AU7693600A - Dna construct and its use - Google Patents

Dna construct and its use Download PDF

Info

Publication number
AU7693600A
AU7693600A AU76936/00A AU7693600A AU7693600A AU 7693600 A AU7693600 A AU 7693600A AU 76936/00 A AU76936/00 A AU 76936/00A AU 7693600 A AU7693600 A AU 7693600A AU 7693600 A AU7693600 A AU 7693600A
Authority
AU
Australia
Prior art keywords
xanthophyll
oilseed plant
dna construct
nucleotide sequence
carotene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
AU76936/00A
Inventor
Anna-Stina Hoglund
Kjell Stalberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Astareal AB
Original Assignee
Astacarotene AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Astacarotene AB filed Critical Astacarotene AB
Publication of AU7693600A publication Critical patent/AU7693600A/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Description

WU U1/zUUll C1/SEUU/U1767 1 DNA construct and its use. The present invention relates to a new DNA construct for transformation into oilseed plants. The DNA construct comprises nucleotide sequences encoding peptides with enzyme 5 activities necessary for the high-level production and esterification of keto group-containing xanthophylls in oilseed plants. Background of the invention Carotenoids are produced de novo by plants, fungi, algae and some bacteria. A number of biosynthetic steps are needed for the biological production of the carotenoids. 10 There are two chemically different groups of carotenoids, namely carotenes containing only carbon and hydrogen molecules and xanthophylls containing oxygen in the molecule in addition to carbon and hydrogen. The xanthophylls, and particularly astaxanthin (3,3'-dihydroxy-P-P-carotene-4,4' dione), are often colored pigments and are used as such or as anti-oxidants. 15 Carotenes are biological precursors for the production of the oxygen-containing xanthophylls. There are two types of enzymes responsible for the introduction of hydroxy groups and keto groups into the carotenes, namely hydroxylases and ketolases, respectively. The keto group-containing xanthophyll astaxanthin, which has keto and hydroxy groups, is biosynthetically produced from beta-carotene. 20 Large-scale production of xanthophylles from natural sources is at present performed by AstaCarotene AB, Gustavsberg, Sweden, by cultivation of the alga Haematococcus pluvialis for the production of astaxanthin in esterified form. It would be desirable to be able to produce keto group-containing xanthophylls particularly astaxanthin, in oilseed plants. Oilseed plants have naturally p-carotene 25 hydroxylases but lack p-carotene C-4-oxygenase enzymes or ketolases. Description of the invention The present invention provides DNA constructs enabling and promoting production of keto group containing xanthophylls, especially astaxanthin, in oilseed plants, such as rape, sunflower, soybean and mustard. The DNA construct is transformed into the 30 oilseed plant cell for expression of a protein or fused protein which has an enzyme activity enabling keto group insertion into a carotene or hydroxy carotene for the biosynthetic production of a keto group containing xanthophyll, such as cantaxanthin (p,p-carotene-4,4' dione) and/or astaxanthin. Use is thus made of the biosynthetic pathway of the oilseed plant to WU UI/LUUII PCT/SEUU/U1767 2 produce carotenoids. The naturally occurring synthesis of carotenoids involves a number of enzymes, namely 1 -D-deoxyxylulose 5-phosphate synthase, isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase, geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, zeta-carotene desaturase, lycopene beta 5 cyclase, p-carotene hydroxylase, and P-carotene C-4-oxygenase. Genes coding for peptides having these enzymatic activities may be inserted into the DNA construct of the invention, one or several per construct, to promote high-level production in the transgenic oilseed plant. In case only one enzyme coding gene is inserted per plant, two or more plants may be sexually interbred to produce plants containing all the desired enzyme activities. 10 Thus, the present invention is directed to a DNA construct comprising in the 5' to 3' direction of transcription operably linked a promoter region directing transcription to the seed of an oilseed plant, a nucleotide sequence coding for at least one peptide with enzyme activity necessary for keto group containing xanthophyll production and esterification in an oilseed plant and a transcriptional termination region. 