AU4801490A - Synthetic interleukin-6 - Google Patents

Description

SYNTHETIC INTERLEUKIN-6

This application is a continuation-in-part of copending U.S. Application Serial No. 07/278,690, filed December 1, 1988.

1. INTRODUCTION

The present invention relates to genes and their encoded proteins which are recombinant mature interleukin-6 (hereinafter IL-6) and a synthetic cysteine-free protein that retains IL-6 activity. These proteins are expressed in unicellular hosts as the amino or carboxy terminal peptide portion of a tri-hybrid fusion protein comprising either interleukin-6 or its modified synthetic form, together with a portion of a cleavage site and carrier DNA. The

recombinant fusion protein is purified and digested in vitro with a protease that is specific for the cleavage site to liberate the peptide with IL-6 activity, which is easily separated from the large β-galactosidase protein expressed by the carrier DNA. The purified peptide can be used to stimulate the production of proteins, including

immunoglobulins and hepatic proteins and may be used to prevent viral infections. The protein can also be added to vaccine preparations as an adjuvant.

2. BACKGROUND OF THE INVENTION

2.1. PEPTIDE REGULATORS

Physiological agents that regulate metabolic activity of distant cells were given the name hormone by English scientists Bayliss and Starlinger in 1909. These agents consist of amino acid derivatives, steroids and peptides. More recently, a variety of peptides that activate and/or inhibit cell proliferation have been identified and termed stimulatory factors or growth factors. An alternative general term for such cellular factors is cytokine although more specific terminology indicates the cell of origin, i.e. lymphokines which are produced by lymphocytes. Lymphokines also belong to the interleukin class of molecules that modulate the proliferation of cells in the immune system. Other peptides produced by the immune system result in specific antiviral activities; such peptides are termed interferons. To qualify as an interferon a factor must be a protein which exerts antiviral activity through cellular metabolic processes involving the synthesis of both RNA and protein (Committee on Interferon Nonmenclature, 1980, Nature 86(2):110).

2.2. INTERLEUKIN-6

Interleukin-6 (IL-6) is the term given to a peptide described alternatively as IFNßS2A, BSF-2, HSF, G-CSF, CS- 309, HPGF, or 26 kDa protein by a multiplicity of

investigators. These original factors now known as IL-6 include: I) interferon-β2 (Zilberstein et al., 1986, EMBO J. 5:2529) or 26 kDa protein (Haegeman,et al., 1986, Eur. J. Biochem. 159:625) which was first detected in poly(rl) poly(rC) stimulated fibroblasts; 2) a potent T-cell derived lymphokine termed B-cell stimulation factor-2 (BSF-2)

(Hirano et al., 1986, Nature 324:73); 3) a fibroblast product called B-cell hybridoma/plasmacytoma growth factor (HPGF or HGF) (Van Snick et al., 1986, Proc. Natl. Acad. Sci. 83 : 9679 ; Billiau, 1987 , Immunol . Today 8 : 84 ; Van Damme et al., 1987, Eur. J. Biochem. 168:543; Tosato et al., 1988, Science 239:502); and 4) a peripheral blood monocyte protein called hepatocyte stimulating factor (HSF) (Gauldie et al., 1987, Proc. Natl. Acad. Sci. 84:7251).

The functions which have been ascribed to the IL-6 peptide are basic to both the inflammatory and immune response in human pathology. Those functions are diverse and depend on the type of cells under examination. IL-6 is expressed in leukocytes, epithelial cells, IL-I treated fibroblasts, hepatocytes, vascular endothelial cells, cardiac myxoma tissue, certain bladder carcinomas, certain cervical cancer cells and glial cells. IL-6 is one of the peptides involved in the interaction of T cells with B cells to result in the proliferation and differentiation of antibody producing cells. IL-6 significantly enhances secretion of immunoglobulins in activated B-cells (Muraguchi et al., 1988, J. Exp. Med. 167 (2):332; Tosato et al., 1988, Science 239:502; Hirano et al., 1985, Proc. Nat:1. Acad.

Sci. 82:5490).

With regard to the antiviral activity responsible for the initial identification of IL-6 as an interferon, the transformation of Chinese hamster ovary cells with a

recombinant IL-6 plasmid which allowed constitutive

expression of IL-6 resulted not only in the detection of the peptide in media, but also resulted in the detection of antiviral activity (Zilberstein et al., 1986, EMBO J.

5:2529).

Whether natural IL-6 has antiviral activity or not has been subject to debate in the scientific literature.

Antiviral specific activities were first reported by

Weissenbach et al., (1980, Proc. Natl. Acad. Sci. 77:7152); and members of this scientific group have continued to report antiviral activities in their preparations (see

Content et al., 1985, Eur. J. Biochem. 152:253; May et al.,

1988, J. Biol. Chem. 263:7760). The values reported for antiviral activity range from 5-10 x 10⁶ U/mg protein to as low as 1-3 x 10² U/mg. In contrast, a large number of other investigators have reported no significant antiviral effects associated with their purified recombinant IL-6

preparations. (Poupart et al., 1987, EMBO J. 6:1219; Van

Damme et al., 1988, J. Immunol. 140:1534; Reis et al., 1988,

J. Immunol. 140@5):1566; Hirano et al., 1988, Immunol.

Lett. 17(1):41). IL-6 appears to suppress the action of TNF (Kohase et al., 1987, Mol. Cell Biol. 7 : 213 ) . However, it stimulates the growth of human B-lymphoblastoid cells infected with EBV (Tosato et al., 1988, Science 239:502), and of human

thymocytes and T-lymphocyte's (Lotz et al., 1988, J. Exp.

Med. 167(3):1253). It has been identified as a growth factor for murine hybridomas (Poupart et al., 1987, EMBO J. 6:1219) and hybridoma plasmacytoma cell lines (Van Damme et al., 1987, J. Exp. Med. 165:914). In combination with IL-3, IL-6 supports the proliferation of hematopoietic progenitor cells (Van Damme et al., 1987, J. Exp. Med. 165:914;

Ikebuchi et al., 1987, Proc. Natl. Acad. Sci. 84:9035), and modulates the synthesis of a subset of hepatocyte proteins in response to injury and infection (Gauldie et al,, 1987, Proc. Natl. Acad. Sci. 84:7251; Andus et al., 1987, FEBS Lett. 221:18). The multiplicity of its own actions, and its interactions with other peptide regulators like IL-1, TNF, IFNβ₁ and PDGF, have led to the suggestion that IL-6 plays a pivotal role in a complex cytokine network needed for homeostatic control of cellular functions (Kohase et al., 1987, Mol. Cell Biol. 7:273; Sehgal et al., 1987, Science 235:731; Billiau, 1987, Immunol. Today 8:84; Sporn and

Roberts, 1988, Nature 332:217).

2.3. DNA SEQUENCE OF THE INTERLEUKIN-6 PROTEIN Comparison of the primary structure of factors that were originally characterized by multiple investigators on the basis of differing biological activities revealed the identity of their amino acid sequences and resulted in the renaming of the peptides as interleukin-6 (IL-6).

Fibroblasts treated with either poly(rl) (rC) or

cycloheximide and actinomycin D produced a 14S mRNA molecule which coded for a protein capable of inducing antiviral activity called IFNβ52 (Weissenbach et al., 1980, Proc. Natl. Acad. Sci. 77:7152; British Patent No. 2,063,882). Clones produced from cDNA copies of this induced mRNA fraction provided a partial sequence of the IFNß2 promoter that was clearly different from IFNß1, IFN7αA, IFN7α, and IFNαD

(Chernajovsky et al., 1984, DNA 3:297; Revel et al., 1983, Interferon 5:205 1. Gresser ed., Academic Press, N.Y.). The complete 1FNβ2 sequence derived from multiple cDNA clones defined a 212 amino acid long protein in addition to a probable ATG start sequence, polyadenylation sites, TATA boxes and the mRNA start site which was revealed by S1 nuclease mapping (Zilberstein et al., 1986, EMBO J. 5:2529; European Patent Application 0220574A1, Publication Date 06- 05-1987). In a different analysis of the IFNβ2 sequence, May et al., 1986, Proc. Natl, Acad. Sci. 83 :8957, also defined the 212 amino acid protein sequence using a full length cDNA clone rather than the partial cDNA clones of Zilberstein et al., 1986, EMBO J. 5:2529. These

investigators also noted that IFNβ2 was induced by TNF.

Even though their 26 kDa protein had no detectable antiviral activity, Haegemann et al., 1986, Eur. J. Biochem. 159:625 recognized that the sequence of their 26.kDa

protein, induced in fibroblasts by treatment with

cycloheximide or interleukin-1, was identical to the IFNß2 of Zilberstein et al., 1986, EMBO J. 5:2529. Because the 5' terminus of the protein was missing in the cDNA clone collection, a screen of a human gene library, testing for complementarity with an internal cDNA sequence of the 26 kDa peptide, yielded genomic clones that provided the complete 212 amino acid sequence, as well as the DNA sequence of a 162 bp intron in the 5' terminus region of the human gene. A search of a protein data base containing 3309 individual peptide sequences failed to reveal any significant

similarities with proteins in the database.

In a separate study (Hirano et al., 1986, Nature

324:73), BSF-2 protein was purified from a human T-cell line that constitutively produced the factor and was established using the HTLV-1 virus. The amino acid sequence data from nine peptide fragments provided the information necessary to produce synthetic oligomers which were used to probe cDNA libraries. The cDNA clones were sequenced as was the amino terminus of the purified IL-6 protein. The end of the mature protein sequence was pro-val-pro-pro indicating that the 212 amino acid prepeptide that was predicted from the nucleic acid sequence contained a 28 amino acid long signal peptide which is cleaved to produce the natural mature BSF-2 (IL-6) protein.

Continued sequence analysis of the entire BSF-2 (IL-6) genomic DNA demonstrated that the chromosomal segment contained five exons and four introns (Yasukawa et al., 1987, EMBO J. 6:2939). The organization of the BSF-2 (IL-6) gene was strikingly similar to that of G-CSF when the two genes were compared.

After completion of the sequence of HGF (Brakenhoff et al., 1987, J. Immunol. 139:4116), the identity of HGF and IL-6 was confirmed. In addition, a study of the sequence differences in all reported analyses of the IL-6 gene (as HGF, IFNβ2, the 26 kDa protein or BSF-2) revealed few single base changes. Neither of the two changes that occur within the peptide reading frame produce an amino acid change. Van Damme et al., 1988, J. Immunol. 140:1534, also noted that the amino terminal sequence of HGF was identical to IFNβ2, the 26 kDa protein and BSF-2.

Clark et al. (International Application Number

PCT/US87/01611, Publication Number WO88/00206, published January 14, 1988) also reports the cDNA sequence of IL-6.

2.4. CONSERVATION OF CYSTEINE RESIDUES IN IL-6 All cysteine residue positions are conserved between the two proteins, BSF-2 (IL-6) and G-CSF. Upon noting this similarity, Hirano et al., 1986, Nature 324:73, suggested that intramolecular disulphide bonds would be important in the structure of BSF-2 (IL-6) and G-CSF. Their suggestion was based on a comparison of the BSF-2 (IL-6) sequence with other sequences in a personal database of multiple growth factors, interleukins and interferons which revealed that BSF-2 (IL-6) was distantly related to G-CSF. However, comparison with the National Biomedical Research Foundation database or the Genetic Sequence Data Bank revealed no significant similarity with other proteins in those

databanks.

Conservation of the cysteines was also suggested by Van Snick et al., 1986, Proc. Natl. Acad. Sci. 8J3:9679. They sequenced murine HP-1 and found conserved homology with human IL-6. They also examined the positions of the

cysteines of HP-1, IL-6 and G-CSF and noted that the

cysteine positions were conserved within the three peptides .

As described by Yasukawa et al . , supra, the

organization of exons and introns within the BSF-2 (IL-6) gene was strikingly similar to that of G-CSF when the two genes were compared. This finding provides further support for the shared evolutionary history, of the two proteins (see also Kishimoto, 1987, J. Clin. Immunol. 7 (5):343).

The presence of cysteines in a protein can cause problems in processing when the protein is being produced recombinantly in a bacterial host. Microbially produced cysteine-containing proteins may tend to form multimers which greatly complicate purification of the protein

product. Several additional purification steps, such as reduction and reoxidation of the recombinant protein, may be required to obtain the protein in the proper conformation. Removal of one or more of the cysteine residues, with concurrent replacement by a chemically equivalent neutral amino acid, would be desirable, in order to simplify the isolation and purification of the IL-6 molecule. However, the successful removal of cysteines from biologically active molecules is unpredictable, in that the tertiary structure, in the absence of the normally formed disulfide bridges, can be substantially altered. It is often the case that one or more of these residues may be essential to retaining the desired activity.

Natural cysteine residues are expected to be

particularly critical for cytokines such as IL-6, since the cysteines of IL-6 have been conserved (See above).

Moreover, the biological activity of other cytokines has been reported to be affected if cysteines are removed. For example, only one cysteine residue out of three can be removed without affecting the biological activity of the IFN-β (see U.S. Pat. No. 4,737,462). Similarly, only one of four cysteines of IFNβ1 can be removed without complete loss of activity (Mark et al., 1984, Proc. Natl. Acad. Sci. 81: 5662).

2.5. PRODUCTION OF NATURAL INTERLEUKIN-6

AS A RECOMBINANT PROTEIN

2.5.1. RECOMBINANT DNA TECHNOLOGY AND GENE EXPRESSION

Recombinant DNA technology involves insertion of specific DNA sequences into a DNA vehicle (vector) to form a recombinant DNA molecule which is capable of replication in a host cell. Generally, the inserted DNA sequence is foreign to the recipient DNA vehicle, i.e., the inserted DNA sequence and the DNA vector are derived from organisms which do not exchange genetic information in nature, or the inserted DNA sequence may be wholly or partially

synthetically made. Several general methods have been developed which enable construction of recombinant DNA molecules.

Regardless of the method used for construction, the recombinant DNA molecule must be compatible with the host cell, i.e., capable of autonomous replication in the host cell or stably integrated into one or more of the host cells chromosomes. The recombinant DNA molecule should preferably also have a marker function which allows the selection of the desired recombinant DNA molecule (s). In addition, if all of the proper replication, transcription, and

translation signals are correctly arranged on the

recombinant vector, the foreign gene will be properly expressed in, e.g., the transformed bacterial cells, in the case of bacterial expression plasmids, or in permissive cell lines or hosts infected with a recombinant virus or carrying a recombinant plasmid having the appropriate origin of replication.

Different genetic signals and processing events control levels of gene expression such as DNA transcription and messenger RNA (mRNA) translation. Transcription of DNA is dependent upon the presence of a promoter, which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. The DNA sequences of eucaryotic promoters differ from those of procaryotic promoters. Furthermore, eucaryotic promoters and

accompanying genetic signals may not be recognized in or may not function in a procaryotic system and furthermore, procaryotic promoters are not recognized and do not function in eucaryotic cells.

