AU3494500A - Methods for substrate-ligand interaction screening - Google Patents

Description

WO 00/49417 PCTIUSOO/04089 1 METHODS FOR SUBSTRATE-LIGAND INTERACTION SCREENING 2 3 4 RELATED APPLICATIONS 5 6 This application is a continuation in part of US application serial nos. 09/251,364 and 7 09/350419 of K. A. Kamb, entitled "Methods For Substrate-Ligand Interaction Screening," 8 and claims priority therefrom. The disclosures of the priority applications are incorporated 9 by reference in their entirety herein. 10 FIELD OF THE INVENTION 11 The present invention relates generally to novel methods of screening for, detecting, 12 identifying and quantifying substrate-ligand interactions, and more specifically relates to 13 novel methods for achieving these ends for protein-ligand interactions, and more specifically 14 protein-protein interactions. The inventive method is suitable for screening large or very 15 large libraries, and for generating protein interaction maps. 16 BACKGROUND OF THE INVENTION 17 18 Many physiological functions in mammals and other organisms are mediated through 19 interactions of cellular proteins with a variety of endogenous ligands, including for example 20 other proteins, glycoproteins, polypeptides, hormones or other small molecules. Because of 21 the importance of these endogenous protein-ligand interactions, pharmaceutical companies 22 often seek to modify or disrupt physiological pathways by providing exogenous molecules 23 that interact with those endogenous proteins. In some cases, researchers may target 24 particular, previously characterized proteins, and screen for molecules that interact with that 25 protein. But in the vast majority of cases, researchers lack the initial insight into a given 26 physiological pathway, and must first identify the native proteins involved in that pathway 27 before achieving the ability to modify the physiological effects of that pathway. 28 While much is now known about the genome of humans and other organisms, 29 researchers have yet to close the link in many instances between DNA sequence information 30 and physiological function. In order to do so efficiently, it is desirable to first identify key 31 native proteins that are related to specific physiological functions, and then to relate those 32 proteins to the DNA sequences encoding them. Once such key proteins are identified, then 33 researchers may identify ligands (proteinaceous or otherwise) that interact with these 34 proteins, and in turn relate these targeted protein-ligand interactions to physiological changes. 35 But to date, the methods used in the art for evaluating protein-ligand interactions have not WO 00/49417 PCT/USOO/04089 1 provided a simple, efficient method of identifying the key native proteins (and screening for 2 ligands that interact with them). Nor has the art provided an efficient high-throughput 3 screening method that allows researchers to broadly catalogue, e.g., all endogenous protein 4 protein interactions, before turning to the related questions of physiological function and 5 targeted drug development. 6 Researchers are particularly hampered in their ability to comprehensively catalogue 7 endogenous protein-protein interactions in a human or other organism by the sheer magnitude 8 of endogenous proteins that must be evaluated. For example, some 105 - 106 proteins are 9 believed to be encoded by the human genome. To begin by evaluating the interaction of each 10 of those proteins with each other encoded protein thus requires evaluating 106 x 106 protein 1I protein interactions, or 1012 total interactions. Such a large-scale evaluation is problematic, 12 because it involves evaluating a matrix of all possible combinations; thus the number of 13 interactions scales as the square of the number of proteins to be evaluated (termed more 14 generally herein, the "n x n" problem). Current methodologies simply cannot evaluate such 15 vast numbers of protein interactions in a time- and cost-efficient manner. The inability of 16 current methodologies to provide rapid, quantitative high-throughput screening is particularly 17 acute if comparative information regarding protein interactions in different cell types or cell 18 states is desired. 19 The limitations of current methodologies can be seen by considering current 20 technologies for mapping protein interactions. For example, one typical approach to probing 21 protein-ligand interactions involves an in vivo, quasi-genetic approach known as the yeast 22 two-hybrid assay. This approach suffers from the drawbacks of (i) limitation to probing 23 protein-protein interactions, (ii) lack of speed, (iii) prevalence of false-positive and false 24 negative results, (iv) lack of quantitative information (e.g., binding affinities between specific 25 protein pairs). These drawbacks remain a substantial obstacle to utilizing yeast two-hybrid 26 technology to screen for interactions, notwithstanding recent advances in, e.g., automation of 27 the two-hybrid technology. 28 Phage display techniques have been used to select proteins that bind to a particular, 29 pre-selected ligand. Such methodologies again are essentially in vivo, as the proteins that are 30 borne by the phages are isolated and identified only after the intermediate steps of culturing 31 the phage in E. coli, plating the bacteria and isolating phage from phage-generated plaques or 32 cultures. These intermediate steps are necessary because the phage must be generated in cells 33 and cannot be created without cells. In addition, phage must be bound, eluted, and re-grown 2 WO 00/49417 PCT/USOO/04089 1 in cells prior to analysis. Thus, the technique is not well suited to screening applications such 2 as generating protein interaction maps. Nor is the technique amenable to high throughput 3 applications. Moreover, the technique does not provide quantitative information. 4 Alternatively, researchers have utilized limited-throughput screening techniques to 5 evaluate the binding of ligands to a particular substrate. For example, a selected 6 proteinaceous substrate, or small number of such substrates, have been immobilized by a 7 variety of means for exposure to a select pool of ligands. E.g., U.S. No. 5,635,182; US No. 8 5,776,696; US No. 5,498,530; Major, E.S., "Challenges of high throughput screening against 9 - cell surface receptors,"-J. Recept. Signal Transduct. Res. 15(1-4):595-607 (1995). But such io methodologies are not amenable to screening, e.g., large or very large populations, for 11 generating protein interaction maps, and/or for screening previously uncharacterized 12 substrates -- i.e., the techniques do not adequately address the "n x n" problem generated by 13 large-scale screening efforts. 14 More generally, other researchers have utilized various solid-state screening 15 techniques to evaluate interactions of different moieties. For example, assays exist that 16 immobilize known antigens or antibodies on beads or other such solid supports. E.g., Roque 17 et al., Acta Histochem. 98(4):441-451 (Nov. 1996). Two or three-dimensional matrices 18 tagged with nucleic acids have been utilized to screen for DNA-binding moieties. Other 19 researchers have utilized "lawn assays" that detect protein interactions utilizing diffusion of a 20 ligand through a colloidal matrix. However, none of these techniques addresses the "n x n" 21 problem, and thus none provides rapid, quantitative and/or large-scale evaluation of 22 substrate-ligand interaction, or more specifically, protein-protein interactions. 23 Thus, the need remains for a flexible, efficient, quantitative methodology for 24 evaluating substrate-ligand interactions generally, and protein-protein interactions in 25 particular. The present invention meets such needs. 26 SUMMARY OF THE INVENTION 27 The present invention provides methods for detecting substrate-ligand interactions, 28 more particularly polypeptide-ligand interactions or polypeptide-polypeptide interactions. 29 The polypeptides may be individual polypeptides, or may alternatively be library 30 polypeptides, including those of large or very large libraries and/or of native, endogenous 31 polypeptides. The methods utilize randomizable ligand-bearing supports bearing unique tags, 32 and may optionally use location-determinable supports. In some embodiments, a magnetic 33 support may be used to adhere to either the substrate or the ligand, and magnetic culling of 3 WO 00/49417 PCT/USOO/04089 I bead aggregates that result from substrate-ligand complexes provides for an enrichment step. 2 Interacting pairs are identified by correlating (i) location information and (ii) identity 3 information provided by each unique tag. The location information may be derived from 4 correlating back to a unique location, or alternatively by evaluating the origination of 5 location-determinable supports. The unique tags may use a variety of techniques, including 6 fluorescent bar codes, to encode ligand identity information. By such methods, protein 7 interaction maps for, e.g., the human organism, may be generated. 8 The invention further provides methods for identifying and quantifying such 9 ~interactions. In some embodiments, the interacting substrate-ligand pairs may be detected 10 with antibodies, for example fluorescent antibodies, and the interactions quantified via a II FACS machine or CCD camera. 12 BRIEF DESCRIPTION OF THE DRAWINGS 13 14 FIGURE 1 is a map of plasmid vector pSE420/trx/GFP. 15 FIGURE 2 is a map of plasmid vector pSE420/biotrx/GFP/BirA. 16 FIGURE 3 is a map of plasmid vector pSE420/Caltrx/GFP. 17 FIGURE 4 is a map of plasmid vector pSE420/DHFR/GFP. 18 FIGURE 5 is a map of plasmid vector pLex biotrx GFP LbirA. 19 FIGURE 6 depicts a bead that has been derivatized for crosslinking with a 20 methotrexate as an adhesion moiety and SANPAH as a photoactivatable crosslinker. 21 FIGURE 7 is a FACS histogram demonstrating the crosslinking of interacting 22 proteins. Peak A is streptavidin coated particles reacted with BL21 lysate and FITC 23 calmodulin conjugate. Peak B is streptavidin coated particles reacted with a lysate having a 24 biotin-thioredoxin-CBP fusion protein, which is then exposed to the FITC-calmodulin 25 conjugate in the presence of calcium chelator EGTA. Peak C is streptavidin coated particles 26 reacted with a lysate having a biotin-thioredoxin-CBP fusion protein, which is then exposed 27 to a FITC-calmodulin conjugate. Peak D is streptavidin coated particles reacted with a lysate 28 having a biotin-thioredoxin-CBP fusion protein, FITC-calmodulin conjugate and a protein 29 crosslinking agent. Peak E is streptavidin coated particles reacted with a lysate having a 30 biotin-thioredoxin-CBP fusion protein, FITC-calmodulin conjugate, protein crosslinking 31 agent and then EGTA. 32 FIGURE 8 depicts the enrichment of biotin-coated fluorescent beads from a mixture 33 of fluorescent beads coated only with Bovine Serum Albumin (BSA), using streptavidin 4 WO 00/49417 PCT/USOO/04089 1 coated magnetic beads. The streptavidin and the biotin interact, and subsequently the 2 aggregates are segregated from the BSA-coated beads with a magnet. 3 FIGURE 9 depicts the enrichment of beads coated with an SV40 large T antigen 4 conjugate from a mixture of fluorescent beads coated only with BSA, using magnetic beads 5 coated with an anti-SV40 large T antigen antibody conjugate. The antigen and antibody 6 interact, and subsequently the aggregates are segregated from the BSA-coated beads with a 7 magnet. 8 9 DETAILED DESCRIPTION OF THE INVENTION 10 The methodologies of this invention provide rapid, efficient, quantitative substrate 11 ligand interaction screens. The invention differs from prior approaches in that it does not rely 12 on yeast-two hybrid technology or other such in vivo techniques, but instead provides a high 13 throughput in vitro screening methodology. While the inventive methods do provide rapid, 14 quantitative screening of individual polypeptides or other substrates against a selected ligand 15 pool, the techniques provide for scale-up for screening small (on the order of 1 x 102) 16 substrate populations, and advantageously may be used to screen large (on the order of 103 or 17 104) or even very large (105, 106 or even 107) populations. This is so because the inventive 18 use of both location information and unique tags to identify substrate-ligand pairs renders the 19 technique suitable for screening previously uncharacterized polypeptides or other substrates 20 en masse, rather than relying upon the pre-selection of a known substrate or small number of 21 substrates and thereby screening in a "lxn" manner rather than an "n x n" manner. 22 More specifically, the invention provides its quantitative, high throughput 23 polypeptide/ligand screening capabilities by cross-indexing (i) polypeptide (or other 24 substrate) identity information derived from the characteristic, unique location from which 25 one particular polypeptide (or other substrate) is derived, and (ii) ligand identity information 26 derived from its associated randomizable support, which bears a unique tag that correlates to 27 the identity of that ligand. The polypeptide may be an individual polypeptide, or alternatively 28 may be a member of a polypeptide library of various sizes. Non-polypeptide substrates may 29 include, e.g., small organic or inorganic molecules, of either endogenous or synthetic origin. 30 In some embodiments, a unique polypeptide or other such substrate may be adhered to 31 a location-determinable support, which correlates to the unique location from which a 32 particular library polypeptide is derived, prior to exposure to the ligands. In other 33 embodiments the unique polypeptide or substrate remains in a lysate or other such solution, 5 WO 00/49417 PCT/USOO/04089 1 to which the randomizable ligand-bearing supports are added. The supports described herein 2 may be microbeads, or may be a fixed solid support. The unique tag that identifies a 3 particular ligand may be, for example, a fluorescent "bar code" or oligonucleotide tag. 4 The invention encompasses a number of potential substrates, including (i) non-nucleic 5 acid, proteinaceous substrates such as individual polypeptides and library polypeptides, (ii) 6 other non-nucleic acid substrates such as exogenous natural products, exogenous small 7 organic molecules or endogenous non-proteinaceous products, (iii) nucleic acid substrates, 8 and (iv) inorganic substrates. The term "individual polypeptide" refers to an amino acid 9 sequence, for example-a protein or protein domain, and also includes further derivatized 10 amino acid sequences, such as, e.g., glycoproteins. The sequence may be that of a native 11 molecule (i.e., endogenous to a given cell), or alternatively may be synthetic. Individual 12 polypeptides are typically identified and characterized in advance of the ligand screening, and 13 are not generated or screened en masse. Library polypeptides encompass the same sorts of 14 amino acid sequences, but are encoded by DNA sequences that are generated and screened en 15 masse, and may be previously unknown or uncharacterized molecules. The libraries may 16 vary in size, and include large or very large libraries. In particular, the library polypeptides 17 may include all or substantially all native protein domains encoded by the human genome, or 18 expressed in the human organism. As termed herein, "ligands" are molecules that are 19 screened to identify those members that interact with the polypeptides or other substrates. 20 Ligands may be proteinaceous moieties such as, e.g., polypeptides or glycoproteins from a 21 variety of sources, or may be other organic or inorganic molecules. The ligands may be 22 endogenous molecules such as hormones, antibodies, receptors, peptides, enzymes, growth 23 factors or cellular adhesion molecules, or may be derivatized or wholly synthetic molecules. 24 Because of the flexibility of the invention, the identity of the ligands need not be known or 25 pre-selected in advance, and may also be large or very large populations. 26 The present invention lends itself to automated high-throughput embodiments, in 27 which microbeads serve as the location-determinable and/or randomizable supports. Such 28 microbeads may be readily dispersed by robotic means to, e.g., 384-well microtiter plates. 29 The polypeptides or other such substrates interact with ligands to form interacting pairs, 30 termed "complexes" herein. When each member of the interacting pair are immobilized on 31 supports, then the two supports are linked via the substrate/ligand complex to form an 32 "aggregate." The aggregates and/or complexes are then sorted and identified. Means for 33 accomplishing this include a CCD camera or a fluorescence-activated cell sorter faces) . 6 WO 00/49417 PCT/USOO/04089 I The speed and selectivity of this inventive methodology may be further enhanced by 2 utilizing magnetic attraction to facilitate a solid-state interaction between the polypeptide or 3 other substrate that is bound to a location-determinable support, and the ligand that is bound 4 to the randomizable support. This may be accomplished by utilizing a magnetic material for 5 the support, and then collecting the complexes or aggregates by culling the magnetic supports 6 with a magnetic force, for example by applying a magnetic field to the exterior of the arrays 7 or by inserting a magnetized body such as a pin into each well of the array. 8 Because the methodologies of the present invention are so rapid and efficient, 9 -screening is not limited to small, pre-characterized or artificially culled substrate populations, 10 nor does the invention require pre-selection of known ligands of interest. Rather, the I 1 invention allows for high throughput cross-screening of large or very large populations - 12 e.g., the entire endogenous protein library of a human organism. Indeed, the methodologies 13 of this invention are particularly well-suited for large-scale screening of some 1 x 106 14 proteins, which is the estimated number of proteins produced in a human being. Thus, the 15 inventive methods and materials answer a long-felt need in the industry for evaluating the 16 interactions of endogenous proteins within a human organism, to form a comprehensive 17 human "protein interaction map." Alternatively, the inventive methodology may be used to 18 screen the selected library polypeptides against other ligand libraries -- for example, 19 endogenous ligand libraries such as a second polypeptide library, endogenous hormones, 20 antibodies, receptors, peptides, enzymes, growth factors or cellular adhesion molecules, or on 21 the other hand exogenous ligands derivatized or wholly synthetic molecules, natural products, 22 synthetic peptides, or synthetic organic or inorganic molecules. 