15 In a preferred embodiment of the invention the DNA construct additionally comprises between the promoter region and the nucleotide sequence coding for at least one peptide with enzyme activity a nucleotide sequence coding for a transit peptide directing the translated fusion polypeptide to the chloroplast of the oilseed plant. The DNA construct is preferably such that the promoter is a napin promoter, the 20 peptide with enzyme activity necessary for keto group containing xanthophyll production is selected from the group consisting of peptides with 1-D-deoxyxylulose 5-phosphate synthase, isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase, geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, zeta-carotene desaturase, lycopene beta-cyclase, p-carotene hydroxylase, and p-carotene C-4-oxygenase activity. To 25 promote esterification of astaxanthin a nucleotide sequence coding for a peptide with acyl transferase activity may be included in the group. In a preferred embodiment of the DNA construct according to the invention the nucleotide sequence coding for a peptide with enzyme activity is a nucleotide sequence coding for a N-terminally truncated p-carotene C-4-oxygenase gene from the alga 30 Haematococcus pluvialis. An example of the DNA construct of the invention is presented in the sequence listing as SEQ ID NO:1 and in Fig.1.
WO 01/20011 PCT/SEUU/U1767 3 The present invention is also directed to a transgenic oilseed plant cell comprising the DNA construct of the invention, and preferably the oilseed plant is selected from the group consisting of rape, sunflower, soybean and mustard. The invention is additionally directed to transgenic oilseed plant-produced 5 xanthophyll, e.g. canthaxanthin and astaxanthin. A preferred aspect of the invention is directed to transgenic oilseed plant produced astaxanthin esters. The present invention will now be illustrated with reference to the DNA construct disclosed in the sequence listing and in Fig.1, and the following description of 10 embodiments. However, the invention is not limited to these exemplifications. Short description of the drawings Fig. 1 illustrates the nucleotide sequence of the DNA construct comprising the napin promoter, the chloroplast localization signal, the N-terminally truncated P-carotene C-4-oxygenase gene and the termination sequence, and the deduced amino acid sequences of the transit peptide 15 and the p-carotene C-4-oxygenase. Description of embodiments The invention is illustrated by production of astaxanthin in the seed of oilseed rape. The astaxanthin produced in the seed of the transgenic plant is extracted as part of the extracted oil. By use of conventionally used protocols for Agrobacterium tumefaciens 20 mediated transformation such as described by (Hoekema et al.1983, An et al. 1986, Fry et al. 1987, DeBlock et al. 1988, Radke et al.1988, or Moloney et al. 1989) transgenic plants are produced having a chimeric DNA construct that is genetically inherited and is able to produce astaxanthin. The nucleotide sequence of the chimeric DNA construct consist of four parts of different genetic origin namely: (1) a promoter, (2) a localization signal, (3) a p-carotene C-4 25 oxygenase coding region and (4) a termination sequence. The napin promoter directs transcription to the seed of oilseed rape (Stilberg et al 1996). This promoter was coupled to a localization signal similar but not identical to a transit peptide (TP) of Rbcsla (Krebbers, 1988) that directs the translated product of a fused gene to the chloroplast. The promoter and the TP sequence were ligated to a part of the coding 30 sequence of a ketolase gene BCK (Kajiwara et al. 1995). This enzyme oxygenates p-carotene to canthaxanthin, (Fraser et al. 1997). The chimeric DNA construct was then coupled to a suitable termination sequence, e.g. that of the Agrobacterium tumefaciens nopaline synthase gene (the nos 3' end)(Bevan et al. 1983), as illustrated in Fig.1.
