JPH03503360A - ribosome binding site - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] liposome binding site Technical field of invention The present invention relates to methods of enhancing expression of heterologous polypeptides. In more detail, The present invention is directed to the production of heterologous molecules by changing the binding site of liposomes that are effectively bound to the liposomes. Concerning enhancement of expression of lipeptides.

Background of the invention Certain heterologous polypeptides, including bovine somatotropin (BSt), It is difficult to express in the E. coli expression system. BSt structural remains This is achieved by modification within the first four codons of the cDNA encoding the gene. When expressing their modified cDNA in a pBR322-related vector, BSL The level of expression increases.

These modified cDNAs, when placed in a runaway expression vector, is expressed at even higher levels (US Patent Application S,N.

016.294. Filed on February 19, 1987 (cited herein as a document) .

The modified liposome binding sites of the invention can be achieved by launchway vectors. A non-runaway vector, such as pBR322, corresponding to that produced by resulting in the expression of a heterologous polypeptide by the derivative.

Typically, a heterologous polypeptide is cloned and transformed in a transformed host. Methods of expression are well known to those skilled in the art. As such a heterologous polypeptide , such as human insulin, growth hormone, interferon and factors ■, These include viral antibodies, and other animal hormones.

A liposome binding site is one of the elements involved in such expression. child It includes a region of approximately 20 nucleotides on each side of the start codon, Shine-Dalgarno sequence (Shine-Dalgarno 5eq) upstream from nucleotide) usually contains 6-1'O nucleotides.

The 20 nucleotides after the start codon mark the beginning of the inserted gene sequence for expression. It contains a portion of the gene that can be modified without changing the amino acid sequence of the gene. do not have. Therefore, in a practical sense, manipulation of the liposome binding site This can be done only in the region upstream from the codon. The liposome binding site is a salt It is known that Shine-Dalga functions best when containing groups. Except that the sequence is generally purine-rich, specific There are no known conditions regarding the base. The differences between the various known liposome binding site sequences The strange difference is whether a gene is highly or poorly expressed when it is related. does not give a clear comparison to predict. A preferred embodiment of the present invention is that A and T Shine-Dalgarno sequence ranked 7 using nucleotide-rich sequences This results in increased adenine and Liposome binding site derived from the natural liposome site having a thymidine residue It is to create a position.

Natural BSt is a mixture of heterologous proteins, and its amino acid sequence is known. [Paladini, A, C, et al., Molecular Biology ・Molecular Biology of Growth Hormone owth Hormone), CRC Reviews in Biochemistry Story 4 (CRCReviews in Biochem,), 15(1): 25-56 (1983)]. The natural mixture is purified from the bovine pituitary gland. Ru. Commercial studies on using BSt to promote growth and lactation The potential for [Eppard, P. J. and Ba. uman, D, E,), The Effect on Long-Term Atomist Rage 1 on Growth Hormone on Performance, On Roughness The Effect of Long-Ter m Administration of Growth Hormone o n　Psrformans　ofLacLating　Dairy　Cows ); and Bauman, D.E., Effect on Gro. Us Hormones on Growth Rain and Mammary Development Effect of Growth Hormone on Growth Rates and I Jammary Develo pment of Ruminants), Proc, 1984 Cornell Ni. 7 Allens for Feed Manufacturers (CornellNutrition Conference for Fee d Manufacturers) + pp, 5-17. = Knee York, Ita Power's Cornell University Published by ].

Recombinant bovine somatotropin (rBst) is produced using various recombinant genetic plasmids. and can be produced in transformed microorganisms [Seeb urg, P. H.) et al., “Efficient Bacterial Expression. ・On Bobbin and Boshin Growth Hormones (Efficien) t Bacierial Expression of Bovine and Forcine Growth Hormones)”, DNA, 2:37- 45 (1983); European Patent Publication No. 47600; British Patent Application CB 20 No. 7324SA; Schoner, B.E., et al., Roll on m. RNA Transrage Efficiency in Bobbin Growth Fist Hormone Expression in Escherichia Cori (Role of mRNA Translational Efficiency Bovi ne Growth Hormone Expression in Esch erichia coli).