Similarly, translation of mRNA in procaryotes depends upon the presence of the proper procaryotic signals, which differ from those of eucaryotes. Efficient translation of mRNA in procaryotes requires a ribosome binding site called the Shine-Dalgarno (S/D) sequence on the mRNA (Shine, J. and Dalgarno, L., 1975, Nature 254:34). This sequence is a short nucleotide sequence of mRNA that is located before the start codon, usually AUG, which encodes the amino-terminal methionine of the protein. The S/D sequences are

complementary to the 3' end of the 16S rRNA (ribosomal RNA), and probably promote binding of mRNA to ribosomes by

duplexing with the rRNA to allow correct positioning of the ribosome. Although the Shine/Dalgarno sequence, consisting of the few nucleotides of complementarity between the 16S ribosomal RNA and mRNA, has been identified as an important feature of the ribosome binding site (Shine and Dalgarno, 1975, Nature 254: 34; Steitz, 1980, in Ribosomes: Structure, Function and Genetics ed. Chambliss et al. Baltimore, Md., University Park Press pp. 479-495), computer analysis has indicated that approximately one hundred nucleotides surrounding the AUG initiating codon are involved in ribosome/mRNA

interaction as indicated by proper prediction of translation start signals (Stormer et al., 1982, Nucl. Acids Res.

10:2971; Gold et al., 1984, Proc. Natl. Acad. Sci.

81:7061). No prediction of what actually provides the best and complete ribosome binding site for maximum translation of a specific protein can be made (see Joyce et al., 1983, Proc. Natl. Acad. Sci. 80:1830).

Schoner and Schoner recognized the significance of the entire ribosome/mRNA interaction region in the development of recombinant expression vectors in their characterization of a 72 bp sequence, termed the "minicistron" sequence (See Figure 1 of Schoner et al., 1986, Proc. Natl. Acad. Sci. USA 83: 8506). A one base deletion in the first cistron of the "minicistron" sequence was sufficient to increase the production of the downstream recombinant protein Met- [Ala]bGH from 0.4% to 24% of total cell protein (See Figure 4, pCZ143 compared to pCZ145, Schoner et al., id.).

Alternatively a two base insertion also resulted in significant expression of the coding peptide encoded by the second cistron. Control experiments indicated that the differences in expression were due to translational

differences because mRNA levels in these constructs were essentially equivalent (no more than 3 fold different) as compared to the expressed protein differences (which were approximately 50 fold). The conclusion was that the position of the stop codon that terminates translation of the first cistron of the minicistron sequence affected the efficiency of translation of the second cistron, containing the coding sequence of the recombinant protein. Most importantly their work indicated that one or two base changes in the sequence immediately preceding the coding sequence of a recombinant protein can have tremendous effects on downstream expression.

Successful expression of a cloned gene requires

sufficient transcription of DNA, translation of the mRNA and in some instances, post-translational modification of the protein. Expression vectors have been used to express genes under the control of an active promoter in a suitable host, and to increase protein production.

2.5.2. NONBACTERIAL PRODUCTION OF RECOMBINANT INTERLEUKIN-6

Although Weissenbach et al., 1980, Proc. Natl. Acad. Sci. 77:7152 translated cDNA in oocytes to make recombinant IFNβ2 in vitro, Zilberstein et al., 1986, EMBO J. 5:2529 reported the first example of IFNβ2A (IL-6) cDNA expression in vivo. The restriction fragment containing the fused cDNAs of different primary clones was positioned downstream from the SV40 early promoter to produce the pSVCIFB2

plasmid. In this plasmid, the entire IFN/32A cDNA sequence and some adjacent nucleotides of the original cloning vector followed the SV40 early promoter and the first 60

nucleotides of the T antigen RNA. The IFNβ2A sequence was followed by the T antigen splicing region and

polyadenylation site. After the steps of transfection into Chinese hamster ovary (CHO) tissue-culture cells and

methotrexate amplification selection, CHO cell clones labeled with [ ³⁵S ] were screened for radioactive IFNβ2 protein production by immunoprecipitation using

nonsaturating amounts of antibodies. In the same study, plasmid constructs, wherein the entire IFNβ2A cDNA sequence was fused to the T7 RNA polymerase promoter, also were transcribed in vitro to produce mRNA that was subsequently translated in rabbit reticulocyte lysates. Following immunoprecipitation of the lysate, the proper sized IFNβ2 (IL-6) protein could be detected on SDS-polyacrylamide gels.

BSF-2 (IL-6) was functionally expressed in COS7 cells following transfection of a plasmid containing the entire coding region of BSF-2 adjacent to the SV40 early promoter (Hirano et al., 1986, Nature 324:73). BSF-2 activity could be detected after purification and concentration of the media from the transfected cells using immunoaffinity gel methods. Recombinant IL-6 produced using this method was used to analyze the regulation of fibrinogen and albumin mRNA in FAO cells (Andus et al., 1987, FEBS Letts. 221: 18).

Clark et al., (International Publication Number

W088/00206, published January 14, 1988) described the construction of pCSF309 wherein the IL-6 CDNA sequence was ligated into the p91023B plasmid which contains the SV40 enhancer, major adenovirus late promoter, DHFR coding sequence, SV40 late message poly-A addition site and the VA I gene. When COS cells are transfected with this plasmid, IL-6 hematopoietic stimulating activity could be recovered at a 10-4 dilution of conditioned tissue culture cell medium. This type of recombinant preparation was used in an analysis of the effect of IL-6 on T-cell proliferation in the presence of either ConA or agarose beads coupled with F23.1 IgG2a anti-[mouse T-cell receptor B chain variable region segments 8.1, 8.2, and 8.3]-mouse antibodies (Garman et al., 1987, Proc. Natl. Acad. Sci. 84:7629). The

preparation of recombinant IL-6 was also used in a study of the effect of IL-6 on the differentiation of Ly-2⁺ cytolytic lymphocytes from murine thymocytes in the present of

interleukin-2 (Takai et al., 1988, J. Immunol. 140:508). Alternative methods of higher cell production of recombinant IL-6 include in vitro synthesis following injection of IL-6 mRNA into Xenopus oocytes (Weissenbach et al., 1980, Proc. Natl. Acad. Sci. 77 : 7152 ; Coulie et al., 1987, Eur. J.

Immunol. 17:1435; poupart et al., 1987, EMBO J. 6:1219), by translation of the IL-6 mRNA in rabbit reticulocytes

(Poupart et al., 1987, EMBO J. 6:1219), or by cDNA

expression in yeast (La Pierre et al., 1988, J. Exp. Med. 167:794).

2.5.3. BACTERIAL PRODUCTION OF RECOMBINANT INTERLEUKIN-6 Clark et al., (International Publication Number

W088/00206, published January 14, 1988) reported the

expression and production of recombinant IL-6 in E. coli using pCSF309 (deposited July 11, 1986 as accession number ATCC 67153). However, the preferred embodiment reported therein selectively modified the sequence of pCSF309 a) to delete its signal peptide leader sequence and its 3'

noncoding sequence; and b) to couple the protein coding sequence to a temperature inducible P_L promoter in

association with a temperature sensitive C_I repressor. This strain, containing plasmid pAL309C-781, was not deposited with the ATCC. In this strain, the bacterially expressed protein was produced in an insoluble form which first had to be solubilized and then refolded (see example V of their patent application). Alternatively, a plasmid termed pAL- Sec-IL6-181 was constructed to produce IL-6 by coupling the cDNA sequence of IL-6 to a synthetic signal peptide leader sequence under P_L promoter control. Following high

temperature induction of the P_L promoter in a temperature sensitive C_I repressor strain, IL-6 was isolated from the periplasm of the transformed cells as a homogeneous protein from which the signal peptide had been removed. No yield of purified protein was reported.

Brakenhoff et al., 1987, J. Immunol. 139:4116, reported the expression of HGF, hybridoma growth factor (IL- 6), in different E. coli strains containing any one of seven specific IL-6 cDNA clones. Media was screened for IL-6 activity to identify the clones producing IL-6. The

activity varied at least 5,000 fold between the clones. The most active construct (clone 7) was missing the first 43 amino acids of the peptide, but that construct produced more than 20X as much activity as the next active clone. The constructs containing the complete ammo acid coding region of HGF (IL-6) had the least activity (for example, clone 15 starting at position -62 from the ATG start site had 1.7 kU/ml of activity compared to clone 7 which had 10,000 kU/ml). In order to detect activity, recombinant IL-6 was first separated from cytosolic proteins of clones 7 and 15. Activity was assayed only after elution of individual SDS- PAGE slices. Even though activity was detected, no IL-6 protein was apparent in the gel protein profile.

Tosato et al., 1988, Science 239:502, reported the production of an antiserum after immunization with

recombinant IL-6 that was produced in E. coli but the details of both the antiserum production methods and the recombinant IL-6 protein synthesis and purification were not published (see their reference 10, reported as manuscript in preparation).

Recombinant BSF-2 (IL-6) was produced in E . coli using pTBCDF-12 (Hirano et al . , 1988 , Immunol . Letters 17:41). Induction of this plasmid resulted in the production of a fusion protein in which the recombinant IL-6 peptide was fused to the IL-2 peptide. Protease digestions using

Kallikrein and amino peptidase-P were required to obtain mature IL-6 protein. However, the details of the procedure other than this nonenabling description were to be published elsewhere (see their manuscript in preparation citation).

May et al., 1988, J. Biol. Chem. 263:7760 reported the production of an insoluble form of IL-6 in bacteria

following the fusion of the IL-6 cDNA in a REV expression vector (Repligen Corp., Cambridge, MA) to produce a product containing 34 amino acids of a prokaryotic leader peptide fused to an IL-6 peptide portion of 182 amino acids. The expressed protein was recovered in an insoluble pellet which was solubilized in 8M urea, 5 mM DTT and 10 mM β- mercaptoethanol in a Tris based buffer. The fusion product was partially purified from the numerous other E. coli pellet proteins by DEAE-sepharose column chromatography using a salt gradient with the solubilizing buffer, followed either by immunoaffinity chromatography with a monoclonal antibody to the prokaryotic leader peptide or FPLC with a Mono Q column (Pharmacia). No yields of purified protein were reported. The DEAE-Sepharose peak fraction exhibited antiviral activity of 0.5-1 IU/ml using a cytophatic effect reduction assay in FS-4 cell cultures and vesicular

stomatitis virus. The recombinant fused IL-6 protein was injected into rabbits to produce a polyclonal antiserum.

The polyclonal antiserum was used to characterize the natural IL-6 protein in fibroblastic FS4 cells following TNF and cycloheximide induction of IL-6 or in human monocytes.Incubation of the antiserum with the FS4 cell medium

prevented the induction of immunoglobulins in CESS cells.

Multiple investigators have reported a recombinant IL-6 protein made in E. coli, but no disclosure of the

methodology for recombinant IL-6 production was provided (Taga et al., 1987, J. Exp. Med. 166(4):967; Gauldie et al., 1987, Proc. Natl. Acad. Sci. 84:7251; Lotz et al., 1988, J. Exp. Med. 167(3):1253; Muraguchi et al., 1988, J. Exp. Med. 167(2):332; Reis et al., 1988, J. Immunol, 140(5):1566).

2.5.4. PRODUCTION OF HIGH YIELDS OF RECOMBINANT

INTERLEUKIN-6 IS DIFFICULT

Although nonenabling reports of production of natural

IL-6 in bacteria exist (see Section 2.5.3), production of high yields of the natural protein in bacteria has not been successful even using recombinant DNA bioengineering methods

(Asagoe et al., 1988, Biotechnology 6:806) (see also Section 5.1 of this application). The Asagoe study reports the inability to produce natural IL-6 as a detectable protein in induced cell extracts using a plasmid construct very

reminiscent to those reported in Section 2.5.3. supra. The unsuccessful Asagoe expression plasmid contained the mature processed BSF-2 (IL-6) protein coding sequence adjacent to and in frame with the P_TAC promoter and ATG start sequence. Although the plasmid was analyzed in a variety of strain backgrounds, IL-6 protein was not detected following

induction. Significant amounts of insoluble recombinant IL-6 activity were produced by Asagoe et al. only after induction of a plasmid containing a multi-hybrid-fusion protein in which 1) the P_TRYP promoter and ATG start site were fused to human growth hormone coding sequence; 2) the human growth hormone sequence was fused to an

oligonucleotide sequence producing a Xa factor peptide recognition site (ile-glu-gly-arg); and 3) the-Xa factor recognition site was then fused to either a glu-phe-met- BSF-2 sequence or an ala-BSF-2 coding sequence.

This recombinant IL-6 (or BSF-2) peptide was thus the carboxy terminal portion of the human growth hormone/Xa factor sequence/BSF-2 hybrid fusion product in this

construct. The recombinant IL-6 activity, existing either as glu-phe-met-BSF-2 peptide in one plasmid construct or ala- BSF-2 peptide in the other, could be purified only after solubilization of the fusion protein in 8M urea.

Cleavage of the fusion protein with Xa factor required refolding the purified fusion protein by extensive dialysis. The refolding process was incomplete since the fusion protein preparation was only incompletely digested by Xa factor.

The Xa factor cleavage produced a heterogeneous mixture containing intact fusion protein, recombinant IL-6 peptides, and human growth hormone peptide, in addition to other partial cleavage products. In order to recover IL-6 activity in the purified product, the Xa factor/cleavage mixture first had to be denatured with 6M guanidinium hydrochloride. After chromatographical purification of the recombinant IL-6 peptide, it was subjected to an additional round of extensive dialysis in order to recover a refolded active peptide. The resultant recombinant peptides, either glu-phe-met-BSF-2 or ala-BSF-2, were examined only for their activity in a B-cell stimulatory factor assay. The yield reported for the production process was approximately 5% (3 mg of purified activity was recovered from an initial 100 mg of fusion protein of which 58 mg was IL-6 peptide; 3/58 = 5.17%).

A need thus still exists for a convenient, relatively inexpensive method of producing high yields of IL-6.

Recombinant methods using mammalian cells tend to be rather costly. Although bacterial production is a lower cost alternative, previous attempts to produce IL-6 in

transformed bacteria have not resulted in commercially feasible yields. The present invention provides DNA

constructs and methods for producing IL-6 in bacteria which permit the production of the protein in high yields,

typically about 20% of total cytosol protein. The invention also provides a cysteine-free form of IL-6 which retains the biological activity of the native IL-6 molecule.

3. SUMMARY OF THE INVENTION

The present invention is directed to the economical production of recombinant synthetic cysteine-free IL-6 proteins produced by bacteria as well as active peptide fragments of each of the proteins. The proteins produced are either cysteine-containing or cysteine-free, and retain IL-6 biological activity. Bacterial cultures express either recombinant protein as a high percentage, generally at least 20%, of total soluble cytosol protein. The recombinant IL-6 protein does not require treatment with harsh denaturing agents like 8M urea, or β-mercaptoethanol to solubilize the protein from a pellet. As used throughout the present specification and claims, the phrase "substantially soluble in water" refers to this property.

In the present invention, the IL-6 is produced

recombinantly in a unicellular host by expression of a tripartite fusion protein. The fusion protein comprises first, second and third peptide portions. The first peptide portion has IL-6 activity; the second peptide portion is a chemically or enzymatically cleavable sequence which links the first peptide portion to the third peptide portion; the third peptide portion is a protein or portion thereof which is capable of being expressed by the unicellular host, and which preferably has a detectable function. The three peptide portions are referred to as "first", "second" or "third" only for convenience, and should not be read as requiring a specific order, relative to the promoter

controlling expression of the protein: the positions of the first and third peptide portions are interchangeable .

