AU3368301A - Transduction of recombinases for inducible gene targeting - Google Patents

Description

WO 01/49832 PCT/EPO1/00060 1 Transduction of recombinases for inducible gene targeting The present invention provides the use of a fusion protein comprising a site-specific DNA recombinase domain and a protein transduction domain for preparing an agent for inducing target gene alteration in a living organism or in cultured cells, suitable fusion proteins and a method for the production of said fusion proteins. Background For some years targeted mutagenesis in totipotent mouse embryonic stem (ES) cells has been used to inactivate genes, for which cloned sequences were available (Capecchi, Trends in Genetics 5, 70 - 76 (1989)). Since ES cells can pass mutations induced in vitro to transgenic offspring in vivo, it is possible to analyze the consequences of gene disruption in the context of the entire organism. Thus, numerous mouse strains with functionally inactivated genes ("knock out mice") have been created by this technology and utilized to study the biological function of a variety of genes. A refined method of targeted mutagenesis, referred to as conditional mutagenesis, employs a site-specific recombination system (e.g. Cre/loxP or Flp/frt - Sauer and Henderson, N. Proc. Nati. Acad. Sci. USA 85, 5166 5170 (1988); Senecoff et al., J. Mol. Biol., 201, 405 - 421 (1988)) which enables a temporally and/or spatially restricted alteration of target genes (Rajewsky et al., J. Clin. Invest., 98, 600 - 603 (1996)). The creation of conditional mouse mutants requires the generation of two mouse strains, i.e. the recombinase recognition strain and the recombinase expressing strain. The recombinase recognition strain is generated by homologous recombination in ES cells as described above except that the targeted WO 01/49832 PCT/EPO1/00060 2 exon(s) is (are) flanked by two recombinase recognition sequences (hereinafter "RRS"; e.g. loxP or frt). The type of recombination event mediated by the recombinase depends on the disposition of the RRS, with deletions, inversions, translocations and integrations being possible (Torres and Kthn, Oxford University Press, Oxford, New York (1997)). By placing the RRS into introns, an interference with gene expression before recombination can be avoided. The recombinase expressing strain contains a recombinase transgene (e.g. Cre, Fip) whose expression is either restricted to certain cells and tissues or is inducible by external agents. Crossing of the recombinase recognition strain with the recombinase expressing strain recombines the RRS-flanked exons from the doubly transgenic offspring in a prespecified temporally and/or spatially restricted manner. Thus, the method allows the temporal analysis of gene function in particular cells and tissues of otherwise widely expressed genes. Moreover, it enables the analysis of gene function in the adult organism by circumventing embryonic lethality which is frequently the consequence of gene mutation. For pharmaceutical research, aiming to validate the utility of genes and their products as targets for drug development, inducible mutations provide an excellent genetic tool. However, the current systems for inducible recombinase expression in transgenic animals suffer from a certain degree of leakiness in the absence of the inducer (KOhn et al., Science 269(5229):1427-9 (1995); Schwenk et al., Nucleic Acids Res.; 26(6):1427-32 (1998)). Furthermore, the generation of conditional mutants is a time consuming and labor intensive procedure, since the recombinase recognition strain and the recombinase expressing strain have to be breed at least over two generations in order to obtain animals carrying both, the recombinase transgene and two copies of the RRS-flanked target gene sequence. Protein tranduction domains (hereinafter shortly referred to as "PTD") that have the ability to cross cell membranes were identified, e.g. in the WO 01/49832 PCT/EPO1/00060 3 Antennapedia protein from Drosophila (Vives et al., J. Biol. Chem, 272(25):16010-7 (1997)), Kaposi fibroblast growth factor (Kaposi FGF; Lin et al., J. Biol. Chem. 270: 14255-58 (1995)), VP22 from HSV (Elliott and O'Hare, Cell, 88(2):223-33 (1997)) and TAT from HIV (Green and Loewenstein, Cell, 55(6):1179-88 (1988); Frankel and Pabo, Cell, 55(6):1189-93 (1988)). WO 99/29721 moreover mentions TAT mutants having an enhanced activity as compared to the wild-type peptide. Fusion of PTDs to heterologuous proteins conferred the ability to transduce into cultured cells (Fawell et al., Proc. Natl. Acad. Sci. USA, 91(2):664-8 (1994); Elliott and O'Hare (1997), Phelan et al., Nature Biotech. 16; 440 443 (1998) and Dilber et al., Gene Ther., 6(1):12-21 (1999)). Dalby and Bennett showed that a fusion protein consisting of VP22 and functional Flp recombinase translocated between cells in culture (from COS-1 cells transfected with VP22-Flp to CHO cells carrying FIp recognition sites (FRT sites); see Dalby and Bennett, Invitrogen, Expressions 6.2, page 13 (1999)). Further WO 99/11809 mentions a fusion protein Antp-Cre and emphasizes that it may be used to deliver the Cre .into the cell which recombines inside the cell nucleus. It is mentioned that the fusion protein is suitable for manipulating genomic DNA at precise locations in a temporal regulated manner. Furthermore, a recent report demonstrated that the 8-galactosidase protein fused to the 11 amino acids PTD from the HIV TAT protein can infiltrate all tissues of living mice reaching every single cell (Schwarze et al., Science, 285(5433):1569-72 (1999)). Finally, WO 99/60142 discloses vector constructs for gene therapy carrying a tumor cell sensitizing gene, a sensitizing gene expression regulatory system, a control gene and a control gene expression regulatory system, wherein the control gene can be a fusion gene consisting of a recombinase (viz. Cre or FIp) and a trafficking protein (viz. VP22).

WO 01/49832 PCT/EPO1/00060 4 With regard to the fusion protein Antp-Cre of WO 99/11809, it is however, general knowledge in the art that the Antennapedia PTD is not a generally applicable transducing protein, namely it has only a limited activity with proteins having more than 100 amino acid residues (Derossi et al., Trends Cell Biol. 8: 84-87, 1998). In view of the limited transducing activity of the Antp PTD and the size of the generally known recombinases (ranging from about 200 to about 600 amino acid residues), it was desirable to provide a more potent system for the transduction of recombinases. It was, however, not clear for a person skilled in the art whether PTDs would be effective at all with recombinases for the following reasons: (i) only a single example of PTD-mediated delivery of proteins (above 100 amino acid residues) in vivo has been reported so far (Schwarze et al., Science, 285(5433):1569-72 (1999); Fawell et al., PNAS, 91: 664-68 (1994); both references describing the TAT-mediated transduction of B galactosidase in mice); (ii) it is known that - due to defolding and refolding processes - the transduction of native proteins into cells may result in a significant loss of protein activity (e.g., as described for TAT-GFP; Schwarze et al, Trends Cell Biol. 10: 290-95 (2000)); (iii) neither the number of protein molecules that can be transferred into a cell by a given translocation domain has been systematically determined, nor the number of Cre molecules in the cell nucleus that is required for efficient recombination; (iv) the delivery of active proteins requires unfolding- and proper refolding which is unpredictable for a given protein (Bonifaci et al., AIDS 9: 995-1000 1995); and (v) the mechanism by which protein transduction domains facilitate protein transduction in unknown and several findings have been published that rule out classical receptor-, transporter-, endosome- or endocytosis mediated processes in the transduction of Ant, TAT and VP22 (G. Eliott, P. O'Hare, Cell 88, 223-233 (1997); D.A. Mann, A.D. Frankel, EMBO. J. 10, WO 01/49832 PCT/EPO1/00060 5 1733-1739 (1991); D. Derossi et al., 3. Biol. Chem. 269, 10444-10450 (1994); D. Derossi et al., J. Biol. Chem. 271, 18188-18193 (1996); E. Vives et al., J. Biol. Chem. 272, 16010-16017 (1997)). Moreover, there was still the need for a generally applicable method where the genetic manipulation can be performed in both, endogenous genes and transgenes. Summary of the Invention It was found that site-specific DNA recombinase proteins can be translocated into cells of a living organism when fused to specific protein transduction domains, namely transduction domains being derived from the VP22 protein of HSV or from the TAT protein of HIV. Thus, whenever a gene mutation is desired, recombination is induced upon the injection of the appropriate site-specific recombinase fused to a transduction domain into such a living organism (provided, however, that said organism carries at least one appropriate RRS integrated in the genome). The present invention thus provides (1) the use of a fusion protein comprising (a) a site-specific DNA recombinase domain and (b) a protein transduction domain (PTD) for preparing an agent for inducing target gene alterations in a living organism or cell culture, wherein said living organism carries at least one or more recognition sites for said site-specific DNA recombinase integrated in its genome; (2) a method for inducing gene alterations in a living organism which comprises administering to said living organism a fusion protein comprising a site-specific DNA recombinase domain and a PTD as defined in (1) above, wherein said living organism carries at least one or more WO 01/49832 PCT/EPO1/00060 6 recognition sites for said site-specific DNA recombinase integrated in its genome; (3) a fusion protein comprising (a) a site-specific DNA recombinase domain and (b) a PTD being derived from the VP22 protein of HSV or from the TAT protein of HIV provided that when the site-specific DNA recombinase domain is wild-type Cre or Fip then the PTD is not the full length VP22 PTD of HSV (i.e., the fusion protein is not identical to the fusion protein of Dalby and Bennett, Invitrogen, Expressions 6.2, page 13 (1999) and of WO 99/60142); (4) a DNA sequence coding for the fusion protein of (3) above; (5) a vector comprising the DNA sequence as defined in (4) above; (6) a host cell transformed with the vector of (5) above and/or comprising the DNA of (4) above; (7) a method for producing the fusion protein of (1) above which comprises culturing the transformed host cell of (6) above and isolating the fusion protein; and (8) an injectable composition comprising the fusion protein as defined in (1) or (3) above. The invention is further illustrated by the appended Figures and is explained in detail below. Description of the Figures Fig. 1: Generation of induced mouse mutants using purified fusion proteins. A: Expression of the fusion protein consisting of the site-specific DNA recombinase (e.g. Cre) and the protein transduction domain (e.g. the HIV derived TAT peptide) in prokaryotic or eukaryotic cells. B: Extraction and purification of the expressed fusion protein (e.g. as described in Nagahara et al., Nat. Med. 4 (12):1449-52 (1998)).