PNAS US^, 81:5403-5407 (1984); European patent application Junsan No. 103395; and European Patent No. 111,814], these The literature suggests that the 5″ of the BSL gene produces a protein different from the natural polypeptide. Insertions or deletions of terminal bases, or maximizing preferred codons and mRNA Changes in or expression of BSt cDNA to reduce the second construct in Concerning the use of runaway plasmids to enhance On the other hand, The present invention provides heterologous polypeptides, particularly AT- It teaches the use of rich liposome binding sites.

Methods for culturing and fermenting transformed microorganisms expressing BSt are described in the aforementioned document. It is also quoted in

Purification of biologically active rBst from transformed cells has also been previously disclosed. [U.S. Pat. Nos. 4,511.502, 4,511.503, 4,512] No. 922 and No. 4.518.526; European Patent No. 131843; Schoner, R.G., et al., 'Isolation and ・Purificecon on Protein Granules 70ml ・Cori Sells Overproducing ・BST (Isolation) and Purification of Protein Granules from E, coli Cells Overproducing BSt) ”, Bio-Tech, 3:151-154 ( 1985)].

Summary of the invention The present invention relates to liposome binding sites rich in adenine and thymidine.

More particularly, the present invention provides deoxyribonucleans encoding heterologous polypeptides. A recombinant consisting of a cleotide sequence and a liposome binding site operatively linked to it. a DNA molecule, in which the liposome binding site is a molecule that induces the liposome binding site; increased adenine (A) compared to the natural liposome binding site in which it is associated. and a thymidine (T) residue. It is something that

More particularly, the heterologous polypeptide is preferably porcine, ovine and more particularly , the recombinant DNA molecule liposome binding site deoxyribonucleotide sequence is A 　AGTTCACGTTATTAA　AA　ATTA　A　AGAGGTA　T ATATTAATG or AAGTTCACGTTATTAAAATTAAG GAGGTATATCGATAATG, preferably bovine somatotopin AAGTTCACGTTATTAAAAAAATTAAAGAGGTATAT ATTAATGGCCTTCCCACCT MapukohaAAGTTCACGTTAT TAAAAATTAAGGAGGTATATCGATAATGGCCCTTCCC It is AGCT.

The present invention is directed to AAGTTCACGTTATTAAAAAAATTAAAGAG GTATATATTAATGGCCTTCCCAGCT%AAGTTCACGT TATTAAAAAA TTA AGGAGGTATATCGATAATGGCC TTCCCAGCT1AAGTTCACGTTATTAAAATTAAAGA GGTATATATTAATG and AAGTTCACGTTATTAAAAAA Deoxyliponu selected from TTAAGGAGGTATATCGATAATG It provides a DNA molecule consisting of a nucleotide sequence.

The present invention also provides increased A and T residues compared to natural liposome binding sites. and derived from or associated with the natural liposome binding site. It also provides a liposome binding site.

Detailed description of the invention Generally, the terminology and descriptions of common laboratory methods used in the present invention are The definition is Molecular Cronin by Maniatis, T. Molecular Cloning, A Laboratory Manual Laboratory Manual) [Cold Spring +/11 Bar ・Laboratory (Cold Spring l{arbor Laboratory) ry). Cold Spring Harbor, New York. 1982] Smell This is something that can be seen. The manual is herein referred to as “Mani atis)" and is cited herein as a document.

All E. coli strains were grown in Luria broth (L B), LB containing 0.2% glucose, Dirco antibiotic medium (Dirco 's Antibiotic Mediu+n) #2 or 0.2% Glue M9 supplemented with course and 0.05-0.1% acid monohydrolyzed casein amino acids Grow on medium. Maniatis, a drug that treats strains resistant to antibiotics. maintain concentration. Morrison, D.A. [(1977), Journal of Bact. 132:3 Transformation was performed according to the method disclosed by No. 49-3511.

All restriction endonucleases and other DNA modifying enzymes are commercially available. available and used according to the manufacturer's instructions.

Control@7 fragments were determined by agarose or polyacrylamide gel electrophoresis. separated by electroelution and isolated by electroelution ( Maniatis).

Large scale rapid plasmid isolation is performed as described by Maniatis.