23 Other uses and advantages of this screening methodology will be apparent to those of 24 skill in the art. 25 Overview of the methodology 26 The general strategy of the methodology is exemplified as follows. A substrate pool 27 of interest is selected - for example, a library of all or substantially all native polypeptides 28 expressed by the human organism, or a selection of individual polypeptides of interest. A 29 corresponding set of library polypeptides or individual polypeptides are generated in cells. 30 Single colonies, each of which is expressing one particular polypeptide of interest, are 31 selected and replated in order to generate single-cell clones (i.e., multiple copies of one 32 particular cell, each cell expressing the same individual polypeptide or unique member of the 33 polypeptide library). Each such clone is uniquely located at one particular location of an 7 WO 00/49417 PCT/USOO/04089 I array -- e.g., each particular well of a given 384 well plate contains a one particular clone. 2 The expression products of each of those clones are then harvested from the cells, for 3 example by generating soluble lysates that correspond to each of the plated clones. Thus, 4 each well corresponds to the soluble lysate of one particular clone, which in turn corresponds 5 to one individual polypeptide or one unique member of a polypeptide library. Alternatively, 6 each member of a non-proteinaceous substrate pool of interest is individually arrayed at a 7 unique location. 8 In the case of proteinaceous substrates, the expression product of each lysate is then 9 -either (i) kept segregated in a -unique location (e.g., one particular well of a 384 well array); 10 or (ii) exposed to a solid support that is unique to that lysate source, and whose location may 11 be tracked in order to identify the corresponding lysate source to which it was exposed. Such 12 a solid support is termed herein, a "location-determinable support." This location 13 determinable support may be any solid support that is suitable for adhering a desired 14 polypeptide from a polypeptide-containing lysate, and which can be correlated back to a 15 particular polypeptide source -- e.g., a particular microtiter well in a particular array. 16 Exemplary location-determinable supports include (i) beads that are kept segregated in 17 microtiter wells that are derived from, and thus correspond to, the original lysate-bearing 18 array location; and (ii) a fixed solid support such as a pin or other such probe that is suitable 19 for dipping into one unique location in a lysate-bearing microtiter well. The same strategy 20 may be applied to non-proteinaceous substrates. 21 The ligands to be screened may advantageously may be immobilized on a solid 22 support, although in order to screen a large variety of ligands for interaction with any 23 particular substrate, such solid supports should be "randomizable" -- i.e., in terms of this 24 invention, (i) each such support can be dispersed into a mixture of such supports in a manner 25 that allows for full mixing and resultant random distribution of support constructs in any 26 subsequent aliquot of the mixture, and (ii) each such randomizable support bears with it a 27 corresponding unique identification tag that identifies the associated ligand. Use of such 28 randomizable supports to create a fully integrated set of ligand-bearing supports increases the 29 statistical likelihood that an aliquot taken from the fully integrated ligand set will contain a 30 fully dispersed, representative subset of ligands. Examples of such randomizable supports 31 include microparticles (e.g., small beads) in a variety of materials and sizes. The unique tags 32 may be, for example, fluorescent, oligonucleotide sequence tags, mass tags, radio tags, or any 33 combination thereof. 8 WO 00/49417 PCT/USOO/04089 I As one exemplary use of the invention, a polypeptide library may be screened against 2 itself to generate a "protein interaction map" -- i.e., an "n x n" matrix of interactions for all or 3 substantially all native polypeptides of a human or other selected organism. By "native 4 polypeptides" is meant polypeptides that are endogenous to a selected organism -- i.e., that 5 are encoded by the organism's genome and which may be expressed by that organism. Native 6 polypeptides include functional subunits or "protein domains" of endogenous proteins. In 7 such embodiments, the polypeptides of interest serve as both substrate and ligand - i.e., each 8 randomizable support is adhered to multiple copies of one member of the polypeptide library, 9 - and each unique array location contains_ multiple copies of one member of the polypeptide 10 library. Once each randomizable support bears its corresponding unique library polypeptide, 11 the supports are pooled into one volume and mixed to form a fully integrated ligand 12 collection -- i.e., the pooled volume represents all ligand species. Next, ligand aliquots are 13 drawn from this fully integrated ligand collection. Each aliquot contains a randomized, 14 representative sampling of the ligands that is statistically likely to contain at least one copy of 15 each species of ligand present in the pooled ligand volume. These ligand aliquots then are 16 presented for interaction with each of the library polypeptides, either by simply adding an 17 aliquot of integrated ligand-bearing supports to each uniquely located library polypeptide 18 lysate within the library array, or by first adhering the library polypeptides in the array to 19 location-determinable supports and then exposing each such set of polypeptide-bearing 20 supports (which bear only one type of polypeptide) to an integrated aliquot of randomizable 21 supports. 22 In another exemplary use a first set of library polypeptides may be screened against a 23 second, independent polypeptide library, composed of, e.g., a separate set of native protein 24 domains, a set of synthetic polypeptides containing, e.g., point mutations, or randomly 25 generated synthetic polypeptide sequences. In such embodiments, the same methodology is 26 applied, but a second, independent expression library is used to generate a second, 27 independent array containing the second, independent polypeptide library. 28 In another exemplary use, a first set of polypeptides may be screened against some 29 other ligand set -- e.g., small organic molecules, natural products, hormones, receptors, 30 antibodies, peptides, enzymes, growth factors, cellular adhesion molecules, combinatorial 31 library components and the like -- that is adhered to the randomizable support and presented 32 to the library polypeptides. In many such instances, a prior cellular expression step to 33 produce the ligands will not be necessary. 9 WO 00/49417 PCTIUSOO/04089 I Whatever the source of the ligands that are adhered to the randomizable supports, the 2 methodology is completed by exposing each uniquely located substrate (either in solution or 3 adhered to its analogous location-determinable support) to an aliquot of ligand-bearing 4 supports. If the ligand bearing support is exposed directly to a substrate, e.g., to a lysate or 5 other such polypeptide-bearing solution, then any interactions will result in formation of a 6 substrate-ligand complex -- e.g., a randomizable support with consecutive layers of adhered 7 ligand and polypeptide. If the substrate is first immobilized on its own support, then any 8 substrate-ligand interaction will adhere the two supports into an aggregate. Such aggregates 9 -may be detected and characterized in that form. Alternatively, the aggregates may be re 10 suspended in a corresponding unique library polypeptide solution to displace the support 11 linked polypeptide with an unbound form of that polypeptide, or removed by some other 12 procedure. 13 Interactions between substrates and ligands are then detected by fluorescent or other 14 means, for example by use of a fluorescently tagged antibody. Interacting pairs are then 15 culled out in a sorting or detection process, for example via FACS, so that the components of 16 the various complexes may be identified. The identity of the substrate is determined by 17 correlating it to the unique array location from which it was derived (either directly, or via the 18 analogous location-determinable support). If the substrate is proteinaceous, then the DNA 19 encoding the polypeptide produced by the original single-cell clone at that unique location of 20 the library array may then be sequenced or otherwise characterized. The identity of the 21 ligand is determined by evaluating the associated unique identification tag on the 22 randomizable support to which that ligand is bound. If the ligands are also polypeptides that 23 have been uniquely arrayed, the unique identification tag can be further correlated back to a 24 single clone in its corresponding array location. 25 The screening methods of the present invention can be adapted in a number of ways 26 apparent to those of skill in the art to displacement screening. In one non-limiting 27 embodiment, the substrate-ligand pairs are first formed, and are adhered to a solid support. 28 Subsequently, these pairs are exposed to a secondary ligand. If the secondary ligand is 29 capable of adhering to the substrate, then in many cases it will displace the first ligand. The 30 substrate-secondary ligand pair can then be manipulate, enriched and analyzed according to 31 the method of the invention. The secondary ligand may be a proteinaceous moiety such as, 32 e.g., a polypeptide or glycoprotein from a variety of sources, or may be some other organic or 33 inorganic molecule. The secondary ligand also may be an endogenous molecule such as a 10 WO 00/49417 PCT/USOO/04089 1 hormone, antibody, receptor, peptide, enzyme, growth factor or cellular adhesion molecule, 2 or may be a derivatized or wholly synthetic molecule. In particularly preferred embodiments 3 of displacement screening, the secondary ligand is a small organic molecule. 4 5 Generation and expression of polypeptide fusion libraries 6 If the substrate of interest is proteinaceous, then an expression library may be 7 generated first. The overall goal of this step is to generate a selection of desired individual 8 polypeptides or library polypeptides that are suitable as either substrate or ligand (or both), 9 -for rapid, efficient ligand interaction screening. Once a desired pool of polypeptides is 10 identified, DNA encoding each member polypeptide is incorporated into a corresponding 11 expression construct that produces the desired levels of protein expression. If it is desired to 12 adhere the polypeptides to a support (e.g., to a bead acting as either a location-determinable 13 support or as a randomizable support), then the DNA encoding each member polypeptide is 14 fused in frame with DNA encoding a suitable adhesion partner to form a 15 polypeptide/adhesion moiety fusion construct, described elsewhere herein. Optionally, as 16 described in more detail below, the construct may also utilize a downstream marker that 17 provides rapid indication of whether the fusion construct is in fact expressed in frame, and 18 with no premature terminations, and/or in a stable, suitably folded conformation. 19 In the case of screening the native cellular proteins of an organism, an expression 20 library is created by standard techniques, generating a sufficient number of fragments of 21 DNA so as to ensure that all protein domains are likely to be expressed in the library. 22 Sambrook, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor 23 Laboratory Press (1989), Chapters 7-9. Genomic DNA, cDNA synthetic or cloned DNA 24 sequences may be used. As one non-limiting example, synthesis of cDNA and cloning are 25 accomplished by preparing double-stranded DNA from random primed mRNA isolated from, 26 e.g., human placental tissue. Alternatively, randomly sheared genomic DNA fragments may 27 be utilized. In either case, the fragments are treated with enzymes to repair the ends and are 28 ligated into an expression vector suitable for expression in, e.g., E. coli cells. Exemplary 29 vectors include inducible systems, e.g., the trc promoter system, which is induced by addition 30 of suitable amounts of IPTG. 31 If a subcloning strategy is to be employed, the library polypeptide-encoding vectors 32 may be introduced into E. coli and clones are selected. Before proceeding with the inventive 33 method, the quality of the selected library optionally may be examined. For example, a set of 11 WO 00/49417 PCT/USOO/04089 1 100 clones can be picked and sequenced at random, looking for homologies to known genes, 2 evidence of splicing, and such features. Alternatively, the library representation can be 3 explored by filter hybridization using probes of sequences of known abundance such as actin 4 and tubulin. These sequences should be present at a frequency in the library of between 5 0.01% and 1.0%. 6 Once a satisfactory polypeptide-encoding library (or, alternatively, DNA encoding a 7 desired set of individual polypeptides) is obtained, DNA encoding a suitable adhesion moiety 8 may be incorporated in frame with the polypeptide encoding DNA sequences. This DNA 9 - fusion construct is then placed under control of a selected promoter in an expression vector 10 construct, so that upon induction one obtains suitably high levels of expression of the fusion 11 construct. There are many suitable adhesion moieties known to the art, including without 12 limitation biotin/avidin, thioredoxin/PAO, calmodulin binding peptide/calmodulin, 13 dihydrofolate reductase/methotrexate, maltose-binding protein/amylose, chitin-binding 14 domain/chitin, cellulose-binding domain/cellulose, glutathione-S-transferase/glutathione, or 15 antibody/antibody epitopes such as the FLAG epitope. One of ordinary skill may choose an 16 adhesion moiety that binds either reversibly or irreversibly to its complementary moiety. One 17 factor to consider in selecting an adhesion moiety complex is the relative spontaneous 18 dissociation constants (KD) of the complexes. For example, the biotin/avidin link has a KD Of 19 approximately 10- 15 M and is therefore relatively stable and irreversible. Maltose binding 20 protein/amylase, on the other hand, is less stable, with a KD of 10-6 M. One option to increase 21 stability is to use cross-linking, for example by selecting a fusion protein with an adhesion 22 moiety that can be cross-linked by UV light. 23 The expression vector is chosen based largely on its ability to generate moderate to 24 high expression levels of either a given polypeptide or a fused polypeptide/adhesion moiety 25 (termed herein, a "fusion construct"), in a host cell of interest. E. coli is one such host cell, 26 although those of skill will appreciate that other bacterial, yeast or mammalian host cells, for 27 example 293 cells, are also suitable for use in the present invention. In the case of E. coli, 28 many suitable expression vectors are known to those in the art. For example, the expression 29 vector may employ the PL, PR, Piac, Ptac, Ptrc, Ptrx or T7 promoters, to name only a few such 30 promoters known to those in the art. These promoters are regulated such that high level 31 expression is induced via increased growth temperature (from PL or PR through a mutant 32 temperature-sensitive form of the lambda repressor, c1857) or by addition of a suitable 33 inducing agent (e.g., IPTG for Plac or Pac) to the media. In order to provide a recognition 12 WO 00/49417 PCT/USOO/04089 I sequence for detecting interacting polypeptide/ligand pairs, the expression vector may 2 optionally be constructed to produce a fusion protein that consists of-an N- or C- terminal 3 recognition domain (for example, an epitope that is specifically recognized by an antibody), 4 followed in frame by a sequence encoding the desired library polypeptide which is optionally 5 flanked by sites to facilitate cloning, followed by an N- or C-terminal adhesion domain to 6 enable attachment to a solid support, depending on the strategy employed. 7 Optionally, the expression vector may include a suitable downstream marker such as a 8 reporter or antibiotic resistance gene, by which one may determine whether the expression 9 vector construct is intact and correctly in frame. This variant includes in the above-described 10 DNA fusion construct an additional marker sequence designed to sort out viable constructs 11 from, e.g., out of frame or inverted constructs. Suitable reporter sequences include green 12 fluorescent protein, which is one of a family of naturally occurring fluorescent proteins 13 whose fluorescence is primarily in the green region of the spectrum, or modified or mutant 14 forms having altered spectral properties (e.g., Cormack, B.P., Valdivia R.H. and Falkow, S., 15 Gene 173: 33-38 (1996)). (Both native GFP and such related molecules are collectively 16 referred to herein as "GFP") Alternatively, this GFP reporter may be inserted into the 17 expression construct in place of the adhesion domain if only the integrity of the library 18 polypeptide-encoding portion of the construct is of interest. Non-fluorescent markers of 19 construct integrity may also be employed, including a variety of antibiotic resistance genes 20 that are familiar to the art. 21 Fluorescent reporters such as GFP allow for subsequent rapid sorting of expression 22 products using flow cytometry with a fluorescence-activated cell sorter (FACS) machine. 23 This FACS sorting detects expression constructs that properly read through the GFP reporter 24 sequence and which are expressed at desirably high levels. Cells that express intact, in-frame 25 constructs are readily separated by detecting and collecting "bright" cells, which have an 26 intact GFP moiety that is properly in-frame with the polypeptide of interest, correctly folded, 27 and located downstream from a functional promoter. Constructs that are not intact will be 28 dim. Similarly, constructs with mutations or frame-shift deletions will eradicate the proper 29 relationship of the GFP moiety to the promoter, and the cells bearing such constructs will be 30 dim. Collecting only bright cells in this enrichment step significantly reduces the number of 31 underexpressed or nonfunctional fusion polypeptides that proceed into subsequent screening 32 steps. If antibiotic resistance is used as a marker, then transformed cells are plated on 13 WO 00/49417 PCT/USOO/04089 1 antibiotic-bearing media; only those cells that read through completion of a construct that 2 includes an intact, downstream antibiotic resistance gene will survive and grow. 3 After the GFP-expressing clones are isolated, the polypeptide or fusion construct 4 inserts can be recovered. If the polypeptide library/adhesion moiety DNA fusion construct 5 was screened, the GFP reporter sequence may optionally be deleted from the vector using 6 standard restriction endonuclease fragment excision and religation, or other such techniques. 