AU592062B2

AU592062B2 - Synthetic regulation region

Info

Publication number: AU592062B2
Application number: AU46468/85A
Authority: AU
Inventors: Joachim Engels; Michael Leineweber; Eugen Uhlmann
Original assignee: Hoechst AG
Current assignee: Hoechst AG
Priority date: 1984-08-21
Filing date: 1985-08-20
Publication date: 1990-01-04
Anticipated expiration: 2005-08-20
Also published as: DK378385D0; AU4646885A; ES546242A0; FI853177A0; JPS6158591A; DE3430683A1; FI853177L; ES8605033A1; PT80989B; ATE46538T1; DK378385A; GR852000B; PT80989A; HUT39207A; EP0173149B1; KR870002259A; DE3573134D1; HU197353B; ZA856304B; EP0173149A1

Abstract

1. Claims (for the Contracting States : BE, CH, DE, FR, GB, IT, LI, LU, NL and SE) A synthetic regulation region for the expression of heterologous genes in E. coli, containing a promotor, a modified lac operator and a ribosome-binding site, characterized in that a) the -35 region in the promotor has the nucleotide sequence (coding strand) TTGACAT or CTTGACAT b) the -10 region in the promotor has the nucleotide sequence (coding strand) GTATAAT, c) a spacer group of 14 to 17 base-pairs is between the -35 and the -10 regions, and d) a spacer group of 6 to 14 base-pairs is located between the ribosome-binding site and the ATG start codon. 1. Claims (for the Contracting State AT) A process for the expression of heterologous genes in E. coli, characterized by placing, upstream of the heterologous gene in the direction of reading, a synthetic regulation region which contains a promotor, a modified lac operator and a ribosome-binding site, in which a) the -35 region in the promotor has the nucleotide sequence (coding strand) TTGACAT or CTTGACAT b) the -10 region in the promotor has the nucleotide sequence (coding strand) GTATAAT, c) a spacer group of 14 to 17 base-pairs is between the -35 and the -10 regions, and d) a spacer group of 6 to 14 base-pairs is located between the ribosome-binding site and the ATG start codon.

Description

it

I

11 5 92 062.L Form COMMONWEALTH OF AUSTRALIA PATENTS ACT 1952-69 COMPLETE

SPECIFICATION

Class tnt. Class -Application Numben Lodged., d8 mprete Specification Lodged: 4 Accepted: Published; 4 4*4

#V*

#Aelated Art Ljhql 2 ~frs 'aeof Applicant: Address of Applicant: ~Actiual Inventor; HOECHST

AKTIENGESELLSCHAFT

45 Bruningstrasse, D-6230 Frankfurt/Main Federal Republic of Germany JOACHIM ENGELS, EUGEN UHLMANN and ICHAEL LEINEWEBER Address for Servica EDWD. WATE RS SONS, QUEEN STREET, MELBOURNE, AUSTRALIA, 8000.

Complete Specification for the invention entitled: SYNTHETIC REGULATION

REGION

T~he following siaterrant Is a full description of this invention, including thq best method of performing It kno\fyn to us -2- -I HOE 84/F 192 In the pro; ration of eukaryotic polypeptides in bacteria- in particular E. colif by gen.ic engineering, the "heteroLogous" gene which codes for the desired eukaryotic polypeptide is incorporated in a suitable vector, an' this hybrid vector is then introduced into the bacterial host. However, a number of conditions must be met for this heterologous gene to be able to bring about the production of the desired polypeptide. An essential S,I' condition is a functioning regulation region, consisting Srfi of an operator, a promoter and a so-callcd "Shine-Dalgarno sequence", also called an SD sequence or, simplifying t (since only the corresponding sequence of the mRNA binds to the ribosome), called the "ri bs'ma binding site" below.

Correct expression of the gene, that is to say the production of the desired polypeptide, is conditional on recognition of the promoter by the bacterial host. The enzyme RMA polymerase which is intrinsic to the host t t* recognizes a part sequence in the $NA of the promoter and 20 binds to this part sequence. This brings about an opening of the double-stranded DNA in this region, whereupon the synthesis of the mRNA on the coding strand (transcription strand) starts.

The operator, which frequently overlaps with the promoter, is recognize- by a represtor protein which is intrinsic to the host. The frequency of transcription is controlled by the more or less effective binding of this repressor protein to the oper(tor. This system is affeci ted by inducers (inducer molecules) which bind the repressor protein and thus activate the operator.

