca ttatggg ggtaacctcg gtggggctat ggaaaacccc tcaccctcct tgacccgcct gtagaccgtc cagcgacccc gcggaagaag aaaacaattc gtaagtcaaa cgcagaaggc cacttacttt caagttcctc atggagtgtc aatccaattc tggagtgaaa catcttcata agccatcatg gcatcatgtc tttttaaata cttccgtatc tcattttagc agctaattat ccagaaaaca gccgattttg gtgtttttga tgacggggtg ctgccgtaaa gaaaatcatt cgttggcCtc cgcatacagc gtcggggcta 14353 14413 14473 14533 14593 14653 14713 14773 14833 14893 14953 15013 15073 15133 15193 15253 15313 15373 15433 15493 15553 15613 15673 15733 15793 15853 15913 15973 16033 16093 WO 01/44447 WO 0144447PCT/EPOO/12347 -144 aatcgcgcca acgtattcgg ttgacgtggt agctgcacgt ggcagcacct atgacaaagt cccaattatg catgcaagtt cttgccccct tcagtattgt tggtagcttt tcatacctcg cgaacacgag gccccgccat ggccgccgcc cgtcaatgct cggcaatggc ggcgcagccc ggggcacccc aggt tta taa gggcggaaac aggtgcgccc ctgtcagtag cacatcatct cagctccacg gagtcggccc gcgaggtatc ggcgcgtttg agcgtcgcaa gaagtcgctc gcgctggc tg tgaacgcact gatatggatg aatcagcaag ggcacggctg catcgggcat atagaattta tttatgcttL gaaatcctta caatatattc ttaaatatgg gtataatctt cacggcaccc gaagtccgtg ctcac tgccc tccgggcgtc aaggac tgcc ctggggggat ccttcggcgt atattggttt ccttgcaaat ctcatctgtc tcgcgcccct gtgggaaact tcgccggccg ctcaagtgtc cacaacgccg cagggccata aggcgctcgg ttcttgatgg ttttacgcgt atggcgacgc acggatggct cgatatacgc ggacggaagt tatctgaaca caagctataa gcccattcta catacggcga aaggcaatct cgcttcatag acctatcacc gcgaccacta aatgccccga ggcacctggt gcgctcgggc agcgctgcca gggaggcccg gcgcggtcac aaaagcaggt gc tgga t t agcactctgc caagtgtcaa cgcgtaaaat aaatcgagcc aacgtccgcc gcggccgcgg gacggccgcc tcttgccttg agcgcatggg atgacagtct tggggcgtct ggccgctgta agcgaattga cgctgtcgtt taaaacacta ggttattgtc tagatatalt tatcttctat gcctcctcat ag taattctg tcaaatggtt tgccaagaat cggccgaagt cgctgaatgt tgatcgccca tttttggggt cgttagcggg gcgcacaggg taaaagacag ctgcctgtgg.