The third peptide portion provides a protein or portion thereof which the unicellular host cell can make. The presence of the carrier DNA that expresses the third peptide facilitates production of the eucaryotic IL-6 protein. In its detectable function, (for example, enzymatic activity), the third peptide portion also provides a means by which transformed clones producing the fusion protein' can be readily identified and isolated. The first peptide portion, which possesses the desired biological activity, is

separated from the remainder of the fusion protein by cleavage of the second peptide portion. The recombinant IL-6 peptide is then separated and purified from the protein mixture by methods known in the art such as by high

performance liquid chromatography (HPLC) to yield a pure protein that is active in IL-6 assays. The present

invention also -contemplates nucleotide seuuences encoding the fusion protein, recombinant vectors comprising these nucleotide sequences, as well as unicellular hosts

transformed with these vectors.

In a particular embodiment, a synthetic peptide having IL-6 activity is produced with all four cysteines of the native IL-6 sequence replaced by serine residues. Unless otherwise specified, the term synthetic cysteine-free IL-6 or recombinant cysteine-free IL-6 is used in the

specification and claims to identify a synthetic peptide having IL-6 activity with all four cysteines of the native IL-6 sequence replaced by serine residues. The peptide so produced surprisingly retains its biological activity. For example, the cysteine-free form of IL-6 has been shown to exhibit hepatocyte activation and B-cell stimulation. The proteins of the present invention may have antiviral activity and may prevent viral infection of cells. The cysteine-free synthetic protein may be nonpyrogenic or at least

significantly less pyrogenic than native IL-6 protein.

The proteins of the present invention also include different cysteine-free and cysteine-containing. IL-6 peptides which have deleted up to 27 amino acid residues from the IL-6 amino terminus, and/or which add up to 50 amino acid residues on the amino terminus and/or up to 350 amino acids on the carboxy terminus of the IL-6 sequence, and retain the

relevant biological activity. Thus, surprisingly, and unlike many other biologically active peptides, the basic IL-6 sequence can be modified substantially without any

significant loss of activity. The invention therefore encompasses the gene sequences encoding the cysteine-free peptides, as well as truncated and extended cysteine-free or cysteine-containing peptides which retain IL-6 activity.

The present method represents an improvement over known recombinant methods for producing IL-6 in that it provides means for producing IL-6 in commercial quantities in a recombinant/vector system. Previous IL-6 fusion protein constructs, such as the one described by Asagoe, supra, have not been successful in obtaining expression of the protein in large quantities, and also require extensive harsh

purification and refolding procedures in order to obtain a functional protein. This treatment with harsh denaturing agents is not required in the present method, however, nor is refolding of either the fusion protein or the cleavage protein necessary.

The peptides produced by culturing these recombinant hosts retain characteristic IL-6 activity in their

stimulatory effects on the immune system and on therapeutic cell activity. The present invention also contemplates methods of treatment of viral disease, immunodeficiencies and hepatic disorders, as well as overall modulation of immune response, by administration of the claimed synthetic IL-6 peptide.

3.1. DEFINITIONS

ATCC : American Type Culture Collection bp : base pair

BSF-2 : B-cell Stimulation Factor

CDNA : Complementary DNA

CHO : Chinese Hamster Ovary

CSF : Colony Stimulating Factor

DHFR : Dihydrofolate Reductase

DNase : Deoxyribonucleic acid nuclease

ELISA : Enzyme Linked Immunosorbent Assay

G-CSF : Granulocyte Colony Stimulating

Factor

HGF : Hepatocyte Growth Factor

HPGF : Hybridoma Plamacytoma Growth Factor

HPLC : High Performance Liquid

Chromatography

HSF : Hepatocyte Stimulating Factor

IGF : Insulin-Like Growth Factor IgG, IgM : Immunoglobulin G, M

IL-1, IL-3,

or IL-6, : Interleukin 1 , 3 , or 6

IPTG : Isopropylthiogalactoside

INF : Interferon

kDa : kilo Dalton

Kb : Kilobases

LB : Luria Broth

mRNA : messenger RNA

PAGE : Polyacrylamide Gel Electrophoresis

PBS : Phosphate buffered saline

PDGF : Platelet Derived Growth Factor

Poly (rl) ^. (rC) : RNA with a strand of ribo-Inosine duplexed with a ribo-Cytosine strand

PL : Promoter Left of Lambda

PR : Promoter Right of Lambda

^PTAC' ^PTRC : Synthetic Promoter of Tryptophan-Lac

Combination

RNase : Ribonucleic acid nuclease

SDS : Sodium Dodecylsulfate

S/D sequence : Shine-Dalgarno sequence

SH : Sulfhydryl

TN-F : Tumor Necrosis factor

X-gal : Bromo-chloro-indolyl-ß-D- galactopyranoside

YT : Yeast-tryptone growth media

4. BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Diagram of the construction of p360. The plasmid p360 is a plasmid expression vector constructed to express the cysteine free synthetic IL-6 like peptide as a protein of approximately 22-23 KDa in E. coli.

Oligonucleotide 737 [AGC TGA TTA AAT AAG GAG GAA TAA CCA TGG CTG CA 3'] and 738 [GCC ATG GTT ATT CCT CCT TAT TTA ATC 3'] were fused and replaced the Hind III-Pst I fragment of pBS (+), a phagemid purchased from Stratagene Systems, to form p350. The sequence for the synthetic cysteine free IL-6 like peptide from plasmid p337-1, which contains a peptide

terminating codon, replaced the Nco I-Eco RI fragment of p350 to produce plasmid p360. In p360, expression from the

inducible lac promoter through the minicistron sequence and through the synthetic cysteine free IL-6 like sequence fails to produce a peptide of the size of IL-6 in extracts of E. coli (see Figure 3 for gel of expressed proteins).

FIG. 2. Diagram of the construction of p369. The fragment containing the sequence for the synthetic cysteine free IL-6 like peptide of plasmid p365, which contains no peptide terminating codon is this construction, replaced the Nco I-Bam HI fragment of p350 (described in Figure 1) to form plasmid p369 wherein the synthetic cysteine free IL-6 like peptide sequence was fused in frame to the alpha- complementing fragment of β-galactosidase. Induction of the lac promoter of p369 fails to produce a detectable peptide which would be the fusion product between the synthetic IL-6 like peptide and the alpha-complementing portion of β- galactosidase (see Figure 3 for gel of the expressed

proteins).

FIG. 3. Expression and nonexpression of plasmid constructs containing sequences for the synthetic cysteine free IL-6 peptide. Cultures of E. coli cells carrying different plasmids were induced with IPTG. Samples of cell cultures were lysed and electrophoresed in SDS-polyacrylamide gels. The gels were stained with coomasie blue to visualize proteins. Lanes a and b are duplicate aliquots from

different tubes of the same culture. Lanes 1a and b are from cells bearing plasmid p369. The expected induction protein should be a fusion protein of the alpha-complementing portion of β-galactosidase and the synthetic IL-6 like peptide. No large molecular weight protein representing the fusion is present. Lanes 2a and b are from cells bearing plasmid p367, the successful expression vector for the fusion product of the synthetic IL-6 like peptide/collagen/β-galactosidase. Note the large amount of high molecular weight fusion protein in the approximately 130 kDA position of the gel. Lanes: 3a and b are from cells bearing plasmid p360 which were expected to produce a peptide of 22-23 μDa, the size of deglycosylated IL-6. The arrowhead marks the position of the expected small peptide.

FIG. 4. Diagram of the construction of p340-1. The steps in the construction of p340-1 are described in Section 5.2. Oligonucleotide 237 was [AAT TCT AAT ACG ACT CAC TAT AGG GTA AGG AGG TTT AAC CAT GGA GAT CTG 3']. Oligonucleotide 238 was [GAT CCA GAT CTC CAT GGT TAA ACC TCC TTA CCC TAT AGT GAG TCG TAT TAG 3'] Oligonucleotide 703 was [CAT GTA TCG ATT AAA TAA GGA GGA ATA ACC 3']. Oligonucleotide 704 was [CAT

GGG TTA TTC CTC CTT ATT TAA TCG ATA 3']. P_{T RC} is the hybrid promoter tryptophan/lac. "Term" represents the terminating codon that is in the same reading frame as the preceeding initiating methionine codon. ΛP_R represents the rightward promoter, from bacteriophage lambda. Amp^r represents the ampicillin resistance marker from pBR322. Ori represents the plasmid origin of DNA replication from pBR322. β-gal

represents the E. coli β-galactosidase gene region.

FIG. 5. Complete nucleotide sequence (5'-3') of the synthetic recombinant IL-6 gene and its predicted amino acid sequence. The coding sequence of the fused gene begins at nucleotide 3 (Met). The amino acid sequence of the

recombinant IL-6 protein extends to nucleotide 557 (Met) where it.is fused to the collagen linker of the fusion protein via a serine residue. The asterisk designates the location of the TAG stop codon normally found in the native cDNA sequence. Modified amino acid residues are shown in script below the sequence.

FIG. 6. Assembly of the gene for the synthetic

cysteine-free IL-6 like peptide. Synthetic oligonucleotides were annealed and ligated to form the four synthetic double stranded sub-fragments of the synthetic gene. The insert contained in p333 was formed by ligating two pairs of

complementary oligonucleotides, each bearing internal five- base 5' complementary overhangs (nucleotides 59-63 in Figure 5) . Construct p334 was composed of three pairs of annealed oligonucleotides joined at residues 162-167 and 220-225.

Complementary overhangs for the assembly of p331 were located at nucleotides 312-315 and 358-361. Construct p332 was ligated at positions 457-461 and 512-517.

The synthetic fragments were cloned into a modified pBS M13+ Stratogene vector by insertion into the multiple cloning site of the circular vector via synthetic 4-6 base overhangs (represented by the hatched boxes). The coding sequence for the synthetic cysteine-free IL-6 like gene is shown in black. Open boxes represent the modified pBS M13+ sequences.

Fragments were assembled by digesting with appropriate enzymes, purifying the desired bands by electroelution from agarose gels and religating. Removal of the termination codon in p337 was accomplished by substituting a second synthetic fragment containing a serine residue and a

compatible Eco RI overhang (RI). Ligation of this fragment, to yield construct p365, resulted in the addition of another Bgl II site and loss of the Eco RI site. Nucleotide 564 identifies the position of the last base contained in the Bgl II site required to fuse the insert in p365 with the collagen linker of the expression vector. Restriction sites are identified as follows: B, Bam HI; Bg, Bgl II; RI, Eco RI; RV, Eco RV; H, HinD III; N, Nco I; S, Stu I; X, Xba I.

FIG. 7. Diagram showing the construction of plasmid p367, the successful expression vector for producing the synthetic cysteine-free IL-6 peptide. The steps in the construction of p367 are described in sections 5.2-5.5 in the text.

FIG. 8a. Plasmid map of recombinant plasmid p367 showing the location of the IL-6 sequence (designated HSF). The assembled synthetic cysteine-free recombinant IL-6 gene contained in an (Nco I - Bgl II) insert was introduced between the Nco I and Bam H I restriction sites of the vector. The open box (C) indicates the location of the 60 amino acid collagen linker through which recombinant IL-6 is fused to β- galactosidase. Expression of the complete fusion gene produces a 130 kDa hybrid protein.

FIG. 8b. Plasmid map of recombinant plasmid p367 showing the location of the sequence for the synthetic cysteirie-free IL-6 like peptide (designated HSF). The vector shown is a significantly modified version of pJG200 as describing in the application in section 5. The assembled synthetic IL-6 like gene contained in an (Nco I-BGl II) insert was introduced between the Nco I and Bam HI

restriction sites of the vector. The open box (C) indicates the location of the 60 amino acid collagen linker through which the synthetic IL-6 like peptide is fused to β- galactosidase. Expression of the complete fusion gene produces a hybrid protein of approximately 130 kDa (see

Figure 3 for expression of the plasmid in induced E. coli).

FIG. 9. NaDodSO₄ -PAGE analysis of synthetic cysteine- free IL-6 protein purification. Samples collected at various stages of purification were electrophoresed on 10%

polyacrylamide- NaDodSO₄ gels under reducing -conditions as shown. Protein molecular weight markers are shown in lanes M. E. coli cells grown in 10 L batch culture were lysed by addition of lysozyme followed by brief sonication (Lane 1). The unusually hydrophobic fusion protein was purified by repeated ammonium sulfate precipitation after solubilization in PBS- Sarkosyl (Lane 2). Partially purified fusion protein was then digested with collagenase to release the 23 kDa recombinant IL-6 moiety (Lane 3). After removing the

maj ority of the cleaved, soluble ß-galactosidase by

precipitation in 40% ammonium sulfate, synthetic IL-6 was recovered in near homogeneous form as a pellicle upon

increasing the ammonium sulfate concentration to 70%

saturation (Lane 4). Reverse phase HPLC was used in the final step of the purification. The protein was recovered in a single peak fraction eluting at 54% acetonitrile (Lane 5).

FIG. 10. Stimulation of fibrinogen sythesis by

synthetic cysteine-free recombinant IL-6 as prepared

according to the methods described in §§5.2 to 5.8.

Confluent FAZA cell monolayers were treated with varying concentrations of purified recombinant cysteine-free IL-6 in the presence of 10^-7 M dexamethasone. After five hours of stimulation, cell medium was recovered and filtered through a nitrocellulose membrane using a dot-blot apparatus. Secreted fibrinogen levels were determined by solid phase immunoassay using a polyclonal fibrinogen antiserum as primary antibody and alkaline phosphatase conjugated anti-IgG antiserum as secondary antibody. Bound antibody was visualized by adding chromσgenic substrates (BCIP and NBT) to the blots.

Concentrations of secreted protein were determined by

scanning laser densitmetry and comparison of signal .

intensities against dilutions of a purified rat fibrinogen standard.

FIG. 11. B-cell differentiation assay. CH12.LX cells (2 x 10⁵ cells/well) were co-cultured m the presence or absence of antigen (SRBC) prior to treatment with various concentrations of recombinant synthetic cysteine-free IL-6, as prepared according to the methods described in §§5.2 to

5.8. After 48 hrs, treated CH12.LX aliquots were mixed with a freshly washed suspension of SRBC containing guinea pig complement, and transferred to Cunningham chambers for incubation at 37 degrees Centigrade. After 30 minutes, cells were returned to room temperature allowing hemolytic plaques to develop. Results of the assay are expressed as plaque forming colonies per million viable cells (shown as Pfc on the y axis). Bacterial lipopolysaccharide, included in the assay as a positive stimulatory control, gave a response of 10,726 pfc/million cells. The results shown represent mean values of duplicate assays.

FIG. 12a and b. Diagrammatic illustration of the construction of pTrpE/EK/cfIL-6. The details of the

construction are found in the text in Section 5.10.1.

FIG. 13. Graphic depiction of Time ∅ colony assay for stimulation of progenitor cells by various growth factors and combinations thereof.