Finally, the ribosomal binding site is responsible for the initially synthesized part of the mRNA containing an RNA sequence for the binding to the ribosome on which the translation into the polypeptide takes place.

Thus the regulation region is responsible for the expression of the gene to give the desired polypeptide via -3 the transcription stage (transcription of DNA into mRNA) and the subsequent translation. Apart from the sequence of nucLeotides, an important point about the structure of a regulation region of this type is the geometry, that is to say the spatial arrangement of the promoter, operator and ribosomal binding site.

Xn the following text, the numbering of the nucleotides relates to the site at which transcription starts (zero), counting being, as usual, from 5' to 3'.

Natural promoters for E. coli RNA polymerase have two regions of DNA sequences which are preserved. One is the -35 region and the other is the -10 region, also S called the "Pribnow-Schaller box", the numbering being Sbased on the abovementioned nucleotide numbering, that is I2 to say these regions are Located upstream of the start of t ranscription.

i The regulation sequence according to the invention represents a modification of the natural regulation sequences and ensures optimal binding of the RNA polymerase to the promoter and effective utilization of the operator. The regulation sequence according to the invention can either be placed directly upstream of the heterologous gene, whereupon the desired polypeptide (with methionine at the amino terminal end) is expressed, or a bacterial gene in whole or in part is interpolated upstream of the heterologous gene, this leading to expression of a fusion protein in which (a portion of) the bacterial protein is bonded to the amino terminal end of the desired polypeptide.

The synthetic regulation region according to the invention for the expression of heterologous genes in S'a. coli, containing a promoter, a modified lac operator and a ribosomal binding site, comprises one or more of the following features: the -35 reion in the promote ha, the fol.lowing nmlietid mmee 4: (erin 3trar.- -TT CA 4 a) a spacer group of 15 to 18 base-pairs is located between the -35 and the -10 regions, and b) a spacer group of 6 to 14 base-pairs is located between the ribosomal binding site and the ATG start codon and optionally: c) the -35 region in the promoter has the following nucleotide sequence (coding strand) TTGACAT or CTTGACAT, d) the -10 region in the promoter has the following Snucleotide sequence (coding strand)

GTATAAT.

Other embodiments of this invention include the following: A regulation region wherein the spacer region has base-pairs (bp) and/or is A-T rich. A regulation region wherein the spacer group is between the ribosome binding site and the start codon has 10 bp and/or is A-T rich. A regulation region wherein the r.b.s. is rich in 20 purines. A regulation region wherein the modified lac operon has the DNA sequence I or IIa as herein defined.

Apart from the advantages already mentioned, the regulation region according to the invention is distinguished by being very variable and, because there is a number of unique restriction sites, it allows the individual ,elements, namely the promoter, operator and ribosomal binding site, to be cut out and combined with known systems.

Moreover, by modification of the spacer groups, it is possible to vary the geometry and suit it even better to the circumstances of the individual case.

The regulation region according to the invention is preferably constructed by complete synthesis. It is possible to use the known DNA synthetic methods for this purpose, for example the phosphite method.

©CO ±1 4a DNA sequence I (Appendix) shows an advantageous embodiment of the total regulation region. DNA sequences IIa to IIh show specific, preferred embodiments of sequence I. For the synthesis of sequences I and II, a few nucleotide pairs which permit attack by restriction enzymes for "cutting to size" are additionally attached to the and 3' ends in each case. DNA sequence IIa is also given in complete detail, three nucleotide pairs being placed on each of the 5' and 3' ends. Obviously, it would also be possible to attach other or more nucleotide pairs to these.

In the Examples which follow, specific embodiments t, of the invention are illustrated in detail, from which the large number of possible modifications and combinations is evident to those skilled in the art. Unless otherwise S St 15 specified, percentages data in these Examples relate to weight.

tf a 5 Example 1 Synthesis of DNA sequence IIa a) Chemical synthesis of a single-stranded oligonucleotide The synthesis of the structural units of the gene is illustrated by the example of structural unit Ia of the gene, which comprises nucleotides 1-19 (plus three others at the 5 end to allow attack by Bam HI) of the coding strand. Uaing known methods J. Gait et al., Nucleic Acids Res. 8 (1980) 1081-1096), the nucleoside located at the 3' end, that is to say in the present case thymidine (nucleotide no. 19), is covalently bonded via the 3'j hydroxyl group to silica ge ((R)FRACTOSIL, supplied by j Merck). For this purpose, first the silica gel is reacted S with 3 -(triethoxysilyl)propylamine with elimination of It I I S ethanol and formation of an Si-O-Si bond. The thymidine is reacted with the modified carrier in the presence of paranitrophenol and N,N'-dicyclohexylcarbodiimide, the free carboxyl group of the succinoyl group acylating the amino radical of the propylamino group.