Protein concentration was determined by Coomassie Blue staining (Coomassie Blue staining). BioRad protein test kit based on Measure using

SDS polyacrylamide gel electrophoresis for protein analysis was performed using Mohs rse, L. ) et al. 1978. Journal of Pyostology (J.Viro) l. ). 26:389-410.

Western immunoblotting analysis was performed by Towbin.H. et al. 1979, Proceedings of the National Academy of Sci. (Proc. Natl. Acad. Sci.). USA, 76:43 50-4354.

The colony hybrid method was developed by Grunstein, M. et al. Rossi Deindus of National Academy of Sciences (Pro c. Natl Acad. Sci. ), 72:3961-5 (1975) Follow the general instructions.

Hybridization conditions for oligonucleotide probes were described by Guedel ( Goeddel, D. V. ) et al.'s Nature. 290=2 0-26 (1981).

Plasmids for restriction endonuclease digestion to analyze transformed strains. DNA mini-lysate was developed by Holmes, D.S. et al. Karoo Biochemistry (Analyt.Biochem-), 114:1 93 (1981)] or the alkaline cell lysis method described in Maniatis. thus prepared. Large-scale plasmid preparation follows the method described by Maniatis. This is carried out by the CsCQ precipitation method.

Plasmid sequencing was performed by Wallace, R.B. et al. ene). 16:21-26 (1981)] dideoxy chain growth termination and adaptation method. , or Maxam, A.M. and Gilbert ,W. ) [Methods in Enzymology ymology). 65:499-560 (1980)] according to the chemical decomposition method. I will do it.

Oligonucleotides were obtained from Needham-Van de Juanter. Nuclear Acids Research (NuDevanter, D.R.) et al. cleic Acids Res, ), 12:6159-6168 (1984 ), the in-phase phosphoramidite triester method [view -Beaucage, S.

L, ) and Caruthers, M, H, Tetrahedron ・Letts (Tetrahedron Letts,), 22(20):18 59-1862 (1981)]. oligonucleo Tido was prepared using 12-20% polyacrylamide containing 7M urea. Purified by gel electrophoresis. 37" in 0.54 M ammonium acetate. Elute the appropriate bands from the gel by incubating the gel slices. . Oligonucleate on a Waters 5ep-Pak C18 column Absorb cleotide and elute with acetonitrile:HzO (40:60V:V) The salt is removed by this.

For high level expression of desired cloned genes in prokaryotic systems, minimal , a strong promoter to direct mRNA transcription, and a liposome for translation initiation. some binding sites, and a transcription termination code (total Specifically, it is essential to construct an expression vector containing an "expression control sequence".

The term "effectively binds" refers to Having appropriate starting signals and insertion under the control of expression control sequences. allows expression of the encoded gene and synthesis of the desired product encoded by the gene. This includes maintaining the correct reading frame for the purpose of making the readings possible. large amount of genetic material Product synthesis inhibits cell proliferation and often causes cell death. Before the promoter is introduced, the selected promoter is In addition, cell proliferation should be regulated in such a way that high concentrations can be reached. suitable for this An example of a regulatory region is the E. coli (E, col) tryptophan biosynthetic pathway. Promoter and operator region Qrp promoter) and Phagela It is a wasteful left hand promoter (PL). The trp promoter is tryptopha tryptophan starvation or induction. It can be induced by the addition of indole acrylic acid [Yanofsky (Ya. nofsky, C.) et al., Journal of Bacteriology (J. Bact. Eriol, ), 158:1018-1024 (1984)]. promoter -P, is regulated by the repressor cl. el gene, e.g. c18 For temperature-sensitive mutations in 57, Pt was induced at temperatures above 38°C. [)\-Skovjnots (Herskowitz, I) and Hagen ()lagan, D.), 1980. Ann, Rev, C+enet, + 14:399-445].

Most preferably, the expression vector has restriction enzyme sites for insertion of the gene. It is expressed at an appropriate distance from the Yine-Dalgarno sequence.

゛ In E. coli, the start codon, usually ATG, is the gene is placed in conjunction with an appropriate liposome binding site sequence for effective expression of [Gold, L. et al., 1981. Ann, Rev.