7 If only the library polypeptide-encoding constructs were screened but fusion to an adhesion 8 -moiety is desired, then-the polypeptide-encoding fragments are transferred into a vector 9 containing the adhesion-domain, or alternatively, the adhesion-domain-encoding sequence 10 can be inserted into the vector, or swapped into the vector in exchange for the GFP reporter 11 sequence. Other markers such as antibiotic resistance genes may similarly be removed, if 12 desired. 13 Generation of individual arrays 14 Next, each substrate must be individually arrayed at a unique location. In the case of 15 proteinaceous substrates, each corresponding clone is arrayed separately, in a unique location, 16 so that in subsequent steps, the identity of any particular polypeptide may be determined by 17 cross-referencing back to its unique location in the original array. Non-proteinaceous 18 substrates may be arrayed directly, without a preceding expression step. 19 In order to obtain a source of only a given single polypeptide, a single-cell clone is 20 obtained as follows. Once the above-described DNA fusion constructs are assembled, 21 selected host cells are transfected or transformed by standard gene transfer techniques such as 22 electroporation. The transformed cells are selected by growth of colonies on selective media 23 familiar to those of skill in the art (e.g., standard ampicillin-enriched Luria Broth). Single 24 colonies are then picked and placed into growth media in, e.g., 384-well microtiter trays. A 25 robot may be used for this purpose. If desired, duplicate trays may be prepared bearing host 26 cells of identical clones in identical array locations on a separate set of microtiter trays. 27 (Duplicate arrays are particularly desired if the ligands to be screened also are polypeptides - 28 i.e., if a protein-interaction map is sought). 14 WO 00/49417 PCT/US0O/04089 I As a result of this step, library arrays in, e.g., 384-well plate format are generated in 2 which each well produces a unique polypeptide (derived either from a library, or from a 3 selection of individual polypeptides of interest). Thus, in later steps, the identity of a 4 particular polypeptide may be determined by tracing its origin back to this corresponding 5 unique array location. 6 Generation of lysate plates 7 Once each desired polypeptide is being expressed by the corresponding host cells, the 8 cells are lysed so as to release the polypeptides. This growth and lysis may be accomplished 9 directly, in each unique array location that contains them (e.g., microtiter well). 10 Alternatively, in some embodiments each single-cell clone may be grown in an intermediate 11 location of larger size or volume, so that a greater number of cells may be generated and 12 concentrated for lysis. In such embodiments, each concentrated volume of polypeptide is 13 then either lysed and the lysate transferred to its corresponding, unique array location, or the 14 concentrate is transferred to that array location and then lysed in situ. Each clonal lysate then 15 is kept separate from every other, and in a unique location that can be referenced throughout 16 the ligand screening process. Thus, each soluble lysate can be correlated back to its unique 17 library array location, and the identity of the library polypeptide ascertained thereby, as the 18 soluble lysates are used in later ligand interaction screening steps. 19 In order to obtain the uniquely arrayed soluble lysates, the host cells first are grown 20 until mid- or late-log phase. Expression of the DNA fusion constructs (library polypeptide 21 and adhesion moiety) is induced by whatever method is required by the selected promoter 22 (e.g., IPTG or by raising the growth temperature to 420 C). After one to five hours of 23 continued cell growth under inducing conditions, the cells are lysed to free the library 24 polypeptide/adhesion moiety fusion constructs. 25 Any methods familiar to those of the art may be used to free the polypeptides of 26 interest from the host cells. For example, the host cells may be treated with lysozyme to 27 remove the cell wall, followed by hypotonic shock to disrupt the cell membranes and release 28 the contents of the cell into the buffer. The cells alternatively may be sonicated, lysed with a 29 freeze/thaw protocol, or lysed by addition of detergent. The lysate may optionally be 30 concentrated by standard techniques prior to further process steps. Alternatively, the library 31 polypeptide or its corresponding fusion construct may be secreted by the cells, in which case 32 the growth media rather than the cells are further processed. 15 WO 00/49417 PCTIUSOO/04089 I Other ligands 2 In some embodiments of the invention, the screening may seek to identify interacting 3 pairs of endogenous polypeptides, in which case duplicate sets of soluble lysate arrays may 4 be generated from the same set of library polypeptides. In other embodiments, a variety of 5 other ligands may be tested for interaction with the original library polypeptides or other 6 substrates of interest. These other ligands may be proteinaceous in nature, in which case the 7 above procedure may be modified slightly so that a set of host cells expressing the 8 proteinaceous ligands is generated, and the corresponding array obtained. 9 In other cases, exogenous ligands may be screened for interaction with the 10 polypeptides of interest. Ligands such as small molecules, natural products, hormones, 11 receptors, antibodies, peptides, enzymes, growth factors, cellular adhesion molecules, 12 combinatorial library components and the like may be exposed directly to an appropriate 13 randomizable support (e.g., a support that will adsorb sufficient amounts of the ligand). In 14 other instances, the ligands may require initial derivitization so as to be chemically reactive 15 with surface functional groups on the support, in which case the ligands are, e.g., covalently 16 linked to the support. Alternatively, the ligands may be synthesized on the support. 17 Alternatively, this screening methodology can be altered slightly to serve as a displacement 18 assay, wherein a secondary ligand such as a small molecule is exposed to the primary 19 ligand/substrate pair. The secondary ligand may advantageously be adhered to a 20 randomizable support with a unique tag (for embodiments in which a large or very large 21 number of such secvondary ligands are screened). Alternatively, for embodiments in which a 22 lesser number of secondary ligands are screned, such secondary ligands can be free in 23 solution. In either event, pairs in which the secondary ligand displaces the primary ligand 24 can be detected, collected and analyzed as described elsewhere herein. 25 Preparation of randomizable supports with unique tags 26 In order to screen a variety of ligands for interaction with a given polypeptide, the 27 method generally requires using a support or substrate that will serve three functions; (a) it 28 will adhere to the ligand of interest; (b) it will be fully randomizable, so that an aliquot 29 containing a representative sampling of ligands may be presented to each polypeptide of 30 interest, and (c) it will carry a unique identification tag that corresponds to the particular 31 ligand adhered to its surface, and distinguishes it from other ligand-bearing supports. 32 In one embodiment of the invention, the randomizable support is a bead or other such 33 microparticle. A variety of bead sizes and compositions are suitable for use in the present 16 WO 00/49417 PCT/USOO/04089 I invention. For example, bead size may range from 50 nm to 50 microns in diameter. The 2 beads may be composed of polystyrene, glass (silica), latex, agarose, magnetic resin, or a 3 variety of other matrices. Some beads may be obtained from commercial sources with 4 adhesion moieties already attached; for example, numerous avidin-conjugated beads are 5 available. Other beads can be obtained with functional groups such as hydroxyl or amino 6 groups suitable for chemical modifications, such as attachment of adhesion moieties that will 7 interact with the fusion protein. In yet another formulation, the beads do not require specific 8 functional groups; rather, the interaction between the fusion protein and the bead is of a 9 -nonspecific type involving, e.g., hydrophobic interactions. Beads suitable for this purpose 10 may be polystyrene, latex, or some other plastic. 11 If the beads require functionalization in order to bind to the selected polypeptide or 12 ligand, then enough beads are generated in one reaction to permit numerous experiments to 13 be performed, e.g., 101 4 beads. These beads are then stored under conditions that ensure the 14 stability of the chemical modifications, such as low temperature. For example, in mapping 15 protein interactions in a human cell, approximately 1 x 107 beads are generated for each 16 potential expression product to be screened (e.g., in the case of the human cell, approximately 17 1 x 106 potential endogenous polypeptides, resulting in a need for some 1 x 1013 beads). This 18 number of beads ensures that at least one full experiment involving genome-wide protein 19 protein interaction measurements can be performed. 20 A variety of methods are suitable for providing each support with an identification tag 21 that correlates to the ligand that the support will bear. For example, the beads may be tagged 22 with DNA tags in which the tags can be amplified and fingerprinted, or detected by 23 hybridization. Alternatively or in conjunction, the beads may be tagged with fluorescent tags 24 such as fluorescent barcodes, radio frequency tags, or mass tags detected by mass 25 spectrometry 26 Fluorescent barcodes 27 Fluorescent tags for the randomizable supports are advantageous because the 28 identification tag may be read simultaneously with quantification of the binding interaction. 29 One representative method of fluorescent tagging is to use the variety of existing fluorescent 30 materials such as fluorescent organic dyes or microparticle dyes, and the sensitivity of 31 existing fluorescence detectors, to devise a series of fluorescent barcodes. 32 Fluorescent barcodes may be generated as follows. Fluorescence detectors presently 33 exist that can quantify fluorescence at up to nine separate wavelengths using multiple lasers, 17 WO 00/49417 PCT/USOO/04089 I photo-multiplier tubes (PMTs) and filter sets. One example of such a device is the 2 Cytomation flow cytometer that is not only capable of measuring fluorescence at multiple 3 wavelengths in single cells or beads, but also of sorting cells and beads based on these 4 signals. The measurements are also highly accurate, so that it is possible to distinguish easily 5 a fluorescence value of 0 (background) from, lx, 2x, 3x, and 4x. Thus, it is possible to 6 design a barcoding strategy whereby the unique signature of a particular bead is based on a 7 fluorescence number composed of, e.g., nine digits (i.e., the nine separate wavelengths), each 8 digit able to assume 5 values (i.e., 0 through 4x). Combining these two variables yields a set 9 -of potential unique barcodes-of 59, or approximately 2 million different barcodes. 10 To stamp each bead with a barcode, a set of, e.g., 1 x 1013 beads is broken into one 11 million groups of I x 107 each. Each group of beads is placed in one well of a 384-well tray, 12 requiring a total of about 2,600 trays. As one of skill will appreciate, this process may 13 preferably be automated via known methods, using commercially available robotics. To the 14 beads are added various quantities and types of fluorochrome dye such that the barcode 15 requirements are fulfilled -- i.e., that each type of bead has a unique barcode that will identify 16 the associated ligand and distinguish it from all other ligands. The fluorochromes may 17 readily be incorporated by dissolution in organic solvent followed by exposure to the beads 18 for sufficient time to allow full diffusion and interaction with the beads. The organic solvent 19 is then removed and the beads dried. Alternatively, various types of covalent chemical 20 attachments to the beads may be employed, or the fluorescent dye may be incorporated into 21 the bead by other methods known to the art, for example by synthesizing the beads from dye 22 containing materials, or by encapsulating the fluorescent dye within the bead. 23 Generation of a randomized ligand library for screening 24 Once the beads are prepared with the desired fluorescent barcode or other such 25 unique tag, the desired ligands (or secondary ligands) may be adhered to the beads, to form a 26 series of uniquely tagged ligand sets. 27 A variety of methods for adhering a ligand to the support are known to the art, and 28 one of ordinary skill can select a particular method based on the exact nature of the ligand to 29 be adhered. For example, if the ligand is proteinaceous, the adhesion moiety may be, e.g., 30 biotin/avidin, thioredoxin/phenyl arsine oxide, maltose binding protein/amylose, 31 calmodulin/calmodulin binding peptide, dihydrofolate reductase/methotrexate, chitin/chitin 32 binding protein, cellulose/cellulose binding protein or antibody/antibody epitopes such as the 33 FLAG epitope, as described elsewhere herein. In each case, one binding moiety is expressed 18 WO 00/49417 PCT/USOO/04089 I as part of a fusion construct in frame with the proteinaceous ligand, and the other is 2 immobilized on the support by a covalent or noncovalent chemical linkage. In the case of 3 hormones or other endogenous compounds, or other organic or inorganic molecules, the 4 compounds may be attached via a chemical linker, e.g., a hydroxyl or primary amine, or may 5 be synthesized directly on the bead. 6 If the ligand to be adhered is proteinaceous, then a subset of uniquely tagged, 7 derivatized beads is exposed to a corresponding expression product lysate, which is collected 8 in a particular location in, e.g., a 384 well array. The subset of identically tagged beads is 9 - suspended in solution and added to each well by either a pipetting device or by means of a 10 magnetic dispenser (in the event that the beads are magnetic). The beads are mixed with the 11 lysate in the well for a sufficient time to permit binding. This step thus generates subsets of 12 uniquely identified ligands on randomizable supports. 13 It is most preferable to adhere each member ligand to its corresponding set of 14 location-determinable supports in a substantially irreversible manner. Some adhesion 15 moieties form such links by a covalent link or an extremely tight noncovalent link -- e.g., the 16 interaction between biotin and avidin, Kd = 10~" M. Such substantially irreversibly linked 17 beads are ready for the next step in the process - exposure of the substrates to ligands that are 18 firmly bound to their randomizable supports. However, if the interaction between the 19 randomizable support and the ligand is reversible (e.g., on the order of Kd = 10-6 to 10-m M), 20 an additional step may be employed. In this additional step, the ligands are eluted from the 21 first set of supports (which may, in this instance, be unlabelled, as the various subsets of 22 ligands at this juncture remain segregated) by addition of a large excess of soluble (i.e., 23 unbound) ligand. 24 In the case of polypeptide/adhesion moiety fusion constructs, one adds an excess 25 soluble adhesion moiety so as to competitively interfere with the interaction between the bead 26 and the adhesion domain of the fusion construct, thus displacing the fusion construct from the 27 bead. The soluble fusion construct then is re-attached via an irreversible linkage to another 28 set of beads that are added to the solution in a location-determinable manner. This interaction 29 may involve, e.g., binding avidin-coated beads by biotinylated fusion protein, or it may 30 involve nonspecific, hydrophobic adsorption of the soluble protein onto the bead surface. 31 Alternatively, it may be preferable to crosslink polypeptides to beads using, e.g., UV light of 32 a specific wavelength and/or a chemical cross-linking agent, as is the case with the 33 randomizable supports, described elsewhere herein. 19 WO 00/49417 PCT/USOO/04089 1 Once all subsets of uniquely tagged beads have been successfully linked to the 2 corresponding ligand subsets, then all the ligand subsets are collected by either a pipetting 3 device or by the magnetic instrument and mixed into one integrated pool such that, e.g., all 1 4 x 10 3 ligand-labeled beads are present. This step thus disperses all the tagged ligands into a 5 fully randomized pool that represents all of, e.g., the one million protein-bead types, each 6 type represented 107 times. Each bead in the aliquot bears a ligand and a corresponding 7 unique tag to identify that ligand. An aliquot of, e.g., 10 7 beads is then drawn from this 8 integrated pool of ligand-bearing beads. Each aliquot contains a statistically representative 9 -portion of the fully integrated-ligand pool -- i.e., a subset of beads representing a substantially 10 full spectrum of available ligands (the degree of complete representation in any selected 11 aliquot is determined by statistical sampling issues familiar to those in the art). Each location 12 in the substrate array receives one aliquot of integrated ligand beads. Thus each arrayed 13 substrate has the opportunity to interact with every ligand. 14 Preparation of a location-determinable support and exposure to substrates 15 16 Alternatively, in some embodiments of the invention, the substrates are adhered to a 17 location-determinable support prior to exposure to the aliquots of integrated ligand-bearing 18 supports. Generally, the two major characteristics of the location-determinable support are 19 that (i) it is capable of adhering to the selected library polypeptide or other such substrate, 20 and (ii) it is kept segregated so that it links the adhered substrate to the original clone array 21 position (i.e., well) from which that substrate was derived. This support can be a fixed type 22 of support, for example a finger, pin or other such probe that is rigidly arrayed so as to match 23 the clone array (e.g., a 384 pin hand). Alternatively, the support can be a bead or other such 24 microparticle, which is kept segregated in an array that directly correlates back to the original 25 location in the substrate array (e.g., a set of beads that is kept segregated in one well of a 384 26 well tray, corresponding to the well of the 384 well tray from which, e.g., the original clonal 27 polypeptide was derived). Microparticles may be preferable for selections that involve large 28 numbers of substrate-ligand interactions, or that involve relatively specific or slow-forming 29 interactions. Fixed supports offer advantages for reduced handling and/or automation. 