ccctcaagtg taccgcaggg caggcgtttt tgcccctcat cctcatctgt tgtctcgcac agcccagcgg ctcgtcggtg gacgtgcttg ccggaagacg ta tgagcc tg tgaatcccgc gcggcataac c tcaaaatcg tcaataagtt ctgggtttca gataagcgcg ataaaagata cctcttcatc taaaggtcca cgctgggttt gcccaaggta gaagggcagg cgatgccagc tcccgttact gaggccgttc ccgggaggg I cgcagccctg gttagcggtg acagcccctc tcaaggatcg cacttatccc cgccgat ttg ctgtcaacgc cagtgagggc acggcttcga cgagggcaac atgtacttca gcaatcacgc gttgt tgcgc ctgtcaccct ctgaagggaa ctgaatctga gtggagc tgc ggagtcat Ia agcattagtc ctgcctatgc tattatctta ctcttcgtct attc Icgttt atcgcacccc aaaattgccg ccgccacc acctgcggca gccccgatcc gcggccgagg tcgagaaggg gttaaaaaca gccgaaaaac aaatgtcaat cgcccctcat caggcttgtc cgaggctggc cgcgccgggt caagttttcc cggcgtttct cagcccggtg ccagctccgc gcaccccccg 16153 16213 16273 16333 16393 16453 16513 16573 16633 16693 16753 16813 16873 16933 16993 17053 17113 17173 17233 17293 17353 17413 17473 17533 17593 17653 17713 17773 17833 17893 WO 01/44447 WO 0144447PCT/EPOO/12347 -145gccgttttag ccttgccaag caccgaaccg ggcccaggtc tgattttgta ccgccttttc tgcccttcct cggtagccgg ggacagtgaa gacgccgttg gtgcgaaaaa cagcggaaaa agggtcggaa agtcctgtcg gggcggagcc tggccttttg accgcctttg gtgagcgagg gcttggacgc cggtggaaag ccggcagcgg gcctcctttt gaccggcttc caacggtgcc caacagtgaa cctcgcagag tgccggcatg cattcccgat tctccgccag agtaaagcgc cggc taaaaa ctcgtcctgc cgccgtgcgc gccattgatg gccctggccg ctcaatcgct ggttggcttg ccagcctcgc gaaggaacac gatacaccaa ggatggatat gcgccacgct caggagagcg ggtttcgcca tatggaaaaa ctcacatgtt agtgagctga aagcggaaga tagggcaggg ggggagggga tcctgatcaa cgccaatcca gtcgaaggcg gccgcgctcg gtagctgatt gaagcgaagc gatgcgcgcg cagaaatgag catggcttcg cggctgctga agtcatggct ttctcttcga gggtcg tcg cgggccagct acggccagca cttcgttcgt gtttcatcag agagcagga t ccgctcgcgg ggaaagtcta accgaaaaaa tcccgaaggg cacgagggag cctctgactt cgccagcaac ctttcctgcg taccgctcgc gcgccagaag catgaaaaag tg ttgtc Lac tcgtcaccct tcgacaatca tctatcgcgg ccggcatcgc gtca tcagcg tgcgcgtcgg ccatcgcggt cgccagtcgt gccagtgcgt acccccaacc ctgccctcgg tcttcgccag tgagccagag cgcggacgtg gg taggccga c tggaaggca ccatccgctt tcccgttgag gtgggcctac cacgaaccct tcgctataat agaaaggcgg cttccagggg gagcgtcgat gcggcctttt ttatcccctg cgcagccgaa gccgccagag cccgtagcgg atggctctgc ttctcggtcc ccgcgagtcc cccgcaacag tgtcgccggc cat tgacggc ccgtttccat aggcgagcag cgtcggctct cgagcagcgc gttccgccag gcggaccacg cagggcgagg tttcagcagg c tcatagtcc caggctcatg gtacaccttg gccctcatct caccgccagg ttcacctatc ttggcaaaat gaccccgaag acaggtatcc gaaacgcc tg ttttgtgatg tacggttcct attctgtgga cgaccgagcg aggc cgagcg gctgctacgg tgtagtgagt ttcaacgt tc ctgctcgaac cggcgagagc ctgc tcctca gtccccggc ctgcggtgcg cgcc tgcctg cggcaccgaa ccgc ttgttc tttgcgtgtc cccatcatga atcgtggcat ccgcccaggc acgacgcccg ccggccgccg ataggtgggc gttacgccgg tgcgaataag ctgcccggct cctgtatatc cagggttatg ggtaagcggc gtatctttat ctcgtcaggg ggccttttgc taaccgtatt cagcgagtca cggccgtgag gcgtctgacg gggttgcgct ctgacaacga gctgcgtccg ggagcctgtt agcacggccc gaaaaacccg cccggtcgcg aagctgcggg tgcgtatgat ctgaagtgc gtcagaccgt 17953 18013 18073 18133 18193 18253 18313 18373 18433 18493 18553 18613 18673 18733 18793 18853 18913 18973 19033 19093 19153 19213 19273 19333 19393 19453 19513 19573 19633 19693 WO 01/44447 PCT/EPOO/12347 146 ctacgccgac ttgtcatgct aaagaatccg caacataccc gattatgccg ccactatggc gggcgcgctg cagatc c tcgt tcaac tgacacttta cgcgt tcaat ctgatcgtaa gtgctgccgg attctgctgg tcggatcgtt aggtccaggg tcactgataa cggaccagcg ttctgagcac gcctcctgcg cgctgtatgc tcgggcggcg cggcacggat cactgtattc acataatatg tccaccaact gaggctggtc cggaggccag tgtcgcgctc gacgctgtcg cgatctggtt cactcgaacg gttggtgcaa tttgcctgcg gccaatcttg ctcgtctcgc ggctgcaact tatcagtga t acgtgaaacc gcatcggcct acgtcaccgc cacctgtgct tggccggcgc 19753 19813 19873 19933 19993 20053 20113 20119

Claims (22)

1. A method of transferring a halogen to a substrate in a regiospecific manner comprising contacting the substrate with a regiospecific halogenase in the presence of an oxidant, a halogen donor, an electron transferase, and a reductant where if the transfer occurs in vivo the electron transferase is encoded by a heterologous nucleic acid molecule.