WO 01/49832 PCT/EPO1/00060 7 C: Injection of the purified fusion protein into mice carrying the RRS flanked target sequence. D: Analysis of the pattern of induced target gene recombination and the resulting phenotype. Triangle: RRS. Fig. 2: Scheme of the bacterial expression vector pT7-TACS (SEQ ID NO:16). The coding region of the 11 amino acid protein transduction domain of HIV TAT protein is fused to the N-terminus of the Cre recombinase protein sequence. The 10-amino-acid strep tag and the protease factor Xa recognition sequence are fused to the C-terminus. The T7 promoter permits expression of TAT-Cre protein in E. coli. Fig. 3: Detection of purified TAT-Cre protein by Coomassie staining and Western blot analysis. A: Coomassie stained SDS-PAGE gel. Lane 1: 10 kDa ladder (Life Technologies, Cat. No.: 10064-012), 2: 1000 ng BSA, 3: 750 ng BSA, 4: 500 ng BSA, 5: 100 ng BSA, 6: 50 ng BSA, 7: 5 pl TAT-Cre, 8: 1 pl TAT Cre in Bicine buffer. B: Western blot analysis using an alkaline phosphatase-conjugated anti strep tag antibody (IBA, Cat. No: 2-1503-001). Lane 1: MultiMark (Invitrogen, Cat. No.: LC5725), 2: 7 pl TAT-Cre, 3: 5 pl TAT-Cre, 4: 2,5 pl TAT-Cre, 5: 1,25 pl TAT-Cre in Bicine buffer. Fig. 4: X-Gal staining of M5Pax8 cells treated with TAT-Cre protein. M5Pax8 fibroblasts where treated for 18 h with 3,5 (A), 6,9 (B) and 13,8 pg/mI TAT-Cre protein (C) in serum-free medium. Four days after treatment, cells were fixed and stained with X-Gal. Fiq. 5: Measurement of B-galactosidase activity in cell lysates. M5Pax8 fibroblasts where treated for 18 h with increasing concentrations of TAT Cre, as indicated, or transiently transfected with either expression vectors WO 01/49832 PCT/EPO1/00060 8 for Cre (pCMV-I-Cre-pA, see SEQ ID NO:29) or B-galactosidase (pCMV-I B-pA, see SEQ ID NO:30). Four days after treatment, cells were lysed and the B-galactosidase activities were determined. Fig. 6: PCR detection of TAT-Cre mediated recombination in mice. A: PCR-analysis of genomic DNA from duodenum (lane 2), liver (3), kidney (4), spleen (5), muscle (6), lung (7), tail (8) and brain (9) of a p/n13 mouse treated three times with intraperitoneal injections of 75 pg TAT Cre protein at two-day-intervals. Deletion of the loxP-flanked DNA segment is indicated by the presence of the about 400 bp fragment. Lane 1: 1-kb-ladder (Life Technologies). B: PCR strategy to detect Cre-mediated deletion of the loxP-flanked DNA segment. Arrows indicate the positions of the primers. C: PCR-analysis of genomic DNA from spleen of a p/n13 mouse treated three times with intraperitoneal injections of 75 pg TAT Cre protein at two day-intervals (lane 4). To confirm the presence of the BamH I restriction site, the PCR product was digested with BamH I which produces two diagnostic fragments of about 190 and about 210 bp (5). As a control, tail DNA from untreated mice carrying the loxP-flanked (lane 2) and the detected pIn13 allele (3) was subjected to PCR amplification. Lane 1: 100 bp ladder (Life Technologies), lane 6: 1 kb ladder (Life Technologies). Fig. 7: Scheme of the bacterial expression vectors pT7-VPCS (SEQ ID NO:17) and pCRT7-AVPCS (SEQ ID NO:15). The coding region of the 301 amino acid protein transduction domain of HSV VP22 protein (A) or the truncated 143 amino acid AVP22 domain (B) is fused to the N-terminus of the Cre recombinase protein sequence. The 10-amino-acid strep tag and the protease factor Xa recognition sequence are fused to the C-terminus. The T7 promoter allows the expression of VP22-Cre and AVP22-Cre fusion proteins in E. co/i. The sequence in pCRT7-AVPCS encoding the 15 amino WO 01/49832 PCT/EPO1/00060 9 acid N-terminal leader sequence is used for enhanced protein stability (Invitrogen). Fiq. 8: Detectionof the purified VP22-Cre and AVP22-Cre fusion proteins by Coomassie staining and Western blot analysis. A: Detection of VP22-Cre protein in a Coomassie-stained SDS-PAGE gel. Lane 1: 10 kDa ladder, 2: 1000 ng BSA, 3: 500 ng BSA, 4: 100 ng BSA, 5: inclusion body protein extract before chromatography, 6: unbound protein, 7: fraction 17, 8: fraction 18, 9: fraction 19, 10: fraction 20. The position of the 75 kDa VP22-Cre protein is indicated by the arrow head. B: Detection of VP22-Cre protein by Western blot analysis using an alkaline phosphatase-conjugated anti-strep tag antibody (IBA, Cat. No.: 2 1503-001). Lane 1: MultiMark (Invitrogen), 2: inclusion body protein extract before chromatography, 3: unbound protein, 4: fraction 10, 5: fraction 11, 5: fraction 16, 6: fraction 17, 7: fraction 18, 8: fraction 19, 9: fraction 19, 10: fraction 20. C: Detection of AVP22-Cre protein in a Coomassie-stained SDS-PAGE gel. Lane 1: 10 kDa ladder, 2: inclusion body protein extract before chromatography, 3: unbound protein, 4: fraction 1, 5: fraction 8, 6: fraction 9, 7: fraction 15, 8: 100 ng BSA, 9: 500 ng BSA, 10: 1000 ng BSA. The position of the 60 kDa AVP22-Cre protein is indicated by the arrow head. D: Detection of AVP22-Cre protein by Western blot analysis using a alkaline phosphatase-conjugated anti-strep tag antibody (IBA, Cat. No.: 2 1503-001). Lane 1: MultiMark (Invitrogen), 2: inclusion body protein extract before chromatography, 3: unbound protein, 4: fraction 4, 5: fraction 8, 6: fraction 10, 7: fraction 12, 8: soluble protein extract before chromatography, 9: unbound protein, 10: fraction 7. Fig. 9: X-Gal staining of M5Pax8 cells treated with VP22-Cre and AVP22 Cre fusion proteins. M5Pax8 fibroblasts where treated for 18 h with either WO 01/49832 PCT/EPO1/00060 10 Bicine buffer (A), 0.5 pg/ml VP22-Cre (B) or 3.75 g/ml AVP22-Cre (C) in serum-free medium. Four days after treatment, cells were fixed and stained with X-Gal. Fig. 10: Measurement of B-galactosidase activity in cell lysates. M5Pax8 fibroblasts where treated for 18 h with VP22-Cre, AVP22-Cre or Bicine buffer alone, as indicated or transiently transfected with expression vectors for Cre (pCMV-I-Cre-pA, see SEQ ID NO:29) or f-galactosidase (pCMV-I-B-pA, see SEQ ID NO:30). Four days after treatment, cells were lysed and the B-galactosidase activities were determined. Fig. 11: PCR detection of Cre mediated recombination in cells treated with VP22-Cre and AVP22-Cre fusion proteins shown in SEQ ID NOs: 21 and 14, respectively). A: PCR-analysis of genomic DNA isolated from M5Pax8 fibroblasts. Cells were transiently transfected with a Cre expression vector (lane 2) or treated for 18 h with either buffer alone (lane 3), 7.5 pg/ml VP22-Cre (4, 5) or 15 pg/ml AVP22-Cre (6, 7) in serum-free medium. Four days after treatment, genomic DNA was extracted and subjected to PCR amplification. Deletion of the loxP-flanked DNA segment is indicated by the presence of the 226 bp DNA fragment. To confirm the presence of the Nco I restriction site in the recombined allele, the PCR products were digested with Nco I which produces two diagnostic fragments of 85bp and 141bp (lanes 5 and 7). Lane 1: 100 bp ladder (Life Technologies), lane 8: 1 kb ladder (Life Technologies). B: PCR strategy to detect Cre-mediated deletion of the loxP-flanked DNA segment. Arrows indicate the positions of the primers. Detailed Description of the Invention The expression "target sequences" according to the present invention means all kind of sequences which may be mutated (viz. deleted, WO 01/49832 PCT/EPO1/00060 11 translocated, integrated and/or inverted) by the action of the recombinase. The number of RRS in the target sequence depends on the kind of mutation to be performed by the recombinase. For most of the mutations (especially for deletions and invertions) two RRS are required which are flanking the sequence to be mutated (deleted or inverted). For some kinds of integrations only one RRS may be necessary within the target sequence. The "living organisms" according to the present invention are multi-cell organisms and can be vertebrates such as mammals (e.g., rodents such as mice or rats) or non-mammals (e.g., fish) or can be invertebrates such as insects or worms, or can be plants (higher plants, algi or fungi). Most preferred living organisms are mice and fish. "Cell culture" according to the present invention include cells isolated from the above defined living organism and cultured in vitro. These cells can be transformed (immortalized) or untransformed (directly derived from the living organism; primary cell culture). The site-specific DNA recombinase domain within the fusion protein of the invention of the present application is preferably selected from a recombinase protein derived from Cre, Flp, 4C31 recombinase (Thorpe and Smith, Proc. Natl. Acad. Sci, USA, vol. 95, 5505-5510 (1998)), y resolvase (Schwickardi and Drbge, FEBS letters 471:147-150 (2000) and R recombinase (Araki et al., J. Mol. Biol., 182, 191-203 (1985)). The preferred recombinases are Cre and mutants thereof (preferably the Cre variant of aa 15 to 357 of SEQ ID NO: 2 or aa 325-667 of SEQ ID NO: 6) and Flp and variants thereof including Flpe (preferably the Flp variant of aa 15 to 437 of SEQ ID NO: 4 or aa 325 to 747 of SEQ ID NO: 8).

WO 01/49832 PCT/EPO1/00060 12 The protein transduction domain according to the present invention includes, but is not limited to, the PTDs mentioned in Background of the Invention. The PTD preferably is derived from the VP22 protein of HSV or from the TAT protein of HIV. Suitable TAT proteins include, but are not limited to, proteins comprising (i) the amino acid sequence shown in SEQ ID NO: 10 and mutant thereof such as (ii) proteins comprising the amino acid AGRKKRRQRRR (SEQ ID NO:22) YARKARRQARR (SEQ ID NO:23) YARAAARQARA (SEQ ID NO:24) YARAARRAARR (SEQ ID NO:25) YARAARRAARA (SEQ ID NO:26) YARRRRRRRRR (SEQ ID NO:27) YAAARRRRRRR (SEQ ID NO:28) as known from WO 99/29721. Preferred are transduction domains consisting of the TAT proteins (i) and (ii) above. Suitable VP22 proteins include, but are not limited to, the wild-type VP22 protein, i.e., a protein comprising amino acids 1 to 302 of SEQ ID No:21, and truncated forms thereof. Truncated VP22 proteins in accordance with the present invention can be those lacking 1 to 158 amino acid residues at their N-terminal end. The most preferred VP22 protein is the truncated VP22 PTD comprising amino acid residues 16 to 157 of SEQ ID NO:14. The fusion of the two domains of the fusion protein can occur at any possible position, i.e., the protein transduction domain can be fused to the N- or C-terminal of the site-specific DNA recombinase or can be fused to active sites within the site-specific DNA recombinase. Preferably the protein transfusion domain is fused to the N-terminal of the site-specific DNA recombinase domain.

WO 01/49832 PCT/EPO1/00060 13 The protein transduction domain can be fused to the site-specific DNA recombinase either through a direct chemical bond or through a linker molecule. Such linker molecule can be any bivalent chemical structure capable of linking the two domains. The preferred linker molecule according to the present invention is a short peptide, e.g., having 1 to 20, preferably 1 to 10, amino acid residues. Specifically preferred short peptides are essentially consisting of Gly, Ala and/or Leu. The fusion protein of the invention of the present application may further comprise other functional sequences such as secretion conferring signals, nuclear localisation signals and/or signals conferring protein stabilisation. In case the fusion protein comprises a protein transduction domain derived from the TAT protein of HIV, the DNA sequence coding for said fusion protein preferably comprises the sequence 5' TAC GGC CGC AAG AAG CGC CGC CAA CGC CGC CGC 3'. Such a preferred DNA sequence is for instance shown in SEQ ID NO: 11. In said sequence the 3' terminal codon ggc codes for the linker Gly. The DNA sequence of a suitable recombinase may be directly attached to said codon ggc. The fusion protein can be obtained by the following steps: 1. Fusion of the recombinase coding region (e.g. encoding Cre: see amino acids 15 to 357 of SEQ ID NO: 2) with the sequence conferring protein translocation (e.g. the sequence encoding the TAT peptide YGRKKRRQRRR, SEQ ID NO: 10) using standard cloning protocols (Maniatis et al., Cold Spring Harbor Laboratory, New York (1989)) or chemical synthesis.

WO 01/49832 PCT/EPO1/00060 14 2. Generation of a construct for the expression of the fusion protein in prokaryotic or eukaryotic cells, e.g. in E. coli DH5a (Hanahan, J. Mol. Biol.;166(4):557-80 (1983)) using the QIAexpress pQE vector (Qiagen, Hilden). 3. Expression of the above mentioned fusion protein in prokaryotic or eukaryotic cells, e.g. in E. coli DH5a (Hanahan, 1983) 4. Extraction and purification of the above mentioned fusion protein e.g. as described in Nagahara et al., Nat. Med., 4(12):1449-52 (1998). In an experiment it was shown that TAT-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting both in cell lines and living organisms. In this experiment a vector for the expression of a TAT-Cre fusion protein in E. coli was constructed, TAT-Cre protein was expressed in E. coli and purified from bacterial lysates. To test the activity of the TAT-Cre protein in vitro, a reporter cell line that contains a loxP-containing reporter construct was used. This reporter, when recombined by Cre recombinase, allows the expression of a B galacosidase gene. Further, a transgenic mouse strain carrying a loxP flanked target was used to invest the activity of the TAT-Cre protein in vivo. In a second experiment it was shown that VP22-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting. In this experiment Bacterial expression vectors were constructed for the production of VP22-Cre fusion proteins in E. coli. The activity of purified VP22-Cre proteins were tested using a reporter fibroblast cell line containing a loxP-flanked reporter construct. Thus, the injection of the purified fusion protein of the present invention into a living organism (e.g., a mouse) carrying a gene comprising the RRS-flanked target sequence (e.g., in an amount of 1 to 200, preferably 5 WO 01/49832 PCT/EPO1/00060 15 to 50 pg per g body weight). To demonstrate the feasibility of the invention, a reporter mouse strain carrying an RRS-flanked cassette was used (Thorey et al., Mol. Cell Biol., 18(10):6164 (1998)). Analysis is achieved by determining the pattern of induced target gene recombination (e.g. through PCR analysis, Southern blot analysis or X-Gal staining on tissue sections; Maniatis et al., 1989; Gossler and Zachgo, Joyner AL (Ed.), Oxford University Press, Oxford, New York (1993)). The procedure's advantages over current technology are as follows: (i) The absence of background recombination before administration of the fusion protein. (ii) The reduction of time and resources which are necessary to combine the recombinase transgene and two copies of the RRS-flanked target gene by conventional breeding. In experiments it was shown the following: (a) With a suitable vector for the expression of a TAT-Cre fusion protein, a TAT-Cre fusion protein was expressed in E. coil and purified from bacterial lysates. (b) A reporter cell line containing a loxP-containing reporter construct was used to test the activity of the TAT-Cre protein in vitro. This reporter, when recombined by Cre recombinase, allows the expression of a 8 galacosidase gene. (c) A transgenic mouse strain carrying a loxP-flanked target was used to invest the activity of the TAT-Cre protein in vivo. These experiments demonstrate that TAT-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting both in cell lines and living organisms.