WU UI/ZUUII PCT/SEOO/01767 4 Cellular storage of Astaxantin The storage of large amounts of free astaxanthin in plants will be difficult due to toxic effects of the molecule as it intercalates in the plant membranes. An effective esterification of astaxanthin to fatty acids enables storage of the esterified molecules in 5 triacylglycerol containing oleosomes. Thus, an acyl transferase can be claimed to be of fundamental importance for the process, as is proteins that can mediate transport of different forms of astaxanthin from the chloroplast to the vesicles. Sequences and oligonucleotides used in the construction of the DNA construct 1. Napin promoter (GeneBank ACCESSION No. J02798) 10 This promoter sequence, a 1145 base pair fragment including the 5' leader sequence has a unique HindIII site at the 5' end. The 3' end was synthesized with an additionally 6 nucleotide BamHI site. 2. Transit peptide similar to RBCSla (GeneBank A CCESSION No. X13611, X14565) The transit peptide (TP) was amplified by PCR from -28 to the end of the transit 15 cleavage aa=54/55 site of the Rbcsla gene. The 5' end was synthesized with a BamHI site and similarly the 3' sequence was synthesized with a XbaI site. The two following oligonucleotides were used for the PCR amplification. BamHI 20 5' primer: TP1 5'AGAC GGATCC TCAGTCACACAAAGAGTA 3' SacI XbaI 3' primer: TP2 5'GTTC GAGCTC TCTAGA CATGCAGTTAACGC 3' 3. BCK (&carotene C-4 oxygenase) (Genebank A CCESSION No. D45881) 25 The BCK fragment was amplified by PCR including a 5' XbaI site and was ligated to the TP already described. The 5' primer (BCK1) used for PCR, is homologous to the BCK sequence from nucleotide 264 and the 3' oligonucleotide (Ax40) ends with a stop codon and was synthesized with a SacI restriction site for cloning. The synthesized fragment was fused to the TP as shown in Fig 1. 30 Oligonucleotides used for PCR: XbaI 5' primer: BCK1 5'ACAG TCTAGA ATGCCATCCGAGTCGTCA 3' SacI 3'primer: AX40 5'CACCGAGCTCCATGACACTCTTGTGCAGA 3' WO 01/20U11 PCT/SE00/01767 5 Description of SEQ ID NO:1 and SEQ ID NO:2 The sequences shown i Fig. 1 are the same as the two sequences which are shown in the sequence listing. The SEQ ID NO:1 is a nucleotide sequence composed of the following features: 5 Nucleotide No. Cloning site HindIII 1-6 Napin Promoter 1-1145 Cloning site BamHI 1146-1151 Transit peptide leader 1152-1178 10 Transit peptide coding 1179-1347 Cloning site XbaI 1348-1353 p-carotene C-4-oxygenase 1354-2217 p-carotene C-4-oxygense 3' untranslated 2218-2266 Cloning site SacI 2267-2272 15 Nopaline synthetase termination 2273-2536 Cloning site EcoRI 2538-2543 The SEQ ID NO: 2 is a deduced amino acid sequence of the fusion protein of the transit peptide and the peptide with p-carotene C-4-oxygenase activity.
WU UI/2UUlI I Iu/5iEUU/Ui7O7 6 References An G, Watson BD, Chiang CC (1986), Transformation of tobacco, tomato, potato and 5 Arabidopsis-thaliana using a binary vector system. Plant Physiology 81 (1) 301-305. Bevan M, BarnesWM and Chilton MD (1983). Structure and transcription of the nopaline synthase gene region of T-DNA. Nucleic Acids Res. 11 (2), 369-385 . 10 DeBlock M, DeBrouwer D, Tenning P (1989). Transformation of Brassica napus and Brassica oleracea using Agrobacterium tumefaciens and the expression of the BAR and NEO genes in transgenic plants Plant Physiology 91:2, 694-701. Fraser PD, Miura Y, Misawa N, (1997). In vitro characterization of astaxanthin biosynthetic 15 enzymes. J Biol Chem. Mar 7;272(10):6128-35. Fry J, Barnason A, and Horsch RB, (1987). Transformation of Brassica napus with Agrobacteriium tumefaciens based vectors. Plant Cell Reports 6:321-325. 20 Hoekema A, Hirsch PR, Hooykas PJJ Schilperoort, (1983). A binary vector strategy based on separation of vir and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature vol 303, 179-180. Josefsson LG, Lenman M, Ericson ML and Rask L, (1987). Structure of a gene encoding the 25 1.7 S storage protein, napin, from Brassica napus. J. Biol. Chem. 262 (25), 12196-12201. Kajiwara S, KakizonoT, Saito T, Kondo K, OhtaniT, Nishio N, Nagai S and Misawa N. (1995). Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli Plant Mol. Biol. 30 29 (2), 343-352.
WO 01/20011 PCT/SEUU/U1767 7 Krebbers E, Seurinck J, Herdies L, Cashmore AR and Timko MP, (1988). Four genes in two diverged subfamilies encode the rubulose-1, 5-bisphosphate carboxylase small subunit polypeptides of Arabidopsis thaliana Plant Mol. Biol. 11, 745-759. 5 Moloney M, Walker JM and Sharma KK, (1989). High efficiency transformation of Brassica napus using Agrobacterium vectors. Plant Cell Reports 8:238-242. Radke SE, Andrews BM, Moloney MM, Crouch ML, Kridl JC, Knauf VC (1988), Transformation of Brassica napus using Agrobacterium tumefaciens - Developmentally 10 regulated Expression of a reintroduced napin gene. TAG, 75: (5) 685-694 . Pua E-C, Mehra-Palta A, Nagy F and Chua N-H, (1987). Transgenic plants of Brassica napus. Biotechnology vol 5, 815-817. 15 Stilberg K, Ellerst6m M, Ezcurra I, Ablov S, Rask L (1996). Disruption of an overlapping E box/ABRE motif abolished high transcription of the napA storage-protein promoter in transgenic Brassica napus seeds. Planta 199(4):515-9.