30 As described above, it is most preferable that the substrate be linked in a substantially 31 irreversible manner to the location-determinable support. If this is not accomplished by the 32 initial adhesion step, then the substrates are eluted from the first set of supports by addition of 33 a large excess of soluble (i.e., unbound) substrate. The substrate is then re-adhered to a 20 WO 00/49417 PCT/USO0/04089 I second set of location-determinable supports in a substantially irreversible manner, as 2 described above. 3 Exposure of each substrate to the integrated ligand library 4 Generally, this step requires that each uniquely located substrate (either in solution or 5 adhered to its analogous location-determinable support) is exposed to an aliquot of integrated 6 ligand-bearing supports. Typically, these ligands will be in an appropriate buffer that mimics 7 conditions inside the cell (i.e., reducing environment, neutral pH, 150 mM salt), and can be 8 added directly to each array location containing a corresponding soluble or bound substrate. 9 -The lysate buffer may be of the same makeup. The binding buffer also may have other 1o additives, e.g., those designed to minimize non-specific binding (e.g., detergent, bovine I I serum albumin). If a fixed type of location-determinable support (e.g. a pin or finger) is used, 12 it may simply be dipped into a well containing an aliquot of the randomized ligand-bearing 13 supports. If the location-determinable support is a bead or other such microparticle, a set of 14 such beads containing one particular substrate may be added to a well that contains a 15 randomized aliquot of the ligand-bearing beads, and the two sets of beads mixed thoroughly 16 so as to maximize substrate-ligand exposure. Interaction between the substrate and any of the 17 many different ligands thus results in the corresponding ligand-bearing bead (with its unique 18 identification tag) adhering to the substrate, thereby forming a bead-bead aggregate. 19 In some embodiments utilizing microparticles as location-determinable supports, it 20 may be desirable to replace the support-bound substrate with soluble substrate after exposure 21 to the ligand aliquots (and formation of substrate-ligand bead aggregates). In such cases, 22 soluble substrates (termed herein, "replacement substrates") are added to each array location 23 that contains the corresponding bead aggregates. For example, in the case of individual or 24 library polypeptides, the polypeptide domains of the replacement polypeptides are identical to 25 those of the polypeptides bound to the supports. Because the replacement polypeptides are in 26 vast excess, and because the interactions between polypeptides and ligands in solution are 27 generally characterized by relatively rapid off-rates, the soluble replacement polypeptides 28 bind the ligands and displace competitively the support-bound polypeptides. Thus, in a 29 single step the location-determinable supports are displaced from the ligand-bearing 30 randomizable supports and soluble replacement polypeptides are attached to the ligand 31 bearing supports in preparation for further characterization or screening. For example, in 32 embodiments in which both the replacement substrate and the ligand are proteinaceous, the 33 pairs may be subsequently exposed to secondary ligands, typically small organic molecules, 21 WO 00/49417 PCT/USO0/04089 1 as described herein. Small organic molecules that bind to the primary ligand, for example, 2 can displace the replacement substrate, thereby identifying small a organic molecule with 3 potential therapeutic value as a disruptor of a protein-protein interaction. 4 Alternatively, it may be preferable to detach the location-determinable supports in a 5 separate step, followed by incubation of the segregated sets of interacting ligand-bearing 6 beads with soluble replacement polypeptide or such substrate. This may be accomplished, 7 for example, by hyrolysis of a linker that attaches the library polypeptides to the location 8 determinable supports. If a DNA linker is used, DNAse treatment may release the location 9 -determinable beads, while the residual fusion protein remains bound by noncovalent forces to 10 the ligands on the randomizable beads. A second binding step involving the ligand-bearing 11 beads and soluble replacement polypeptides is then performed in order to adhere the second 12 layer (the library polypeptide layer) to the bead prior to detection of polypeptide-ligand 13 complexes. This replacement step is generally applicable to non-proteinaceous substrates, as 14 well. 15 Magnetic interactions 16 In one embodiment of the invention, beads formed from a magnetic resin are used as 17 the location-determinable support. In this embodiment, a set of magnetic beads (e.g., 107 18 beads per well) is apportioned into each array location, which contains a corresponding 19 library polypeptide or other such substrate. As the magnetic beads have adhesion domain 20 binding moieties that are complementary to those of, e.g., the fusion polypeptides conjugated 21 to their surfaces, after some period of time saturating or near-saturating amounts of fusion 22 protein will adhere to the resin, and the polypeptide-coated beads are collected. This may be 23 accomplished by dipping a magnetic pin into each well, allowing the magnetic beads (with 24 the adhered substrates) to be drawn to the pin, withdrawing the beads, transferring to another 25 well, and discharging the magnetic bead by demagnetizing the pin. In other embodiments, 26 the magnetic forces may be applied externally to pull the magnetic beads to the well wall, 27 with subsequent removal of the remaining non-magnetic materials. 28 Next, substrate/ligand bead aggregates are formed and collected. First, each set of 29 magnetic beads in the array is exposed to aliquots of non-magnetic ligand-bearing supports. 30 After a period of time to permit interactions between substrates and ligands, the magnetized 31 beads are again collected with the aid of a magnetic device. Any of the ligand-bearing beads 32 that have interacted to form aggregates with the magnetized beads are pulled along with the 33 magnetic beads to the magnet. Ligand-bearing beads that do not interact are left behind in 22 WO 00/49417 PCT/USO0/04089 1 solution. The aggregates of magnetic beads and interacting ligand-bearing beads are then 2 collected. Thus, only those beads that contain interacting substrates- and ligands are 3 recovered for subsequent quantitative analysis. 4 Conversely, the ligand-bearing randomizable supports may be magnetized while the 5 location-determinable supports remain unmagnetized. The magnetized randomizable 6 supports then function analogously to gather the bead aggregates formed by the 7 substrate/ligand complexes. 8 In using magnetic forces to cull out interacting substrate/ligand complexes, a "surface 9 -interaction" as opposed to solution interaction is created, and provides an enrichment for 10 substrate-ligand interactions. This enrichment step obviates the need to examine carefully 11 every possible substrate-ligand interaction using a quantitative, but serial device such as a 12 flow cytometer. Accordingly, interaction sets on the order of 106 x 106 polypeptides (akin to 13 a human protein interaction map) may be screened rapidly and efficiently by inserting a bead 14 bead interaction step. 15 Segregating, identifying and quantifying the substrate/ligand pairs 16 Once the substrate/ligand interactions are consummated, the interactions can be 17 quantified, and each substrate and ligand identified as follows. 18 In the case of proteinaceous substrates, one ultimately obtains a set of supports that 19 bear a polypeptide layer reversibly bound to ligand-bearing randomizable supports (i.e., 20 either the randomizable supports were exposed only to soluble polypeptides, or the bead 21 bound polypeptides were subsequently displaced by an intervening exposure to soluble 22 polypeptides). Such polypeptide/ligand complexes may be rapidly quantified by use of a 23 fluorescence-activated cell sorter. The fluorescent signals emitted by the unique tags on the 24 ligand-bearing supports provide the basis for rapid and accurate quantitation by this method. 25 In other embodiments, substrate-ligand complexes can be detected by either detecting 26 a unique recognition domain (e.g., epitope) on the polypeptide or ligand (by "unique" is 27 meant either that the recognition domain exists on only one member of the complex, or 28 alternatively that it is present on both members but sterically accessible only on the outer 29 layer). Supports that bear a ligand may be identified by a variety of immunological or 30 fluorescence techniques known to those in the art. As one non-limiting example of such 31 identification, a fluorescence-labeled antibody that reacts with such an epitope on the library 32 polypeptide is utilized. After a period of time suitable for antibody binding (typically one 33 half hour), the beads are collected and examined by an instrument such as a FACS machine 23 WO 00/49417 PCT/USOO/04089 I to measure the level of antibody (determined from the fluorescence signal of the particular 2 fluorochrome attached to the antibody). Concurrently, the randomizable support barcode can 3 be read by fluorescence measurements at other wavelengths. This in turn reveals the identity 4 of the fusion protein attached irreversibly to the randomizable support. The identity of the 5 soluble protein is retained based on the well from which the bead was collected (i.e. the 6 unique array location) immediately prior to the detection step. Thus, both the identity of the 7 primary, irreversibly attached protein and the soluble protein is known, and the approximate 8 strength of the interaction between them can be determined from the antibody fluorescence 9 - signal. 10 For some applications, a CCD camera may be utilized to detect interacting substrate 11 ligand complexes. For example, in applications screening for interaction of a non 12 proteinaceous organic molecule with a polypeptide, a CCD system can be used to visualize 13 interacting complexes, thereby providing both detection and quantification. The CCD 14 camera can detect a variety of visual outputs, including without limitation fluorescent 15 emissions, chemiluminescent emissions, and SPA (scintillation Proximity Assay) emissions. 16 In the SPA format, one member of the interacting pair is radiolabeled using standard 17 techniques, and the other member of the pair is adhered to a bead in which a radio-detecting 18 scintillation component is incorporated in the interior of the bead. When the radiolabeled 19 component interacts with the bead-bound component, a detectable scintillation signal is 20 emitted. The beads can optionally be displayed on some surface, for example an 21 identification grid with grid locations correlating to each unique array location, for scanning 22 by the detector. 23 One non-limiting example of CCD detection of fluorescent signals utilizes a scientific 24 grade CCD camera incorporating a high quantum efficiency image sensor. The target 25 molecules are distributed along the well bottoms of optically transparent microtiter plates. 26 The CCD, fitted with lenses and optical filters, acquires images of the through the optically 27 transparent well bottoms. Fluorescent excitation of the fluorescent molecules is generated by 28 appropriately filtered coherent or incoherent light sources. The resulting digital images are 29 stored on a computer for subsequent analysis. 30 An exemplary detection system is composed of a PixelVision SpectraVideoTM Series 31 imaging camera (1100 x 330 back-illuminated array), PixelVision PixelView m 3.03 32 software, two 50-mm/fl.0 Canon lenses, four 20750 Fostec light sources, four 8589 Fostec 33 light lines, one 59345 Oriel 510-nm band pass filter, four 52650 Oriel 488-nm laser band pass 24 WO 00/49417 PCT/USOO/04089 I filters, a 4457 Daedal stage, Polyfiltronic clear bottom microtiter plates, and supporting 2 mechanical fixtures. Mechanical fixtures are constructed to position the PixelVision camera 3 below a microtiter dish. Additionally, the fixtures mounted four Fostec light lines and 4 allowed the excitation light to be focused on the viewed area of the microtiter dish. The two 5 Canon lenses were butted up against each other front to front. A 510-nm filter is placed 6 between the two lenses. The front-to-front lens configuration provides 1:1 magnification and 7 close placement of the target object to the imaging system. 8 The above-described techniques quantify polypeptide binding pairs or 9 -polypeptide/ligand binding pairs. Optionally, the exact make-up of each binding pair is 10 ascertained by identifying (i) the unique array location from which the library polypeptide or 11 other such substrate is derived, and (ii) the ligand identity that corresponds to the unique tag 12 on the bead (which, in the case of creating protein interaction maps, will in turn relate back to 13 another unique library polypeptide array location). Optionally, if sequence information about 14 a given interacting polypeptide is desired, one may sequence the DNA encoding the 15 polypeptide produced by each unique location in the library array. 16 17 DESCRIPTION OF PREFERRED EMBODIMENTS 18 19 EXAMPLE 1 20 LYSATE LIBRARIES 21 Expression vectors 22 In order to generate sufficient amounts of polypeptides for ligand screening, it is 23 desirable to first clone DNA encoding the library polypeptides of interest into a vector that is 24 suitable for high levels of expression of those polypeptides. The host cells of interest are 25 transformed with such an expression vector, production of the library polypeptides is 26 induced, and the library polypeptides are collected. 27 A variety of expression vectors are suitable for use in this invention. As one non 28 limiting example, an expression vector bearing an inducible trc promoter was used. Plasmid 29 pSE420 (Invitrogen) features the trc promoter, the lacO operator and lacI4 repressor, a 30 translation enhancer and ribosome binding site, and a multiple cloning site. For insertion into 31 this vector, the E. coli thioredoxin gene was amplified from pTrx-2 (ATCC) in such a manner 32 as to retain a restriction enzyme site on the 5' side of the gene, and was cloned into the 33 pSE420 vector's multiple cloning site at the 5' NheI and 3'NgoMIV locations, thus placing it 25 WO 00/49417 PCT/USOO/04089 1 under control of the trc promoter. The thioredoxin gene can advantageously enhance 2 recombinant protein solubility and stability. Moreover, as a cytoplasmic protein, it can be 3 produced under reducing conditions but still can be released by osmotic shock because of 4 accumulation at adhesion zones. 5 Once the pSE420 plasmid was modified to contain the thioredoxin gene 6 (pSE420/trxA), the gene encoding GFP was inserted in frame with the thioredoxin, in order 7 to rapidly isolate intact, in-frame constructs and thereby to eliminate constructs in which the 8 library polypeptide would not be properly produced. The gene encoding EGFP was PCR 9 amplified from plasmid pEGFP-1 (Clontech), maintaining a NotI restriction site 3' of the 10 EGFP sequence, and establishing a second NotI site 5' of that sequence. The NotI sites may 11 be used to readily remove the EGFP fragment from the vector after intact constructs are 12 isolated. The NotI fragment containing EGFP was then cloned into the NotI site of the 13 pSE420/trxA vector. Vectors containing the EGFP in frame and in the correct orientation 14 were designated plasmid pSE420/trxA/EGFP. Figure 1. 15 Once the vector containing the desired promoter and other components is prepared, 16 DNA encoding the desired adhesion moiety is introduced. For example, a biotinylation 17 signal may be used to adhere the library polypeptides to steptavidin beads. The in vivo 18 biotinylation peptide sequence was cloned into the pSE420/trxA/EGFP vector (Figure 1) in 19 frame to the amino terminus of the thioredoxin gene by cutting at the 5' NcoI and 3' NheI site 20 and filling in the overhanging nucleotides with Klenow prior to ligation. The biotinylation 21 signal peptide is 23 residues long (Tsao et al, Gene 169:59-64 (1996)), and the sequence that 22 encodes it can be readily synthesized on an oligonucleotide synthesizer using standard 23 techniques. The vector may advantageously be modified to include the BirA gene, which 24 encodes the enzyme responsible for adding biotin to the recombinant biotinylation signal. 25 The BirA gene was amplified from genomic E. coli DNA by PCR. A copy of the BirA gene 26 was added in a polycistronic fashion to the carboxyl terminus of the biotin/trxA/EGFP 27 sequence and the resultant modified pSE420 vector was designated pSE420/biotrx/GFP/BirA 28 (Figure 2). 29 An alternative adhesion moiety, dihydrofolate reductase (DHFR) was incorporated 30 into the expression construct as follows. The DHFR gene was amplified from E. coli 31 genomic DNA by PCR with NcoI and KpnI sites on the 5' and 3' ends, respectively. This 32 fragment was cloned into the NcoI/KpnI site of pSE420. Subsequently, the NotI fragment 26 WO 00/49417 PCT/USO0/04089 1 containing EGFP (described above) was cloned in frame with DHFR into the NotI site. The 2 resultant plasmid was designated pSE420/DHFR/GFP (Figure 4). 3 Another promoter system suitable for use in the invention features the PL promoter. 4 This system was constructed by digesting the pLex plasmid (Invitrogen) with NdeI and PstI 5 and blunting the resultant ends with mung bean nuclease. The pSE420/biotrxGFP/BirA 6 construct described above was digested with NcoI and HindIII, and the NcoI/HindIII 7 fragment then blunt-ended with T4 polymerase. This fragment was then inserted into the 8 pLex construct. The resulting plasmid was designated pLex/biotrx/GFP/BirA (Figure 5). 9 -Optionally, the DHFR/GFP expression cassette described above may be inserted into the 10 pLex plasmid by digesting pLex with NdeI and PstI, blunting the ends with mung bean 11 nuclease, and inserting the blunte-ended NcoI/HindIII fragment from pSE420,DHFR/GFP. 12 Following construction of the described vectors, expression was induced by 13 introduction of the appropriate induction agent (IPTG for pSE420-based expression vectors, 14 and tryptophan for pLex-based vectors). Production of the recombinant polypeptide insert 15 was detected by GFP fluorescence via FACS, or by western blot analysis. The recombinant 16 polypeptides were then selectively bound and removed from bacterial lysatyes of induced 17 cultures via binding with the respective binding partner (streptavidin for biotrx/GFP and 18 methotrexate for DHFR/GFP), which had been immobilized to beads, as described elsewhere 19 herein. 