WO 01/49832 PCT/EPO1/00060 16 Furthermore, bacterial expression vectors were constructed for the production of VP22-Cre fusion proteins in E. coli. The activity of purified VP22-Cre proteins were tested using a reporter fibroblast cell line containing a loxP-flanked reporter construct. These experiments demonstrate that VP22-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting. The invention is further illustrated by the following, non-limitative examples. Examples Materials and Methods Construction of pT7-TACS: The TAT-Cre coding region was generated by PCR using Advantage-HF PCR Kit (Clontech), 20 pmol of the primers TATcre sense (5'-atg cca tgg gct acg gcc gca aga agc gcc gcc aac gcc gcc gcg gca tgt cca att tac tga ccg tac acc-3'; SEQ ID NO:31) and TATcre antisense (5'-ttt cgg atc cgc cgc ata acc agt g-3'; SEQ ID NO:32) and 10 ng pCMV-I-Cre-pA (see SEQ ID NO:29) as template. The PCR reaction was performed using the following cycle profile: 2'94 *C, 4 x (30" 94 *C min, 30" 50 *C, 1' 72 *C), 12 x (30" 94 *C min, 30" 55 *C, 1' 72 *C) and 10' 72 *C. The resulting PCR fragment was digested with Nco I and BamH I, treated with Kienow enzyme and ligated into the plasmid pBSII KS+ which had been opened with restriction enzyme BamH I, treated with Klenow and dephosphorylated with calf intestinal phosphatase. The resulting plasmid pBS TAT-5'cre was verified by DNA sequencing. The Plasmid pCMV-I-Cre-pA (SEQ ID NO:29) was digested with Age I and Sal I which released a 1,036 kb fragment containing the 3' part of the Cre coding region. This fragment was ligated into the plasmid pBS TAT-5'cre which had been opened with Age I and Sal I.

WO 01/49832 PCT/EPO1/00060 17 10 ng pBS-TATCre was subjected to PCR amplification using 20 pmol of primers FPA001 (5'-tat atc tag acc atg ggc tac ggc cgc aag aag c-3'; SEQ ID NO:33) and FPA002 (5'-gct acc acg acc ttc gat acc atc gcc atc ttc cag cag gcg c-3'; SEQ ID NO:34). PCR was performed using 2,5 U Platinum Pfx DNA polymerase (Gibco BRL) and 2 x Enhancer Solution (Gibco BRL) according to the manufacturers protocol. The following cycle profile was used: 2' 94 OC, 25 x (30" 94 *C min, 15" 54,6 *C, 2'30" 68 *C). The amplified PCR fragment was purified using GFX columns (Amersham Pharmacia), digested with Xba I and ligated into the plasmid pASK57 (Skerra and Arne, Gene 151: 131-135 (1994)) which had been opened with restriction enzymes Xba I and Eco 47 III and dephosphorylated with calf intestinal phosphatase. The resulting plasmid pASK75-TACS was digested with restriction enzymes Nco I and Hind III which released a 1,1 kb fragment. The fragment was subsequently ligated into the plasmid pT7 7 (Studier and Moffatt, J. Mol. Biol. 189: 113-130 (1986)) which had been opened with restriction enzymes Nco I and Hind III and dephosphorylated with calf intestinal phosphatase resulting in the plasmid pT7-TACS (SEQ ID NO:16). Construction of pT7-VPCS: The Cre coding region was generated by PCR using Advantage-HF PCR Kit (Clontech), 20 pmol of the primers VP22cre sense (5'-taa cta gcg gcc gca tgt cca att tac tga ccg tac ac-3'; SEQ ID NO:35) and VP22cre antisense (5'-tcg agc ggc cgc cat cgc cat ctt cca gca ggc g-3'; SEQ ID NO:36) and 10 ng pgkcre-pA (SEQ ID NO:40) as template. The PCR reaction was performed using the following cycle profile: 2' 94 0 C, 5 x (30" 94 *C, 30" 50 *C, 2' 72 0 C), 15 x (30" 94 0 C, 30" 55 *C, 2' 72 *C) and 10' 72 *C. The resulting PCR fragment was digested with Not I and ligated into the plasmid pVP22/Myc-His (Invitrogen), which had been opened with restriction enzyme NotI, dephosphorylated with calf intestinal phosphatase. The resulting plasmid pVP22-cre myc/His was verified by DNA sequencing.

WO 01/49832 PCT/EPO1/00060 18 10 ng pVP22-cre myc/His was subjected to PCR amplification using 20 pmol of primers FPA004 (5'-tat atc tag aca tat gac ctc tcg ccg ctc cg-3'; SEQ ID NO:37) and FPA002 (SEQ ID NO:34). PCR was performed using 2,5 U Platinum Pfx DNA polymerase (Gibco BRL) and 2 x Enhancer Solution (Gibco BRL) according to the manufacturers protocol. The following cycle profile was used: 2' 94 *C, 25 x (30" 94 *C min, 15" 54,6 *C, 2'30" 68 0 C). The amplified PCR fragment was purified using GFX columns (Amersham Pharmacia), digested with Xba I and ligated into the plasmid pASK57 (Skerra and Arne, Gene 151: 131-135 (1994)) which had been opened with restriction enzymes Xba I and Eco 47 III and dephosphorylated with calf intestinal phosphatase. The resulting plasmid pASK75-VPCS was digested with restriction enzymes Nde I and Hind III which released a 2,0 kb fragment. The fragment was subsequently ligated into the plasmid pT7-7 (Studier and Moffatt, 3. Mol. Biol. 189: 113-130 (1986)) which had been opened with restriction enzymes Nde I and Hind III and dephosphorylated with calf intestinal phosphatase resulting in the plasmid pT7-VPCS (SEQ ID NO:17). Construction of pCRT7-AVPCS: The AVP22-Cre coding region was generated by PCR using Platinum Pfx DNA polymerase (Life Technologies), 20 pmol of the primers FPA007 (5'-ttc cga aga cga cga aac acc-3'; SEQ ID NO:38) and FPA008 (5'-tat att cga agc tta tta acc acc gaa ctg cg-3'; SEQ ID NO:39) and 30 ng pT7-VPCS (SEQ ID NO:17) as template. The PCR reaction was performed using the following cycle profile: 2' 94 *C, 25 x (30" 94 0 C, 30" 61 *C, 2'30" 68 *C) and 7' 68 *C. The resulting 1,8 kb PCR fragment was digested with Nco I and Sfu I and ligated into the plasmid pCRT7/VP22-1 (Invitrogen), which had been opened with restriction enzymes Nco I and Sfu I, and dephosphorylated with calf intestinal phosphatase. The resulting plasmid pCRT7-AVPCS (SEQ ID NO:15) was verified by DNA sequencing.

WO 01/49832 PCT/EPO1/00060 19 Expression of the fusion proteins in E. coli: E. coli BL21(DE3)-RIL cells (Stratagene) were transformed with pT7-TACS and grown on LB agar plates containing .100 pg/ml ampicillin. E. coli BL21(DE3)-RP cells (Stratagene) were transformed with pT7-VPCS and grown on LB agar plates containing 100 pg/ml ampicillin. E. coli BL21(DE3)-pLysS (Invitrogen) were transformed with pCRT7-AVPCS and grown on LB agar plates containing 25 pg/ml kanamycine and 34 pg/ml chloramphenicol. Single colonies were isolated and used to prepare glycerol stocks. Eight 5ml LB (Lura Bertani) aliquots containing antibiotics were inoculated with stabs from the glycerol stocks and grown overnight at 37 0 C with shaking. Two 5ml overnight cultures were each used to inoculate one of four 1L LB aliquots containing antibiotics and grown at 37 0 C with shaking. Growth rate was monitored by spectrophotometry at 578nm. When the cultures had obtained an OD 5 78 = 0,5 expression of the fusion proteins were induced by the addition of 0,5 mM Isopropyl-B-D-1-thiogalactopyranosid (IPTG). Two hours after induction cells were harvested by centrifugation at 12000xg and the pellet rapidly frozen in liquid nitrogen and stored immediately at -80 0 C. Purification of the fusion proteins from bacterial lysates: Each 10g cell pellet was resuspended on ice in 30ml Bicine buffer (50mM Bicine, pH 8,5) including one protease inhibitor tablet (Complete, Roche). Cells were lysed through threefold treatment (1500psi, 5 minutes) with the cell disruption bomb (Parr Instrument). 30ml of Benzonase (10000U, Merck) was added and cell extracts were incubated for 30 minutes at 4 0 C. Cell extracts were then centrifuged at 12,000xg (4 0 C). The pellet was redissolved in 8M urea, 50mM Bicine, 100mM DT7, pH 8,5 by incubation for 16 hours at 4 0 C. Protein extract was centrifuged at 31000xg and supernatant harvested. Protein extract was diluted in an equal volume of Chromatography buffer A (50mM Bicine, pH 8,5). PH was adjusted to pH WO 01/49832 PCT/EPO1/00060 20 8,5 and the extract was filtered through a 0,45pm filter (Millipore). FPLC (Akta Explorer, Amersham Pharmacia) was performed using a cation exchange column (Sepharose SP, Column body HR_5/5 (0.5 x 5cm), column volume (CV) 1ml, linear flow 300cm/hour, Amersham Pharmacia). After addition of sample to FPLC column, buffer was exchanged with Chromatography buffer A at 10 CV. TAT-Cre and VP22-Cre fusion proteins were eluted from the column by gradient elution using chromatography buffer B (50mM Bicine, 1M NaCl, pH 8,5) using the following profile: 0 - 50 % buffer B, 0 CV; 50 % buffer B, 10 CV; 50 - 100 % buffer B (linear gradient), 20 CV; 100 % buffer B, 10 CV. AVP22-Cre protein was eluted from the column by gradient elution using the following profile: 0 - 10 % buffer B, 0 CV; 10 % buffer B, 10 CV; 10 - 30 % buffer'B, O CV; 30 % buffer B, 10 CV; 30 - 100 % buffer B, 0 CV; 100 % buffer B, 10 CV. Three 1,5ml fractions each containing purified fusion proteins were collected. Purity and concentration of protein fractions were determined by Coomassie blue stained SDS-PAGE gels and Western blot analysis using dilutions of BSA standard solutions. In addition protein content was determined using a Bradford assay (Coomassie Plus protein assay, Pierce). SDS-PAGE and Western blot analysis: SDS-PAGE and Coomassie staining was performed according to standard protocols (Maniatis et al., Cold Spring Harbor Laboratory, New York (1989)) using 4 - 12 % gradient SDS-polyacrylamide gels (NuPAGE, Invitrogen, cat. no.: NP0321). Western blot analysis was performed using a Semi-Try Blotting Chamber (Biorad) and nitrocellulose membranes (0,2 pm; Schleicher & Schuell) according to the manufacturers protocols. The fusion proteins were detected by using an alkaline phosphatase-conjugated anti-strep tag antibody (IBA, Cat. No.: 2-1503-001) according to the manufacturers protocol.