Claims (11)

1. A DNA construct comprising in the 5' to 3' direction of transcription operably linked a promoter region directing transcription to the seed of an oilseed plant, a nucleotide sequence coding for at least one peptide with enzyme activity necessary for keto group 5 containing xanthophyll production and esterification in an oilseed plant and a transcriptional termination region.
2. The DNA construct according to claim 1, which between the promoter region and the nucleotide sequence coding for at least one peptide with enzyme activity additionally comprises a nucleotide sequence coding for a transit peptide directing the translated fusion 10 polypeptide to the chloroplast of the oilseed plant.
3. The DNA construct according to claim 1 or 2, wherein the promoter is a napin promoter, the peptide with enzyme activity necessary for keto group containing xanthophyll production and esterification is selected from the group consisting of peptides with, 1-D deoxyxylulose 5-phosphate synthase, isopentenyl pyrophosphate:dimethylallyl pyrophosphate 15 isomerase, geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, zeta-carotene desaturase, lycopene beta-cyclase, p-carotene hydroxylase, P-carotene C-4 oxygenase, and acyl transferase activity.
4. The DNA construct according to any one of claims 1 - 3, wherein the nucleotide sequence coding for a peptide with enzyme activity is a nucleotide sequence 20 coding for a N-terminally truncated p-carotene C-4-oxygenase gene from the alga Haematococcus pluvialis.
5. The DNA construct according to claim 4, wherein the nucleotide sequence is SEQ ID NO:1.
6. Transgenic oilseed plant cell comprising the DNA construct of any one of 25 claims 1-5 .
7. Transgenic oilseed plant cell according to claim 6, wherein the oilseed plant is selected from the group consisting of rape, sunflower, soybean and mustard.
8. Transgenic oilseed plant-produced xanthophyll.
9. Transgenic oilseed plant-produced xanthophyll according to claim 8, wherein 30 the xanthophyll is canthaxanthin
10. Transgenic oilseed plant-produced xanthophyll according to claim 8, wherein the xanthophyll is astaxanthin.
11. Transgenic oilseed plant-produced xanthophyll according to claim 8, wherein the xanthophyll is astaxanthin esters.
AU76936/00A 1999-09-17 2000-09-13 Dna construct and its use Abandoned AU7693600A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
SE9903336A SE9903336D0 (en) 1999-09-17 1999-09-17 DNA construct and its use
SE9903336 1999-09-17
PCT/SE2000/001767 WO2001020011A1 (en) 1999-09-17 2000-09-13 Dna construct and its use

Publications (1)

Publication Number Publication Date
AU7693600A true AU7693600A (en) 2001-04-17

Family

ID=20417035

Family Applications (1)

Application Number Title Priority Date Filing Date
AU76936/00A Abandoned AU7693600A (en) 1999-09-17 2000-09-13 Dna construct and its use

Country Status (7)