20 Library polypeptides 21 DNA encoding the library polypeptides may be derived from a variety of sources, using 22 techniques that are familiar to the art. As one non-limiting example, a cDNA library 23 encoding human protein domains was prepared, using methods that are well known in the art, 24 from human placental tissue. Poly(A) RNA was isolated from placental tissue by standard 25 methods. First strand cDNA was then generated from poly(A) mRNA using a primer 26 containing a random 9mer, a SfiI restriction endonuclease site and a site for PCR 27 amplification (5' 28 ACTCTGGACTAGGCAGGTTCAGTGGCCATTATGGCCNNNNNNNNN). The second 29 strand was then generated using a primer consisting of a random 6mer, another SfiI site, and a 30 site for PCR amplification (5' 31 AAGCAGTGGTGTCAACGCAGTGAGGCCGAGGCGGCCNNNNNN). After conducting 32 a number of PCR amplification cycles, the DNA was cut with SfiI and the resultant fragments 33 were size-selected for fragments of greater than about 400 bp. The selected fragments were 27 WO 00/49417 PCTIUSOO/04089 1 ligated into the Sfi1 sites of a suitable expression vector, as described herein. The library 2 polypeptide DNA fragments then were isolated and inserted in frame with DNA encoding a 3 corresponding biotin adhesion moiety and thioredoxin. DNA encoding the library 4 polypeptides was prepared by cutting the DNA with SfiI and then inserted at an Sfi1 site 5 placed in a linker (5' GGCCGAGGCGGCCTGATTAACGATGGCCATAATGGCC) placed 6 at the NgoMIV-AvrII sites of plasmid vector pSE420/biotrx/GFP/BirA, or of plasmid vector 7 pET-biotrx-GFP-BirA. 8 To select for those cDNAs that are in-frame with TrxA, E. coli expressing constructs 9 -possessing in-frame cDNAs are selected by FACS sorting and selecting for bright (i.e., 10 "green") cells. Such cells are expressing intact GFP, which is in frame with and downstream 11 from the library polypeptide and TrxA sequences. Plasmid DNA is isolated and the EGFP 12 insert then removed via NotI digestion. Once the EGFP marker has been used to sort cells 13 and removed from the modified pSE420 vector, the modified pSE420 plasmids are again 14 transformed into E. coli and expressed via IPTG induction. 15 Other adhesion moieties 16 Alternatively, the library polypeptides may adhere to calmodulin-containing beads 17 using calmodulin binding peptide ("CBP") as the adhesion moiety. The vector constructs are 18 prepared as described above, but an expression cassette containing CBP is inserted into the 19 vector immediately 5' of the trxA gene via the 5' NcoI and 3' NheI sites, as described above. 20 Figure 3. The CBP thus is used in place of the biotinylation signal peptide, and immobilizes 21 the library polypeptides to the calmodulin beads. 22 As another alternative to the above-described system, the thioredoxin gene product 23 may itself serve as the adhesion moiety, and will bind the fused library polypeptides to 24 phenylarsine oxide ("PAO") beads. Polystyrene beads are modified so as to covalently link 25 phenylarsine oxide to the surface by reacting the carboxyl groups on the bead surface with p 26 aminophenylarsine oxide via a water soluble carbodiimide. Kaleef and Gitler, Methods of 27 Enzymology 233:395-403 (1994). The above-described pSE420/trxA/EGFP vector in this 28 instance is used directly, i.e., no subsequent moiety is fused to the carboxyl terminus of the 29 thioredoxin gene. Screening and expression are carried out as described above. 30 As still another alternative, the library polypeptides may simply be adhered to 31 polystyrene beads via hydrophobic adsorption. In such embodiments, the library 32 polypeptides are first separated from, e.g., the host cell polypeptides by standard methods 33 before exposure to the beads. 28 WO 00/49417 PCT/USOO/04089 1 Crosslinked embodiments 2 In some embodiments, polypeptide substrates or ligands may be crosslinked with the 3 supports. As one non-limiting example, the bacterial lysate containing the expressed 4 recombinant fusion protein is incubated with microspheres containing a ligand specific for 5 the fusion partner. Following binding of the fusion protein, a photoactive crosslinker on the 6 microsphere will irreversibly bind the fusion protein. Examples of possible ligand-fusion 7 partner combinations are, but not limited to, phenylarsine oxide (PAO) and thioredoxin 8 (Methods of Enzymology (1994) 233, 395-403), or a suicide substrate and its corresponding 9 enzyme (e.g. clavulanic acid and beta-lactamase; J. Mol. Biol. (1994) 237, 415-422). 10 In embodiments utilizing PAO and thioredoxin, the thioredoxin fusion product is i i constructed as described above. The PAO moiety, 4-aminophenylarsine oxide, is synthesized 12 as described in the literature (Biochemistry (1978) 17, 2189-2192). The 4-aminophenylarsine 13 oxide is then reacted with a large molar excess of BS 3 (Pierce Chemical Co.) in order to place 14 an amine reactive NHS ester and 8 carbon spacer at the 4 position of 4-aminophenylarsine 15 oxide. The NHS ester-modified PAO is then reacted in equimolar amounts with sulfo 16 SANPAH (Pierce Chemical Company) and 10 pm amine-functionalized latex microspheres 17 (Polysciences, Inc.). The result of this reaction yields microspheres with approximately one 18 half of the available amine groups with PAO attached, while the remaining half have the 19 photoactivatable crosslinker. These microspheres are then reacted with the bacterial lysate 20 containing the expressed fusion protein. Vicinal dithiol-containing proteins, including the 21 recombinant thioredoxin fusion protein, is bound to the microspheres. After washing steps to 22 remove non-specifically bound proteins, the microspheres with the bound recombinant fusion 23 protein are crosslinked to the microspheres via amine groups on thioredoxin by exposing to 24 light at 320nm-350nm. These microspheres are then ready to be used as described elsewhere 25 in this application. 26 In another non-limiting embodiment, library polypeptides are covalently attached to 27 the supports by adsorption to the support, followed by crosslinking. For example, the library 28 polypeptides may be constituted as fusions with maltose binding protein. These fusion 29 constructs then are purified from the lysate using a maltose affinity resin and released with 30 soluble maltose (J. Chrom. 633 (1993) p.273- 2 8 0). The purified fusion constructs then are 31 adsorbed onto polystyrene beads, thus attaching via hydrophobic interactions. Finally, the 32 polypeptides are crosslinked with a phototactivated crosslinker, for example sulfo-SANPAH 33 (Pierce Chemical Co.). 29 WO 00/49417 PCT/USOO/04089 I In yet another non-limiting embodiment, polypeptide substrates are attached to 2 microparticles via the interaction of a DNA-binding protein and a DNA moiety or analog on 3 a bead. Specifically, a DNA binding fusion library such as a Gal4 fusion is constructed. The 4 corresponding microparticles have two features -- a peptide nucleic acid (PNA) oligomer for 5 binding the protein of interest, and a photoactivatable crosslinker, e.g. sulfo-SANPAH 6 (Pierce Chemical Company), attached to the end of the oligomer. The microparticles are 7 placed into lysates containing the various Gal4/library polypeptide fusion constructs, and 8 those constructs then bind to the beads via interaction between the Gal4 binding moiety and 9 - the bead oligomer. The crosslinker is then photoactivated, thus forming the covalent linkage 10 between the proteins and the beads. 11 Alternatively, the bacterial lysate containing the expressed recombinant fusion 12 polypeptides are incubated with microspheres that bear a ligand specific for the fusion 13 polypeptide. After the polyeptides bind to the beads via the ligands, a photoreactive 14 crosslinker on the bead is activated so as to irreversibly bind the fusion polypeptide to the 15 bead. Non-limiting examples of fusion polypeptide/ligand partners include 16 DHFR/methotrexate, PAO/thioredoxin, or a suicide substrate and corresponding enzyme 17 (e.g., clavulanic acid and beta-lactamase; J. Mol. Biol. (1994) 237:415-422). 18 For an embodiment utilizing the thioredoxin construct described elsewhere herein, 4 19 aminophenylarsine oxide is synthesized as described in the literature (Biochemistry (1978) 20 17:2189-2192), reacting the 4-aminophenylarsine oxide with a large molar excess of BS 3 21 (Pierce Chem. Co.) in order to place an anime reactive NHS ester and and eight carbon spacer 22 at the 4 position of the 4-aminophenylarsine oxide. The NHS-modified PAO is then reacted 23 in equimolar amounts with sulfo-SANPAH (Pierce Chem. Co.) and 10 gm amine 24 functionalized latex microspheres (Polysciences, Inc.), yielding microspheres with 25 approximately one half of the available amine groups with PAO attached, while the 26 remaining half attaches the photoactibatable crosslinker. The microspheres are then reacted 27 with the bacterial lysate containing the expressed thioredoxin fusion protein. Vicinal dithiol 28 containing polypeptides, including the recombinant thioredoxin fusion protein, are thus 29 bound to the microspheres. After washing steps to remove the non-specifically bound 30 protein, the microspheres with the bound recombinant fusion polypeptide are crosslinked via 31 the thioredoxin amine groups by exposing the complexes to 320-350 nm light. 32 For a DHFR/methotrexate embodiment, the DHFR expression vector is as described 33 elsewhere herein. The corresponding affinity resin, sulfo-SANPAH (Pierce Chem. Co.) is 30 WO 00/49417 PCT/USOO/04089 1 reacted with the amine-functionalized latex microspheres (Polysciences Inc.) in non 2 saturating amounts to couple the crosslinker onto the microspheres in non-saturating 3 amounts. Methotrexate (Sigma Chem. Co.) is then reacted with EDC (Pierce Chem. Co.) and 4 the sulfo-SANPAH functionalized beads so as to couple the methotrexate to available amine 5 groups on the beads. The resultant functionalized microspheres are depicted in Figure 6. A 6 bacterial lysate containing DHFR fusion polypeptide is then bound and photo-crosslinked as 7 described for the thioredoxin/PAO system. 8 In embodiments that utilize fluorescent identification tags, it may be preferable to first 9 -protect the fluorescent tags before undertaking chemical cross-linking. This may be 10 accomplished in a variety of ways familiar to the art, including without limitation embedding 11 the fluorescent tags beneath the surface of the bead, or chemically protecting the fluorescent 12 tags by first derivatizing with non-reactive functional groups, and then de-protecting the tags 13 once chemical crosslinking is complete. 14 Host cells 15 A variety of host cells are suitable for use in this invention. One common species of 16 host cell with utility here is E. coli. Preferred strains of E. coli are characterized by (1) over 17 expressing the necessary amount of protein required to fulfill other parts of the invention 18 (coating of the beads, etc.), (2) tolerating "leaky" expression of toxic target plasmids, and (3) 19 being amenable to cell lysis and protein recovery. Such strains include, without limitation, 20 TOP10 (Invitrogen Corporation), BL21 (Novagen), and AD494 (Novagen). One such strain, 21 BL21 (DE3) RIL (Stratagene), was selected for further study in this non-limiting Example. 22 These host cell strains are used in the presence or absence of the T7 phage gene 23 encoding lysozyme which resides on the plasmid pLysS (Novagen). T7 lysozyme cuts a 24 specific bond in the peptidoglycan cell wall of E. coli. High levels of expression of T7 25 lysozyme can be tolerated by E. coli since the protein is unable to pass through the inner 26 membrane to reach the peptidoglycan cell wall. Mild lytic treatments of cells expressing T7 27 lysozyme that disrupt the inner membrane results in the rapid lysis of these cells. Thus, use 28 of the pLysS plasmid should facilitate the lysis of E. coli host cells expressing the library 29 polypeptide constructs. 30 Arraying single-cell clones 31 Prior to induction of fusion polypeptides, individual clones are arrayed at unique 32 locations. The location from which each library polypeptide is derived will serve to identify 33 it during subsequent screening steps. Each unique location is tracked throughout the 31 WO 00/49417 PCT/USOO/04089 1 screening, either by directly moving each segregated library polypeptide sequentially to 2 other, correspondingly unique locations, or by indirectly tracking the origin of each library 3 polypeptide via its corresponding location-determinable support, which is adhered to the 4 library polypeptide via the adhesion moiety that was incorporated in the above-described 5 fusion construct. 6 Methods for generating single-cell clones are known to the art. For example, the 7 library is first plated to permit well-isolated colonies to grow. Cells from individual colonies 8 may be isolated manually or via automated techniques such a colony picker, and cells from 9 -each isolated colony are placed at its corresponding unique location to generate a single-cell 10 clone. Commercially available microtiter trays, for example in 96 or 384 well formats, 11 provide convenient arrays for generating and tracking a unique location for each such single 12 cell clone. Alternatively, as described in more detail below, the process may be automated 13 for generating arrays with large numbers of single cell-type clones, each of which generates a 14 correspondingly unique library polypeptide. 15 Lysing the host cells 16 Following induction and expression, the host cells are harvested and lysed and the 17 polypeptide-bearing lysate collected. A variety of lysing techniques are suitable for use in 18 this invention, including without limitation the three techniques described in detail below. 19 The cells also may be sonicated, for example with the use of commercially available 20 sonicators designed for use with, e.g., 96 well plates (e.g., Misonix Incorporated. Model 431 21 T). 22 In one embodiment, host cells are lysed using osmotic shock. This technique is a simple 23 method of preparing the periplasmic fraction of expressed proteins. In E. coli strains 24 containing the pLysS plasmid, standard osmotic shock techniques can be modified as 25 follows: T7 lysozyme-containing host cells are resuspended in ice-cold 20% sucrose, 2.5mM 26 EDTA, 50mM Tris-HCl pH 8.0 to a concentration of OD 550 =5 and incubated on ice for 10 27 minutes. The cells are centrifuged at 15,000xg for 30 seconds, the supernatant discarded, and 28 the pellet resuspended in the same volume of ice-cold 2.5mM EDTA, 20mM Tris-HCl pH 8.0 29 and incubated on ice for 10 minutes. The cells are centrifuged at 15,000xg for 10 minutes. 30 The supernatant contains protein fraction released due to osmotic shock. Total protein is 31 assessed using the BCA Protein Assay kit. 32 In another embodiment, the host cells are lysed by employing a freeze/thaw protocol. 33 This technique is intended for cells containing the pLysS plasmid. Such cells are 32 WO 00/49417 PCTIUSOO/04089 I resuspended in 1/10 culture volume of 50mM Tris-HCl pH 8.0, 2.5mM EDTA. The cells are 2 frozen at -80'C and then rapidly thawed in order to lyse the cells. The cell debris are pelleted 3 at 15,000xg for 10 minutes and the supernatant saved. To shear the DNA, a DNA nuclease 4 solution is added and incubated for 15-30 minutes at 30*C. The number of freeze/thaw cycles 5 required is determined by monitoring lysate protein concentration. 6 In yet another embodiment, the host cells are lysed by addition of a mild detergent. 7 This technique is also intended for cells containing the pLysS plasmid. Host cells lacking 8 the pLysS plasmid were resuspended in 1/10 culture volume of 50mM Tris-HCI pH 8.0, 9 2.0 mM EDTA and 100 gg/ml lysozyme. Cells were then incubated for 15 minutes at 10 30'C. Triton X-100 was added to a final concentration of 0.1% and incubated for 15 11 minutes at room temperature. The cell debris were pelleted at 15,000xg for 10 minutes 12 and the supernatant saved. To shear the DNA, a DNA nuclease solution is added and 13 incubated for 15-30 minutes at 30'C. 14 EXAMPLE 2 15 PREPARATION OF MICROBEADS 16 17 A variety of supports can be used as randomizable supports for binding ligands, and 18 location-determinable supports for binding the library polypeptides. Suitable supports 19 include beads in a variety of sizes and compositions. Selection of a particular bead depends 20 in part upon the type of adhesion to be used (i.e., chemical/covalent linking, or linking 21 through biological adhesion moieties), and the size and type of library polypeptide or other 22 ligand to be adhered to the bead. 23 One preferred system uses polystyrene microparticles of, e.g., 10gm, to adsorb 24 proteins onto the surface of the bead (Polysciences, Inc. or Bangs Laboratories, Inc.). Library 25 polypeptides are adhered to such supports by hydrophobic interactions between the library 26 polypeptides and the bead surface. Other ligands are adhered by, e.g., synthesizing the 27 combinatorial ligand library on the surface of the bead itself, or by incorporating a reactive 28 functional group into the ligand structure, by which a covalent link is formed to the bead 29 surface. 30 The polystyrene beads are exposed to, e.g., the individual library polypeptides 31 uniquely located in the library arrays by suspending an aliquot of the beads in a buffer that is 32 compatible with the chosen lysate solution (e.g., for mild detergent lysis, 1% Triton X-100 33 may be used) and pipetting aliquots into each 384 well format microtiter well. The beads are 34 mixed by repetitive pipetting or by shaking the array plates to ensure maximal dispersion. 33 WO 00/49417 PCT/US00/04089 I The beads are left in for approximately 5-15 minutes to several hours, depending on the scope 2 of the population to be screened, to ensure greater than approximately 70-100% maximal 3 adhesion of the polypeptides to the microsupports. Exact conditions are optimized by routine 4 testing familiar to one of ordinary skill in the art. The beads bearing the library polypeptides 5 or other ligands then are removed, for example by vacuuming the soluble contents of each 6 well through the base of a 384 well filter plate and then collecting the remaining coated 7 beads, which are then utilized for interaction screening, as described below. 8 Another preferred embodiment utilizes streptavidin coated polystyrene beads to bind 9 fusion proteins containing biotin. Such beads feature streptavidin molecules saturated to 1.8 10 mgs per gram of 10pm polystyrene particle. To form such beads, streptavidin molecules I1 (Pierce) are coupled to polystyrene beads having surface carboxyl reactive groups 12 (Polysciences, Inc. or Bangs Laboratories, Inc.) using techniques familiar to those in the art. 13 The particles are placed in the buffer 2-[N-morpholino]ethanesulfonic acid (MES). They are 14 reacted with 1 -ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Pierce) 15 and N-hydroxysuccinimide (NHS) (Pierce) to form an acyl amino ester. Alternatively, the 16 particles are reacted with EDC to form an amine-reactive O-acylurea intermediate, which can 17 then react with the free amine on a polypeptide to covalently link the polypeptide (e.g., 18 streptavidin) to the bead surface. After washing with MES to remove excess reagents, excess 19 streptavidin (e.g., 18 mgs per gram of bead) is added and the reaction mixed. The derivatized 20 beads are then ready to bind biotin-bearing fusion polypeptides. 