WO 01/49832 PCT/EPO1/00060 21 Generation of the M5Pax8 Cre reporter cell line: The SV40-transformed murine embryonic fibroblast line MEF5/5 (Schwenk et al., Nucl Acids Res 26(6), 1427-32 (1998)) was transfected with the vector pPGKpaX1 (Kellendonk et al!, Nucl. Acids Res. 24, 1404-11 (1996)). 106 MEF5/5 cells were electroporated with 20 pg pPGKpaX1 plasmid DNA linearised with Sca I and plated into 48-well-plates. The cells were cultured in DMEM/Glutamax medium (Life Technologies) supplemented with 10 % fetal calf serum at 37 0 C, 10 % CO 2 in humid atmosphere. Two days after transfection the medium was supplemented with 5 pg/ml puromycine (Calbiochem) for the selection of stable integrants. 14 puromycine resistant clones were expanded and tested by transien transfection with the Cre expression vector pPGK-Cre-pA (SEQ ID NO: 40). In two out of the 14 puromycine-resistant clones, the expression of B-galactosidase could be detected by staining with X-Gal. One of these clones, M5Pax8, was used as Cre reporter cell line. Transfection and measurement of B-calactosidase activity: Fibroblasts (106 cells per 24 well plate (Falcon)) were transfected with 25 ng pCMV-I Cre-pA (see SEQ ID NO:29) or pCMV-I-B-pA (see SEQ ID NO:30) plasmids using the FuGene transfection reagent (Roche Diagnostics). After 2 days the cells were lysed and the 8-galactosidase activities were determined with the 8-galactosidase reporter gene assay (Roche. Diagnostics) according to the manufacturers guidelines using a Lumistar luminometer (MWG). Histochemical detection of B-cialactosidase activity: To quantitate B galactosidase expression, fibroblast cells were washed once with phosphate buffered saline (PBS), and the cells were fixed for 5 minutes at room temperature in a solution of 4% formaldehyde in PBS. Next, the cells were washed twice with PBS and finally incubated in staining solution for 24 hours at 37 0 C (staining solution: 5 mM K3(Fe(CN)6), 5mM WO 01/49832 PCT/EPO1/00060 22 K4(Fe(CN)6), 2mM MgCl2, 1mg/ml X-Gal (BioMol) in PBS). Blue stained, B-galactosidase positive cells were detected and distinguished from negative (transparent) cells in a cell culture binocular microscope under 200x magnification. For each determination a minimum of 200 cells was counted. PCR detection of Cre-mediated recombination: Genomic DNA extracted from tissue samples was subjected to PCR using Taq-polymerase (Gibco BRL Cat. No. 10342-020) using 20 pmol of each primer (sense: 5'-CAT CTC CGG GCC TTT CGA CCT G - 3', antisense: 5' -GCG ATC GGT GCG GGC CTC TTC - 3'; SEQ ID Nos: 41 and 42, respectively). PCR was performed using the following cycle profile: 2' 94 0 C, 35 x (30" 94 0 C, 30" 55 *C, 1' 72 *C), 10 min 72 *C. PCR products were separated on a 1,2 % agarose gel. Example 1 The vector pT7-TACS (SEQ ID NO: 16) was constructed for the expression of a TAT-Cre fusion protein in E. coli. The plasmid contains the coding region of the 11 amino acid protein transduction domain of the wild-type HIV TAT protein (Green and Loewenstein, Cell, 55(6):1179-88 (1988); Frankel and Pabo, Cell, 55(6): 1189-93 (1988); SEQ ID NO:10) fused to the N-terminus of Cre recombinase protein sequence. The 10-amino-acid strep tag at the C-terminus allows the detection and purification of the fusion protein using specific antibodies (Schmidt and Skerra, J. Chromatogr A 676: 337-345 (1994)). The protease factor Xa recognition site (Ile-Glu-Gly-Arg) permits the removal of the strep tag by proteolytic cleavage. The estimated molecular weight of the TAT-Cre fusion protein is 42 kDa. A scheme of the TAT-Cre expression vector is depicted in figure 2. For the expression of TAT-Cre, the E. coli strain BL21(DE3)-RIL (Stratagene) was used. This strain carries an IPTG-inducible T7 polymerase gene and additional copies of the tRNA genes for the 'rare WO 01/49832 PCT/EPO1/00060 23 codons' argU, ileY and leuW. E. coli BL21(DE3)-RIL cells were transformed with pT7-TACS and grown in LB medium containing 100 pg/ml ampicillin. The expression of the 40 kDa TAT-Cre fusion protein could be strongly induced by the addition of 0,5 mM IPTG to the culture medium. Analysis of protein lysates revealed that approximately 50 % of TAT-Cre protein accumulated as insoluble inclusion bodies. The inclusion bodies where extracted and dissolved in 8 M urea. TAT-Cre was subsequently purified from this fraction using ion exchange chromatography. The quantity and purity of TAT-Cre protein was determined using Coomassie stained SDS-PAGE gels and Western blot analysis (figure 3). The purification process yielded TAT-Cre protein extracts of 64 % purity and a concentration of 100 pg/mI. To analyse the ability of the purified TAT-Cre protein to transduce into cultured cells, we used the fibroblast cell line M5Pax8 (R. KOhn, unpublished) that contains a loxP-containing reporter construct. This reporter, when recombined by Cre recombinase, allows the expression of a 13-galacosidase gene (Buchholz et al, Nucleic Acids Res. 24, 4256-4262, 1996). Cells were cultured for 18 h with increasing concentrations of TAT Cre protein in serum-free medium and analysed 4 days later for 13 Galacosidase activity. Staining with X-Gal showed that > 50 % of the cells treated with 13,8 pg/ml TAT-Cre protein expressed 13-galactosidase indicating recombination of the loxP-flanked reporter construct had occurred (figure 4). Measurement of 8-galactosidase activity in cell lysates revealed an up to 30-fold higher level of B-galactosidase activity in comparison to cells which had been transiently transfected with an eukaryotic Cre expression vector (figure 5). To investigate the activity of TAT-Cre protein in a living organism, we used a transgenic mouse strain carrying a loxP-flanked target for Cre-mediated recombination (Thorey et al., 1998, Mol. Cell. Biol. 18: 3081 - 3088). Mice where treated three times with intraperitoneal injections of 75 pg TAT Cre protein at two-day-intervals and analysed 2 days later. Genomic DNA was WO 01/49832 PCT/EPO1/00060 24 isolated from a variety of organs and subjected to PCR amplification which specifically amplifies a 400 bp fragment of the recombined allele. The deleted allele could be detected in multiple tissues from treated mice indicating TAT-Cre-mediated recombination in these organs (figure 6). This experiments demonstrates that TAT-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting in cell lines and in living organisms. Example 2 The vectors pT7-VPCS (SEQ ID NO:17) and pCRT7-AVPCS (SEQ ID NO:15) were constructed for the expression of VP22-Cre and AVP22-Cre fusion proteins in E. coli. The VP22-Cre gene of pT7-VPCS contains the full length protein translocation domain of the HSV VP22 protein (Elliott and O'Hare, Cell, 88(2): 223-33 (1987), whereas the AVP22-Cre gene of pCRT7-AVPCS contains a truncated VP22 protein transduction domain (amino acids 159 301; Invitrogen; aa 16-157 of SEQ ID NO:14) fused to the N-terminus of Cre recombinase protein sequence. A 10-amino-acid strep tag at the C terminus of Cre protein sequence allows the detection and purification of the fusion proteins using specific antibodies (Schmidt and Skerra, J. Chromatogr A 676: 337-345 (1994)). The protease factor Xa recognition site permits the removal of the Strep tag by proteolytic cleavage. The estimated molecular weight is 75 kDa for VP22-Cre protein and 60 kDa for AVP22-Cre protein. A scheme of the vectors pT7-VPCS and pCRT7-AVPCS is depicted in figure 7. E. coli BL21(DE3)-RIP cells (Stratagene) were transformed with pT7-VPCS and cultured in LB medium containing 100 pg/ml ampicillin. E. coli BL21(DE3)-pLysS cells (Stratagene) were transformed with pCRT7-AVPCS and cultured in LB medium containing 25 pg/ml kanamycine and 34 pg/ml chloramphenicol. Expression of the VP22-Cre and AVP22-Cre fusion proteins could be induced by the addition of 0,5 mM IPTG to the culture medium. Analysis of protein extracts using Coomassie staining and WO 01/49832 PCT/EPO1/00060 25 Western blotting of SDS-PAGE gels revealed that 50 - 60 % of VP22-Cre and AVP22-Cre proteins accumulated as insoluble inclusion bodies. The inclusion bodies where extracted and dissolved in 8 M urea. VP22-Cre and AVP22-Cre fusion proteins were subsequently purified using ion exchange chromatography. The quantity and purity of the isolated VP22-Cre and A VP22-Cre fusion proteins was determined using Coomassie stained SDS PAGE gels and Western blot analysis (figure 8). To analyse the ability of the purified fusion proteins to transduce into cultured cells, we used the fibroblast cell line M5Pax8 that contains a loxP containing reporter construct. When recombined by Cre recombinase, the reporter allows the expression of a B-galacosidase gene (Buchholz et a!, Nucleic Acids Res. 24, 4256-4262, 1996). The cells where cultured for 18 h with increasing concentrations of VP22-Cre and AVP22-Cre in serum-free medium and analysed 4 days later for 8-Galacosidase activity. Staining with X-Gal showed ~2 % blue cells in the cultures treated with up to 15 pg/ml AVP22-Cre indicating recombination of the loxP-flanked reporter construct had occurred. In contrast, cell cultures treated with up to 0,5 pg/ml VP22-Cre did not show any X-gal staining (figure 9). Measurement of cell lysates revealed a strong increase of 8-galactosidase activity upon A VP22-Cre treatment when compared to untreated cells (figure 10). Genomic DNA was isolated fand subjected to PCR amplification that specifically amplifies a 250 bp fragment of the recombined allele. The deleted allele could be detected in cells treated with both VP22-Cre and A VP22-Cre fusion proteins (figure 11). This experiment demonstrates that VP22-mediated delivery of active Cre protein works with sufficient efficacy to facilitate inducible gene targeting.

WO 01/49832 PCT/EPO1/00060 26 SEQUENCE LISTING <110> ARTEMIS Pharmaceuticals GmbH <120> Transduction of recombinases for inducible gene targeting <130> 010007wo/JH/ml <140> <141> <160> 42 <170> PatentIn Ver. 2.1 <210> 1 <211> 1074 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TAT-Cre <220> <221> CDS <222> (1)..(1071) <400> 1 atg ggc tac ggc cgc aag aag cgc cgc caa cgc cgc cgc ggc atg tcc 48 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Met Ser 1 5 10 15 aat tta ctg acc gta cac caa aat ttg cct gca tta ccg gtc gat gca 96 Asn Leu Leu Thr Val His Gln Asn Leu Pro Ala Leu Pro Val Asp Ala 20 25 30 acg agt gat gag gtt cgc aag aac ctg atg gac atg ttc agg gat cgc 144 Thr Ser Asp Glu Val Arg Lys Asn Leu Met Asp Met Phe Arg Asp Arg 35 40 45 cag gcg ttt tct gag cat acc tgg aaa atg ctt ctg tcc gtt tgc cgg 192 Gln Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val Cys Arg 50 55 60 tcg tgg gcg gca tgg tgc aag ttg aat aac cgg aaa tgg ttt ccc gca 240 Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe Pro Ala 65 70 75 80 gaa cct gaa gat gtt cgc gat tat ctt cta tat ctt cag gcg cgc ggt 288 Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gln Ala Arg Gly 85 90 95 ctg gca gta aaa act ato cag caa cat ttg ggc cag cta aac atg ctt 336 Leu Ala Val Lys Thr Ile Gln Gln His Leu Gly Gln Leu Asn Met Leu 100 105 110 cat cgt cgg tcc ggg ctg cca cga cca agt gac agc aat gct gtt tca 384 His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp Ser Asn Ala Val Ser 115 120 125 WO 01/49832 PCT/EPO1/00060 27 ctg gtt atg cgg cgg atc cga aaa gaa aac gtt gat gcc ggt gaa cgt 432 Leu Val Met Arg Arg Ile Arg Lys Glu Asn Val Asp Ala Gly Glu Arg 130 135 140 gca aaa cag gct cta gcg ttc gaa cgc act gat ttc gac cag gtt cgt 480 Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gln Val Arg 145 150 155 160 tca ctc atg gaa aat agc gat cgc tgc cag gat ata cgt aat ctg gca 528 Ser Leu Met Glu Asn Ser Asp Arg Cys Gln Asp Ile Arg Asn Leu Ala 165 170 175 ttt ctg ggg att gct tat aac acc ctg tta cgt ata gcc gaa att gcc 576 Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu Arg Ile Ala Glu Ile Ala 180 185 190 agg atc agg gtt aaa gat atc tca cgt act gac ggt ggg aga atg tta 624 Arg Ile Arg Val Lys Asp Ile Ser Arg Thr Asp Gly Gly Arg Met Leu 195 200 205 atc cat att ggc aga acg aaa acg ctg gtt agc acc gca ggt gta gag 672 Ile His