FIG. 14. Number of nonadherent cells after 7 days of liquid culture. This assay is described in Example 11.

FIG. 15. Imclone vs. Endogen IL-6 on 7td.1.

FIG. 16. Imclone vs. bm IL-6 on 7td.1.

FIG. 17. Imclone v. Genzyme IL-6 using 7td.1.

FIG. 18. The sequence in pTrpE/EK/cfIL-6 from the enterokinase site through the amino terminal sequence of cysteine-free IL-6 to the natural carboxy terminus of IL-6 followed by three stop codons.

DETAILED DESCRIPTION OF THE INVENTION

5.1. INITIAL EXPRESSION CONSTRUCTS

Initial attempts to express high levels of

interleukin-6 in bacterial cells resulted in the production of no detectable or commercially useful amounts of the protein. One attempt to produce commercially useful amounts of protein resulted in the synthesis of plasmid p360. In this expression vector, the synthetic cysteine-free IL-6 sequences from p337-1 were inserted immediately downstream from the minicistron sequence produced by the fusion of oligo 737 [AGCTGATTAAATAAGGAGGAATAACCATGGCTGCA-3 ' ] and oligo 738 [GCCATGGTTATTCCTCCTTATTTAATC-3']. In this construct the synthetic IL-6 peptide had- a termination codon and was not fused to the β-galactosidase protein. Induction was expected to yield a non-glycosylated synthetic IL-6 peptide slightly larger than 22 KDa. The construction of plasmid p360 is graphically diagrammed, but not to scale, in Figure 1. The induction of expression of the synthetic IL-6 peptide by the addition of IPTG to cells carrying p360 resulted in no

detectable peptide (see Figure 3, lanes 3a and 3b for absence of protein at the arrow).

Similarly induction of a strain carrying plasmid p369, constructed as diagrammed in Figure 2, wherein the synthetic IL-6 like peptide was fused in frame with the alpha- complementing fragment of β-galactosidase resulted in no detectable protein (see lanes la and b. Figure 3).

These unsuccessful attempts to produce synthetic IL-6 can be compared in Figure 3 with the successful production, as described infra, of the synthetic cysteine-free

IL-6/collagen/β-galactosidase fusion protein (see the large amount of the 130 KDa protein in lanes 2a and b of Figure 3).

5.2. CONSTRUCTION OF AN IL-6 EXPRESSION VECTOR

5.2.1. THE INITIAL VECTOR pJG200

Plasmid pJG200 was the starting material that was modified to produce a successful IL-6 expression vector.. The initial plasmid, pJG200, contained target cistrons that were fused in the correct reading frame to a marker peptide with a detectable activity via a piece of DNA that codes for a protease sensitive linker peptide (Germino and Bastia, 1984, Proc. Natl. Acad. Sci. USA 81:4692; Germino et al., 1983, Proc. Natl. Acad. Sci. USA 80 :6848). The promoter in the original vector pJG200 was the P_R promoter of phage lambda. Adjacent to the promoter is the C_I857 thermolabile repressor, followed by the ribosome-binding site and the AUG initiator triplet of the Cro gene of phage lambda. Germino and Bastia inserted a fragment containing the triple helical region of the chicken pro-2 collagen gene into the Bam HI restriction site next to the ATG initiator, to produce a vector in which the collagen sequence was fused to the lacZ β-galactosidase gene sequence in the correct translational phase. A single Bam HI restriction sites was regenerated and used to insert the plasmid R6K replication initiator protein coding

sequence.

The plasmid pJG200 expressed the R6K replicator

initiator protein as a hybrid fusion product following a temperature shift which inactivated the C_I857 repressor and allowed transcription initiation from the P_R promoter. Both the parent vector construct with the ATG initiator adjacent to and in frame with the collagen/β-galactosidase fusion (noninsert vector), and pJG200 containing the R6K replicator initiator protein joined in frame to the ATG initiator codon (5') and the collagen/β-galactosidase fusion (3') (insert vector), produced β-galactosidase activity in bacterial cells transformed with the plasmids. As a result, strains

containing plasmids with inserts are not distinguishable from strains containing the parent vector with no insert.

5.2.2. REMOVAL OF THE P_R CI857 REPRESSOR

AND AMINO TERMINUS OF CRO

The first alteration to pJG200 in this invention was the removal and replacement of the Eco RI-Bam HI fragment that contained the P_R promoter, C_I857 repressor and amino terminus of the cro protein which provided the ATG start site for the fusion proteins. An oligonucleotide linker was inserted to produce the p258 plasmid, which maintained the

Eco RI site and also encoded the additional DNA sequences recognized by Nco I, Bgl II and Bam HI restriction

endonucleases. This modification provided a new ATG start codon that was out of frame with the collagen/β-galactosidase fusion. As a result, there is no β-galactosidase activity in cells transformed with the p258 plasmid. In addition this modification removed the cro protein amino terminus so that any resultant recombinant fusion products inserted adjacent to the ATG start codon will not have' cro encoded amino acids at their amino terminus. In contrast, recombinant proteins expressed from the original pJG200 vector all have cro encoded amino acids at their amino terminus.

5.2.3. ADDITION OF THE P_TAC PROMOTER, SHINE

DALGARNO SEQUENCE SND ATG CODON

In the second step of construction of the IL-6

expression vector, a restriction fragment, the Eco RI-Nco I fragment of pKK233-2 (Pharmacia Biochemicals, Milwaukee, WI), was inserted into the Eco RI-Nco I restriction sites of plasmid p258 to produce plasmid p277. As a result, the p277 plasmid contained the P_TAC (also known as P_TRC) promoter of pKK233-2, the lacZ ribosome binding site and an ATG

initiation codon. In the p277 plasmid, the insertion of a target protein sequence allows its transcription from an IPTG inducible promoter in an appropriate strain background. The appropriate strain background provides sufficient lac

repressor protein to inhibit transcription from the uninduced

P_TAC promoter. Because cells can be induced by the simple addition of small amounts of the chemical IPTG, the p277 plasmid provides a significant commercial advantage over promoters that require temperature shifts for induction such as the P_R promoter of pJG200. Induction of commercial quantities of cell cultures containing temperature inducible promoters would otherwise require heating large volumes of cells and medium to produce the temperature shift necessary for induction. For example, induction by the P promoter requires a temperature shift to inactivate the C_I857

repressor inhibiting pJG200's promoter. One additional benefit of the promoter change is that cells are not

subjected to high temperatures or temperature shifts. High temperatures and temperature shifts result in a heat shock response and the induction of heat shock response proteases capable of degrading recombinant proteins as well as host proteins (See Grossman et al., 1984, Cell 38:383; Baker et al., 1984, Proc. Natl. Acad. Sci. 81:6779). 5.2.4. IMPROVEMENT OF THE RIBOSOME BINDING SITE

The p277 expression vector was further modified by insertion of twenty-nine base pairs, namely

5'CATGTATCGATTAAATAAGGAGGAATAAC3' into the Nco I site of p277 to produce plasmid p340. This sequence is related to, but different than, one portion of the Schoner "minicistron" sequence (described in section 2.5.1). The inclusion of these 29 base pairs provides an optimum Shine/Dalgarno site for ribosomal/mRNA interaction. The final p340 vector significantly differs from pJG200 because it contains a highly inducible promoter suitable for the high yields needed for commercial preparations, and improved synthetic ribosome binding site region to improve translation, and means to provide a visual indicator of fragment insertion. The steps in the construction of vector p340-1 are diagrammed in Figure 4.

5.3. MODIFICATIONS OF THE INTERLEUKIN-6 SEQUENCE

The coding sequence used for the expression of

synthetic cysteine-free recombinant IL-6 was based on the . cDNA sequence of human IL-6. The coding sequence was

constructed using 11 complementary synthetic oligonucleotide pairs. Several mutations were introduced into the

recombinant IL-6 coding sequence during oligonucleotide synthesis to enable proper assembly of the gene sub-fragments on the one hand, and to ensure efficient expression of the assembled gene on the other. Nucleotide sequence

modifications, designed to introduce novel restriction sites for use in joining the gene sub-fragments, were incorporated within the coding sequence in such a manner as to avoid altering the amino acid composition of the synthetic gene with respect to the native IL-6 protein sequence. The modifications included: 1) replacement of the 5' terminal 118 nucleotides, which encode the 28 amino acid signal sequence normally found in the native IL-6 gene, with a methionine codon (nucleotides 3-5); ii) replacement of the [Pro] residue in the native IL-6 protein sequence with [Gly] (nucleotides 6-8) in the synthetic IL-6 sequence; iii) replacement of the normal TAG stop codon with a serine codon (nucleotides 558-560) to effect fusion of the synthetic IL-6 protein with the collagen linker; and iv) replacement of the four internal cysteine residues with serines (nucleotides 135-137, 153-155, 222-224, 252-254) to produce a synthetic IL-6 protein that is unable to form disulfide bonds. The sequence of the modified synthetic cysteine-free protein is included in Figure 5. Those skilled in the art will

recognize that other modifications in the sequence of the synthetic peptide are useful in the present invention. The invention as contemplated includes the modification of other amino acids of the peptide sequence or other nucleotides of the DNA sequence.

5.4. OLIGONUCLEOTIDE SYNTHESIS AND ASSEMBLY Assembly of the synthetic oligomers was carried out in three steps. Initially,- oligonucleotides bearing

complementary overhangs were annealed and ligated to produce four separate double stranded fragments, one composed of four oligonucleotides (2 per strand) and three composed of six oligonucleotides each (3 per strand). Before assembly, synthetic oligomers were kinased with 10 units of T4

polynucleotide kinase. To prevent concatenation during ligation, the 5' terminal oligomers on either strand were not phosphorylated. Subsets of these double stranded

oliqonucleotides were assembled in separate annealing and ligation reactions to produce four sub-fragments, each representing approximately one fourth of the recombinant synthetic cysteine-free IL-6 coding sequence.

A modified plasmid was constructed to allow for DNA amplification and ease in sequencing each oligomer. A pBS M13+ cloning vector (Stratagene) was modified by insertion of a 28 base oligonucleotide adapter

(5 'AGCTTCCATGGTCGCGACTCGAGCTGCA-3 ' ) between the Hind III and Pst I sites of its multiple cloning region. As a result, the modified plasmid, designated p287, no longer contains its original Sph I restriction site but encodes additional sites for Nco I, Nru I and Xho I.

The synthetic oligomers were separately cloned into the modified pBS M13+ vector p287 to allow DNA amplification and sequence verification by dideoxy-nucleotide sequencing.

Insertion of the assembled fragments into the modified vector produced recombinant plasmids p333, p334, p331, and p332, each containing a portion of the synthetic cysteine-free IL-6 protein coding region proceeding from amino to carboxy terminus respectively. Following ligation, each plasmid DNA was transformed separately into competent E. coli JM101.

The second step of the assembly involved the

construction of two vectors that encoded the amino and carboxy halves of synthetic cysteine-free IL-6. These were obtained by ligating the inserts of p333 and p334 to produce the N- terminal coding vector p336 and.by joining the inserts of p332 and p331, to form the C-terminal coding vector p335.

In the third and final step of the construction, inserts were subsequently combined to yield the entire coding sequence of the recombinant synthetic cysteine-free IL-6 gene. The insert released from plasmid p335 was ligated into p336. The resulting plasmid p365 contained the complete coding sequence of synthetic IL-6 inserted between the Nco I and Eco RI sites of the modified pBS M13+ vector p287. The constructions are shown diagrammatically in Figure 6.

5.5. CONSTRUCTION OF THE p367 VECTOR FOR

EXPRESSING THE SYNTHETIC IL-6/COLLAGEN/β GALACTOSIDASE FUSION PRODUCT

The assembled cysteine-free recombinant IL-6 gene was excised from p365, and inserted into plasmid p340 between the Nco I site, which encompasses the initiating methionine, and the BamH I site adjacent to the collagen linker as depicted in Figure 7. The resulting vector p367 , diagrammed in Figure 8 but not to scale, was used to transform E. coli JM101.

Recombinant colonies were selected on the basis of antibiotic resistance and by appearance of blue coloration in the presence of X-Gal. The size of the insert DNA was confirmed by mini-lysate extraction followed by polyacrylamide gel electrophoresis.

A tripartite fusion protein composed of synthetic cysteine-free IL-6, a sixty amino acid collagen linker and β-galactosidase was produced in transformed bacteria (See Figure 3 and Figure 9). As predicted from the gene sequence, ampicillin resistant transformants carrying the modified IL-6 expression plasmid produced blue colonies upon addition of the inducing agent IPTG and the chromogenic β-galactosidase substrate X-Gal. Synthesis of the fusion protein by IPTG- induced transformants was independently confirmed by western blot analysis of a total E.coli lysate using a monoclonal anti-β-galactosidase antibody obtained from Promega Biotec. The monoclonal anti-β-galactosidase antibody used in the Western blot recognized a band with an apparent molecular weight of 130,000 kDa.

5.6. INDUCTION OF LARGE AMOUNTS OF THE MODIFIED

INTERLEUKIN-6 FUSION PROTEIN

Transformed JM101 containing plasmid p367 were grown in

10 L batch cultures using a Magnaferm fermentor (New

Brunswick Scientific). Cells were grown in 2x YT containing

100 ug/ml ampicillin and induced at A550 = 1.5 by addition of

5 mM isopropylthio-B-D-galactopyranoside (IPTG, Sigma). At 8 to 12 hours post-inoculation, when the cell numbers and β- galactosidase activity had reached maximal levels, cells were pelleted by centrifugation at 5000 x g and stored frozen at

-20°C until needed. 5.7. PURIFICATION OF THE FUSION PROTEIN

Frozen E. coli cell pellets were processed in aliquots of 100 g (wet weight) by washing with TNS buffer (30 mM

Tris.Cl, pH 7.4; 30 mM NaCl, 0.05% sodium lauroyl sarcosine). Washed cells were lysed in 450 ml TNS containing 1.5 mM EDTA and 0.5 mg/ml lysozyme. After incubating the suspension on ice for 30 minutes, complete lysis was ensured by subjecting cells to three cycles of freeze-thawing and brief sonication. Soluble proteins, devoid of β-galactosidase activity, were removed by three repeated washings in TNS followed by

centrifugation at 10,000 x g for 20 minutes. The final pellet, weighing approximately 40 g, was resuspended in 60 ml of 10% sarkosyl and diluted to 2.4 liters with phosphate buffered saline (PBS). Insoluble material was removed by centrifugation and the supernatant made 40% with respect to a saturated solution of ammonium sulfate. After incubating the extract on ice for 30 min. precipitated protein was again recovered by centrifugation and subjected to two additional rounds of ammonium sulfate precipitation. The final extract was resuspended in 250 mis of 20 mM Tris.Cl, pH 7.4 and 150 mM NaCl, divided into 4 ml aliquots and stored at -20°C until ready for further processing.