Microbiol, 35:365-403; Chassis (Schere r, 'G, F, E,) et al., 1980 ucleic Ac1ds Res, ), 17:3895-39061゜ The origin of cDNA sequences in E. coli and other prokaryotes. In order to synthesize proteins encoded by karyotic genes within cells, the 5' The translated region and the signal peptide-encoding sequence are removed to produce the mature protein. It is convenient to provide an initiation codon for the initiation of translation of a sequence encoding be. A chemically synthesized oligonucleotide containing some of the coding sequences for the mature protein. It is also necessary to exchange cleotides to maximize translation efficacy. Preferences of the present invention A new DNA coding sequence can be created at the fourth codon by changing GCC to GCT. Modified BSt cDNA sequence. Preferred vectors of the invention have very high pBR32'2 replica expressing modified levels of bovine somatotropin Consists of Vectors other than pBR322-derived plasmids may also be used. can. pBR322 has the Co1El replicon. Co1El　 Other useful plasmids containing replicons include pKC71,) AT15 3 and pBR325. These are the drug resistance manufacturers pACY C184 (pl 5A replicon), pNo. 1523 (pMB 1 replicon) I) LG338 (+) SCIOI L, precon), Oyohi pBEU5 0 (R1 replicon) [Maniatis; Pouvel Cloning Vectors ), Elsbayer, New York 1985. In addition, pURA (R1 and C oIEl replicon; U.S. Patent No. 1i1S,N, 016.294), pUc 19 [Yanisch-Perron, C. et al., Gene (Gene), 33:103-11919851 and pHc314 [Poros (Boros, I,) et al.

Gene 30:257-2601984 is also useful.

As mentioned above, isolation and purification of mammalian somatotropin from recombinant microorganisms , are known [e.g., U.S. Pat. No. 4,511.502; 2 and 4.518.526: European Patent Application No. 131.843; and Schoner, R.G., et al., Isolation and Pure -Refinement of Protein Granules 70ml ・Cells Over Producing ・BGH (Isolation and Purification of protein granules fr om E, coli cellsover producing BGFI), Bio-Technology, 3:151-154 reference]. Generally, the method involves lysing the recombinant microorganism, selective centrifugation, Reshuffling and reshuffling of non-natural disulfide bonds to natural structures and column chromatography.

Conventions used to represent plasmids and 7 fragments in charts 1-4 Examples are as follows. Single lines represent circular and linear double-stranded DNA; Translation initiation or transcription is in the direction of the arrow shown below the promoter or structural gene. occurs in The asterisk (”) indicates the missing nucleotide bridge that completes the plasmid circle. Represents a bridge. Fragments have an asterisk because they are linear pieces of double-stranded DNA. do not have. Endonuclease restriction sites are indicated above the line. Genes are shown below the line . The positional relationship between these components is not the actual distance, but is based on the described DNA sequence. It is only meant to indicate the relative position above, and does not include cDNAs modified with C or CT. plasmids pTrp-BSt102 and pTrp-BStm4. The construction is disclosed in detail in US Patent Application No. S, N, 016.294. Generally speaking The expression vector pTrpl is derived from pSK4 [Kayt. es, P, S, et al., 1986. Journal of Biotechnology (J , of Biotechnology), 4:205-218). pTrp l is the promoter of the tryptophan biosynthesis pathway of E. coli and operator sequence (trp promoter), trpL gene shiner Dulcano sequence, pBR322-derived origin of replication, and ampicillin resistance Contains genes. pTrpl follows the trpL Scheindal force-no sequence. Only one ClaI site, and only one KpnI/ immediately after the start codon ATG It has an Asp718 site. The open cell inserted at the ClaI site of pTrpl Genes with start codons are not expressed with foreign amino acids.

4 containing the cDNA sequence encoding amino acid residues 24 to 188 of BSt. The 94 bp Pvun fragment was derived from pLG23 [Illinois, USA; Northern Surgical Research Laboratory in Peoria n Regional Research Laboratory), the accession number pTrp isolated from 1, which has been deposited under No. NRRL B12436. codons for the first 22 amino acid residues. Create a BSt cDNA sequence that is deleted.