Ile Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly Val Glu 210 215 220 aag gca ctt agc ctg ggg gta act aaa ctg gtc gag cga tgg att tcc 720 Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp Ile Ser 225 230 235 240 gtc tct ggt gta gct gat gat ccg aat aac tac ctg ttt tgc cgg gtc 768 Val Ser Gly Val Ala Asp Asp Pro Asn Asn Tyr Leu Phe Cys Arg Val 245 250 255 aga aaa aat ggt gtt gcc gcg cca tct gcc acc agc cag cta tca act 816 Arg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gln Leu Ser Thr 260 265 270 cgc gcc ctg gaa ggg att ttt gaa gca act cat cga ttg att tac ggc 864 Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr His Arg Leu Ile Tyr Gly 275 280 285 gct aag gat gac tct ggt cag aga tac ctg gcc tgg tct gga cac agt 912 Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu Ala Trp Ser Gly His Ser 290 295 300 gcc cgt gtc gga gcc gcg cga gat atg gcc cgc gct gga gtt tca ata 960 Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val Ser Ile 305 310 315 320 ccg gag atc atg caa gct ggt ggc tgg acc aat gta aat att gtc atg 1008 Pro Glu Ile Met Gln Ala Gly Gly Trp Thr Asn Val Asn Ile Val Met 325 330 335 aac tat atc cgt aac ctg gat agt gaa aca ggg gca atg gtg cgc ctg 1056 Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr Gly Ala Met Val Arg Leu 340 345 350 ctg gaa gat ggc gat tag 1074 Leu Glu Asp Gly Asp 355 <210> 2 <211> 357 <212> PRT WO 01/49832 PCT/EPO1/00060 28 <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TAT-Cre <400> 2 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Met Ser 1 5 10 15 Asn Leu Leu Thr Val His Gln Asn Leu Pro Ala Leu Pro Val Asp Ala 20 25 30 Thr Ser Asp Glu Val Arg Lys Asn Leu Met Asp Met Phe Arg Asp Arg 35 40 45 Gln Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val Cys Arg 50 55 60 Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe Pro Ala 65 70 75 80 Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gln Ala Arg Gly 85 90 95 Leu Ala Val Lys Thr Ile Gln Gln His Leu Gly Gln Leu Asn Met Leu 100 105 110 His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp Ser Asn Ala Val Ser 115 120 125 Leu Val Met Arg Arg Ile Arg Lys Glu Asn Val Asp Ala Gly Glu Arg 130 135 140 Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gln Val Arg 145 150 155 160 Ser Leu Met Glu Asn Ser Asp Arg Cys Gln Asp Ile Arg Asn Leu Ala 165 170 175 Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu Arg Ile Ala Glu Ile Ala 180 185 190 Arg Ile Arg Val Lys Asp Ile Ser Arg Thr Asp Gly Gly Arg Met Leu 195 200 205 Ile His Ile Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly Val Glu 210 215 220 Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp Ile Ser 225 230 235 240 Val Ser Gly Val Ala Asp Asp Pro Asn Asn Tyr Leu Phe Cys Arg Val 245 250 255 Arg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gln Leu Ser Thr 260 265 270 Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr His Arg Leu Ile Tyr Gly 275 280 285 Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu Ala Trp Ser Gly His Ser 290 295 300 Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val Ser Ile 305 310 315 320 WO 01/49832 PCT/EPO1/00060 29 Pro Glu Ile Met Gln Ala Gly Gly Trp Thr Asn Val Asn Ile Val Met 325 330 335 Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr Gly Ala Met Val Arg Leu 340 345 350 Leu Glu Asp Gly Asp 355 <210> 3 <211> 1317 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TAT-Flpe <220> <221> CDS <222> (1)..(1311) <400> 3 atg ggc tac ggc cgc aag aag cgc cgc caa cgc cgc cgc ggc atg agt 48 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Met Ser 1 5 10 15 caa ttt gat ata tta tgt aaa aca cca cct aag gtc ctg gtt cgt cag 96 Gln Phe Asp Ile Leu Cys Lys Thr Pro Pro Lys Val Leu Val Arg Gln 20 25 30 ttt gtg gaa agg ttt gaa aga cct tca ggg gaa aaa ata gca tca tgt 144 Phe Val Glu Arg Phe Glu Arg Pro Ser Gly Glu Lys Ile Ala Ser Cys 35 40 45 gct gct gaa cta acc tat tta tgt tgg atg att act cat aac gga aca 192 Ala Ala Glu Leu Thr Tyr Leu Cys Trp Met Ile Thr His Asn Gly Thr 50 55 60 gca atc aag aga gcc aca ttc atg agc tat aat act atc ata agc aat 240 Ala Ile Lys Arg Ala Thr Phe Met Ser Tyr Asn Thr Ile Ile Ser Asn 65 70 75 80 tcg ctg agt ttc gat att gtc aac aaa tca ctc cag ttt aaa tac aag 288 Ser Leu Ser Phe Asp Ile Val Asn Lys Ser Leu Gln Phe Lys Tyr Lys 85 90 95 acg caa aaa gca aca att ctg gaa gcc tca tta aag aaa tta att cct 336 Thr Gln Lys Ala Thr Ile Leu Glu Ala Ser Leu Lys Lys Leu Ile Pro 100 105 110 gct tgg gaa ttt aca att att cct tac aat gga caa aaa cat caa tct 384 Ala Trp Glu Phe Thr Ile Ile Pro Tyr Asn Gly Gln Lys His Gln Ser 115 120 125 gat atc act gat att gta agt agt ttg caa tta cag ttc gaa tca tcg 432 Asp Ile.Thr Asp Ile Val Ser Ser Leu Gln Leu Gln Phe Glu Ser Ser 130 135 140 gaa gaa.gca gat aag gga aat agc cac agt aaa aaa atg ctt aaa gca 480 Glu Glu Ala Asp Lys Gly Asn Ser His Ser Lys Lys Met Leu Lys Ala 145 150 155 160 WO 01/49832 PCT/EPO1/00060 30 ctt cta agt gag ggt gaa agc atc tgg gag atc act gag aaa ata cta 528 Leu Leu Ser Glu Gly Glu Ser Ile Trp Glu Ile Thr Glu Lys Ile Leu 165 170 175 aat tog ttt gag tat acc tcg aga ttt aca aaa aca aaa act tta tac 576 Asn Ser Phe Glu Tyr Thr Ser Arg Phe Thr Lys Thr Lys Thr Leu Tyr 180 185 190 caa ttc ctc ttc cta gct act ttc atc aat tgt gga aga ttc agc gat 624 Gln Phe Leu Phe Leu Ala Thr Phe Ile Asn Cys Gly Arg Phe Ser Asp 195 200 205 att aag aac gtt gat ccg aaa tca ttt aaa tta gtc caa aat aag tat 672 Ile Lys Asn Val Asp Pro Lys Ser Phe Lys Leu Val Gln Asn Lys Tyr 210 215 220 ctg gga gta ata atc cag tgt tta gtg aca gag aca aag aca agc gtt 720 Leu Gly Val Ile Ile Gln Cys Leu Val Thr Glu Thr Lys Thr Ser Val 225 230 235 240 agt agg cac ata tac ttc ttt agc gca agg ggt agg atc gat cca ctt 768 Ser Arg His Ile Tyr Phe Phe Ser Ala Arg Gly Arg Ile Asp Pro Leu 245 250 255 gta tat ttg gat gaa ttt ttg agg aat tct gaa cca gtc cta aaa cga 816 Val Tyr Leu Asp Glu Phe Leu Arg Asn Ser Glu Pro Val Leu Lys Arg 260 265 270 gta aat agg acc ggc aat tct tca agc aac aaa cag gaa tac caa tta 864 Val Asn Arg Thr Gly Asn Ser Ser Ser Asn Lys Gln Glu Tyr Gln Leu 275 280 285 tta aaa gat aac tta gtc aga tcg tac aac aag gct ttg aag aaa aat 912 Leu Lys Asp Asn Leu Val Arg Ser Tyr Asn Lys Ala Leu Lys Lys Asn 290 295 300 gcg cct tat cca atc ttt gct ata aag aat ggc cca aaa tct cac att 960 Ala Pro Tyr Pro Ile Phe Ala Ile Lys Asn Gly Pro Lys Ser His Ile 305 310 315 320 gga aga cat ttg atg acc tca ttt ctg tca atg aag ggc cta acg gag 1008 Gly Arg His Leu Met Thr Ser Phe Leu Ser Met Lys Gly Leu Thr Glu 325 330 335 ttg act aat gtt gtg gga aat tgg agc gat aag cgt gct tct gcc gtg 1056 Leu Thr Asn Val Val Gly Asn Trp Ser Asp Lys Arg Ala Ser Ala Val 340 345 350 gcc agg aca acg tat act cat cag ata aca gca ata cct gat cac tac 1104 Ala Arg Thr Thr Tyr Thr His Gln Ile Thr Ala Ile Pro Asp His Tyr 355 360 365 ttc gca cta gtt tct cgg tac tat gca tat gat cca ata tca aag gaa 1152 Phe Ala Leu Val Ser Arg Tyr Tyr Ala Tyr Asp Pro Ile Ser Lys Glu 370 375 380 atg ata gca ttg aag gat gag act aat cca att gag gag tgg cag cat 1200 Met Ile Ala Leu Lys Asp Glu Thr Asn Pro Ile Glu Glu Trp Gln His 385 390 395 400 ata gaa cag cta aag ggt agt gct gaa gga agc ata cga tac ccc gca 1248 Ile Glu Gln Leu Lys Gly Ser Ala Glu Gly Ser Ile Arg Tyr Pro Ala 405 410 415 WO 01/49832 PCT/EPO1/00060 31 tgg aat ggg ata ata tca cag gag gta cta gac tac ctt tca tcc tac 1296 Trp Asn Gly Ile Ile Ser Gln Glu Val Leu Asp Tyr Leu Ser Ser Tyr 420 425 430 ata aat aga cgc ata taatga 1317 Ile Asn Arg Arg Ile 435 <210> 4 <211> 437 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TAT-Flpe <400> 4 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Met Ser 1 5 10 15 Gln Phe Asp Ile Leu Cys Lys Thr Pro Pro Lys Val Leu Val Arg Gln 20 25 30 Phe Val Glu Arg Phe Glu Arg Pro Ser Gly Glu Lys Ile Ala Ser Cys 35 40 45 Ala Ala Glu Leu Thr Tyr Leu Cys Trp Met Ile Thr His Asn Gly Thr 50 55 60 Ala Ile Lys Arg Ala Thr Phe Met Ser Tyr Asn Thr Ile Ile Ser Asn 65 70 75 80 Ser Leu Ser Phe Asp Ile Val Asn Lys Ser Leu Gln Phe Lys Tyr Lys 85 90 95 Thr Gln Lys Ala Thr Ile Leu Glu Ala Ser Leu Lys Lys Leu Ile Pro 100 105 110 Ala Trp Glu Phe Thr Ile Ile Pro Tyr Asn Gly Gln Lys His Gln Ser 115 120 125 Asp Ile Thr Asp Ile Val Ser Ser Leu Gln Leu Gln Phe Glu Ser Ser 130 135 140 Glu Glu Ala Asp Lys Gly Asn Ser His Ser Lys Lys Met Leu Lys Ala 145 150 155 160 Leu Leu Ser Glu Gly Glu Ser Ile Trp Glu Ile Thr Glu Lys Ile Leu 165 ' 170 175 Asn Ser Phe Glu Tyr Thr Ser Arg Phe Thr Lys Thr Lys Thr Leu Tyr 180 ~ 185 190 Gln Phe Leu Phe Leu Ala Thr Phe Ile Asn Cys Gly Arg Phe Ser Asp 195 200 205 Ile Lys Asn Val Asp Pro Lys Ser Phe Lys Leu Val Gln Asn Lys Tyr 210 215 220 Leu Gly Val Ile Ile Gln Cys Leu Val Thr Glu Thr Lys Thr Ser Val 225 230 235 240 WO 01/49832 PCT/EPO1/00060 32 Ser Arg His Ile Tyr Phe Phe Ser Ala Arg Gly Arg Ile Asp Pro Leu 245 250 255 Val Tyr Leu Asp Glu Phe Leu Arg Asn Ser Glu Pro Val Leu Lys Arg 260 265 270 Val Asn Arg Thr Gly Asn Ser Ser Ser Asn Lys Gln Glu Tyr Gln Leu 275 280 285 Leu Lys Asp Asn Leu Val Arg Ser Tyr Asn Lys Ala Leu Lys Lys Asn 290 295 300 Ala Pro Tyr Pro Ile Phe Ala Ile Lys Asn Gly Pro Lys Ser His Ile 305 310 315 320 Gly Arg His Leu Met Thr Ser Phe Leu Ser Met Lys Gly Leu Thr Glu 325 330 335 Leu Thr Asn Val Val Gly Asn Trp Ser Asp Lys Arg Ala Ser Ala Val 340 345 350 Ala Arg Thr Thr Tyr Thr His Gln Ile Thr Ala Ile Pro Asp His Tyr 355 360 365 Phe Ala Leu Val Ser Arg Tyr Tyr Ala Tyr Asp Pro Ile Ser Lys Glu 370 375 380 Met Ile Ala Leu Lys Asp Glu Thr Asn Pro Ile Glu Glu Trp Gln His 385 390 395 400 Ile Glu Gln Leu Lys Gly Ser Ala Glu Gly Ser Ile Arg Tyr Pro Ala 405 410 415 Trp Asn Gly Ile Ile Ser Gln Glu Val Leu Asp Tyr Leu Ser Ser Tyr 420 425 430 Ile Asn Arg Arg Ile 435 <210> 5 <211> 2004 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22-Cre <220> <221> CDS <222> (1)..(2001) <400> 5 atg acc tct cgc cgc tcc gtg aag tcg ggt ccg cgg gag gtt ccg cgc 48 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 - 15 gat gag tac gag gat ctg tac tac acc ccg tct tca ggt atg gcg agt 96 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 WO 01/49832 PCT/EPO1/00060 33 ccc gat agt ccg cct gac acc tcc cgc cgt ggc gcc cta cag aca cgc 144 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gin Thr Arg 35 40 45 tcg cgc cag agg ggc gag gtc cgt ttc gtc cag tac gac gag tcg gat 192 Ser Arg Gin Arg Gly Glu Val Arg Phe Val Gin Tyr Asp Glu Ser Asp 50 55 60 tat gcc ctc tac ggg ggc tcg tct tcc gaa gac gac gaa cac ccg gag 240 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 gtc ccc cgg acg cgg cgt ccc gtt tcc ggg gcg gtt ttg tcc ggc ccg 288 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 ggg cct gcg cgg gcg cct ccg cca ccc gct ggg tcc gga ggg gcc gga 336 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 cgc aca ccc acc acc gcc ccc cgg gcc ccc cga acc cag cgg gtg gcg 384 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gin Arg Val Ala 115 120 125 act aag gcc ccc gcg gcc ccg gcg gcg gag acc acc cgc ggc agg aaa 432 Thr Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 tcg gcc cag cca gaa tcc gcc gca ctc cca gac gcc ccc gcg tcg acg 480 Ser Ala Gin Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 gcg cca acc cga tcc aag aca ccc gcg cag ggg ctg gcc aga aag ctg 528 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gin Gly Leu Ala Arg Lys Leu 165 170 175 cac ttt agc acc gcc ccc cca aac ccc gac gcg cca tgg acc ccc cgg 576 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 gtg gcc ggc ttt aac aag cgc gtc ttc tgc gcc gcg gtc ggg cgc ctg 624 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 gcg gcc atg cat gcc cgg atg gcg gcg gtc cag ctc tgg gac atg tcg 672 Ala Ala Met His Ala Arg Met Ala Ala Val Gin Leu Trp Asp Met Ser 210 215 220 cgt ccg cgc aca gac gaa gac ctc aac gaa ctc ctt ggc atc acc acc 720 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 230 235 240 atc cgc gtg acg gtc tgc gag ggc aaa aac ctg ctt cag cgc gcc aac 768 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 245 250 255 gag ttg gtg aat cca gac gtg gtg cag gac gtc gac gcg gcc acg gcg 816 Glu Leu Val Asn Pro Asp Val Val Gin Asp Val Asp Ala Ala Thr Ala 260 265 270 act cga ggg cgt tct gcg gcg tcg cgc ccc acc gag cga cct cga gcc 864 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 