Country Link
EP (1) EP1212444A1 (en)
JP (1) JP2003509057A (en)
AU (1) AU7693600A (en)
CA (1) CA2382444A1 (en)
NO (1) NO20021305L (en)
SE (1) SE9903336D0 (en)
WO (1) WO2001020011A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2418155A1 (en) 2000-07-18 2002-01-24 National Research Council Of Canada Cloning, sequencing and expression of a comamonas cyclopentanone 1,2-monooxygenase-encoding gene in escherichia coli
US20070094749A1 (en) 2002-08-20 2007-04-26 Sungene Gmbh & Co. Kgaa Method for producing ketocarotinoids in plant fruit
DE10321963A1 (en) * 2003-05-15 2004-12-02 Icon Genetics Ag Process for the production of a plastid-directed protein in plant cells
EP1866428A2 (en) 2005-03-18 2007-12-19 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US20070293568A1 (en) 2006-06-16 2007-12-20 Yamaha Hatsudoki Kabushiki Kaisha Neurocyte Protective Agent
US8691555B2 (en) 2006-09-28 2014-04-08 Dsm Ip Assests B.V. Production of carotenoids in oleaginous yeast and fungi
CA2767724A1 (en) 2009-07-23 2011-01-27 Chromatin, Inc. Sorghum centromere sequences and minichromosomes

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618988A (en) * 1990-03-02 1997-04-08 Amoco Corporation Enhanced carotenoid accumulation in storage organs of genetically engineered plants
US5916791A (en) * 1995-11-24 1999-06-29 Hirschberg; Joseph Polynucleotide molecule from Haematococcus pluvialis encoding a polypeptide having a β--C--4--oxygenase activity for biotechnological production of (3S,3S)astaxanthin
BR9713462A (en) * 1996-08-09 2000-03-28 Calgene Inc Methods for producing carotenoid compounds and special oils in plant seeds.
US6429356B1 (en) * 1996-08-09 2002-08-06 Calgene Llc Methods for producing carotenoid compounds, and specialty oils in plant seeds
SE522246C2 (en) * 1997-02-27 2004-01-27 Astacarotene Ab Oral preparation for prophylactic and therapeutic treatment of Helicobacter Sp. infection
SE511237C2 (en) * 1997-12-16 1999-08-30 Astacarotene Ab Use of at least one type of xanthophyll for the preparation of a human or veterinary drug for the prophylactic treatment of mastitis in mammalian mothers

Also Published As

Publication number Publication date
NO20021305D0 (en) 2002-03-15
NO20021305L (en) 2002-05-15
CA2382444A1 (en) 2001-03-22
SE9903336D0 (en) 1999-09-17
EP1212444A1 (en) 2002-06-12
WO2001020011A1 (en) 2001-03-22
JP2003509057A (en) 2003-03-11

Similar Documents

Publication Publication Date Title
Sandmann Carotenoid biosynthesis and biotechnological application
EP1549133B1 (en) Fatty acid desaturases from fungi
US5618988A (en) Enhanced carotenoid accumulation in storage organs of genetically engineered plants
US6787683B1 (en) Phytyl/prenyltransferase nucleic acids, polypeptides and uses thereof
EP1709179B1 (en) Transgenic plants with reduced level of saturated fatty acid and methods for making them
EP0746615B1 (en) Dna constructs, cells and plants derived therefrom
JP2004514401A (en) Transgenic plants containing tocopherol methyltransferase
CA2491234A1 (en) Use of a gene for increasing the oil content in plants
US8557585B2 (en) Fusion polynucleotide for biosynthesis of beta-carotene using bicistronic gene expression and method for producing beta-carotene using the same
US20150322444A1 (en) Enhanced accumulation of carotenoids in plants
AU7693600A (en) Dna construct and its use
KR100905219B1 (en) Fusion polynucleotide for biosynthesis of beta-carotene comprising self-cleavage 2A sequence and transformed cell using the same
JP3759628B2 (en) Production of bleaching herbicide-tolerant plants
Karim Zarhloul et al. Breeding high-stearic oilseed rape (Brassica napus) with high-and low-erucic background using optimised promoter-gene constructs
CA2423502A1 (en) Triacylglycerol lipases from arabidopsis thaliana
EP1458878A1 (en) Method of increasing the transgene-coded biomolecule content in organisms
Supathaweewat et al. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003.
ZA200409749B (en) Fatty acid desaturases for fungi