The obtained plasmid is designated as pTrp-BSLll1. incomplete S For each manipulation of the t sequence, the codon for amino acid residue 188 was Connect the BSt 3″ end between the MstII and BamH1 sites with a suitable oligonucleotide. Removed by replacing it with Otide. The obtained plasmid was pTrp- It is written as B Stml b. To eliminate the BSt sequence at the 5° end, C1al Replace the small region from to Pvun with the appropriate oligonucleotide. obtained plasmids, namely pTrp-BStlO2 and pTrp-BStm 4 has a BSt sequence and trpL liposome binding downstream from the trp promoter. It has parts. Plasmid pTrp-BStl O2 contains the BSt coding sequence. Although there is no change in the initial part, pTrp-BSS tm4 has GCC It has the fourth codon for alanine changed from to GCT. These plastics Sumido is shown in Chart 1.

Example 1: BSt expression plasmid with AT-rich liposome binding site construction Liposomes with increased A and T residues compared to the starting liposome binding site To construct a plasmid to express BSt with binding sites, two from Hpal in pTrp-BS tm4 using the oligonucleotide of Replace the C1aI region.

Regarding chart 2, pTrp-BS tm4 with HpaI and C1al Process. Place the HpaT cleavage site in the trp promoter sequence and The cleavage site is placed immediately upstream of the start codon ATG. Shine-Dalgarno arrangement Except for guanidine (G) and cytosine (C) in the liposome binding site. ) generated by C1al digestion. mung-bean overhang Remove by ze. Then, the 7 fragments (flags) generated in this way 1) with two complementary oligonucleotides chemically synthesized as described above. (Chart 2). Fragment 2 is , can be ligated to fragment l in two directions, so the start codon The desired orientation associated with the Shine-Dalgarno sequence (GAGG) close to ATG is Identified by sequencing. The plasmids were pAT-831m4 and write down In a similar manner, pTrp-BSt102 was isolated from Hpal, Cla I and Treated with mango bean nuclease, ligated to 7 fragment 2, yielding T-102.

pTrp-BStl　O2, pAT-BStl　02, p7　rp　-B　S　 The fourth codon and mRNA of BSt in tm4 and pAT-831m4 The starting sequence between base +1 and the resulting sequence are shown in Chart 3.

Example 2: A B using a plasmid with a T-rich liposome binding site St expression To test for BSt expression using the expression plasmid of Example 1, plus Mid-competent E. coli strain, K12 (ATCC# e23716) and D112 (U.S. Patent Application S, N.

016.294). Cultures were grown in 0.2% glucose, 100μ9/ in LB medium containing ampicillin and 100 μg/mQ tryptophan. Grown overnight. - The late culture was grown in 0.2% glucose, 0.05% acid hydrolysis solution. Contains tococlaved casein amino acids and 100μg/mQ ampicillin Diluted 50-100 times in M9 medium to an OD of 0.3-0.4 at 550 nm. Grow at 30'' or 37'' with aeration until

A sample was taken from the induced culture and subjected to 5DS-polyacrylamide gel electrophoresis. It was analyzed by the movement. The gel was stained with Coomassie blue and scanned for visual inspection. The amount of BSt produced was measured. The gel was used for Western immunoblotting analysis. It was also used for The results are shown in Table 1. Values for low levels of expression are The high level of expression was determined by 5DS-PAGE. It is something.

Porcine and ovine somatotropin can be produced in a similar manner.

Implementation fi3: First step for BSt expression with AT-'J liposome binding site. Construction of 2 plasmids The two complementary oligonucleotides used had C1al sticky ends and Therefore, these are pTrp-BS treated with Hpal and C1al. Same as pA, T-831m4 (*Example 1) except that it is cloned into tm4 Then, construct plasmid pTrp2-BStm4. pTrp2-831m 4 and p, AT-831m4 is the difference between pTrp2- B S tm4. The liposome binding site is more A- than the liposome binding site in pAT-831m4. It is not T-rich (see chart 5).

Example 4: B using a second plasmid with an AT-rich liposome binding site St expression Plasmid pTrp2-BStm4 was created essentially as described in Example 2. E. coli strains 12 and D112 were transformed and induced, Expression was analyzed. The results are shown in Table 1.