WO 01/49832 PCT/EPO1/00060 34 cca gcc cgc tcc gct tct cgc ccc aga cgg ccc gtc gag ggt acc gag 912 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 ctc gga tcc act agt cca gtg tgg tgg aat tct gca gat atc cag cac 960 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gin His 305 310 315 320 agt ggc ggt cgc atg tcc aat tta ctg acc gta cac caa aat ttg cct 1008 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gin Asn Leu Pro 325 330 335 gca tta ccg gtc gat gca acg agt gat gag gtt cgc aag aac ctg atg 1056 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 340 345 350 gac atg ttc agg gat cgc cag gcg ttt tct gag cat acc tgg aaa atg 1104 Asp Met Phe Arg Asp Arg Gin Ala Phe Ser Glu His Thr Trp Lys Met 355 360 365 ctt ctg tcc gtt tgc cgg tcg tgg gcg gca tgg tgc aag ttg aat aac 1152 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 370 375 380 cgg aaa tgg ttt ccc gca gaa cct gaa gat gtt cgc gat tat ctt cta 1200 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 385 390 395 400 tat ctt cag gcg cgc ggt ctg gca gta aaa act atc cag caa cat ttg 1248 Tyr Leu Gin Ala Arg Gly Leu Ala Val Lys Thr Ile Gin Gin His Leu 405 410 415 ggc cag cta aac atg ctt cat cgt cgg tcc ggg ctg cca cga cca agt 1296 Gly Gin Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 420 425 430 gac agc aat gct gtt tca ctg gtt atg cgg cgg atc cga aaa gaa aac 1344 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 435 440 445 gtt gat gcc ggt gaa cgt gca aaa cag gct cta gcg ttc gaa cgc act 1392 Val Asp Ala Gly Glu Arg Ala Lys Gln Ala-Leu Ala Phe Glu Arg Thr 450 455- 460 gat ttc gac cag gtt cgt tca ctc atg gaa aat agc gat cgc tgc cag 1440 Asp Phe Asp Gin Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gin 465 470 475 480 gat ata cgt aat ctg gca ttt ctg ggg att gct tat aac acc ctg tta 1488 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 485 490 495 cgt ata gcc gaa att gcc agg atc agg gtt aaa gat atc tca cgt act 1536 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 500 505 510 gac ggt ggg aga atg tta atc cat att ggc aga acg-aaa acg ctg gtt 1584 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 515 520 525 agc acc gca ggt gta gag aag gca ctt agc ctg ggg gta act aaa ctg 1632 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 530 535 540 WO 01/49832 PCT/EPO1/00060 35 gtc gag cga tgg att tcc gtc tct ggt gta gct gat gat ccg aat aac 1680 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 545 550 555 560 tac ctg ttt tgc cgg gtc aga aaa aat ggt gtt gcc gcg cca tct gcc 1728 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 565 570 575 acc agc cag cta tca act cgc gcc ctg gaa ggg att ttt gaa gca act 1776 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 580 585 590 cat cga ttg att tac ggc gct aag gat gac tct ggt cag aga tac ctg 1824 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 595 600 605 gcc tgg tct gga cac agt gcc cgt gtc gga gcc gcg cga gat atg gcc 1872 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 610 615 620 cgc gct gga gtt tca ata ccg gag atc atg caa got ggt ggc tgg acc 1920 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 625 630 635 640 aat gta aat att gtc atg aac tat atc cgt aac ctg gat agt gaa aca 1968 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 645 650 655 ggg gca atg gtg cgc ctg ctg gaa gat ggc gat tag 2004 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp 660 665 <210> 6 <211> 667 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22-Cre <400> 6 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 15 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gln Thr Arg 35 40 45 Ser Arg Gln Arg Gly Glu Val Arg Phe Val Gln Tyr Asp Glu Ser Asp 50 55 60 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gln Arg Val Ala 115 120 125 WO 01/49832 PCT/EPO1/00060 36 Thr Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 Ser Ala Gln Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 165 170 175 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 210 215 220 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 230 235 240 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 245 250 255 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 260 265 270 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 305 310 315 320 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gln Asn Leu Pro 325 330 335 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 340 345 350 Asp Met Phe Arg Asp Arg Gln Ala Phe Ser Glu His Thr Trp Lys Met 355 360 365 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 370 375 380 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 385 390 395 400 Tyr Leu Gln Ala Arg Gly Leu Ala Val Lys Thr Ile Gln Gln His Leu 405 410 415 Gly Gln Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 420 425 430 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 435 440. 445 Val Asp Ala Gly Glu Arg Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr 450 455 460 WO 01/49832 PCT/EPO1/00060 37 Asp Phe Asp Gln Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gln 465 470 475 480 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 485 490 495 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 500 ! 505 510 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 515 520 525 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 530 535 540 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 545 550 555 560 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 565 570 575 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 580 585 590 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 595 600 605 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 610 615 620 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 625 630 635 .640 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 645 650 655 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp 660 665 <210> 7 <211> 2247 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22-Flpe <220> <221> CDS <222> (1) ..(2241) <400> 7 atg acc tct cgc cgc tcc gtg aag tcg ggt ccg cgg gag gtt ccg cgc 48 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 15 gat gag tac gag gat ctg tac tac acc ccg tct tca ggt atg gcg agt 96 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 WO 01/49832 PCT/EPO1/00060 38 ccc gat agt ccg cct gac acc tcc cgc cgt ggc gcc cta cag aca cgc 144 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gln Thr Arg 35 40 45 tcg cgc cag agg ggc gag gtc cgt ttc gtc cag tac gac gag tcg gat 192 Ser Arg Gln Arg Gly Glu Val Arg Phe Val Gln Tyr Asp Glu Ser Asp 50 55 60 tat gcc ctc tac ggg ggc tcg tct tcc gaa gac gac gaa cac ccg gag 240 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 gtc ccc cgg acg cgg cgt ccc gtt tcc ggg gcg gtt ttg tcc ggc ccg 288 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 ggg cct gcg cgg gcg cct ccg cca ccc gct ggg tcc gga ggg gcc gga 336 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 cgc aca ccc acc acc gcc ccc cgg gcc ccc cga acc cag cgg gtg gcg 384 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gln Arg Val Ala 115 120 125 act aag gcc ccc gcg gcc ccg gcg gcg gag acc acc cgc ggc agg aaa 432 Thr Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 tcg gcc cag cca gaa tcc gcc gca ctc cca gac gcc ccc gcg tcg acg 480 Ser Ala Gln Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 gcg cca acc cga tcc aag aca ccc gcg cag ggg ctg gcc aga aag ctg 528 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 165 170 175 cac ttt agc acc gcc ccc cca aac ccc gac gcg cca tgg acc ccc cgg 576 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 gtg gcc ggc ttt aac aag cgc gtc ttc tgc gcc gcg gtc ggg cgc ctg 624 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 gcg gcc atg cat gcc cgg atg gcg gcg gtc cag ctc tgg gac atg tcg 672 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 210 215 220 cgt ccg cgc aca gac gaa gac cte aac gaa ctc ctt ggc atc acc acc 720 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 230 235 240 atc cgc gtg acg gtc tgc gag ggc-aaa aac ctg ctt cag cgc gcc aac 768 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 245 250 255 gag ttg gtg aat cca gac gtg gtg cag gac gtc gac gcg gcc acg gcg 816 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 260 265 270 act cga ggg cgt tct gcg gcg tcg cgc ccc acc gag cga cct cga gcc 864 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 WO 01/49832 PCT/EPO1/00060 39 cca gcc cgc tcc gct tct cgc ccc aga cgg ccc gtc gag ggt acc gag 912 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 ctc gga tcc act agt cca gtg tgg tgg aat tct gca gat atc cag cac 960 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 305 310 315 320 agt ggc ggc cgc atg agt caa ttt gat ata tta tgt aaa aca cca cct 1008 Ser Gly Gly Arg Met Ser Gln Phe Asp Ile Leu Cys Lys Thr Pro Pro 325 330 335 aag gtc ctg gtt cgt cag ttt gtg gaa agg ttt gaa aga cct tca ggg 1056 Lys Val Leu Val Arg Gln Phe Val Glu Arg Phe Glu Arg Pro Ser Gly 340 345 350 gaa aaa ata gca tca tgt got gct gaa cta acc tat tta tgt tgg atg 1104 Glu Lys Ile Ala Ser Cys Ala Ala Glu Leu Thr Tyr Leu Cys Trp Met 355 360 365 att act cat aac gga aca gca atc aag aga gcc aca ttc atg agc tat 1152 Ile Thr His Asn Gly Thr Ala Ile Lys Arg Ala Thr Phe Met Ser Tyr 370 375 380 aat act atc ata agc aat tcg ctg agt ttc gat att gtc aac aaa tca 1200 Asn Thr Ile Ile Ser Asn Ser Leu Ser Phe Asp Ile Val Asn Lys Ser 385 390 395 400 ctc cag ttt aaa tac aag acg caa aaa gca aca att ctg gaa gcc tca .1248 Leu Gln Phe Lys Tyr Lys Thr Gln Lys Ala Thr Ile Leu Glu Ala Ser 405 410 415 tta aag aaa tta att cct gct tgg gaa ttt aca att att cct tac aat 1296 Leu Lys Lys Leu Ile Pro Ala Trp Glu Phe Thr Ile Ile Pro Tyr Asn 420 425 430 gga caa aaa cat caa tct gat atc act gat att gta agt agt ttg caa 1344 Gly Gln Lys His Gln Ser Asp Ile Thr Asp Ile Val Ser Ser Leu Gln 435 440 445 tta cag ttc gaa tca tcg gaa gaa gca gat aag gga aat agc cac agt 1392 Leu Gln Phe Glu Ser Ser Glu Glu Ala Asp Lys Gly Asn Ser His Ser 450 455 460 aaa aaa atg ctt aaa gca ctt cta agt gag ggt-gaa agc atc tgg gag 1440 Lys Lys Met Leu Lys Ala Leu Leu Ser Glu Gly Glu Ser Ile Trp Glu 465 470 475 480 atc act gag aaa ata cta aat tcg ttt gag tat acc tcg aga ttt aca 1488 Ile Thr Glu Lys Ile Leu Asn Ser Phe Glu Tyr Thr Ser Arg Phe Thr 485 490 495 aaa aca aaa act tta tac caa ttc-ctc ttc cta gct act tto atc aat 1536 Lys Thr Lys Thr Leu Tyr Gln Phe Leu Phe Leu Ala Thr Phe Ile Asn 500 505 510 tgt gga aga ttc agc gat att aag aac gtt gat ccg aaa tca ttt aaa 1584 Cys Gly Arg Phe Ser Asp Ile Lys Asn Val Asp Pro Lys Ser Phe Lys 515 520 525 tta gtc caa aat aag tat ctg gga gta ata ato cag tgt tta gtg aca 1632 Leu Val Gln Asn Lys Tyr Leu Gly Val Ile Ile Gln Cys Leu Val Thr 530 535 540 WO 01/49832 PCT/EPO1/00060 40 gag aca aag aca agc gtt agt agg cac ata tac ttc ttt agc gca agg 1680 Glu Thr Lys Thr Ser Val Ser Arg His Ile Tyr Phe Phe Ser Ala Arg 5~45 550 555 560 ggt agg atc gat cca ctt gta tat ttg gat gaa ttt ttg agg aat tct 1728 Gly Arg Ile Asp Pro Leu Val Tyr Leu Asp Glu Phe Leu Arg Asn Ser 565 570 575 gaa cca gtc cta aaa cga gta aat agg acc ggc aat tct tca agc aac 1776 Glu Pro Val Leu Lys Arg Val Asn Arg Thr Gly Asn Ser Ser Ser Asn 580 585 590 aaa cag gaa tac caa tta tta aaa gat aac tta gtc aga tcg tac aac 1824 Lys Gln Glu Tyr Gln Leu Leu Lys Asp Asn Leu Val Arg Ser Tyr Asn 595 600 605 aag gct ttg aag aaa aat gcg cct tat cca atc ttt gct ata aag aat 1872 Lys Ala Leu Lys Lys Asn Ala Pro Tyr Pro Ile Phe Ala Ile Lys Asn 610 615 620 ggc cca aaa tct cac att gga aga cat ttg atg acc tca ttt ctg tca 1920 Gly Pro Lys Ser His Ile Gly Arg His Leu Met Thr Ser Phe Leu Ser 625 630 635 640 atg aag ggc cta acg gag ttg act aat gtt gtg gga aat tgg agc gat 1968 Met Lys Gly Leu Thr Glu Leu Thr Asn Val Val Gly Asn Trp Ser Asp 645 650 655 aag cgt got tct gcc gtg gcc agg aca acg tat act cat cag ata aca 2016 Lys Arg Ala Ser Ala Val Ala Arg Thr Thr Tyr Thr His Gln Ile Thr 660 665 670 gca ata cct gat cac tac ttc gca cta gtt tct cgg tac tat gca tat 2064 Ala Ile Pro Asp His Tyr Phe Ala Leu Val Ser Arg Tyr Tyr Ala Tyr 675 680 685 gat cca ata tca aag gaa atg ata gca ttg aag gat gag act aat cca 2112 Asp Pro Ile Ser Lys Glu Met Ile Ala Leu Lys Asp Glu Thr Asn Pro 690 695 700 att