S In the following synthetic steps, the base compo- "20 nent is used in the form of the dialkylamide or chloride of the monomethyl ester of the side 3'-phosphorous acid, the adenine being in the form of the N 6 -benzoyl compound, the cytosine being in the form of the N 4 -benzoyl compound, the guanine being in the 1,25 form of the N 2 -isobutyryl compound and the thymidine, which contains no amino group, being without a protective group.

100 mg of the polymeric carrier which contains 4 Jmol of bound thymidine are treated consecutively with the following agents: a) nitromethane b) saturated zinc bromide solution in nitromethane containing IX water c) methanol d) tetrahydrofuran e) acetonitrile f) 80 pmol of the appropriate nucleoside phosphite and 400 Pmol of tetrazole in 1 ml of anhydrous acetonitrile (5 minutes) 6 g) 20% acetic anhydride in tetrahydrofuran containing lutidine and 10% dimethylaminopyridine (2 minutes) h) tetrahydrofuran i) tetrahydrofuran containing 20% water and 40% Lutidine; j) 3% iodine in collidine/water/tetrahydrofuran in the ratio by volume of 5:4:1 k) tetrahydrofuran and L) methanol.

In this context, the term "phosphite" is to be understood to be the monomethyl ester of the deoxyribose 3'-monophosphorous acid, the third valency being saturated t by chlorine or a tertiary amino group, for example a morphoLino radicaL. The yields in the individual synthetic Ssteps can in each case be determined, after the detrity- SI' lation reaction by spectrophotometry by measuring the absorption of the dimethoxytrityl cation at a wavelength of 496 nm.

After the synthesis of the oligonucleotide is compLete, the methyl phosphate protective groups of the oligomer are eliminated using p-thiocresol and triethyl- S* amine. The oligonucleotide is then removed from the carrier by treatment with ammonia for 3 hours. Treatment I of the oligomers with concentrated ammonia for 2 to 3 days quantitatively eliminates the amino protective groups on the bases. The crude product thus obtained is ourified by S" high-pressure liquid chromatography (HPLC) or by poly- Sacrylamide gel electrophoresis.

The other structural units Ib-Ih of the gene, whose nucleotide sequences are derived from DNA sequence IIa, are also synthesized entirely correspondingly.

b) Enzymatic linkage of the single-stranded oligonucleotides For the phosphorylation of the oligonucleotides at the 5' terminal end, 1.0 nmol of each of oligonucleotides Ib and Ic are treated, with the addition of 10 nmol of adenosine triphosphate, with 6 units of T4 polynucleotide kinase in '20 pl of 50 mM tris HCl buffer (pH 7.6), mM magnesium chloride and 10 mM dithiothreitol (DTT) at 37 0 C for 30 minutes Richardson, Progress in 7 Nucl. Acid. Res. 2 (1972) 825). The enzyme is inactivated by heating at 95 0 C for 5 minutes.

Oligonucleotides If and Ig are phosphorylated ana ogously.

Oligonucleotides Ia and Id and phosphorylated oligonucleotides Ib and Ic are heated in 40 pl of mM tris HCL buffer at 95 0 C for 5 minutes, and they are then allowed to cool slowly to room temperature. To this mixture are added 20 mM magnesium chloride, 10 mM DTT and 1 mM ATP, and reaction with 100 units of T4 DNA Ligase is allowed to continue at 25°C for 16 hours.

Fragments Ie and Ih are linked with phosphorylated S o fragments If and Ig analogously.

The product of the ligase reaction of oligonucleotides Ia to Id (gene fragment A) is freeze-dried and incuo*o* bated in 100 Pl of a buffer solution (150 mM NaCL, 10 mM tris HCl, pH 7.6, 6 mM magnesium chloride), which contains 200 units of the endonuclease Barn HI, at 37°C for 3 hours.