5.8. CLEAVAGE OF THE FUSION PROTEIN AND PURIFICATION

OF THE SYNTHETIC CYSTEINE-FREE INTERLEUKIN-6

The recombinant synthetic cysteine-free IL-6 protein was purified to homogeneity using reverse phase HPLC. Thawed extract (4 mis) was sonicated briefly to disperse aggregates, added to pre- treated collagenase, and incubated for 45 minutes at room temperature. The majority of the cleaved β- galactosidase was removed by adding 0.5 volumes of saturated ammonium sulfate, incubating on ice for 30 minutes and pelleting the insoluble material. The cleaved recombinant cysteine-free IL-6 was concentrated by bringing the total volume of the supernatant to 13 mis with saturated ammonium sulfate, incubating on ice for 30 minutes, and centrifuging to compact the insoluble protein into a floating pellicle. Liquid was drained by puncturing the tube, and the remaining pellicle was resuspended in 0.5 mis of Tris buffered saline.

The resuspended recombinant cysteine-free IL-6 was prepared for reverse phase HPLC by adding an equal volume of 60% acetonitrile, 0.1% trifluroacetic acid. Insoluble material was pelleted and the clarified supernatant was loaded onto a 250 mm, 4.6 mm ID reverse phase column (Vydac, 218Tp, C18, 10 μm- Alltech Associates) in an injection volume of 0.5 to 1 ml. The mobile phase consisted of varying concentrations of solvent B (60% acetonitrile and 0.1% triflurooacetic acid) relative to solvent A (0.1

trifluoracetic acid). The flow rate was 0.5 ml^-1 min , and the system programmed to deliver two consecutive linear gradients, from 25% to 80% B in five minutes, and 80% to 100% B over 54 minutes. Protein eluted from the column at 54% acetonitrile and collected in a single peak fraction was the purified synthetic cysteine-free interleukin-6 peptide which migrated at 23 kDa following SDS-PAGE. The steps of the purification are indicated in Figure 9 and the yields at each step are provided in Table 1.

To confirm the identity of the 23 kDa protein, HPLC- purified material was subjected to direct N-terminal automated protein sequencing. The amino acid residues

(MGVPPGED) identified after seven cycles of sequential degradation coincided with the predicted N-terminal amino acid composition of the recombinant protein as deduced from the synthetic recombinant cysteine-free IL-6 gene.

Confirmation of the protein sequence revealed that the preparation contained a small fraction of recombinant

cysteine-free IL-6 protein with a terminal methionine

residue.

In a particular embodiment the isolated active fraction consisted of a mixture of amino terminal methionine- containing and amino terminal methionine-free synthetic cysteine-free IL-6 proteins. Amino acid sequence analysis indicates that in one preparation of the mixture 90% of the mixture was methionine-free at the amino terminus and 10% contained an amino terminal methionine. In this embodiment, the active preparation of the cysteine-free protein varies from natural IL-6 in that 1) no intramolecular disulfide bonds occur; 2) a methionine amino acid at position one in the bioengineered protein replaces the signal sequence amino acids 1-28 of the natural unprocessed protein; 3) amino acid two in the bioengineered protein, glycine, replaces the proline amino acid present in the natural IL-6 protein; 4) the carboxy terminus contains additional amino acids.

Collagenase generally cleaves after Y in the sequence P-Y-G-P wherein Y represents a neutral amino acid. See Keil et al. FEBS Letters 56: 292-296 (1975). In the present example of the fusion protein with IL-6 sequences the neutral amino represented by Y is valine. Accordingly, the carboxy terminus of the protein produced by induction of the fusion protein coded by the p367 vector after digestion of the fusion protein with collagenase is expected to be mainly . . . P-G-P-V-G-P-V and/or . . . P-G-P-V. If sufficient

collagenase is present under sufficiently rigorous

conditions, the carboxy terminus is exclusively . . . P-G-P-V. If the amino acid sequence starting with the third amino acid (i.e. V) in Figure 5 and ending with the

fourteenth amino acid from the end (i.e. M) is called pep, the following peptides are contemplated by the present invention:

G-pep-SDPGPVGPV (Protein I)

G-pep-SDPGPV (Protein II)

MG-pep-SDPGPVGPV (Protein III)

MG-pep-SDPGPV (Protein IV)

This preparation was used in the examples described in §§7, 8 and 9.

The presence or absence of methionine at the amino terminus, and the presence or absence of G-P-V at the carboxy terminus does not affect the activity of IL-6.

5.9. ALTERNATE METHODS OF PREPARATION

OF SYNTHETIC CYSTEINE-FREE IL-6

The foregoing description is but one specific example of a useful method by which the synthetic cysteine-free IL-6 peptide of the present invention may be prepared. However, those skilled in the art will readily recognize that other vector constructs, as well as other unicellular hosts, are also useful in the method of the present invention. In very general terms, for example, the skilled artisan will

recognize that to eventually achieve transcription and translation of the inserted gene, the gene must be placed under the control of a promoter compatible with the chosen host cell. A promoter is a region of DNA at which RNA polymerase attaches and initiates transcription. The

promoter selected may be any one which has been isolated from the host cell organism. For example, E. coli, a commonly used host system, has numerous promoters such as the lac or recA promoter associated with it, its bacteriophages or its plasmids. Also, synthetic or recombinantly produced promoters, such as the λ phage P_L and P_R promoters may be used to direct high level production of the segments of DNA adjacent to it. Similar promoters have also been identified for other bacteria, and eukaryotic cells.

Signals are also necessary in order to attain efficient transcription and translation of the gene. For example, in E. coli mRNA, a ribosome binding site includes the

translational start codon (AUG or GUG) and other sequence complementary to the bases of the 3' end of 16S ribosomal RNA. Several of these latter sequences (Shine-Dalgarno or S-D) have been identified in E. coli and other suitable host cell types. Any SD-ATG sequence which is compatible with the host cell system, can be employed. These SD-ATG sequences include, but are not limited to, the SD-ATG sequences of the cro gene or N gene of coliphage lambda, or the E. coli

tryptophane E, D, C, B or A genes.

A number of methods exist for the insertion of DNA fragments into cloning vectors in vitro. DNA ligase is an enzyme which seals single-stranded nicks between adjacent nucleotides in a duplex DNA chain; this enzyme may therefore be used to covantly join the annealed cohesive ends produced by certain restriction enzymes. Alternatively, DNA ligase can be used to catalyze the formation of phosphodiester bonds between blunt-ended fragments. Finally, the enzyme terminal, deoxynucleotidyl transferase may be employed to form

homopolymeric 3'-single-stranded tails at the ends of

fragments; by addition of oligo (dA) sequences to the 3' end of one population, and oligo (dT) blocks to 3 ' ends of a second population, the two types of molecules can anneal to form dimeric circles. Any of these methods may be used to ligate the control elements into specific sites in the vector. Thus, the sequence coding for the cysteine-free or cysteine-containing IL-6 fusion protein is ligated into the chosen vector in a specific relationship to the vector promoter and control elements, so that the sequence is in the correct reading frame with respect to the vector ATG

sequence. The vector employed will typically have a marker function, such as ampicillin resistance or tetracycline resistance, so that transformed cells can be identified. The method employed may be any of the known expression vectors or their derivatives; among the most frequently used are plasmid vectors such as pBR 322, pAC 105, pVA 5, pACYC 177, pKH 47, pACYC 184, pUB 110, pmB9 , pBR325, col El, pSC101, pBR313, pML21, RSF2124, pCR1 or Rp4; bacteriophage vectors such as lambda gt11, lambda gt-WES-lambda B, chain 28, chain 4, lambda gt-I-lambda BC, lambda-gt-1 lambda B, Ml3mp7, M13mp8, M13mp9; SV40 and adenovirus vectors; and yeast vectors. The vector is selected for its compatibility with the chosen host cell system. Although bacteria, particularly E. coli, have proven very useful in high yield production of the synthetic IL-6 peptide, and are the preferred host, the invention is not so limited. The present method contemplates the use of any culturable unicellular organism as host; for example, eukaryotic hosts such as yeast, insect, and mammalian cells, are also .potential hosts for IL-6 production. The selection of an appropriate expression system, based on the choice of host cell, is well within the ability of the skilled artisan.

One skilled in the art will readily recognize that variations on the described fusion protein are also possible. For example, the order of the first and third peptide

portions can be reversed, so that the third peptide segment is positioned at the amino terminus and the sequence coding for peptides with IL-6 activity is at the carboxy terminus, with the second, cleavable peptide portion remaining as a link between the two segments.

The identity of each of these segments may also be varied. For example, substantial variation is possible within and around the basic IL-6 peptide sequence. A

particularly interesting observation is that a substantial portion of the amino terminus can be deleted, not only without loss of activity, but with a resultant 2-3 fold increase in activity in both cysteine-containing and cysteine free IL-6 sequences. However, removal of the last 20

residues in the sequence results in a complete loss of activity, in both cysteine-containing as well as cysteinefree forms. Also, as noted above, the presence of additional amino acid residues on the carboxy terminus of the IL-6 peptide does not affect the biological activity of the molecule.

It will also be understood by those skilled in the art that any amino acid in the known sequence of IL-6 may be substituted with a chemically equivalent amino acid. In other words, "silent changes" may be made in the amino acid sequence without affecting the activity of the molecule as a whole. For example, as has been shown, substitution of all cysteine residues with serine residues allows the modified IL-6 molecule to retain its biological activity. Alternative choices as substitutes for cysteine are other neutral amino acids such as valine, proline, isoleucine and glycine, serine, threonine or tyrosine. Negatively charged residues, such as aspartic acid and glutamic acid may be interchanged, as may be positively charged residues such as lysine or arginine. Hydrophobic residues including tryptophan,

phenylalanine, leucine, isoleucine, valine and alanine may also be exchanged. Alteration of the sequence by amino acid substitution, deletion, or addition and subsequent testing of the resultant molecule to determine if biological activity is retained is well within the ability of one skilled in the art, without necessity for undue experimentation.

The identity of the cleavable linker peptide sequence is also a matter of choice and may be accomplished using chemical or enzymatic means. The sequence employed may be any one which can be chemically cleaved, so that the peptide with the biological activity of IL-6 can be released from the remainder of the fusion protein. In a preferred embodiment, the cleavable sequence is one which is enzymatically

degradable. A collagenase-susceptible sequence is but one example. Other useful sites include enterokinase- or Factor Xa-cleavable site. For example, enterokinase cleaves after the lysine in the sequence Asp-Asp-Asp-Lys. Factor Xa is specific to a site having the sequence Ile-Glu-Gly-Arg, and cleaves after the arginine. Another useful cleavage site is that of thrombin which recognizes the sequence Leu-Val-Pro- Arg-Gly-Ser-Pro. Thrombin cleaves between the Arg and Gly residues. Other enzyme-cleavable sites will also be

recognized by those skilled in the art. Alternately, the sequence may be selected so as to contain a site cleavable by cyanogen bromide; cyanogen bromide attacks methionine

residues in a peptide sequence.

It is preferable, although not essential, to select a linker sequence which, when cleaved, leaves a minimal number of residues attached to the IL-6 sequence, so that the terminus of the released IL-6 active peptide is as near to the native sequence as possible. In a particular embodiment the IL-6 active portion is at the carboxy terminal end of the fusion protein, and the cleavage site is specific for a protease that is capable of leaving the natural pro-val-pro amino terminal peptide sequence. Examples of such cleavage sites are those that are cleaved by enterokinase or Factor Xa.

The identity of the third peptide sequence may also be varied. This portion of the tripartite structure potentially serves two purposes: (1) the use of a correctly selected protein, capable of being expressed in the chosen host, can place the production of peptides having activity IL-6 under the control of a strong promoter, and thus facilitate the production of those peptides; and (2) it can provide a convenient means for identifying transformed clones producing the fusion protein. For example, in the discussion provided above, the full sequence encoding β-galactosidase was used; this protein provides a visual means of detection by the addition of the proper substrate.

Alternatively, the third peptide portion can be a fraction of such a protein, provided that the portion

remaining is still readily expressed by the host cell. This portion can also be a peptide which is not necessarily visually detectable, but the presence of which may be

detectable by other means, such as by calculation of the expected molecular weight of the fusion protein or insertion into a vector with a detectable marker. Another useful, alternative sequence for use in a prokaryotic host is the trpE gene product, or a portion thereof (Kleid et al.,

Science 214:1125-1129, 1981). Additional choices include sequences coding for the cro gene of λ phage or other

portions of the lac genes than the lacZ sequence coding forβ-galactosidase. Those skilled in the art will recognize additional choices which may provide the basis for the third peptide portion of the claimed fusion protein.

5.10. ALTERNATE DNA CONSTRUCTS

The following Examples illustrate the preparation of DNA constructs in which the position of the first and third peptide portions of the tripartite fusion proteins is

reversed. Also illustrated is the use of alternative linkers and third peptide portions. The quantity of production of IL-6 protein using this construct is also high, ranging from about 1-20% of total soluble cellular protein.

5.10.1. TrpE - ENTEROKINASE CLEAVAGE SITE - IL-6 MUTEIN FUSION PROTEIN

(a) A fusion protein that encodes the product of the

TrpE gene, anthranilate synthase, followed by an enzymatic cleavage site, followed immediately by a synthetic IL-6 peptide sequence having C-terminus and N-terminus ends of the natural IL-6 peptide and all four cysteines replaced by serines, is expressed by a new recombinant plasmid

pTrpE/EK/cfIL6. To prepare pTrpE/EK/cfIL6, the plasmid p36 - which has been described in Section 5.5 and Figure 6 of this specification - is digested with the enzymes EcoRII (to cut the EcoRII site that is located 14 bases from the 5' NcoI site) and Bglll (to cut the Bglll site that is shown in

Figure 13 as Bglll'). The plasmid is digested with 5 units of each enzyme per 10 μg plasmid at 37°C for 2 hours. The 0.492 Kb EcoRII/Bglll fragment is isolated by standard procedures such as electro-elution. This 0.492 Kb fragment is called sequence A. This sequence A and the subsequent sequences noted in the following text of this section refer to the illustrations in Figure 12.

(b) An additional aliquot of plasmid p365

(approximately 10 μg) is digested with Hindlll and Bglll as described above at pH 7.5 in a buffer of 25 mM Tris HCl, 100 mM MgCl₂, 10 mg/ml BSA and 2 mM BME. The large (3.0 Kb) fragment that results from cutting the unique Hindlll site and the Bglll site referred to in Figure 13 as Bglll' is called sequence B.

(c) A synthetic, double-stranded oligonucleotide

(sequence C) is prepared and ligated to sequence A and sequence B. The oligonucleotide starts with overlapping Hindlll and Bell sites, encodes a sequence of amino acids containing an enterokinase cleavage site followed immediately by the first three amino acids of natural IL-6, Pro-Val-Pro (PVP), and ends with an EcoRII site. The sequence of the oligonucleotide is:

Bell EK Site

5'AG CTT GAT CAG GCG GAT CCG GAA GGT GGT AGC GAC GAC GAC GAC AAA

3' A CTA GTC CGC CTA GGC CTT CCA CCA TCG CTG CTG CTG CTG TTT

P V P 3'

CCG GTT CCG GGC CAA GGC GGT CC 5" EcoRII

Each strand of the oligonucleotide is prepared

separately, treated with polynucleotide kinase in the

presence of 1 mM rATP in a suitable reaction buffer at 37~C for 30 minutes, and annealed by heating to 85~C for 5

minutes, followed by slow cooling to 25-C.