Table 1 pTrp-BSL102, trpL liposome binding site, <0.01 (No change at the beginning of 0,013 St pAT-BSt102, AT-rich liposome binding site, <0.01 1 No change at the beginning of BSt pTrp-BStm4, trpL liposome binding site, <1 1G CC changes to GCT, t:ala4pAT-BSt+n4, A-T rich lipo Some binding site, >10 >20 changed from GCC to OCT and I:al a4pTrp2-BSLm4, AT-rich liposome binding site, 25GCC? ala4 changed to OCT The results in Table 1 show that the BSt cDNA sequence is very low, especially in the D112 host. We show that the level of expression can be increased by AT-rich liposome binding sites. ing. Low level expression of cDNA sequences modified with the ala4 codon indicates that AT- Rich liposome binding sites can enhance up to 20% of total cellular protein Ru.

Example 5: Human tumor necrosis factor with A T-rich liposome binding site -Enhancement of expression of σ (TNF σ) A) Contains AT-rich liposome binding site Construction of expression vector To insert the cloned gene behind the AT-rich liposome binding site, Construct the current vector pTrp2. pT rp -con S D [Curly ( K, A, Curry) and C-S, C, Tomich, “F. ect on liposome binding site on gene expression Restion in E Cori (Effect of Riboso+ne B indingSite on Gene Expression: n E, c oli), DNA, 3988 printing], the liposome binding site region in A Replace with an oligonucleotide containing a T-rich sequence. As shown in chart 3 , the liposome binding site region in pTrp-conSD was expressed with HpaI and C It is removed by treatment with 1al. The obtained fragment 3 was subjected to Hpal and Ligate to two complementary oligonucleotides with C1ar ends to create pT Get rp2. pTrp-cons D and pTrp2 are both E. Promoters and operators of the tryptophan biosynthetic pathway in E. coli promoter sequence Qrp promoter), Shine-Dalgarno sequence GGAGG liposome binding site with a single Clal after the Shine-Dalgarno sequence site, origin of replication derived from pB R322, and genes related to ampicillin resistance Contains. The liposome binding site sequence is AAG in pTrp-consD. TTCACGTAAGCAGGATATCGATAATG and pTrp2. AAGTTCACGTTATTAAAAAAATTAACGAGGTATATC It is GATAATG. The difference between these two sequences is that the liposome in pTrp2 The liposome binding site in pTrp-consD that induces it The point is that it is more AT-rich than the rest of the world.

B) Construction of plasmid for expression of TNFa Gene encoding TNFa British Biotechnology Limited (British B io-technology　Limited　; Brook House, Watlington Road, Cowley, 0xford, 0x4 Purchase from 5LY, UK). This gene has several unique restriction endonucleotides. It has a leotide site. 590bp from this gene 5naB I-Ba The mHI7 fragment can be isolated, which consists of the first two codons. contains the mature TNFσ sequence. This 7-ragment is the first together with two complementary oligonucleotides supplying the two codons; Clone into the current vectors pTrp-con SD and pTrp2. blood As shown in chart 4, pTrp-conSD and pTrp2 were injected into C1a 1 and BamHI to yield seven fragments 5 and 6, respectively. 7 lugs Ment 5 is fragment 7 (5naB containing the blunted TNFσ gene). I-BamHI 7 fragment) and fragment 8 (TN Fα sequence oligonucleosomes with CJal# and 5naBI ends. pTrp-cansD-TNFa is obtained. similar Then, fragments 6 and 7 were ligated to create pTrp2-78 and 8. Obtain TNFa.

C) Expression of TNFe Plasmid pTrp-conSD-TNFa according to the description in Example 2 and pTrp2-TNFa from E. coli strain JM 103, induce expression, and analyze for expression.

TNFa production from pTrp-consD-TNFa and pTrp2-TNFa Current levels are approximately 5% and 30% of total cellular protein, respectively. therefore , AT-rich liposome binding sites increase TNFα expression.