The product of the Ligase reaction of oligonucleotides Ie to Ih (gene fragment B) is freeze-dried and incubated in 100 Pl of a buffer solution (100 mM tris HCL, %o pH 7.5, 50 mM NaCL, 5 mM magnesium chloride), which contains 200 units of endonucLease Eco RI, at 37oC for 0 3 hours. After the enzyme digestion has been stopped by heating at 95 0 C for 2 minutes, the cut gene fragments A and B are purified by gel electrophoresis on S polyacrylamide gel (without addition of urea, 20 x 40 am, o 2 mm thick), the marker substance used being pBR 322 (supplied by Biolabs) cut with Hae III. After extraction of the DNA bands and purification on (R)Sephadex G50 and Sop Pak (supplied by Waters), gene fragments A and B are lirnk d by "'blunt end ligation". A synthetic regulation region corresponding to DNA sequence Ila which has, on the 5' end of the coding strand, an extension for attack by Barn HI and, on the 3' end of the codiag strand, an extension for attack by Eco RI is obtained in this way.

Example 2: Hybrid plasmids which contain the synthetic control region 8 a) Incorporation of the control region in pUC 8 The commercially available plasmid pUC 8 is opened in known manner using restriction endonucleases Eco RI and Bam HI, and is separated, using 1% low-melting agarose S gels, from the oligonucleotides which have been cut out.

The cut plasmid is recovered after dissolving the gel at elevated temperature in accordance with the statements of the manufacturers. 1 Pg of the pUC 8 plasmid thus opened is Ligated with 10 pg of the synthetic control region using T4 DNA ligase at 14°C overnight. In this way, a modified pUC 8 plasmid having the integrated control region is obtained. This hybrid plasmid is represented in Figure 1, in which the control region is indicated by SIP, which stands for "synthetic idealized promoter".

b) Transformation I The strain E. coli K 12 is made competent by S treatment with a 70 mM calcium chloride solution, and a suspension of the hybrid plasmid in 10 mM tris HCI buffer (pH which is 70 mM in calcium chloride, is added. The transformed strains are selected for ampicillin resistance, and the inserted sequence is verified by Maxam-Gi bert sequence analysis Maxam and W. Gilbert, Proc. Natl. Acad. Sci. USA 74, 560-564 (1977)).

1' Example 3: Expression plasmids which contain the synthetic Ot, control region The commercially available plasmid pBR 322 is opened using the restriction enzymes Bam HI and Sal I and is purified on a IX agarose gel as de.cribed above.

The synthetic control region is reisolated from the modified pUC 8 derivative by cutting with the enzymes Eco RI and Bam HI, purified on 10X polyacrylamide gels, and recovered by subsequent electroelutior. In an analogous manner, theY-interferon gene is isolated from appropriate hybrid plasmids by cutting with the restriction enzymes Eco RI and Sal I and purifying on a 2X low-melting agarose gel. The hybrid plasmid containing the -interferon gene which is used is the plasmid pMX 2 whose preparation is described in German Patent Application i 9 P 34 09 966.2. However, the plasmid described in European Patent Application 0,095,350 can also be used.

The linearized plasmid pBR 322, the synthetic control regions and the Y-interferon gene are then Ligated in known manner, the plasmid as shown in Figure 2 being obtained.

Example 4: Comparison of the activity of the synthetic control region with that of the known potent tac control region.

The plasmid pKK 177.3 known from the literature Amann et al., Gene 25, 167 (1983)) is cut using the restriction enzymes Eco RI and S I as described above, Sand the Y-interferon gene is incorporated, by which means Sthe Latter is coupled to the tac control region. The plasmid shown in Figure 3 is obtained.

To remove the tac control region from pKK 177.3, the latter is digested with Bar HI and Sal I. The plasmid thus linearized is ligated with the Y-interferon gene and the synthetic control region as described above. The hybrid plasmid shown in Figure 4 is obtained.

The hybrid plasmids shown in Figure 3 and Figure S 4 are transformed into E. coli K 12, and the bacteria are S cultured in 2 YT medium (Miller, Experiments in Molecular Genetics; 1972) until an optical density of 1 at 578 nm in the shake culture is reached. 0.1 mM IPTG (isopropylt 6-thioga actopyranoside) is added to one portion of the bacterial culture, and thus induces the synthesis of1'interferon for 2 hours.