gag gag tgg cag cat ata gaa cag cta aag ggt agt gct gaa gga 2160 Ile Glu Glu Trp Gln His Ile Glu Gln Leu Lys Gly Ser Ala Glu Gly 705 710 715 720 agc ata cga tac ccc gca tgg aat ggg ata ata tca cag gag gta cta 2208 Ser Ile Arg Tyr Pro Ala Trp Asn Gly Ile Ile Ser Gln Glu Val Leu 725 730 735 gac tac ctt tca tcc tac ata aat aga cgc ata taatga 2247 Asp Tyr Leu Ser Ser Tyr Ile Asn Arg Arg Ile 740 745 <210> 8 <211> 747 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22-Flpe <400> 8 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 15 WO 01/49832 PCT/EPO1/00060 41 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gln Thr Arg 35 40 45 Ser Arg Gln Arg Gly Glu Val Arg Phe Val Gln Tyr Asp Glu Ser Asp 50 55 60 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gln Arg Val Ala 115 120 125 Thr Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 Ser Ala Gln Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 165 170 175 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 210 215 220 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 230 235 240 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 245 250 255 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 260 265 270 Thr Arg' Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 305 310 315 320 Ser Gly Gly Arg Met Ser Gln Phe Asp Ile Leu Cys Lys Thr Pro Pro 325 330 335 Lys Val Leu Val Arg Gln Phe Val Glu Arg Phe Glu Arg Pro Ser Gly 340 345 350 WO 01/49832 PCT/EPO1/00060 42 Glu Lys Ile Ala Ser Cys Ala Ala Glu Leu Thr Tyr Leu Cys Trp Met 355 360 365 Ile Thr His Asn Gly Thr Ala Ile Lys Arg Ala Thr Phe Met Ser Tyr 370 375 380 Asn Thr Ile Ile Ser Asn Ser Leu Ser Phe Asp Ile Val Asn Lys Ser 385 390 395 400 Leu Gln Phe Lys Tyr Lys Thr Gln Lys Ala Thr Ile Leu Glu Ala Ser 405 410 415 Leu Lys Lys Leu Ile Pro Ala Trp Glu Phe Thr Ile Ile Pro Tyr Asn 420 425 430 Gly Gln Lys His Gln Ser Asp Ile Thr Asp Ile Val Ser Ser Leu Gln 435 440 445 Leu Gln Phe Glu Ser Ser Glu Glu Ala Asp Lys Gly Asn Ser His Ser 450 455 460 Lys Lys Met Leu Lys Ala Leu Leu Ser Glu Gly Glu Ser Ile Trp Glu 465 470 475 480 Ile Thr Glu Lys Ile Leu Asn Ser Phe Glu Tyr Thr Ser Arg Phe Thr 485 490 495 Lys Thr Lys Thr Leu Tyr Gln Phe Leu Phe Leu Ala Thr Phe Ile Asn 500 505 510 Cys Gly Arg Phe Ser Asp Ile Lys Asn Val Asp Pro Lys Ser Phe Lys 515 520 525 Leu Val Gln Asn Lys Tyr Leu Gly Val Ile Ile Gln Cys Leu Val Thr 530 535 540 Glu Thr Lys Thr Ser Val Ser Arg His Ile Tyr Phe Phe Ser Ala Arg 545 550 555 560 Gly Arg Ile Asp Pro Leu Val Tyr Leu Asp Glu Phe Leu Arg Asn Ser 565 570 575 Glu Pro Val Leu Lys Arg Val Asn Arg Thr Gly Asn Ser Ser Ser Asn 580 585 590 Lys Gln Glu Tyr Gln Leu Leu Lys Asp Asn Leu Val Arg Ser Tyr Asn 595 600 605 Lys Ala Leu Lys Lys Asn Ala Pro Tyr Pro Ile Phe Ala Ile Lys Asn 610 615 620 Gly Pro Lys Ser His Ile Gly Arg His Leu Met Thr Ser Phe Leu Ser 625 630 635 640 Met Lys Gly Leu Thr Glu Leu Thr Asn Val Val Gly Asn Trp Ser Asp 645 650 655 Lys Arg Ala Ser Ala Val Ala Arg Thr Thr Tyr Thr His Gln Ile Thr 660 665 670 Ala Ile Pro Asp His Tyr Phe Ala Leu Val Ser Arg Tyr Tyr Ala Tyr 675 680 685 WO 01/49832 PCT/EPO1/00060 43 Asp Pro Ile Ser Lys Glu Met Ile Ala Leu Lys Asp Glu Thr Asn Pro 690 695 700 Ile Glu Glu Trp Gln His Ile Glu Gln Leu Lys Gly Ser Ala Glu Gly 705 710 715 720 Ser Ile Arg Tyr Pro Ala Trp Asn Gly Ile Ile Ser Gln Glu Val Leu 725 730 735 Asp Tyr Leu Ser Ser Tyr Ile Asn Arg Arg Ile 740 745 <210> 9 <211> 33 <212> DNA <213> Human immunodeficiency virus <400> 9 tacggccgca agaagcgccg ccaacgccgc cgc 33 <210> 10 <211> 11 <212> PRT <213> Human immunodeficiency virus <400> 10 Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 11 <211> 42 <212> DNA <213> Human immunodeficiency virus <220> <221> CDS <222> (4)..(42) <400> 11 atg ggc tac ggc cgc aag aag cgc cgc caa cgc cgc cgc ggc 42 Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly 1 5 10 <210> 12 <211> 13 <212> PRT <213> Human immunodeficiency virus <400> 12 Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly 1 5 10 <210> 13 <211> 1623 <212> DNA <213> Artificial Sequence <220> WO 01/49832 PCT/EPO1/00060 44 <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein deltaVP22cre-StrepTag <220> <221> CDS <222> (1)..(1617) <400> 13 atg gct agc atg act ggt gga cag caa atg ggt cgg gat ccg tog acg 48 Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Pro Ser Thr 1 5 10 15 gcg cca acc cga tcc aag aca ccc gcg cag ggg ctg gcc aga aag ctg 96 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 20 25 30 cac ttt ago acc gcc ccc cca aac ccc gac gcg cca tgg acc ccc cgg 144 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 35 40 45 gtg gcc ggc ttt aac- aag cgc gtc ttc tgc gcc gcg gtc ggg cgc ctg 192 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 50 55 60 gog gcc atg cat gcc cgg atg gcg gct gtc cag ctc tgg gac atg tcg 240 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 65 70 75 80 cgt ccg cgc aca gac gaa gac ctc aac gaa ctc ctt ggc atc acc acc 288 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 85 90 95 ato cgc gtg acg gtc tgc gag ggc aaa aac ctg ctt cag cgc gcc aac 336 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 100 105 110 gag ttg gtg aat cca gac gtg gtg cag gac gtc gac gcg gcc acg gcg 384 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 115 120 125 act cga ggg cgt tot gcg gcg tcg cgc ccc acc gag cga cct cga gcc 432 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 130 135 140 cca gcc cgc tcc got tct cgc ccc aga cgg ccc gtc gag ggt acc gag 480 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 145 150 155 160 ctc gga tcc act agt cca gtg tgg tgg aat tot gca gat atc cag cac 528 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 165 170 175 agt ggc ggc cgc atg tcc aat.tta ctg acc gta cac caa aat ttg cct 576 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gln Asn Leu Pro 180 185 190 gca tta ccg gtc gat gca acg agt gat gag gtt cgc aag aac ctg atg 624 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 195 200 205 gac atg ttc agg gat cgc cag gcg ttt tct gag cat acc tgg aaa atg 672, Asp Met Phe Arg Asp Arg Gln Ala Phe Ser Glu His Thr Trp Lys Met 210 215 220 WO 01/49832 PCT/EPO1/00060 45 ctt ctg tcc gtt tgc cgg tcg tgg gcg gca tgg tgc aag ttg aat aac 720 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 225 230 235 240 cgg aaa tgg ttt ccc gca gaa cct gaa gat gtt cgc gat tat ctt cta 768 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 245 250 255 tat ctt cag gcg cgc ggt ctg gca gta aaa act atc cag caa cat ttg 816 Tyr Leu Gln Ala Arg Gly Leu Ala Val Lys Thr Ile Gln Gln His Leu 260 265 270 ggc cag cta aac atg ctt cat cgt cgg tcc ggg ctg cca cga cca agt 864 Gly Gln Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 275 280 285 gac agc aat gct gtt tca ctg gtt atg cgg cgg atc cga aaa gaa aac 912 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 290 295 300 gtt gat gcc ggt gaa cgt gca aaa cag gct cta gcg ttc gaa cgc act 960 Val Asp Ala Gly Glu Arg Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr 305 310 315 320 gat ttc gac cag gtt cgt tca ctc atg gaa aat agc gat cgc tgc cag 1008 Asp Phe Asp Gln Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gln 325 330 335 gat ata cgt aat ctg gca ttt ctg ggg att gct tat aac acc ctg tta 1056 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 340 345 350 cgt ata gcc gaa att gcc agg atc agg gtt aaa gat atc tca cgt act 1104 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 355 360 365 gac ggt ggg aga atg tta ato cat att ggc aga acg aaa acg ctg gtt 1152 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 370 375 380 agc acc gca ggt gta gag aag gca ctt agc ctg ggg gta act aaa ctg 1200 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 385 390 395 400 gtc gag cga tgg att tcc gtc tct ggt gta gct gat gat ccg aat aac 1248 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 405 410 415 tac ctg ttt tgc cgg gtc aga aaa aat ggt gtt gcc gcg cca tct gcc 1296 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 420 425 430 acc agc cag cta tca act cgc gcc ctg gaa ggg att ttt gaa gca act 1344 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 435 440 445 cat cga ttg att tac ggc got aag gat gac tct ggt cag aga tac ctg 1392 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 450 455 460 gcc tgg tct gga cac agt gcc cgt gtc gga gcc gcg cga gat atg gcc 1440 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 465 470 475 480 WO 01/49832 PCT/EPO1/00060 46 cgc gct gga gtt tca ata ccg gag atc atg caa gct ggt ggc tgg acc 1488 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 485 490 495 aat gta aat att gtc atg aac tat atc cgt aac ctg gat agt gaa aca 1536 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 500 505 510 ggg gca atg gtg cgc ctg ctg gaa gat ggc gat ggt atc gaa ggt cgt 1584 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg 515 520 525 ggt agc got tgg cgt cac ccg cag ttc ggt ggt taataa 1623 Gly Ser Ala Trp Arg His Pro Gln Phe Gly Gly 530 535 <210> 14 <211> 539 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein deltaVP22cre-StrepTag <400> 14 Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Pro Ser Thr 1 5 10 15 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 20 25 30 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 35 40 45 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 50 55 60 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 65 70 75 80 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 85 90 95 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 100 105 110 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 115 120 125 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 130 135 140 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 145 150 155 160 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 165 170 175 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gln Asn Leu Pro 180 185 190 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 195 200 205 WO 01/49832 PCT/EPO1/00060 47 Asp Met Phe Arg Asp Arg Gln Ala Phe Ser Glu His Thr Trp Lys Met 210 215 220 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 225 230 235 240 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 245 250 255 Tyr Leu Gln Ala Arg Gly Leu Ala Val Lys Thr Ile Gln Gln His Leu 260 265 270 Gly Gln Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 275 280 285 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 290 295 300 Val Asp Ala Gly Glu Arg Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr 305 310 315 320 Asp Phe Asp Gln Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gln 325 330 335 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 340 345 350 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 355 360 365 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 370 375 380 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 385 390 395 400 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 405 410 415 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 420 425 430 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 435 440 445 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 450 455 460 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 465 470 475 480 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 485 490 495 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 500 505 510 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg 515 520 525 Gly Ser Ala Trp Arg His Pro Gln Phe Gly Giy 530 535 WO 01/49832 PCT/EPO1/00060 48 <210> 15 <211> 5953 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pCRT7-deltaVPCS <400> 15 cgatggattt ccgtctctgg tgtagctgat gatccgaata actacctqtt ttgccqggtc 60 agaaaaaatg gtgttgccgc gccatctgcc accagccaqc tatcaactcg cgccctggaa 120 gggatttttg aagcaactca tcqattgatt tacggcgcta aggatgactc tggtcagaga 180 tacctggcct ggtctggaca cagtgcccgt qtcgqagccg cgcgagatat ggcccgcgct 240 ggagtttcaa taccggagat catgcaagct ggtggctgga ccaatgtaaa tattgtcatg 300 aactatatcc gtaacctgga tagtgaaaca qgggcaatgg tgcgcctgct ggaagatggc 360 gatggtatcg aaggtcgtqg tagcgcttgg cgtcacccgc agttcggtqg ttaataagct 420 tcgaacaaaa actcatctca gaagaggatc tqaatatgca taccggtcat catcaccatc 480 accattgagt tttgagcaat aactagcata accccttggg gcctctaaac gggtcttgag 540 gggttttttg ctgaaaggag