Chart 1. List of plasmids pTrpl pTrp-BStnl pTrp-BStmlb pTrp-BSe102. pTrp-BSem4 (4,11kb) A+ap R-striped ampichiampici Phosphorus resistant "trp promoter/operator E - liposome binding site C-Synthetic sequence B-BSt array Chart 2: Construction of PAT-BStm4 a) pTrp-B S tm4 was treated with Hpal, C1al and mango bean nuclease to generate fragments. Obtain the component l.

b) Anneal the two oligonucleotides to obtain fragment 2.

5' AACTA TACCCAAGTrCACGTTATTAAAAATT AAAGAAll; CTATA, TAτrrcATcATcccTTcAAc'r cCAA? AATTrTTAATrTCTCCATATATAC) fragment 1 and 2 are ligated to obtain pAT-BStm4 (4,8 Kb).

pAT-BS country 4 Chart 4: 1) Trp-conSD-TNFa and pTrp2 TN Construction of Fa a) pTrp-cons D was treated with C1al and BamHI″F, Fragment 5 is obtained. pTrp2 was treated with C1al and BamHI to Obtain ragment 6.

Fragments 5 and 6 (4,6 Kb)b) TNFir gene with 5naBl and 7 fragment 7 (460 bp) is isolated by treatment with BamHl and BamHl.

c) Annealing the two complementary oligonucleotides to obtain fragment 8 .

fragment 8 Gτ8C in CGATAAT TOATTACCATC d) Ligate fragments 5.7 and 8 to create pTrp-consDTN Fa was obtained and fragments 6.7 and 8 were ligated to create pTrp2T Obtain NFa.

pTrp-consD-TNFa and pTrp2 TNFa (5, IKb) Ao+pR-ampicillin resistance D - trp promoter/operator E - Shine-Dalgarno arrangement column C-Synthetic sequence T = TNFa sequence Chart 5: Liposome binding site sequence X in BSt expression plasmid pTrp-BSt102 AAGTTCACGTAAAMGGOTATCCATAATG I GCCTT CCCAGCCpAT-BSt102 AAGTTCACGTTATTAMAATTAAA to AGGT＾TATAπgreenτ clccc buy CCC^cccpTrp-BSc+++4 McicAccrAAAAIIIcccTATccATAAlrc l ccc rrccchccxpAτ-BSt! +14 IIIAcrrcp, ccTTATTAAAATTAAAII:AGciAT ArAmmrc　cccrrcCCAGCTpTrp2-15cm4 AAGTTCACGTTATTAAAAAAATTMGGAGGTATATCCAT Add the heterologous polypeptide to the left of the AAT cccrrcccAccT main vertical line. Liposome binding sites useful for expression are shown. The array to the right of the vertical line is BSt Consists of genetic parts.

National cuisine I trial beef international search report

Claims (10)

[Claims] (1) Sequence and sequence of deoxyribonucleotides encoding a heterologous polypeptide A recombinant DNA molecule consisting of a ribosome binding site operatively linked to a The bosome binding site directs or associates with the natural ribosome with increased adenine (A) and thymidine (T) residues compared to the binding site A recombinant DNA molecule characterized by: (2) The recombinant DNA according to claim (1), wherein the heterologous polypeptide is somatotropin. A molecule. (3) the somatotropin is selected from porcine, ovine and bovine somatotropins; The assembled DNA molecule according to claim (2). (4) Recombinant D according to claim (3), wherein the somatotropin is bovine somatotropin. NA molecule. (5) Ribosome binding site deoxyribonucleotide sequence [there is a sequence] or [I have an array] The recombinant DNA molecule according to claim (1). (6) Ribosome binding site deoxyribonucleotide sequence [there is a sequence] or [I have an array] Claim (4) Recombinant DNA molecules described. (7) Deoxyriel selected from [There is an arrangement] and [There is an arrangement] A DNA molecule consisting of a sequence of nucleotides. (8) The recombinant DNA molecule according to claim (6), pAT-BStm4 or pTr p2-BStm4. (9) a naturally occurring ribosome junction that induces or associates with it; Ribosome binding site with increased A and T residues compared to the ribosome binding site. (10) Deoxyribonucleotide sequences are [sequence exists] and [sequence exists] Choose from The ribosome binding site according to claim 9, wherein the ribosome binding site is selected.