The bacteria are then removed by centrifugation and disrupted by treatment with lysozyme, EDTA and ultrasound (Maniatis et al., Molecular Cloning, Cold Spring Harbor, 1982). The interferon titers of the bacterial lysates are found with a commercially available radioimmunoassay (Celltech) to be as follows: Plasmid shown in Figure 3: 1 x 105 units prr Ll Plasmid shown in Figure 4: 1.5 x 10 5 units per ml.

Thus, in comparison with the tac region, which is known to be excellent, the f-interforon yield obtained with the control region according to the invention is 50X higher.

a a..

a a a a.

a a a- a a a a a aa a 44 a A a a.

a a aM a a A a A S S a a .a a a a a S 10 DIIA sequence I (coding strand) GGATCCTAAATAAATTCTTGACATTTI TTAA2TAATTTGGTATAATGT3T 4GAATTG5GAGCG6T7ACAATTBC9CIQGlI12TI3TA14TT15 (ATG) 3' I1= 2= 3= 4= 6= T or G A Or C G or C G or A T or C C, GA or GAA 7 =A or C 8 T or direct bond 9 =A or TAGA 10 A, TTTAAA, AAGCTT or AAGCTA AG or GA =A or G =C or T GAA or AGC C or direct bond DNA sequences lha-h: Ha b

C

d e f 9 h 6 7 GAA A GAA A GAA A GAA A GAA A C C GA C GA C 10

A

TTTAAA

AAGCTT

A AG CTT AAGC TA 14 GA A

GAA

AGG

3 Ul 46 9=

I

-DNA sequence Ila Barn HI A G 3' T C 1 10 C G GA TC C TA A AT A A A T T CT T.G AC A G C C TA G GATT T AT T T A A GA A C TG T A Ib Aha III *t

I

I I $111 4111

I

*141 I 11 I I I $4 (1

I

I't~ 1T T TT TA AAT AA TT TG G TA TA A TG 3' A AA AAT T TA TT A AA0CCA TA m.TA CA Ib-~g Id Ie 50 60 5' G T G GA AT G TG A GC G GAA TA AC A A T T 3' C A C C T TA AC ACTM6C GC C T TAT T C T TA AA A if 11

I

1*1 r 11 I I

II

Eco RI C A C A G AG G A T C T A G A A T T C A C T G TG TC TC C TA GA TCTT A A GT GA Ih

Claims

1. A synthetic regulation region for the expression of heterologous g-nes in E. coli, which contains a promoter, a modified lac operator and a ribosomal binding site, having one or more of the following features: a) a spacer group of 15 to 18 base-pairs is located between the -35 and the -10 regions, and b) a spacer group of 6 to 14 base-pairs is located between the ribosomal binding site and the ATG start codon and optionally: c) the -35 region in the promoter has the following nucleotide sequence (coding strand) TTGACAT or CTTGACAT, d) the -10 region in the promoter has the following nucleotide sequence (coding strand) GTATAAT.

2. A regulation region as claimed in claim 1 wherein ,the spacer group between the -35 and the -10 regions has 17 base-pairs and/or is rich in A and T.

3. A regulation region as claimed in claim 1 or claim 2t wherein the spacer group between the ribosomal binding site and the start codon has 10 base-pairs and/or is rich in A and T.

4. A regulation region as claime' n one or more of the preceding claims, wherein the ribosomtd -inding site is rich in purines. r w- -13 A regulation region as claimed in oci or more of the preceding claims, wherein the lac operator has the DNA sequence I or Ila as herein defined.

6. A gene s uct~ure containing a regulation region as clazimed in any one of claims I to

7. A hybrid vector containing a gene structure as claimed in claim 6. ifif 00 0 if ~4 if ifif if ifififO ,*if~ if 0*4.0 a if,. if if 00 if if 04if0

8. claim 7.

9. claim 8. E. coli containing a hybrid vector as claimed in A polypeptide expressed by E. coli as olaimed in DATED this 16th day of Oc tober, 1989. HOECHST AKTIE1W4GESELrSCHAFT ifoifif if ifif 4 *.j if if 4 t ifi 0041 4 if if ifs I if 0if~ifif if if if 4 44 44 if 0 ~I WATERMARK PATENT TRADEMARK ATTORNEYS 50 Queen Street, MELBOURNE. VIC. 3000. AUSTRALIA. DBM:JM~W:JZ (9.22)