To ligate sequence C to sequences A and B,

approximately 1 μg of synthetic cysteine-free IL-6

EcoRII/Bglll fragment (sequence A) is coprecipitated with 200 ng of the synthetic oligonucleotide (sequence C) and ligated to the Hindlll/Bglll vector component (sequence B) of p365. Ligation is accomplished in a 20 μl reaction volume

containing 20 mM Tris HCl, pH 7.6, 0.5 mM rATP, 10 mM MgCl₂, 5 mM DTT at 16° overnight. The new plasmid is pABC. pABC is cloned by adding a 5 μl aliquot of the reaction mixture to competent HB101 bacteria. Ampicillin-resistant colonies are selected after overnight incubation at 37ºC.

(d) The 3 ' end of the recombinant synthetic cysteine- free IL-6 gene expressed in p365 is reconstructed to encode the natural IL-6 carboxy terminus, which ends with

methionine.

To accomplish this, the following oligonucleotide is synthesized as above:

5' GA TCT TTC AAA GAA TTC CTG CAG TCC TCC CTG CGT GCT CTG CGT 3 ' A AAG TTT CTT AAG GAC GTC AGG AGG GAC GTA CGA GAC GCA

CAG ATG TAA TGA TAG GTA C 3'

GTC TAC ATT ACT ATC 5'

This oligonucleotide, reading from left to right, starts with a Bglll site, encodes the natural amino acid sequence of IL-6 that follows the Bglll' site of p365, and concludes with a methionine residue that is followed immediately by three stop codons and a Kpnl site (sequence

D).

(e) pABC (step C) is digested with Hindlll and Bglll (sequence E).

(f) PATH 23 (available from A. Tzajaloff, Columbia University, New York City) is an ampicillin-resistance plasmid containing a gene that encodes the amino-terminal 337 amino acids of TrpE (anthranilate synthetase component I) adjacent, and in reading frame at its 3' end with, a

polylinker containing a Hindlll site. A general description of the TrpE operon may be found in Miller and Reznikoff, eds., The Operon, Cold Spring Harbor Laboratory, pp. 263-302 (1978). Other sources of DNA that encode all or part of trpE and lacZ are readily available. Such other sources may be found, for example, in Pouwels et al., Cloning Vectors, A Laboratory Manual, Elsevier, 1985. For example, trpE

sequences may be isolated from plasmids having the following identifying codes in the Pouwels et al. manual:

I-A-ii-3 (pDF41 and 42), I-A-iv-23 (pRK353), I-B-ii-4 (pMBL24), I-B-ii-1 (ptrpED5-1), I-D-i-3 (pEP70-pEP75), and I-D-i-4 (pEP165 and pEP168).

10 μg PATH 23 is digested with 5 units each of Hindlll and Kpnl at 37 °C for 2 hours. The large fragment is isolate by gel chromatography, followed by electro-elution and ethanol precipitation (sequence F).

(g) Approximately 200 ng of sequence D are mixed with approximately 1 μg of sequence E. The resulting mixture is coprecipitated with ethanol in the presence of sequence F and ligated as described above. The resulting fragment is called pTrpE/EK/cfIL-6.

(h) Competent E. coli host cells are transformed with pTrpE/EK/cfIL-6. For example, the E. coli HB101 strain is used as host cell for transformation in one embodiment.

Ampicillin-resistant colonies are gathered. These colonies express a fusion protein comprising a TrpE segment, an amino acid segment recognized and cleaved by enterokinase, and the synthetic cysteine-free IL-6 amino acid sequence that has the termini at both carboxy and amino ends of the natural IL-6 peptide, starting with PVP and ending with M.

5.10.2. BETA-GALACTOSIDASE-ENTEROKINASE

CLEAVAGE SITE - SYNTHETIC CYSTEINE-FREE

IL-6 MUTEIN FUSION PROTEIN

The protocol described in Section 5.10.1 for producing the TrpE enterokinase - cleavage site synthetic cysteine-free IL-6 fusion protein is followed, except the pEx-1 vector is substituted for PATH 23 in step f. pEx-1 is digested with BamHI and Kpnl. BamHI and Bell have compatible restriction sites. The resulting construct contains a thermoinducibleβ-galactosidase gene followed by a cloning polylinker. The truncated gene produces a peptide that is approximately 48 Kd of the beta-galactosidase protein (Stanley, K.K. and Luzio, J.P., 1984, EMBO J., Vol. 3, pp. 1429-1434). The resulting construct is called pβgal/EK/cfIL-6. Another source of beta-galactosidase DNA includes pHg2000 described in §5.2.1. The fusion protein is produced after transformation of E.coli N4830 cells with pßgal/EK/cfIL-6 and thermoinduction. The plasmid is replicated in E.coli strain N99. N99 and N4830 are available from Pharmacia. The fusion protein is cleaved by enterokinase using methods known and used in the art.

It is routine to cleave proteins having an enterokinase recognition site with enterokinase. See, for example, Hopp et al., Biotechnology 6: 1204-1210 (1988).

5.10.3. FUSION PROTEINS WITH FACTOR Xa CLEAVAGE SITE

A factor Xa site is substituted for an enterokinase site by modifying step C of Section 5.10.1 and 2. The synthetic oligonucleotide (sequence C) shown in step (C) of Section 5.10.1 comprises a DNA sequence that encodes

Asp.Asp.Asp.Asp.Lys. This DNA sequence is modified so as to encode the factor Xa cleavage recognition site,

Ile.Glu.Gly.Arg. The resulting construct is called

pβgal/Xa/cfIL-6. The plasmids pTrpE/EK/cfIL-6 and

pβgal/Xa/cfIL-6 are expressed as described in §5.10.1 and §5.10.2. The resulting fusion proteins are cleaved with factor Xa, which cleaves after the arg in its recognition site by methods known in the art. See, for example, Nagal & Thogerson, Nature 309: 810-812 (1984).

5.11. ASSAYS OF ACTIVITIES OF THE

SYNTHETIC CYSTEINE-FREE PROTEIN

5.11.1. HEPATOCYTE STIMULATION ASSAY

FAZA 967 rat hepatoma cells were grown in DMEM/F12 supplemented with 10% NuSerum (Collaborative Research), penicillin and streptomycin. Assays were performed on one day old confluent monolayers seeded in 48 well plates

(Costar). Prior to treatment; with cysteine-free recombinant IL-6, as prepared according to the methods described in §§5. to 5.8, and .other conditioned media, cells, were washed with serum-free medium containing 10 M dexamethasone. Treated cells were subsequently maintained in serum- free/dexamethasone medium for the duration of the assay.

Cells were incubated in the presence of cysteine free

recombinant IL-6 and other conditioned media for five hours at 37°C in a tissue culture incubator. After treatment, cell supernatants were removed and stored at -20°C or assayed directly for fibrinogen as follows. Two-fold serial

dilutions of cell supernatants were prepared in a separate 96-well microtiter plate and spotted onto a 0.45 γm

nitrocellulose filter using a dot-blot apparatus (Bio-Rad). Fibrinogen levels were determined by solid phase enzyme- linked immunoassay. Fibrinogen was detected using a 1:1000 dilution of rabbit anti-rat fibrinogen polyclonal antiserum (obtained from Dr. Gerald R. Crabtree, Stanford University). Secondary antibody was affinity purified alkaline

phosphatase-conjugated goat anti-rabbit antisera (Promega

Biotec). Bound antibody was visualized by addition of substrates nitro-blue tetrazolium (NBT) and 5-bromo-4- chloro-3-indoyl-phosphate, p-toluidine salt (BCIP; Sigma).

Positive controls consisted of cells treated with supernatant obtained from PMA stimulated MRC-5 fibroblasts. Quantitation of the assay was carried out by scanning laser densitometry.

5.11.2. B-CELL DIFFERENTIATION ASSAY

Murine B-cell clone CH12.LX (N⁺, d⁺ LY-1⁺) was grown and maintained in RPMI 1640 containing 5% heat-inactivated fetal bovine serum, 300 Ng/ml glutamine, 0.04 mM 2- mercaptoethanol and antibiotics CH12.LX cells bear surface IgM specific for the phosphatidyl choline moiety of sheep erythrocytes (SRBC).

The differentiation assay was performed by culturing 2 x 10 5 B-cells m the presence or absence of various

concentrations of synthetic cysteine-free IL-6, as prepared according to the methods ddscribed in §§5.2 to 5.8, in -2 ml

B-cell medium in Costar 24-well plates. SRBC (ASA Biological

Products, Einston-Salem, NC) were washed three times in RPMI

1640 prior to use; 1 x 10 erythrocytes were included in each test culture. Positive controls consisted of mitogen- stimulated B-cells using 50 Ng/ml lipopolysaccharide (Difco).

Cultures were incubated at 37°C in an atmosphere of 5% CO₂.

Direct hemolytic plaque forming colonies (pfc) in CH12.LX cultures were determined.

5.11.3. IN VITRO BONE MARROW ASSAYS

Synthetic cysteine-free IL-6 prepared in accordance with the methods described in Section 5.2 - 5.8, has also been shown to have therapeutic utility in art-recognized in vitro testing. Delta (Δ) assays of the effect of IL-6, on fluorouracil treated bone marrow cells, indicates that synthetic cysteine-free IL-6 has good stimulatory activity on progenitor cells. The protocol for these assays is found in Figure 14. Particularly effective stimulation is observed when synthetic cysteine-free IL-6 is combined with IL-1, an also when these two cytokines are combined with either M-CSF or IL-3. Tabular presentation of Δ values are found in Table 2 ; graphic depiction of Time ∅ colony assays are shown in Figure 13.

5.11.4. 7TD1 ASSAY OF DELETION MUTATIONS

In a 7TD1 assay (Van Snick et al., Proc. Nat'1. Acad. Sci. USA 83:9679-9683, 1986), which utilizes the

proliferation of an IL-6 dependent murine hybridoma cell line to quantify biological activity, various deletions of amino acid residues from IL-6 sequence were tested. Table 3 shows these results, expressed as percent activity compared with equimolar amounts of recombinant cysteine-containing IL-6 (Amgen). The IL-6 sequences tested are all cysteine- containing. Plasmid p478 is a plasmid construct identical to plasmid p367 except that in p478, the cysteines in the IL-6 sequence have not been replaced. The IL-6 active protein fraction is the IL-6 peptide cut from the fusion protein ("p478 cut" in Table 2) with collagenase. This peptide fraction for each deletion mutation tested is, therefore, a mixture of cysteine-containing IL-6 peptides having discrete amino acids added to the carboxy terminal end of the IL-6 peptide sequence. In addition, the proteins tested are the fusion proteins themselves ("p478 uncut"). The wild type, cysteine-containing, natural IL-6 sequence fusion protein produced by p478 ("478 uncut") retains the biological

activity of IL-6 (3% activity) as compared to the cleaned cysteine-containing IL-6 peptide ("478 cut") that is produced from it. The '478 cut eptide is the standard against which the nine deletion mutations are tested and as such, is 100% active in the test. Thus in Table 3 478 cut refers to the wild type plasmid expressing cysteine-containing IL-6 fusion protem that has had the IL-6 cleaved from the fusion protein with collagenase and 478 uncut in Table 3 refers to the uncut fusion protein. Mutant 1AB is a deletion mutation produced by deletion of amino acids 4 through 23 in the cysteine-containing IL-6 peptide where met is amino acid number one of the peptide sequence for the analogous IL-6 cysteine-free peptide found in Figure 8b. Mutant 2AB, 3AB etc. all refer to the corresponding twenty amino acid

deletions at the appropriate position in the sequence as identified in Table 3 in the second column labeled amino acid residues deleted.

6. EXAMPLE: MATERIALS AND METHODS

6.1. CONDITIONS FOR RESTRICTION ENZYME DIGESTION

Enzymes were obtained from commercial sources (New

England Biolabs) and digestion were carried out as

recommended by the manufacturer.

6.2. BACTERIAL STRAINS AND PLASMIDS

E. coli JM101 (P-L Pharmacia) was transformed as described in Hanahan, 1983, J. Mol. Biol. 166:557. Plasmid pKK233-2 was obtained from P-L Pharmacia; plasmid pBSt was from Stratogene. Other plasmid constructs are as described in this application.

6.3. OLIGONUCLEOTIDE ASSEMBLY

Oligonucleotides were synthesized from CED

phosphoramidites and tetrazole from American Bionetics.

Oligonucleotides were kinased with T4 polynucleotide kinase according to manufacturers suggestions (New England Biolabs). The kinase was inactivated by heating at 65°C.

Oligonucleotide mixtures were 'annealed by heating at* 85°C for 15 minutes and cooled slowly to room temperature. The annealed oligonucleotides were ligated with 10 U T4 ligase, ligated products were separated on a 6% polyacrylamide gel, and the fragments were recovered by electroelution.

6.4. DNA SEQUENCING

The DNA sequence of inserted fragments and

oligonucleotides were determined by the chain termination method of Sanger et al., 1977, Proc. Natl. Acad. Sci.

74:5463, incorporating the modifications of Biggen et al., 1983, Proc. Natl. Acad. Sci. 8CI:3963, Hattori and Sakakai, 1986, Anal. Biochem. 152:232, and Bankier et al., 1988,

Methods Enzymology, in press.

6.5. PROTEIN BLOT ANALYSIS Samples equivalent to 50 μL cell culture were run on 8% NaDodSO₄-polyacrylamide gels under reducing conditions according to Laemlli, 1970, Nature 227:680. Gels were either stained with Coomasie blue or electroblotted onto two layers of nitrocellulose in order to have duplicate blots of the same gel. Prestained molecular weight markers (BRL) were used to monitor transfer. After being blocked with 0.25% gelatin, the blots were incubated with a commercial antibody to β-galactosidase (Promega Biotech). The cross reacting bands were visualized with a phosphatase-linked, affinitypurified, goat anti-mouse IgG antisera (1:7,500 dilution, Promega Biotech) using bromo-chloro-iodoyl phosphate and nitro-blue tetrazolium as recommended by Promega Biotech.

6.6. CELL LYSIS AND TRIHYBRID ASSAY

Cell lysis was performed according to Germino et al., Proc. Natl. Acad. Sci. 1983, 80:6848. E. coli were harvested by centrifugation, and the cell pellets were suspended in one-fifth volume of 0.05 mol/L Tris-HCl pH8, 0.05 mol/L EDTA, 15% sucrose with freshly dissolved lysozyme at 1 mg/ml.

After 15 minutes at room temperature, the lysates were frozen at -70°C, thawed rapidly at 37°C, and sonicated briefly to shear DNA. Trihybrid fusion protein was quantitated by colorimetric assay for β-galactosidase activity using 0- nitrophenyl-β-D-galactopyranoside as substrate.