21 Still another preferred embodiment utilizes a calmodulin surface coating to bind 22 fusion polypeptide constructs that include the calmodulin binding peptide (CBP). Such beads 23 feature approximately 2.3 mgs calmodulin (Sigma) per 1 gram bead, covalently coupled to a 24 10 m polystyrene particle, via the same chemistry described above for covalently linking 25 streptavidin. In embodiments utilizing calmodulin and calmodulin binding protein (CBP), 26 the moieties may be crosslinked as follows. A streptavidin coated 1 Oum particle (prepared as 27 described above) was placed into a bacterial lysate in which a biotin-thioredoxin-CBP 28 (biotrxCBP) fusion protein had been expressed, and the moieties allowed to bind. The beads 29 were then washed to remove nonspecificly bound proteins, and reacted with a commercially 30 available purified calmodulin having FITC covalently attached to the protein (Sigma). In the 31 presence of calcium this interaction takes place (Figure 7). Upon the removal of calcium, the 32 calmodulin/CBP interactions begin to dissociate. However, when the CBP-calmodulin was 34 WO 00/49417 PCT/USO0/04089 I reacted with a crosslinker such as disuccinimidyl suberate, the calmodulin/CBP interaction 2 remained stable even in the absence of calcium. 3 Magnetic beads. 4 In some embodiments, magnetic beads may be used to facilitate collection of the 5 adhered polypeptides, ligands, or interacting pairs. One preferred embodiment of such a 6 magnetic bead features a magnetic core with a polystyrene exterior coating, sized from 1-10 7 pm (commercially available Polysciences, Inc. or Bangs Laboratories, Inc). Such magnetic 8 beads will bind proteins by direct adsorption, via the polystyrene coating. Alternatively, 9 -streptavidin-coated magnetic beads may be used. A variety of sizes are suitable, including 10 135 nm diameter beads (Immunicon, Inc.), 50nm diameter beads (Miltenyi Biotec Inc.), 1p m 11 diameter beads (Bangs Laboratories), 2.8 im diameter beads (Dynal Inc.) and 5pm diameter 12 beads (CPG Inc.). In still another embodiment, calmodulin coated magnetic particles are 13 used. Such particles are synthesized by the same technique described above for streptavidin 14 coated microparticles, but with the exception that calmodulin is substituted for streptavidin. 15 Again, the starting particle is a magnetic particle with carboxy functional groups on the 16 surface (Bangs Laboratories or Polysciences, Inc.). 17 Interactions of a protein on a 1 Oum polystyrene bead and a protein on a 150nm 18 magnetic bead were carried out in two systems. In one system, one set of l0um beads 19 (prepared as described above) were coated with biotin, and another set of 150nm magnetic 20 beads (Immunicon) were coated with streptavidin. A reaction tube was set up with 106 BSA 21 coated 1Oum beads, about 200 1Oum biotin coated beads and about 108 150nm streptavidin 22 coated particles in PBS with 0.5% BSA. Figure 8. These were reacted together for fifteen 23 minutes to allow for binding between the biotin and streptavidin moieties. In order to enrich 24 for these aggregates, a neodymium-iron-boron magnet was placed to the side of the tube and 25 the liquid removed. After several washes with PBS the number of biotin coated and BSA 26 coated particles were counted with a hemacytometer. It was found that the mixture had been 27 enriched several thousand fold for the biotin coated particles. 28 The other system examined the interaction of SV40 large T antigen with an antibody 29 to the antigen. First, streptavidin coated 10 pim beads prepared as described elsewhere herein 30 were added to a lysate containing a biotin thioredoxin SV40 large T antigen fusion protein 31 (prepared as described elsewhere herein). About 200 of these large T antigen coated beads 32 were added to a mixture of about 106 BSA coated 1Oum beads, along with some 1010 150nm 33 magnetic beads coated with goat anti-mouse secondary antibodies (Immunicon), and 0.5ug of 35 WO 00/49417 PCT/USOO/04089 I mouse anti-SV40 large T antigen (Santa Cruz). Figure 9. The reaction proceeded as above. 2 Again the enrichment was several thousand fold for the 1 Oum SV40 -large T antigen coated 3 beads. 4 Fluorescence-tagged beads. 5 In order to distinguish one type of ligand from another, each such ligand may be 6 adhered to a randomizable support that bears a corresponding unique tag. One way of 7 creating a unique tag is to adhere to the exterior surface of a nonporous randomizable 8 support, or to entrap within interior regions of a porous randomizeable support, a particular 9 -mixture of fluorescent dyes - a unique fluorescent dye identifies, also referred to herein as a 10 fluorescent "bar code". The fluorescent dyes may be organic in nature, or alternatively may 11 be fluorescent nanoparticles. Two variables contribute to the bar code -- type of dye (i.e., its 12 particular emission spectrum) and concentration of dye (i.e., intensity of its emission signal). 13 A wide variety of fluorescent dyes with well-characterized excitation and emission spectra 14 are commercially available. For example, Molecular Probes, Inc provides a variety of 15 organic dyes; (see TABLE 1, below). Alternatively, fluorescent nanoparticles may be 16 obtained that feature specific excitation and emission spectra. Such nanoparticles are 17 described by Bruchez et al, Semiconductor nanocrystals asfluorescent biological labels, 18 Science 281: (5385):2013-16 (Sept. 1998) and Cahn, W.C. and Nie, S, Quantum dot 19 bioconjugatesfor ultrasensitive nonisotopic detection, Science 281(5385):2016-18 (Sept. 20 1998), the disclosures of which are incorporated herein in their entireties. Indeed, it is 21 possible to procure sets of fluorescent molecules that cover the spectrum from blue to red. 22 Each dye has characteristic excitation and emission spectra that may be used to create a bar 23 code. 24 In one embodiment of the invention, a set of fluorescent bar codes is created that is 25 sufficiently large to uniquely identify each member of a ligand pool on the order of 1 x 106 26 members (i.e., roughly each protein encoded by a human cell). Optimally, the corresponding 27 set of unique tags is generated from a set of 4-10 separate fluorescent dyes. The dyes are 28 chosen so that there is optimal compatibility of their excitation and/or emission maxima when 29 such dyes are irradiated by any one of a given FACS machine lasers, including Argon and 30 Helium-Neon. The dyes are selected further so that there is minimal overlap of their 31 emission maxima. Moreover, the dyes are chosen so as to be distinguished from any 32 autofluorescence emissions of the bead to be labeled. However, as described below, it is 33 possible to choose dyes that have some overlap because the dye cross-talk can be 36 WO 00/49417 PCT/USOO/04089 1 mathematically reduced or eliminated by certain computations that can be performed off line 2 (i.e., by computers that use stored fluorescence data files as input). 3 TABLE 1 4 EXEMPLARY ORGANIC DYE SPECIES 5 Molecular Dye Name Excitation Emission Probes, Inc. wavelength maxima Catalog # (nm) (nm) A-191 7-amino-4- 351 430 methylcoumarin B-3932 bodipy@ 665/676 665 676 C-652 5-(and-6)- 599 667 carboxynaphtho D-113 dansylcadaverne 335 520 D-275 DiOC18 484 499 D-282 DiOC18(3) 548 564 D-307 DiOC18(5) oil 644 663 D-2184 Biodipy@ FL, SE 488 530 D-2186 bodipy@ 530/550 530 550 D-2187 bodipy@ 530/550SE 530 550 D-2190 bodipy@ 493/503 493 503 D-2191 bodipy@ 493/503SE 493 503 D-2219 Bodipy@ 558/568, SE 558 568 D-2221 bodipy@ 561/570 561 570 D-2222 bodipy@ 564/570SE 564 570 D-2225 Bodipy® 576/589 576 589 D-2227 bodipy@ 581/591 581 591 D-2228 Bodipy@581/591,SE 581 591 D-3921 bodipy@ 505/515 505 515 D-3922 bodipy@ 493/503 493 503 D-6102 Biodipy@ FX-X, SE 488 530 D-6117 Bodipy@ TMR-X,SE 540 560 D-6180 Bodipy@ RGG,SE 530 550 D-6186 Biodipy@ R6G-X, SE 530 550 fluorescein D-10000 Bodipy@ 630/650- 630 650 X,SE D-10001 Bodipy@650/665-X,SE 650 665 D-12731 DiOC18(7) 748 780 N-1142 nile red 552 636 6 7 In other embodiments, fluorescent nanocrystals (Quantum Dot, Corp., Palo Alto CA) 8 may be utilized as the fluorescent dye species forming the barcode. Briefly, the nanocrystal 9 is a semiconductor material such as zinc sulfide-capped cadmium selenide. The nanocrystal 10 also may feature an outer layer to aid in derivatization and/or to aid solubility, for example 11 mercaptoacetic acid (Chan and Nie (1998), supra), or silica derivatives (Bruchez et al. 37 WO 00/49417 PCT/USOO/04089 1 (1998), supra. The emission spectrum of the nanocrystal is dependent upon the size of the 2 cadmium selenide core of the crystal. 3 Fluorescent nanocrystals may be coupled with the beads in a variety of ways. One 4 general approach is to apply absorption techniques such as are used in absorbing organic 5 fluorochromes to beads. Briefly, the nanocrystals can be rendered nonpolar for this purpose 6 by coating the nanocrystals with a nonpolar coating such as an alkyl silane. A polystyrene 7 bead having a porous structure is then exposed to the nonpolar fluorescent nanocrystals, using 8 methods familiar to those in the art. The nanocrystal then equilibrates into the corresponding 9 nonpolar interior of the polystyrene bead, and is maintained there by repulsion from an 10 aqueous solvent. Optionally, more porous particles (Dyno Particles, Inc.) may be utilized to 11 increase the available interior region. 12 Alternatively, the nanocrystals may be linked to the selected beads via covalent 13 bonds, using a variety of different chemistries familiar to those of skill in the art. In such 14 embodiments both the bead surface and the nanocrystals are derivatized with surface reactive 15 groups. In some embodiments, the bead features a porous surface, allowing the nanocrystals 16 to diffuse into the interior regions of the bead prior to covalently cross-linking with the bead. 17 In other embodiments, nonporous bead particles may be used, in which case the nanocrystal 18 is crosslinked to the exterior surface of the bead. 19 A variety of beads and crosslinking chemistries are suitable for use in this invention. 20 For example, in some instances it is advantageous to use porous silica particles having low 21 autofluorescence. As one nonlimiting example, carboxyl coated silica particles (CPG, Inc.) 22 of a desired size (e.g., 10 pim diameter) are selected. The nanocrystals are first reacted with 23 an amine silane, thereby forming an amine functional group. The derivatized beads and 24 nanocrystals are then mixed together so that the nanocrystals diffuse evenly throughout the 25 particle. A crosslinking agent such as EDC (1-ethyl-3-(3 26 dimethylaminopropyl)carbodiimide) is then added, thereby conjugating the nanocrystal to the 27 derivatized silica particle. In other embodiments, other derivatized particles may readily be 28 substituted. 29 38 WO 00/49417 PCT/USOO/04089 1 Fluorescence barcoding. 2 The barcoding system uses a set of dye species chosen with the considerations 3 enumerated above, as exemplified but not limited to those dyes in Table I or the nanocrystals 4 described above. The identity of each randomizable support is encoded as a numerical 5 readout having digit placeholders equal to the number of dyes used (e.g., nine dyes create 6 nine "digits" in the barcode). Each digit in the barcode is then further defined by the amount 7 of the specific dye, as determined from its fluorescence intensity (i.e., Ox, lx, 2x, 3x or 4x). 8 Thus, for 9 dyes and 5 amounts (or fluorescence levels) there are (5)9 possible barcodes. 9 The beads are labeled with dyes-by mixing the selected number of dyes in defined 10 ratios such that a specific bead receives a unique barcode. For example, using nine different 11 dyes one defined bead type may receive dyes in the ratio of (4, 2, 3, 3, 1, 1, 2, 4, 2); a second 12 bead type may receive dyes in the ratio (2, 2, 3, 3, 1, 1, 2, 4, 2). These beads differ only in 13 the levels of the first dye (the first bead type has level 4, the second has level 2). 14 Fluorescent organic dye species may be selected from a wide variety of known dyes 15 and incorporated into a wide variety of known beads, utilizing techniques familiar to those of 16 skill in the art. E.g., U.S. Patent No. 5,573,909, the disclosure of which is incorporated by 17 reference herein in its entirety. As a non-limiting example, by mixing the dyes in an organic 18 solvent such as, e.g., acetonitrile or dimethylformamide, and adding the dye solutions in 19 defined ratios to individual groups of beads and allowing the absorption reactions to go to 20 completion, it is possible to irreversibly adsorb dye molecules onto the bead surface and 21 interior. Removal of the organic solvent followed by drying, leaves the beads labeled with 22 the nine dyes in the predetermined amount dispersed over the surface of each bead. 23 Fluorescently labeled beads prepared in this general way but with only one or a few 24 fluorescent tags have been described in the literature (Michael et al., Analytical Chemistry 25 70(7):1242-48 (1998); Fulton et al., Clinical Chemistry 43(9):1749-56 (1997)) and are 26 available commercially (Luminex Corp.). 27 As one non-limiting example of the barcoding strategy, four dyes were selected for 28 study: BioDIPY 493N, BioDIPY 560PA, BioDIPY580PA and BioDIPY665N. The dyes 29 were incorporated into polystyrene beads (Bangs Labs, Inc. PSO7N) beads as follows. The 30 selected dyes were dissolved in dimethylformamide (DMF). The beads were washed three 31 times with absolute ethul alcohol (and stored in same). A staining mix was prepared, 32 containing 10% DMF, 54% absolute ethyl alcohol and 36% dichloromethane (approximating 33 a 60:40 ratio of ethyl alcohol to dichloromethane). The beads were added and rapidly stirred 39 WO 00/49417 PCTIUSOO/04089 I for ten minutes. The staining solution was then removed from the beads by centrifugation or 2 filtration and the beads were washed two times with absolute methanol followed by two 3 washes of PBS/l% TWEEN 20. The dyed beads were then stored in the PBS/TWEEN 20 4 mixture at 4' C, protected from light. The beads were doped with five different 5 concentrations of each dye, as summarized below in Table 2. 6 TABLE 2 7 SUMMARY OF DYE PROFILES 8 DYE 1 CODE LEVEL 1CONCENTRATION (pM) BIODIPY® D-2190 (NONPOLAR) T_________________1_________________ ____________________T2 T0.43 1 0.043 5 0.01 F BIODIPY8 D-2221 (PROPIONIC ACID) [__________________ __ ________________ FEX 460NM IEM 570NM _______________ _______ ________ F _____________________11 F159 ______________________12 F68 _____________________ _______________5____ 1 1.61 BIODIPY® D-2227 (PROPIONIC ACID) 1__________________ j____ ______________1 EX 580 NM / EM 590 NM hA;_______________1_________________ __ __ __ T1 1 1321 F _ _ _ _ _ _ F _ _ _ _ __5 1.3 F BIODIPY® B-3932 (NONPOLAR) FEX 665 NMI/EM676 NM 1________________ _ __ __ _ 11 100__ __ F _____________________12 1431 __ __ _ _ __ _ _3 101 ________________4___ 14.3_________________ 1- 5 1____ 9 40 WO 00/49417 PCT/USOO/04089 Next, the fluorescence intensity of each dye was characterized in isolation of the 2 others, at five different levels. Table 3 summarizes the resulting fluorescence levels detected 3 in four different windows -- FL1 (525 nm +/-10 nm), FL2 (575 nm +/- 7 nm), FL3 (620 nm 4 +/- 13 nm) and FL4 (675 nm +/- 15 nm). For each of the four dyes, the fluorescence intensity 5 decreased proportionally to the decreasing dye content of the bead. Moreover, each dye 6 provided a suitably distinct fluorescence signature. 7 Next, the four selected dyes were mixed in varying combinations of dyes/intensity 8 levels, as shown in Table 3. The resulting fluorescence intensities were as shown, 9 - demonstrating that the-resulting beads provided discernable labeling information regarding 10 both dye concentration and composition. I I TABLE 3 12 FOUR DYE FLUORESCENCE CODING BODIPY 493N BODIPY 560PA BODIPY 580PA BODIPY 665N FLI FL2 FL3 FL4 LEVELS LEVELS LEVELS LEVELS 53_85 4._ 1 537 8.5 4.8 1 2 248.4 3.8 2.2 1 3 45 1.2 1.1 1 4 20.4 1.1 1.1 1 5 3.9 1 1 1 1 43.9 304.2 427.8 17.2 2 19.4 124.4 180.6 7 3 3.3 20.7 33.5 1.4 4 1.5 8.6 13.9 1.1 5 1.3 2.3 5.3 1 1 _94.9 20.1 345 19.7 2 37.4 8.2 140.4 7.8 3 6.3 1.6 30 1.7 4 2.5 1.2 12.8 1.1 5 1.2 1.1 3.4 1 1 4 1.6 11.2 55.8 2 1.7 1.2 5.3 25.6 3 1.1 1 2.3 5.3 4 1 1 1.7 2.3 T5 1 1 1.4 1 1 1 505.4 294.3 446.3 18.8 1 1 529.7 24.8 334.7 19.2 1 1 450.5 7.8 14.5 55.4 1 1 117.6 299.7 796.1 41.6 1 1 41 234.5 361.4 74.9 1 1 63 15.7 260.6 74.7 41 WO 00/49417 PCT/USOO/04089 4 1 60.3 268.8 443.8 20.4 4 1 87.5 18 326.4 20.3 4 1 22.2 2.1 11.4 58.2 1 4 505.8 12.8 - 20.1 1.3 4 1 75.4 23.5 363.2 22.8 4 4 4.8 5.5 22.3 60.5 1 4 497.5 8.5 16.2 1.3 1 4 43.9 266.6 454 21.5 4 1 5.5 2.2 19.8 59.6 1 4 489.8 7.8 5 .9 1 4 41.4 261.7 438.5 4 72.7 17.6 327.8 22.8 2 Oligonucleotide-tagged beads. 3 In some embodiments, it is possible to construct a sufficient number of unique 4 oligonucleotide tags and to attach such tags to the randomizable supports by, e.g., linking the 5 oligonucleotide to a biotin linker and adhering that linker to a streptavidin-coated bead such 6 as those described above. The oligonucleotide tags bear unique DNA sequences, each of 7 which can be correlated to a given ligand. 8 Such DNA tags can be built in one of several ways. For example, using techniques 9 well known to the art, a multichannel oligonucleotide synthesizer can generate a set of DNA 10 molecules with unique sequences of any given length. Once individual oligonucleotide tags 11 characterized and isolated into homogeneous tag pools, the tags can be adhered to the 12 randomizable supports in a variety of ways. For example, if the randomizable supports have 13 a streptavidin coating, then a biotin adhesion moiety is joined to each oligonucleotide tag at 14 the 5' end by standard synthesis techniques. If the randomizable support is coated with other 15 adhesion moieties, the complementary adhesion moiety can be chemically coupled to a 5' 16 amino-modified oligonucleotide tag. 17 The oligonucleotide tags may be read either by sequencing, by evaluating sequence 18 length, or by hybridization. For sequencing information, the oligonucleotide tags resident on 19 each bead are subjected to PCR, and then run on a sequencing gel. Alternatively, the 20 oligonucleotide tags may be identified via exposing the tags to known hybridization probes. 