2. The method of claim 1, further comprising a FAD or FMN component.

3. The method of claim 2, wherein the further component is FAD.

4. The method of claim 2, wherein the electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to FAD. The method of claim 2, wherein the electron transferase is an enzyme capable of catalyzing the electron transfer from NADH or NADPH or ferredoxin to the regiospecific halogenase.

6. The method of claim 2, wherein the electron transferase is a flavin reductase, ferrodoxin NADP reductase, ferredoxin, diaphorase-sufhydryl reductase or NADH-cyt-B5 reductase, NADPH-FMN reductase, NADPH-cyt-p450 reductase or nitrate reductase. C

7. The method of claim 6, wherein the electron transferase comprises an amino acid S sequence having at least 30% identity to any one of the amino acid sequences according to SEQ ID NOs:19, 21, 23, 25, 27, 29 or 31.

8. The method of claim 7, wherein the electon transferase comprises an amino acid sequence of any one of SEQ ID NOs:19, 21, 23, 25, 29 or 31.

9. The method of claim 1, wherein the regiospecific halogenase is prnA, prnC, pyoluteorin ;i halogenases pltA, pltD, and pltM, tetracycline halogenase cts4, hydrolase a, or balhimycin halogenase bha A. The method of claim 9, wherein the regio specific halogenase comprises SEQ ID NO:1. P:\OPER\Kbm\1707801 rel.doc-19/02/04 -43-

11. The method of claim 10, wherein the regio specific halogenase is a polypeptide comprising an amino acid domain according to any one of SEQ ID NOs:3, 5, 7, 9, 11, 13, or 17.

12. A host cell expressing a heterologous nucleic acid molecule whose compliment hybridizes to any one of SEQ ID Nos:18, 20, 22, 24, 26, 28, or 30 under the hybridization conditions of: 7% sodium dodecyl sulfate (SDS), 0.5M NaP04, ImM EDTA at 50 0 C with washing in 0.1X SSC, 0.1% SDS at 65 0 C; and at least one heterologous nucleic acid molecule whose compliment hybridizes to any one of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14 or 16 under the hybridization conditions of: 7% sodium dodecyl sulfate (SDS), 0.5M NaP04, ImM EDTA at 50 0 C with washing in 0.1X SSC, 0.1% SDS at 65 0 C.

13. The host cell of claim 12, wherein the host cell is a bacterial, fungal or plant cell.

14. The host cell of claim 13, wherein the host cell is a microbial cell. 20 15. The host cell of claim 13, wherein the host cell further expresses nucleic acid sequences encoding prnB and pmD.

16. A method of producing pyrrolnitrin comprising growing the host cell of claim o o o* 25 17. A method of protecting a plant against a pathogen comprising treating the plant with the host cell of claim 15, whereby pyrrolnitrin is produced by the host in amounts that inhibit the pathogen.

18. The method of claim 16, further comprising collecting pyrrolnitrin from the host.

19. A plant comprising a host cell of claim 14. P:\OPER\KCb\17078-01 rsI.doc-19/02/04 -44- A plant comprising a host cell of claim

21. A method of protecting a plant against a pathogen, comprising growing the plant of claim 20, whereby pyrrolnitrin is produced in the plant in amounts that inhibit the pathogen.

22. A seed of the plant according to claim 20 which comprises said host cell.

23. A method of preventing fungal growth on a crop, comprising growing the plant of claim 21, wherein the plant is a crop plant.

24. A method for improving production of halogenated substrates by a host comprising expressing a heterologous nucleic acid molecule encoding electron transferase in a host wherein the host expresses at least one endogenous polypeptide having regiospecific halogenase activity. o

25. A method according to any one of claims 1, 16, 17, 21, 23 or 24, substantially as hereinbefore described. 20 26. A host cell according to claim 12, substantially as hereinbefore described.

27. A plant according to claim 19 or claim 20, substantially as hereinbefore described.

28. A seed according to claim 22, substantially as hereinbefore described. DATED this 1 9 th day of February, 2004 Syngenta Participations AG By DAVIES COLLISON CAVE Patent Attorneys for the Applicants