6.7. COLLAGENASE DIGESTION OF FUSION PROTEIN

Prior to digestion of the fusion protein, non-specific proteolytic activities in the collagenase preparation were reduced by treatment with β-hydroxy-mercuribenzoate according to Lecroisey et al., 1975, FEES Lett. 59:167. One unit of collagenase of Achromobacter iophagus (EC 3.4-24.8;

Boehringer Mannheim) was dissolved in 100 μl of buffer containing 100 mM Tris-HCl, pH 7.4; 250 mM NaCl; 1 mM CaCl₂ ; and 40 μg/ml β-hydroxy-mercuribenzoate. The dissolved collagenase was transferred to a 15 ml siliconized

polypropylene tube and incubated at room temperature for 30 minutes. Thawed cell extract (4 mis) was sonicated briefly to disperse aggregates, added to the pretreated collagenase, and incubated for 45 minutes at room temperature. The majority of the cleaved β-galactosidase was removed by adding 0.5 volumes of saturated ammonium sulfate, incubating on ice for 30 minutes and pelleting the insoluble material. The cleaved recombinant synthetic cysteine-free IL-6 was

concentrated by bringing the total volume of the supernatant to 13 mis with saturated ammonium sulfate, incubating on ice for 30 minutes and centrifuging to compact the insoluble protein into a floating pellicle. Liquid was drained by puncturing the tube and the remaining pellicle was

resuspended in 0.5 ml of Tris buffered saline.

7. EXAMPLE: HEPATOCYTE STIMULATION

Synthetic cysteine-free IL-6, as prepared according to the methods described in §§5.2 to 5.8, stimulates hepatocytes as shown in Figure 11. The hepatocyte stimulating activity . was detected according to the assay described in §5.9.2

supra. The hepatocyte stimulation exhibited by synthetic cysteine-free IL-6 occurs at concentrations of 10 ^-8M,

indicating a specific activity of 104 U/mg protem. This activity is 100 fold different than observed by May et al.,

1988, J. Biol. Chem. 263:7760. The level of fibrinogen synthesis observed in our FAZA cells is similar to the response obtained using crude conditioned medium obtained from PMA induced fibroblasts. At concentrations greater tha

1 μM, the peptide causes a decrease in the number of

hepatocytes resulting in a decrease in the detectable

fibrinogen.

8. EXAMPLE: B-CELL DIFFERENTIATION

The most sensitive method to evaluate the functionality of the synthetic cysteine-free IL-6 protein, as prepared according to the methods described in §§5.2 to 5.8 was the B-cell differentiation assay. A hemolytic plaque assay assessed the ability of the synthetic IL-6 to induce Ig secretion in resting B-cells. The hemolytic assay is

superior for studies of differentiation and proliferation at the cellular level (Gronowicz et al., 1976, Eur. J. Immunol. 6:588). Our protein had a maximal stimulatory concentration of about 0.1 ng/ml (43 p) (see Figure 12). This value is similar to values reported elsewhere for natural IL-6 (Van Snick et al., 1986, Proc. Natl. Acad. Sci. 83:9679;

Brakenhoff et al., 1987, J. Immunol. 139:4116; Poupart et al., 1987, EMBO J. 6:1219; Kishimoto, 1985, Ann. Rev.

Immunol. 3:133). At concentrations above 43 pM, synthetic cysteine-free IL-6 can cause a decrease in the number of differentiated B-cells.

9. EXAMPLE: CYSTEINE-FREE IL-6 RETAINS BIOLOGICAL ACTIVITY Three assays of different activities of the natural IL-6 protein have shown that cysteine-free IL-6 retains biological activity. Our invention has shown that it is the primary sequence of the peptide that is necessary to fold the peptide chain into an active conformation.

Vaccines are often formulated and inoculated in

combination with various adjuvants. The adjuvants aid in attaining a more durable and higher level of immunity using smaller amounts of antigen or fewer doses than if the

immunogen were administered alone. The mechanism of adjuvant action is complex. It may involve the stimulation of

production of cellular cytokines (such as the cytokine IL-6), phagocytosis and other activities of the reticuloendothelial system as well as a delayed release and degradation of the antigen. Examples of adjuvants include Freund's adjuvant (complete or incomplete), Adjuvant 65 (containing peanut oil, mannide monooleate and aluminum monostearate), surface active substances such as lysolecithin, pluronic polyols,

polyanions, peptides, oil emulsions, and mineral gels such as aluminum hydroxide or aluminum phosphate. Freund's adjuvant is no longer used in vaccine formulation for humans because it contains nonmetabolizable mineral oil and is a potential carcinogen.

Purified synthetic IL-6 like peptides of the present invention can be added to vaccine preparations to modulate an immune response, i.e., to act as an adjuvant; this includes vaccine preparations used to immunize animals such as mice, guinea pigs, rabbits, chickens, horses, goats, sheep, cows, chimpanzees as well as other primates, and humans. Methods of introduction of the vaccine with peptides like IL-6 as adjuvant include oral, intradermal, intramuscular,

intraperitoneal, intravenous, subcutaneous, intranasal, or any other route of immunization. The purified IL-6 active peptides can be used as an antigen for host immunization and ultimate production of IL-6 specific monoclonal antibodies. Such antibodies in turn may be used as IL-6 inhibitors and as such may be useful in the treatment of certain conditions in which dysfunction in immunoglobulin production has been implicated. This includes treatment of multiple myeloma, and autoimmune disease. For example, intraarticular injection of these monoclonal antibodies could be employed in treating rheumatoid arthritis.

The purified synthetic IL-6 like peptide of either the cysteine-free form or the form with cysteines is adjusted to an appropriate concentration, formulated with any suitable additions such as other cytokine peptides or vaccines and packaged for use. The peptide with IL-6 activity can also be incorporated into liposomes for use as an adjuvant in vaccine formulations or as a pharmaceutical product by itself. The synthetic peptide with IL-6 activity can also be added to preformed antibodies that are provided for passive

immunotherapy. In an alternative embodiment, the purified peptides with IL-6 activity can be used as an immunostimulant

pharmaceutical product; for example, IL-6 peptides are useful generally for stimulation of hemopoietic stem cells, and specifically for the stimulation of antibody production in disease-caused and drug or radiation-induced

immunodeficiencies. As such, the peptides are useful in the treatment of immunosuppressed AIDS patients. They are also useful for the stimulation of production of hepatic proteins in hepatic dysfunction. The peptide can also be used as a reagent for inducing antibodies in vitro, or to modify the expression of other growth factors in culture. In another embodiment, the purified peptides with IL-6 activity, preferably in combination with other antiviral compounds, can be used for the prevention and/or the treatment of viral diseases, including HIV and HBV. In an alternative

embodiment, the purified peptides with IL-6 activity can be used, alone or in combination with other purified cytokines, to invoke the terminal differentiation of B-cells in

leukemias and other disease states. In another embodiment, the synthetic IL-6 like peptide of either the cysteine-free form or the form containing cysteines can be used to induce antibodies that recognize any portion of the peptide.

10. EXAMPLE: EFFECT OF CYSTEINE-FREE IL-6

AND OTHER GROWTH FACTORS ON PROLIFERATION AND DIFFERENTIATION OF BONE MARROW CELLS IN VIVO (DELTA ASSAY)

Delta assay is designed to determine whether there is renewal of a highly proliferative population (HPP) in bone marrow (BM) stem cells that are stimulated with various growth factors. Mice are treated with 5-fluorouracil (5FU) to remove cells that are of low proliferative potential (LPP).

The HPP cells are incubated in a first semi-solid agarose culture for 12 days in the presence of growth factors. The growth factors used include IL-1, IL-6, and a

1:1 mixture of IL-1 and IL-6. BM stem cells are grown in the presence of each of these growth factors in the absence of other growth factors, and in the presence of granulocyte colony stimulating factor (G-CSF), macrophage colony

stimulating factor (M-CSF), granulocyte macrophage colony stimulating factors (GM-CSF), and IL-3. The number of colonies stimulated by the growth factors is determined by a double-layer agarose clonal assay and exhibited in Figure 16 labelled "Time O CClony Assay" This figure shows the total colony forming units per 2.3 x 10⁵ mouse bone marrow cells 24 hours after mice are treated with 5-FU. The first four bars show the effect of IL-1, IL-6 (cysteine-free), and a 1:1 mixture of IL-1. and IL-6 (cysteine-free) on colony

stimulating activity in the absence of other growth factors.

The next set of four bars represents the effect of G-CSF alone and in combination with IL-1, IL-6 (cysteine-free), an a 1:1 mixture of IL-1 and IL-6 (cysteine-free) on colony stimulating activity. The next three sets of four bars each represent the colony stimulating activity of' M-CSF, GM-CSF, and IL-3 alone and with IL-1, IL-6 (cysteine-free), and a 1: mixture of IL-1 and IL-6 (cysteine-free). The results show that IL-1, IL-6 (cysteine-free), and a combination of IL-1 and IL-6 (cysteine-free) stimulate colony formation when use in combination with M-CSF more than in combination with IL-3,

GM-CSF and G-CSF.

In a separate assay, the HPP cells are incubated with the same growth factors and combination of growth factors in liquid culture. The number of non-adherent cells are counte after 7 days, and the results are illustrated in Figure 15 labelled "Number of Non-Adherent Cells after 7 Days Liquid

Culture." This figure shows the total number of non-adheren cells per ml. Each of the five sets of four bars has the same significance as the corresponding set in the figure labelled "Time O Colony Assay." The largest number of non- adherent cells is observed when a mixture of IL-1 and IL-6 (cysteine-free) are used in combination with IL-3, GM-CSF and M-CSF.

The cells from the liquid culture are washed and again grown in the presence of the growth factors in semi-solid agarose, and subjected to a second double-layer agarose clonal assay. This second agarose clonal assay is referred to as the "readout" assay. A Delta value is calculated by dividing the number of bone marrow colonies in the readout assay by the number of bone marrow colonies in the Time O Clonal Assay. The results are shown in Table 2.

The data from the Delta assay describes which growth factors have synergizing activity in liquid culture when various factors are used in the readout assay. When medium alone is used in the liquid culture, the ability of the added cytokines to facilitate colony formation is IL-1 + IL-6 > IL-1 or IL-6. This preference of IL-1 + IL-6 over the ability of IL-1 or IL-6 to synergize with other growth factors is evident when G-CSF, GM-CSF, M-CSF and IL-3 are used in the liquid culture. The synergy is most evident when G-CSF is used in the readout assay. When GM-CSF and IL-3 are used in the liquid culture in conjunction with IL-6 or IL-1, IL-6 causes a greater Delta value than IL-1. However, when CSF-1 is used in conjunction with IL-1 or IL-6, IL-1 causes a greater synergistic value. The best results in the entire assay were seen when IL-1 + IL-6 were used in conjunction with IL-3 in the liquid assay and G-CSF was used in the readout.

These data suggest that cysteine-free IL-6, when used in conjunction with other growth factors, may be an important tool in bone marrow transplantation and cancer treatment. A high Delta value indicates that a certain combination of growth factors yields both growth and renewal of stem cells. This particular characteristic would be required in a growth factor that would be used to stimulate bone marrow growth and differentiation in vivo.

Protocol for Delta Assay

1) BDF. mice treated with 150 mg/kg 5-fluorouracil (5FU).

2) Kill mice, harvest bone marrow (BM) 24 house after 5FU treatment.

3) Wash BM cells in IMDM medium with 20% fetal bovine serum (FBS) and antibiotic (gentamicin).

4) Grow cells in a double layer agarose clonal assay:

Growth factors in IMDM with 20% FBS are plated in 35mm petri dishes in 0.5% agarose. BM cells are added to an overlayer at a concentration of 2.5 x 10 ⁴ up to 2 x 10⁵ BM cells m .5 ml per plate. This is called the Time O CConal Assay. Grow at 37°C under approximately 7% O₂ for 12 days.

5) BM cells are grown in 1 ml liquid culture (IMDM 20% FB

+ antibiotic) in 24-well cluster plates. Cells are incubate for 7 days starting at 2.5 x 10 ⁵ cells/ml.

6) After 7 days liquid culture, the non-adherent BM cells are collected. The cell numbers are counted, cytospin preparations are made, and the remaining cells are washed over 5ml of cold FBS to remove any growth factors.

7) The cells are then diluted 20-100-fold and plated into the clonal agarose assay. These cultures are grown for 7-12 days at 37ºC, 7% O₂ in a fully humidified atmosphere. This is called the Readout Assay.

8) The Delta value is calculated by dividing the number of BM colonies in the Readout Assay by the number of BM colonies in the Time 0 Clonal Assay.

11. EXAMPLE: COMPARISON WITH OTHER COMMERCIAL

SOURCES OF IL-6 IN 7td.1. ASSAYS

The biological activity of the cysteine-free IL-6 peptide purified from the fusion product induced by cells harboring p367 was compared with cysteine-containing IL-6 from commercial sources using a 7td.l assay (Van Snick et al., Proc. Nat'l. Acad. Sci. USA 83:9679-9683, 1986). Those commercial sources were Boehringer Mannheim (bm) which produced an E. coli derived IL-6; Endogen which was a non- recombinant product; and Genzyme which produced a yeast- derived IL-6. When the cysteine-free synthetic peptide in phosphate buffered saline purified from induced p367

containing cells was compared to Boehringer Mannheim's IL-6, Boehringer's showed higher activity at low concentrations and lower activity at high cdncentrations as shown in Figure 17. The highest maximal activity was reached using the cysteine- free synthetic IL-6.

Comparison of the cysteine-free synthetic IL-6 peptide with Endogen IL-6 revealed that the cysteine-free IL-6 peptide had superior activity over all concentrations

analyzed (0.1 ng to 50 ng) as shown in Figure 16.

Cysteine-free synthetic IL-6 also gave higher

biological activity than Genzyme's IL-6 when concentrations between 0.1 ng and 50 ng were tested as shown in Figure 18.

Description of the 7td.1 Growth Assay

This 3.5 day long assay is performed in 96 well culture plates. Peptides with IL-6 activity are measured in HGF units where 100 HGF units equal approximately 1 PCT-GF unit. Typically 2000 cells of the 7td.1 strain are incubated in highly humidified chambers of 5% CO, in 200 μl of medium containing a dilution of the peptide exhibiting IL-6

activity. After 84 hours, cells are pulsed for 4 hours with the tetrazolium salt 3-(4,5 dimethylthiazol-2-y)-2,5- diphenylformazan bromide (MTT) and the supernatants are then removed following centrifugation at 1000x G for 5 minutes. The formazan crystals ar dissolved with 100 lμ of DMSO and the plates are read at 570 nm wavelength. The optical density is proportional to the number of live cells. Theamount of IL-6 in HGF units is defined as the reciprocal of the dilution required to give 50% of the maximum optical density.

Reagents of the 7td.1 Assay

Diluent medium is RPMI 1640 with 10% fetal calf serum. Supplemented RPMI contains RPMI 1640 with 10% fetal calf serum, 0.1 mM 2-mercaptoethanol and 2x antibiotic solution. The labeling reagent is 5 mg/mL MTT in PBS.