21 Mass spectrometry tags 22 Another suitable method for encoding identities of beads involves use of mass tags - 23 i.e., labels that can be detected by mass spectrometry. Such mass tags are known in the art 24 and must be coupled to the beads in different amounts so as to generate a mass tag bar code. 42 WO 00/49417 PCT/USOO/04089 1 This code can be read by subjecting the beads to mass spectrometry pursuant to methods 2 familiar to those of the art, or by use of gas chromatography. 3 Radio-frequency tags. 4 As yet another alternative for encoding identity information on beads, the beads may 5 be engineered to emit unique, identifying radio signals of various pre-determined frequencies. 6 Such beads may contain, e.g., miniaturized transmitter/receiver circuitry, rectifier, control 7 logic and antenna. Each set of beads thus may contain a unique label laser-etched on the 8 internal chip within the bead. Emissions from the radio-frequency tags are detected by a 9 corresponding radio-frequency detector. 10 Beads with mixed tags. 11 In some embodiments, the number of different ligand populations to be uniquely 12 tagged will be quite large -- on the order of 1 x 106 or more. Although a corresponding 13 number of unique fluorescent bar code tags, mass spec tags or DNA oligonucleotide tags 14 could be formulated as described above, in some instances it may be desirable to make tags 15 that are some combination of fluorescent, mass spec and/or oligonucleotide information. For 16 example, oligonucleotide tags or mass spec tags may be incorporated so as to reduce the 17 number of fluorescent dyes used. Such techniques may advantageously reduce or avoid any 18 instances of fluorescent quenching or fluorescence resonance energy transfer (FRET), and/or 19 may expand the number of bar codes that can be used. 20 Bead-polypeptide interactions 21 To test the bead:bead interactions of the invention, several proteins were inserted into 22 pET-biotrx-BirA and overexpressed in BL21 (DE3) RIL cells: murine p53, SV40 large T 23 antigen, HPV16 E7 and the "Rb pocket" of the Retinoblastoma gene. The E7 and p53 24 polypeptides were bound to the beads via the associated biotinylation signal, and were 25 detected on the beads with antibidies specific to E7 and p53, respectively. 26 27 EXAMPLE 3 28 HIGH THROUGHPUT SCREENING OF A COMPREHENSIVE HUMAN PROTEIN 29 LIBRARY FOR PROTEIN-PROTEIN INTERACTIONS 30 31 The goal of the process is to examine in a quantitative or semi-quantitative fashion all 32 possible pairwise interactions between human protein domains. This involves a test of "n x 33 n" interactions, if "n" is the number of human protein domains. Values for "n" likely fall 43 WO 00/49417 PCT/USOO/04089 1 between 100,000 and 1,000,000. For an interaction screen of this scope, automation of at 2 least some of the following procedures is desirable. 3 To summarize, one embodiment of the process involves a series of steps: (1) 4 generation of a library of expressed human sequences in an E. coli expression vector such 5 that the human DNA is expressed as a fusion with a suitable adhesion moiety; in addition, 6 part of the fusion protein may serve as a recognition sequence tag for attaching labels (e.g., 7 fluorescent antibody labels) so that the protein can be detected; (2) enrichment of the library 8 for clones that contain constructs that are in-frame and expressed at reasonable levels; (3) 9 arraying of the enriched library clones in microtiter plates; (4) growth and induction of the 10 individual library clones to produce fusion proteins inside E. coli; (5) preparation of E. coli I1 lysates to release the expressed fusion proteins from cells; (6) generation of a primary set of 12 beads barcoded with suitable combinations of fluorescent dyes to act as randomizable 13 supports; (7) apportioning of beads to individual wells of microtiter trays to permit adhesion 14 of lysate fusion proteins to the randomizable supports (also referred to herein as "primary 15 beads"); (8) apportionment of secondary magnetic beads (as location-determinable supports) 16 to microtiter wells to allow adhesion of lysate proteins as in 7; (9) mixing of primary and 17 secondary beads to permit aggregation of beads with interacting proteins on their surfaces; 18 (10) magnetic capture of secondary beads and attached primary beads to enrich for primary 19 beads with proteins that interact with protein on the surface of secondary beads; (11) mixing 20 of enriched primary beads with soluble fusion protein in microtiter wells to allow interaction 21 of soluble protein with proteins on the surface of primary beads, as well as detachment of 22 secondary beads; (13) magnetic capture and disposal of secondary beads; (14) collection of 23 primary beads and crosslinking of bound protein using, e.g., paraformaldehyde; (15) 24 exposure to labeling agent (e.g., fluorescent antibody) to enable detection of bound secondary 25 proteins; and (16) detection of labeling agent and barcode reading to determine identity of 26 primary protein (on bead surface) and amount of secondary protein attached via interaction 27 with primary protein. Other embodiments may add to, alter or delete some of the above 28 steps, in ways that will be apparent to one of ordinary skill in the art. 29 Steps 1 and 2 --generation and enrichment of the polypeptide library to be cross 30 screened in order to generate a protein interaction may -- is described in detail in Example 1, 31 above. 32 Step 3 involves plating out and growing up single-cell clones that produce only one of 33 the library polypeptides at a given unique array location. To accomplish this, a commercial 44 WO 00/49417 PCT/USOO/04089 1 robot may be used (e.g., Genetix Ltd. "Q-botTM; TM Analytic, PBA Flexys T M ; BioRobotics 2 Ltd, BioPickTM; or Linear Drives Ltd., MantisTM; any of which with multiple pin tool picking 3 head) to select out a single colony and transfer the cells to a corresponding unique array 4 location in e.g., a 384 well microtiter plate (40 pl volume). Each clone in the array is grown 5 in, e.g., Luria broth or minimal media until early- to mid- log phase, and then expression of 6 the human protein domain construct is induced by adding IPTG (step 4). After a suitable 7 period of time to allow polypeptide expression, the cells are then lysed (step 5) by the method 8 described in detail in Example 1. Thus, each unique location in the chosen array format (384 9 -well plate or other) will contain a lysate bearing one particular human protein domain, 10 amongst the milieu of native E. coli proteins. 11 Alternatively, for ease of generating and processing the lysate from the single cell 12 clone, a single colony may be picked and transferred to a correspondingly unique 13 intermediate container of larger volume for growing up the clone. Once the clone is finished 14 culturing, a sample is taken from the intermediate container and is concentrated and lysed as 15 described in detail in Example 1. An aliquot of the lysate is then transferred to a unique array 16 location in a 384 well microtiter plate (40 pl volume). 17 Step 6 involves the generation of the primary set of beads with fluorescent barcodes. 18 These beads are the randomizable supports that will allow presentation of an aliquot bearing a 19 fully integrated collection of lysate protein domains to each such domain independently, to 20 map all possible interactions amongst those protein domains. Example 2 describes 21 preparation of these uniquely tagged fluorescent beads in detail. 22 Once each primary set of beads with a corresponding unique fluorescent tag is 23 generated, the bead sets are suspended in buffer. A sampling from each tagged bead set is 24 then dispersed into a corresponding array location, so that the tagged primary beads adhere to 25 the protein domains therein (step 7). This may be accomplished by e.g., automated aspiration 26 of the beads into the wells (e.g., TecanAG GenesisTM; Matrix Technologies Corp. 27 PlateMateTM; Carl Creative Systems, Inc. PlateTrakTM) or hopper release of beads into wells. 28 Conversely, an aliquot of the lysate may be aspirated or released from a hopper into a 29 corresponding microtiter well that already contains these primary fluorescent beads. In either 30 event, the beads and protein domains are brought into contact and allowed to adhere via the 31 adhesion moiety fused to the protein domain. The identity of the adhered protein thereafter 32 can be determined via the corresponding, unique fluorescent bar code tag on the bead. 45 WO 00/49417 PCT/USOO/04089 I Once each of the unique array locations (i.e., polypeptides or other substrates) has 2 been exposed to a corresponding set of beads bearing a unique tag, all beads are collected and 3 mixed to form a fully integrated set of protein-bearing beads. This random mixing is 4 accomplished by multiple, automated aspiration and release cycles, by plate agitation with a 5 robotic shaker, or by mechanical stirring. 6 Next, the secondary set of magnetic beads are prepared in situ in each of the unique 7 locations in the library array (step 8). This is accomplished by adding an aliquot of beads to 8 each library as in step 7. Alternatively, a robotic hand with magnetized fingers may be used 9 to capture the magnetic beads and then release the beads in each of the corresponding array 10 locations on the, e.g., 384 well plate, by dipping the fingers into the lysate and demagnetizing 11 the fingers. 12 Aliquots taken from the fully integrated set of primary beads are then collected and 13 dispensed into each unique array location, each of which contains a location-determinable set 14 of secondary beads with adhered protein domains (step 9). The number of primary beads (i.e. 15 randomizable substrates) should be sufficient to reduce probability of not having a particular 16 polypeptide/bead to a small value -- e.g., less than 1:100 probability. This may be 17 accomplished by aspirating and dispensing, as above. This step allows complexes to form 18 between the protein domains adhered to the primary and secondary beads at each array 19 location, and hence forming bead-bead aggregates. 20 Complexes of adhered beads are then retrieved magnetically (step 10) with, e.g., a 21 neodymium-iron-boron magnet (Master Magnetics Inc.). The magnetic aggregates using 22 relatively large magnetic beads (i.e. larger than about 50 nm diameter) are magnetically 23 attracted to the sides of the microtiter wells, either on one side or around the entire perimeter 24 of the wells. Remaining beads are washed away. As yet another alternative, a ferromagnetic 25 pin is placed in the center of the well, with magnets located on the outside of the well. 26 Geometry of the pin and magnet is selected so that the induced magnetic field on the pin will 27 attract the beads, and beads that do not react are removed. 28 Quantification of polypeptide-ligand complexes may be facilitated by replacement of 29 bead-bound protein domain with a soluble, unbound form of the domain (step 11). This is 30 accomplished by introducing the enriched bead complexes derived from step 10 into a 31 soluble protein domain lysate that matches the protein domain on the secondary bead (i.e., the 32 location-determinable domain). Alternatively, the beads may be exposed to the products of a 33 separate library that contains polypeptide inserts that correspond to each polypeptide moiety 46 WO 00/49417 PCT/USOO/04089 1 that is adhered to the bead, but which has a unique labeling domain or epitope. This is 2 readily accomplished by placing the complexes that correspond to, e:g., an array location 3 designated "1" in a first a set of primary 384-well microtiter trays (step 3) into a 4 corresponding location, e.g., designated "1 "', of a duplicate microtiter tray that was prepared 5 in parallel in step 3. Since array location 1 and 1' contain the same lysate, the free lysate in 6 1' will competitively displace the bead-bound lysate of the complex. As a result, the primary 7 bead will now bear two layers of protein domains, adhered to one another via protein-protein 8 interactions. 9 Once the protein-protein interactions are established, the primary beads are collected 10 in a manner that segregates the beads in groups that correspond to each separate array II location from which the protein bound to the secondary bead originated and the bound 12 proteins crosslinked with, e.g., paraformaldehyde (step 14) to stabilize the complexes by 13 preventing dissociation. 14 These stabilized protein-protein pairs are then exposed to a fluorescent antibody (step 15 15). As one non-limiting example, one may detect a bound secondary protein by using a 16 fluorescently-labeled antibody directed against one of the fusion protein epitopes (used as a 17 recognition domain and shared among all library constructs), e.g., a FLAG or biotin epitope. 18 The antibody is incubated with the crosslinked beads, such that it binds to exposed or unique 19 epitopes on the secondary protein; i.e., the labeling agent must recognize an epitope that is 20 either absent from the primary fusion polypeptide, thus necessitating construction and array 21 of a separate library for the secondary polypeptide, or an epitope that is inaccessible on the 22 primary polypeptide). Alternatively, fluorescently labeled avidin may be used. These beads 23 are washed in binding buffer and then analyzed as described below. The fluorescence 24 intensity of the antibody fluorochrome serves as a surrogate for the amount of bound 25 secondary protein. 26 Finally, in step 16, the beads bearing these segregated, labeled protein pairs are then 27 examined by a detecting device to quantify conjugates that have the antibody or biotin label. 28 In one preferred embodiment, the fluorescence information (both wavelength and intensity 29 signatures) are simultaneously read and used to identify the protein domain adhered to that 30 bead. Alternatively or in conjunction, the beads are decoded using familiar techniques such 31 as sequencing or hybridization of oligonucleotide tags, or mass spectrometry to identify mass 32 tags. 47 WO 00/49417 PCT/USO0/04089 I This sorting and/or detection step can be accomplished via one of a number of 2 instruments. Two general categories of instrument have particular utility: a flow cytometry 3 instrument such as a FACS machine or flow analyzer; CCD detector or photomultiplier tube 4 scanner. Each device must have certain capabilities. It must permit rapid analysis of beads 5 using, in the case of FACS, multiple lasers for excitation (e.g., three lasers), and detection of 6 fluorescent emissions at multiple wavelengths (e.g., 3-10 wavelengths). Such capabilities 7 presently exist in the Cytomation flow sorter. The three lasers excite cells or beads in liquid 8 droplets sequentially as the droplets fall in a stream. A series of filters and photo-multiplier 9 - tubes (PMTs) then collect emitted light-at different preselected wavelengths. These data are 10 stored and can be accessed for analysis later off-line from files. II The bead barcode reveals the identity of the primary protein by correlating that 12 protein back to a unique library array location --i.e. the microtiter well that contained the one 13 particular lysate that was exposed to that barcoded primary bead. This barcode is read in the 14 same step as the antibody quantitation is performed. However, to decode a large number of 15 bar codes, multiple measurements on each bead are required. For example, it may be 16 necessary to measure fluorescence emissions of ten dyes at ten wavelengths with specific 17 excitation lasers. These ten measurements provide sufficient information to unambiguously 18 identify each bead according to its specific barcode. 19 The process by which this computation is performed involves two basic steps: (1) 20 parameters are fit to known barcode data; (2) the fitted parameters are used in a 21 deconvolution calculation to determine the bar codes of unknown beads. Total fluorescence 22 of a barcoded bead at a particular wavelength (and at a particular excitation wavelength) can 23 be calculated according to a formula: 24 F= 1 f,+1 2 f 2 +...+.f. 25 where l is the quantity or level of the first dye and f, is the normalized fluorescence 26 contribution of the first dye under particular conditions of excitation and emission (i.e., 27 wavelengths). By generating many beads with defined dye ratios (i.e., bar codes) and 28 measuring their fluorescence (F) at specific wavelengths, it is possible to fit the fn parameters 29 and create at specific wavelengths a set of equations that relate total fluorescence to the 30 individual fluorescences of the different dyes. After this is completed, it is possible to 31 calculate the la's of an unknown bead, thereby determining its barcode and identity. It is 32 necessary to have at least as many independent measurements of F (i.e., at different 33 excitation/emission wavelengths) as there are unknown "I" values in the bar code. 48 WO 00/49417 PCT/USOO/04089 I The fluorescent barcode is used to determine the bead identity, an identity that is 2 linked to the well from which it was originally derived; that is, a barcode matches a well 3 which contained the lysate fusion protein that comprises layer one on the bead. Thus, the 4 nature of the first layer of protein that is adhered to the support can be determined by DNA 5 sequence analysis of the cloned insert in each well. This sequence analysis can be 6 accomplished simply by PCR amplification of insert sequences from each microtiter well 7 using primers on the vector which flank the insert. Standard automated sequence analysis 8 followed by database searches reveals details about each cloned insert. Current sequencing 9 -throughputs permit sequencing of one million inserts in a period of weeks to months. 10 As described above, the fluorescence of a labeling agent, e.g., an antibody against a 11 FLAG epitope serves to quantify the amount of secondary protein attached via protein 12 protein interactions to a bead. If the concentration of protein in the lysate is measured or 13 estimated, and the saturating amount of protein on the bead is known (i.e., how much 14 secondary protein could be maximally bound if all primary protein binding sites were 15 occupied), it is possible to determine the approximate binding constant of the protein-protein 16 interaction from the equation: 17 Kd = [xy]/[x][y] 18 where the ratio [xy] / [x] is simply the ratio of measured bound secondary protein over the 19 saturating (maximal) bound amount, and [y] is concentration of soluble fusion protein in the 20 lysate. 21 22 While the present invention has been described in terms of specific methods and 23 compositions, it is understood that variations and modifications will occur to those skilled in 24 the art in consideration of the present invention. Accordingly, it is intended in the appended 25 claims to cover all such equivalent variations which come within the scope of the invention 26 as claimed, in light of those variations and modifications. 27 49

Claims (25)

1. A method for identifying interacting substrate-ligand pairs, comprising the steps of: (a) adhering a plurality of ligands to a corresponding plurality of randomizable supports bearing a unique fluorescent dye identifier; (b) contacting said ligands with a substrate derived from a unique location so as to form at least one substrate/ligand complex; (c) identifying any complex-forming ligand by its conesponding unique fluorescent dye identifier; and (d) identifying any complex-forming substrate by determining its conesponding unique location.

2. The method of claim 1 , wherein said substrate is an individual polypeptide.

3. The method of claim 1, wherein said substrate is a library polypeptide.

4. The method of claim 3 , wherein said library polypeptide is a native polypeptide.

5. The method of claim 3, wherein said library polypeptide is a member of a large library.

6. The method of claim 3, wherein said library polypeptide is a member of a very large library.

7. The method of claim 3, wherein the identity of said library polypeptide is not known prior to step (a).

8. The method of claim 1 , wherein said ligands are polypeptides.

9. The method of claim 8, wherein said ligands are library polypeptides.

10. The method of claim 9, wherein said library polypeptides are native polypeptides.

1 1. The method of claim 9, wherein said library polypeptides are members of a large library.

12. The method of claim 9, wherein said library polypeptides are members of a very large library.

13. The method of claim 8, wherein the identities of said polypeptides are not known prior to step (a).

14. The method of claim 7, wherein each said substrate derived from a unique location is adhered to a conesponding location determinable support.

15. The method of claim 1 wherein said randomizable support is magnetized and said complexes are segregated by being magnetically culled.

16. The method of claim 14, wherein said location determinable support is magnetized and said complexes are segregated by being magnetically culled.

17. The method of claim 15, wherein said randomizable supports are beads.

18. The method of claim 1 , wherein said unique fluorescent dye identifier is comprises a plurality of fluorescent dye species.

19. The method of claim 18, wherein said plurality of fluorescent dye species includes at least one species of fluorescent nanoparticle.

20. The method of claim 18, wherein said plurality of fluorescent dye species includes at least one species of organic dye.

21. The method of claim 20, wherein said organic dye species is selected from the group consisting of the organic dyes listed in Table 1.

22. The method of claim 1 , wherein said ligands are non-proteinaceous organic molecules.

23. The method of claim 1, wherein said step of identifying comprises the step of detecting each said substrate/ligand complex with a fluorescent label.

24. The method of claim 22, further comprising the step of detecting said substrate/ligand complex with a CCD camera..

25. A human protein interaction map produced by the method of claim 1.