12. DEPOSIT OF MICROORGANISMS

The following plasmids have been deposited with the American Type Culture Collection (ATCC), Rockville, MD on November 29, 1988, and have been assigned the indicated accession numbers:

Plasmid Accession Number

p340 ATCC 40516

p367 ATCC 40517

Prior to December 1, 1989 the following plasmids were deposited with the American Type Culture Collection (ATCC), Rockville, MD and have been assigned the indicated accession numbers: pTrpE/EK/cfIL-6 ATCC 68180

pβgal/EK/cfIL-6 ATCC _________

p478 (cysteine IL6) ______________

p513-13 (mutant 1AB) ______________

p529-61 (mutant 2AB) ______________

p512-24 (mutant 3AB) ______________

p522-2 (mutant 4AB) ______________

p523-11 (mutant 5AB) ______________

P524-8 (mutant 6AB) ______________ p509-11 (mutant 7AB) ________________

P510-34 (mutant 8AB) ________________

p511-3 (mutant 9AB) ________________

The present invention is not to be limited in scope by the plasmids deposited since the deposited embodiments are intended as single illustrations of one aspect of the

invention and any which are functionally equivalent are within the scope of this invention. Indeed, various

modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modification are intended to fall within the scope of the appended claims.

It is also to be understood that all base pair and amino acid residue numbers and sizes given for nucleotides and peptides are approximate and are used for purposes of description.

Name of depository institution: American Type Culture Collection

Address of depository institution: 12301 Parklawn Drive

Rockville, MD 20852 U.S.A.

Date of Deposit Accession Number

November 29, 1988 40517

November 17, 1989 68180

Claims (1)

1. WHAT IS CLAIMED IS:

   1. A recombinant gene comprising a nucleotide sequence which encodes a synthetic trihybrid protein, which trihybrid protein has a first peptide portion, a second peptide portion and a third protein portion, which first peptide portion has IL-6 activity, which second peptide portion comprises a chemically or enzymatically cleavable peptide link between the first peptide portion and the third protein portion, which third protein or portion thereof portion is capable of being expressed by the host cell.

   2. The recombinant gene of claim 1 in which the first peptide portion with IL-6 activity is incapable of forming sulfhydryl bonds.

   3. The recombinant gene of claim 1 or 2 in which the second peptide portion comprises a peptide link which is reactive to a proteolytic enzyme.

   4. The recombinant gene of claim 3 in which the second peptide portion comprises a collagenase sensitive site.

   5. The recombinant gene of claim 3 in which the second peptide portion comprises an enterokinase sensitive site.

   6. The recombinant gene of claim 3 in which the second peptide portion comprises a Factor Xa sensitive site.

   7. The recombinant gene of claim 1 or 2 in which the third protein portion comprises a β-galactosidase sequence or portion thereof.

   8. The recombinant gene of claim 1 or 2 in which the third protein portion comprises a TrpE gene product.

   9. The recombinant gene of claim 1 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a collagenase sensitive site, and the third protein portion comprises a protein with β-galactosidase enzymatic activity.

   10. The recombinant gene of claim 1 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has an enterokinase sensitive site, and the third protein portion comprises a protein which is a TrpE gene product or portion thereof.

   11. The recombinant gene of claim 1 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a Factor Xa sensitive site, and the third protein portion comprises a protein which is a TrpE gene product or portion thereof.

   12. The recombinant gene of claim 1 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has an enterokinase sensitive site, and the third protein portion comprises a β-galactosidase sequence or portion thereof.

   Ϊ3. The recombinant gene of claim 1 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a Factor Xa sensitive site; and the third protein portion comprises a β-galactosidase sequence or portion thereof.

   14. The recombinant gene of any one of claims 9-13 in which the first peptide portion, after cleavage from the second peptide portion, does not retain residual amino acids from the second peptide portion.

   15. The recombinant gene of claim 2 which comprises a

   DNA sequence encoding the IL-6 amino acid sequence depicted in Figure 5.

   16. The recombinant gene of claim 3 which comprises DNA sequence encoding the IL-6 amino acid sequence depicted in Figure 5.

   17. The recombinant gene of claim 4 which comprises a

   DNA sequence encoding the IL-6 amino acid sequence depicted in Figure 5.

   18. The recombinant gene of claim 5 which comprises a DNA sequence encoding the IL-6 amino acid sequence depicted in Figure 5.

   19. A recombinant vector comprising the gene of claim 1.

   20. A recombinant vector comprising the gene of claim 2.

   21. A recombinant vector comprising the gene of claim 3.

   22. A recombinant vector comprising the gene of claim 4.

   23. A recombinant vector comprising the gene of claim 5.

   24. A recombinant vector comprising the gene of claim 6.

   25. A recombinant vector comprising the gene of claim 7.

   26. A recombinant vector comprising the gene of claim 8.

   27. A recombinant vector comprising the gene of claim 9.

   28. A recombinant vector comprising the gene of claim 10.

   29. A recombinant vector comprising the gene of claim 11.

   30. A recombinant vector comprising the gene of claim 12.

   31. A recombinant vector comprising the gene of claim 13.

   32. A recombinant vector comprising the gene of claim 14.

   33. The recombinant vector of any one of claims 19 to 32 which is a plasmid. 34. A plasmid from the group consisting of pTrpE/EK/cfIL-6 ; pβGal/EK/cfIL-6 ; pTrpE/Xa/cfIL-6 ; or pβGal/Xa/cfIL-6.

   35. A unicellular host containing the vector of claim 19.

   36. A unicellular host containing the vector of claim 20.

   37. A unicellular host containing the vector of claim 21.

   38. A unicellular host containing the vector of claim 22.

   39. A unicellular host containing the vector of claim 23.

   40. A unicellular host containing the vector of claim 24.

   41. A unicellular host containing the vector of claim 25.

   42. A unicellular host containing the vector of claim 26.

   43. A unicellular host containing the vector of claim 27.

   44. A unicellular host containing the vector of claim 28. 45. A unicellular host containing the vector of claim 29.

   46. A unicellular host containing the vector of claim 30.

   47. A unicellular host containing the vector of claim 31.

   48. A unicellular host containing the vector of claim 32.

   49. A unicellular host containing the vector of claim 33.

   50. The unicellular host of any one of claims 35-49 which is a prokaryote.

   51. The unicellular host of claim 50 which is a bacterium.

   52. A method for producing a peptide having IL-6 activity which comprises:

   (a) culturing a unicellular host microorganism containing a recombinant gene comprising a nucleotide sequence encoding a synthetic trihybrid protein which has a first peptide portion having IL-6 activity, a second peptide portion which comprises a chemically cleavable peptide link between the first peptide portion and a third protein portion capable of being expressed by the unicellular host, said gene being capable of being replicated, transcribed, and

   translated in the host;

   (b) identifying tripartite proteins produced by the host;

   (c) chemically or enzymatically cleaving, the second peptide portion; and

   (d) recovering the first peptide portion having IL-6 activity.

   53. The method of claim 52 in which the second peptide portion comprises a peptide link which is reactive to a proteolytic enzyme.

   54. The method of claim 53 in which the second peptide portion comprises a collagenase sensitive site.

   55. The method of claim 53 in which the second peptide portion comprises an enterokinase sensitive site.

   56. The method of claim 53 in which the second peptide portion comprises a Factor Xa sensitive site.

   57. The method of claim 53 in which the third protein portion comprises a β-galactosidase sequence or portion thereof.

   58. The- method of claim 53 in which the third protein portion comprises a TrpE gene product.

   59. The method of claim 53 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a collagenase sensitive site, and the third protein portion comprises a protein with β-galactosidase enzymatic activity.

   60. The method of claim 59 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has an enterokinas sensitive site, and the third protein portion comprises a protein which is a TrpE gene product or portion thereof.

   61. The method of claim 59 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a Factor Xa sensitive site, and the third protein portion comprises a protein which is a TrpE gene product or portin thereof.

   62. The method of claim 59 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has an enterokinas sensitive site, and the third protein portion comprises a β- galactosidase sequence or portion thereof.

   63. The method of claim 59 in which the first peptide portion is incapable of forming sulfhydryl bonds; the second peptide portion comprises a peptide which has a Factor Xa sensitive site; and the third protein portion comprises a β- galactosidase sequence or portion thereof.

   64. The method of claim 59 in which the first peptide portion, after cleavage from the second peptide portion, does not retain residual amino acids from the second peptide portion.

   65. The method of any of claims 52-64 in which the trihybrid protein comprises at least about 20% of total protein produced by the host organism.

   66. The method of any one of claims 52-64 in which the host organism is a prokaryote.

   67. The method of claim 66 in which the host organism is a bacterium.

   68. The method of claim 65 wherein the host is a bacterium.

   69. The method of any one of claims 52-64 in which the first peptide portion has no sulfhydryl bonds.

   70. The method of any one of claims 52-64 wherein the first peptide portion comprises the IL-6 amino acid sequence depicted in Figure 5.

   71. The method of claim 70 in which the trihybrid protein comprises at least about 20% of total protein

   produced by the host organism.

   72. A recombinant plasmid having accession number ATCC 40516 (p340).

   73. A recombinant plasmid having accession number ATCC 40517 (p367).

   74. A substantially pure recombinant protein

   comprising a first peptide portion having IL-6 activity, a second peptide portion comprising a cleavable peptide, and a third protein portion capable of being expressed by a chosen host organism.

   75. A recombinant protein encoded by the gene of claim 1.

   76. A recombinant protein encoded by the gene of claim 2.

   77. A recombinant protein encoded by the gene of claim 3.

   78. A recombinant protein encoded by the gene of claim 4.

   79. A recombinant protein encoded by the gene of claim 5.

   80. A recombinant protein encoded by the gene of claim 6.

   81. A recombinant protein encoded by the gene of claim 7.

   82. A recombinant protein encoded by the gene of claim 8.

   83. A recombinant protein encoded by the gene of claim 9.

   84. A recombinant protein encoded by the gene of claim 10.

   85. A recombinant protein encoded by the gene of claim 11.

   86. A recombinant protein encoded by the gene of claim 12.

   87. A recombinant protein encoded by the gene of claim 13.

   88. A recombinant protein encoded by the gene of claim 14.

   89. A recombinant protein having the IL-6 and collagen amino acid sequence depicted in Figure 8b.

   90. A recombinant protein having IL-6 activity, which is the product of chemical or enzymatic cleavage of the protein of any one of claims 75-88.

   91. A recombinant protein having IL-6 activity, which contains no cysteines, which is the product of chemical or enzymatic cleavage of the protein of any one of claims 75-78, and which retains no residual amino acids derived from the second peptide portion after cleavage.

   92. A synthetic peptide having IL-6 activity, and which is substantially soluble in water.

   93. The peptide of claim 59 which is incapable of forming a sulfhydryl bond.

   94. A synthetic peptide comprising the IL-6 amino acid sequence of Figure 5, which sequence contains no cysteines; or any homologue, analogue or active portion thereof.

   95. A synthetic peptide having the IL-6 aminoacid sequence of Figure 5, which sequence contains no cysteine, wherein the amino acids of the collagen linker are partially or entirely deleted.

   96. A synthetic peptide having the IL-6 amino acid sequence of Figure 5, which sequence contains no cysteine, wherein all the amino acids of the collagen linker and the serine residue bridging the collagen to the IL-6 protein are deleted.

   97. A synthetic peptide according to any of claims 94 to 96 containing proline instead of glycine as the second amino acid of the N-terminal sequence.

   98. A synthetic peptide according to any one of claims 94 to 97 lacking the initial methionine at the N-terminal sequence.

   99. A synthetic peptide which is a derivative of a peptide according to any one of claims 94 to 98 by way of amino acid deletion, substitution, insertion, inversion, addition or replacement.

   100. A synthetic peptide comprising the portion of the amino acid sequence of native IL-6 from amino acid 29 to amino acid 212, which sequence does contain cysteins,

   wherein, however, the amino acid 29 is glycine instead of proline.

   101. A synthetic peptide according to claim 100 having an initial methionine residue.

   102. A recombinant gene comprising a nucleotide

   sequence which encodes the synthetic peptide of claim 92 to 101.

   103. A vector comprising the recombinant gene of claim 102.

   104. A unicellular host comprising the recombinant gene of claim 102.

   105. A unicellular host comprising the vector of claim 103.

   106. A method of stimulating antibody production in a host which comprises administering to said host an effective amount of the peptide of any one of claims 90 to 101 in. combination with the effective antigen.

   107. A method of preventing or treating viral infection in a host which comprises administering to said host an effective amount of the peptide of any one of claims 90 to 101.

   108. A method for stimulating production of hepatic proteins in a host which comprises administering to the host an effective amount of the peptide of any one of claims 90 to 101.

   109. A method for stimulating terminal B cell

   differentiation in a host comprising administering to the host an effective amount of the peptide of any one of claims 90 to 101.

   110. A method for stimulating hematopoietic stem cells in a host which comprises administering to the host an effective amount of the peptide of any one of claims 90 to 101.

   111. A method of treating an immunosuppressed host which comprises administering to the host an effective amount of the peptide of any one of claims 90 to 101.

   112. A method of treting a disease condition involving a dysfunction in immunoglobulin production which comprises administering to the host an effective amount of a monoclonal antibody reactive with the peptide of any one of claims 90 to 101.

   113. A pharmaceutical formulation comprising an effective amount of the peptide of any one of claims 90 to 101 in combination with a pharmaceutically acceptable

   carrier.

   114. The formulation of claim 113 wherein the peptide is combined with at least one other cytokine or hematopoietic growth factor.

   115. A formulation according to claim 114 wherein the cytokine or hemopoietic growth factor is chosen from

   erythropoietin, an interleukin and a colony stimulating factor.

   116. A formulation according to claim 114 wherein the interleukin is IL-1, IL-2 or IL-3 and the colony stimulating factor is G-CSF, GM-CSF or M-CSF.

   117. A synthetic peptide according to any of claims 90 to 101 for therapeutic use in simultaneous or serial coadministration with a cytokine or homopoietic growth factor as defined in claim 114 to 116.

   118. The formulation of claim 113 wherein the peptide is present as an adjuvant, in combination with an effective amount of a protective antigen.

   119. A recombinant nucleic acid vector comprising a nucleic acid sequence encoding a first portion which is an inducible promoter, a second portion which is a minicistron sequence, a third portion which is a cloning site for

   insertion of a DNA fragment comprising a protein that lacks a termination codon, a fourth portion which is a nucleotide sequence for a cleavable peptide, and a fifth portion which is a nucleotide sequence for ß-galactosidase which is in frame with the cleavable peptide of the fourth portion; and in which the nucleic acid sequence the third portion cloning site is out of a translational reading phase with the β- galactosidase fifth portion.

   120. The vector of claim 119 which comprises the NDA sequence depicted in Figure 8b.

   121. A recombinant gene according to any one of claims

   1 to 14 which comprises a DNA sequence encloding a peptide according to any of claims 92 to 101.

   122. A recombinant vector comprising a gene according to claim 121.

   123. A unicellular host containing the vector of claim 122.

   124. A recombinant vector comprising the p340 plasmid.

   125. A recombinant vector comprising the mutant 1AB

   DNA sequence

   126. A peptide produced by the vector of claim 125.

   127. A DNA sequence encoding a peptide having IL-6 activity, the peptide having the sequence defined by mutant 1AB.

   128. The peptide encoded by the DNA sequence of claim

   127.

   129. A peptide having IL-6 activity, the peptide having the sequence of native IL-6, with amino acid residues 4-23 inclusive deleted.

   130. A DNA sequence encoding the peptide of claim 129.