gaactatatc cggatatcca caggacgggt gtgqtcgcca 600 tgatcgcgta gtcgatagtg gctccaagta gcgaagcgag caggactggg cggcggccaa 660 agcggtcgga cagtgctccg agaacgggtg cgcatagaaa ttgcatcaac gcatatagcg 720 ctagcagcac gccatagtga ctggcgatgc tgtcggaatg gacgatatcc cgcaagaggc 780 ccggcagtac cggcataacc aagcctatgc ctacagcatc cagggtgacg gtgccgagga 840 tgacgatgag cgcattgtta gatttcatac acggtgcctg actgcgttag caatttaact 900 gtgataaact accgcattaa agcttatcga tgataagctg tcaaacatga gaattaattc 960 ttagaaaaac tcatcgagca tcaaatgaaa ctgcaattta ttcatatcag gattatcaat 1020 accatatttt tgaaaaagcc gtttctgtaa tgaaggagaa aactcaccga ggcagttcca 1080 taggatggca agatcctggt atcqqtctgc qattccgact cgtccaacat caatacaacc 1140 tattaatttc ccctcgtcaa aaataaggtt atcaagtgag aaatcaccat gagtgacgac 1200 tgaatccggt gagaatggca aaagcttatg catttctttc cagacttgtt caacaggcca 1260 gccattacgc tcgtcatcaa aatcactcgc atcaaccaaa ccgttattca ttcgtgattg 1320 cgcctgagcg agacgaaata cgcqatcgct gttaaaagga caattacaaa caggaatcga 1380 atgcaaccgg cgcaggaaca ctgccagcgc atcaacaata ttttcacctg aatcaggata 1440 ttcttctaat acctggaatg ctgttttccc ggggatcgca gtggtgagta accatgcatc 1500 atcaggagta cggataaaat gcttgatggt cggaagaggc ataaattccg tcagccagtt 1560 tagtctgacc atctcatctg taacatcatt ggcaacgcta cctttqccat gtttcagaaa 1620 caactctggc gcatcgggct tcccatacaa tcgatagatt gtcgcacctg attgcccgac 1680 attatcgcga gcccatttat acccatataa atcagcatcc atgttggaat ttaatcgcgg 1740 cctcgagcaa gacgtttccc gttgaatatg gctcataaca ccccttgtat tactgtttat 1800 gtaagcagac agttttattg ttcatgacca aaatccctta acgtgagttt tcgttccact 1860 gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 1920 taatctgctg cttgcaaaca aaaaaaccac cgctaccagc qgtqgtttgt ttgccqgatc 1980 aagagctacc aactcttttt ccgaaqqtaa ctggcttcag cagagcgcaq ataccaaata 2040 ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 2100 catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcqtgtc 2160 ttaccgggtt ggadtcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 2220 ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 2280 agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 2340 taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 2400 atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 2460 cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 2520 ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 2580 accgtattac cgcctttgag tgagctgata ccqctcgccg cagccgaacg accgagcgca 2640 gcgagtcagt gagcgaggaa gcggaagagc gcctgatgcg gtattttctc cttacgcatc 2700 tgtgcggtat ttcacaccgc atatatggtg cactctcagt acaatctgct ctgatgccgc 2760 atagttaagc cagtatacac tccgctatcg ctacgtgact gggtcatqgc tqcgccccga 2820 cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac 2880 agacaagctg tgaccgtctc cgggagctgc atgtqtcaga ggttttcacc gtcatcaccg 2940 aaacgcgcga ggcagctgcg gtaaagctca tcagcgtggt cgtgaagcqa ttcacagatg 3000 tctgcctgtt catccgcgtc cagctcgttgagtttctcca gaagcgttaa tgtctggctt 3060 ctgataaagc gggccatgtt aagggcggtt ttttcctgtt tggtcactga tgcctccgtg 3120 taagggggat ttctgttcat ggggqtaatg ataccgatga aacgagagag gatgctcacq 3180 atacgggtta ctgatgatga acatgcccgg ttactggaac gttgtgaggg taaacaactg 3240 taggctg cgtcacccgc-- - WO 01/49832 PCT/EPO1/00060 49 gcggtatgga tgcggcggga ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt 3300 aatacagatg taggtgttcc acagggtagc cagcagcatc ctgcgatgca gatccggaac 3360 ataatggtgc agggcgctga cttccgcgtt tccagacttt acgaaacacg gaaaccgaag 3420 accattcatg ttgttgctca ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc 3480 tcgcgtatcg gtgattcatt ctgctaacca gtaaggcaac cccgccagcc tagccgggtc 3540 ctcaacgaca ggagcacgat catgcgcacc cgtggccagg acccaacgct gcccgagatg 3600 cgccgcgtgc ggctgctgqa gatggcggac gcgatggata tgttctgcca agggttggtt 3660 tgcgcattca cagttctccg caagaattga ttggctccaa ttcttggagt ggtgaatccg 3720 ttagcgaggt gccgccggct tccattcagg tcgaggtggc ccggctccat gcaccgcqac 3780 gcaacgcggg gaggcagaca aggtataggg cggcgcctac aatccatgcc aacccgttcc 3840 atgtgctcgc cgaggcggca taaatcgccg tgacgatcag cggtccagtg atcgaagtta 3900 ggctggtaag agccgcgagc gatccttgaa gctgtccctg atggtcgtca tctacctgcc 3960 tggacagcat ggcctgcaac gcgggcatcc cgatgccgcc ggaagcgaga agaatcataa 4020 tggggaaggc catccagcct cgcgtcgcga acgccagcaa gacgtagccc agcgcgtcgg 4080 ccgccatgcc ggcgataatg gcctgcttct cgccgaaacg tttggtggcg ggaccagtga 4140 cgaaggcttg agcgagggcg tgcaagattc cgaataccgc aagcgacagg ccgatcatcg 4200 tcgcgctcca gcgaaagcgg tcctcgccga aaatgaccca gagcgctgcc ggcacctgtc 4260 ctacgagttg catgataaag aagacagtca taagtgcggc gacgatagtc atgccccgcg 4320 cccaccggaa ggagctgact gggttgaagg ctctcaaggg catcggtcga cgctctccct 4380 tatgcgactc ctgcattagg aagcagccca gtagtaggtt gaggccgttg agcaccgccg 4440 ccgcaaggaa tggtgcatgc aaggagatgg cgcccaacag tcccccggcc acggggcctg 4500 ccaccatacc cacgccgaaa caagcgctca tgagcccgaa gtggcgagcc cgatcttccc 4560 catcggtgat gtcggcgata taggcgccag caaccgcacc tgtggcgccg gtgatgccgg 4620 ccacgatgcg tccggcgtag aggatcgaga tctcgatccc gcgaaattaa tacgactcac 4680 tatagggaga ccacaacggt ttccctctag aaataatttt gtttaacttt aagaaggaga 4740 tatacatatg gctagcatga ctggtggaca gcaaatgggt cgggatccgt cgacggcgcc 4800 aacccgatcc aagacacccg cgcaggggct ggccagaaag ctgcacttta gcaccgcccc 4860 cccaaacccc gacgcgccat ggaccccccg ggtggccggc tttaacaagc gcgtcttctg 4920 cgccgcggtc gggcgcctgg cggccatgca tgcccggatg gcggctgtcc agctctggga 4980 catgtcgcgt ccgcgcacag acgaagacct caacgaactc cttggcatca ccaccatccg 5040 cgtgacggtc tgcgagggca aaaacctgct tcagcgcgcc aacgagttgg tgaatccaga 5100 cgtggtgcag gacgtcgacg cggccacggc gactcgaggg cgttctgcgg cgtcgcgccc 5160 caccgagcga cctcgagccc cagcccqctc cgcttctcgc cccagacggc ccgtcgaggg 5220 taccgagctc ggatccacta gtccagtgtg gtggaattct gcagatatcc agcacagtgg 5280 cggccgcatg tccaatttac tgaccgtaca ccaaaatttg cctgcattac cggtcgatgc 5340 aacgagtgat gaggttcgca agaacctgat ggacatgttc agggatcgcc aggcgttttc 5400 tgagcatacc tggaaaatgc ttctgtccgt ttgccggtcg tgggcggcat ggtgcaagtt 5460 gaataaccgg aaatggtttc ccgcagaacc tgaagatgtt cgcgattatc ttctatatct 5520 tcaggcgcgc ggtctggcag taaaaactat ccagcaacat ttgggccagc taaacatgct 5580 tcatcgtcgg tccgggctgc cacgaccaag tgacagcaat gctgtttcac tggttatgcg 5640 gcggatccga aaagaaaacg ttgatgccgg tgaacgtgca aaacaggctc tagcgttcga 5700 acgcactgat ttcgaccagg ttcgttcact catggaaaat agcgatcgct gccaggatat 5760 acgtaatctg gcatttctgg ggattgctta taacaccctg ttacgtatag ccgaaattgc 5820 caggatcagg gttaaagata tctcacgtac tgacggtggg agaatgttaa tccatattgg 5880 cagaacgaaa acgctggtta gcaccgcagg tgtagagaag gcacttagcc tgggggtaac 5940 taaactggtc gag 5953 <210> 16 <211> 4727 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pT 7-TACS <400> 16 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta aggccccaa 60 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaaqcttat 180 taaccaccga actgcgggtg acgccaagcg ctaccacgac cttcgatacc atcgccatct 240 tccagcaggc qcaccattgc ccctgtttca ctatccaggt tacggatata gttcatgaca 300 atatttacat tggtccagcc accagcttgc atgatctccg gtattgaaac tccagcgcgg 360 gatctga g--tgtccctg-- WO 01/49832 PCT/EPO1/00060 50 gccatatctc gcgcggctcc gacacgggca ctgtgtccag accaggccag gtatctctga 420 ccagagtcat ccttagcgcc gtaaatcaat cgatgagttg cttcaaaaat cccttccagg 480 gcgcgagttg atagctggct ggtggcagat ggcgcggcaa caccattttt tctgacccgg 540 caaaacaggt agttattcgg atcatcagct acaccagaga cggaaatcca tcgctcgacc 600 agtttagtta cccccaggct aagtgccttc tctacacctg cggtgctaac cagcqttttc 660 gttctgccaa tatggattaa cattctccca ccgtcagtac gtgagatatc tttaaccctg 720 atcctggcaa tttcggctat acgtaacagg gtgttataag caatccccag aaatgccaga 780 ttacgtatat cctggcagcg atcgctattt tccatgagtg aacgaacctg gtcgaaatca 840 gtgcgttcga acgctagagc ctgttttgca cgttcaccgg catcaacgtt ttcttttcgg 900 atccgccgca taaccagtga aacagcattg ctgtcacttg gtcgtggcag cccggaccga 960 cgatgaagca tgtttagctg gcccaaatgt tgctggatag tttttactgt cagaccgcgc 1020 gcctgaagat atagaagata atcgcgaaca tcttcaggtt ctgcgggaaa ccatttccgg 1080 ttattcaact tgcaccatgc cgcccacgac cggcaaacgg acagaagcat tttccaggta 1140 tgctcagaaa acgcctggcg atccctgaac atgtccatca ggttcttgcg aacctcatca 1200 ctcgttgcat cgaccggtaa tgcaggcaaa ttttggtgta cggtcagtaa attggacatg 1260 ccgcggcggc gttggcggcg cttcttgcgg ccgtagccca tggtatatct ccttcttaaa 1320 gttaaacaaa attatttcta gagggaaacc gttgtggtct ccctatagtg agtcgtatta 1380 atttcgcggg atcgagatct cgggcagcgt tgggtcctgg ccacgggtgc gcatgatcgt 1440 gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc cttactggtt agcagaatga 1500 atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc aaaacgtctg cgacctgagc 1560 aacaacatga atggtcttcg gtttccgtgt ttcgtaaagt ctggaaacgc ggaagtcagc 1620 gccctgcacc attatgttcc ggatctgcat cgcaggatgc tgctggctac cctgtggaac 1680 acctacatct gtattaacga agcgctggca ttgaccctga gtgatttttc tctggtcccg 1740 ccgcatccat accgccagtt gtttaccctc acaacgttcc agtaaccggg catgttcatc 1800 atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc ggtatcatta cccccatgaa 1860 cagaaatccc ccttacacgg aggcatcagt gaccaaacag gaaaaaaccg cccttaacat 1920 ggcccgcttt atcagaagcc agacattaac gcttctggag aaactcaacg agctggacgc 1980 ggatgaacag gcagacatct gtgaatcgct tcacgaccac gctgatgagc tttaccgcag 2040 ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac 2100 ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgteagc 2160 gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata gcggagtgta 2220 tactggctta actatgcggc atcagagcag attgtactga gagtgcacca tatatgcggt 2280 gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct 2340 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 2400 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 2460 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 2520 tccgcccccc tgacgagcat cacaaaaatc gacqctcaag tcagaqgtgg cqaaacccga 2580 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 2640 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 2700 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 2760 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 2820 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 2880 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 2940 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 3000 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 3060 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 3120 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 3180 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 3240 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 3300 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 3360 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 3420 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 3480 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 3540 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc atcgtggtgt 3600 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 3660 catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 3720 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 3780 ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 3840 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg qataataccg 3900 cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 3960 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 4020 gatcttcagc atcttttact ttcaccagcgtttctgggtg agcaaaaaca ggaaggcaaa 4080 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 4140 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 4200 c-tgcgc atcgctattt -- - WO 01/49832 PCT/EPO1/00060 51 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 4260 aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat 4320 tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga 4380 tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca 4440 acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct 4500 aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc 4560 cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag 4620 cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca 4680 cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgcca 4727 <210> 17 <211> 4488 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pT7-VPCS <400> 17 aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 60 gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 120 gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 180 cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 240 gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttqttgccgg 300 gaagctagag taagtagttc qccagttaat agtttgcgca acgttgttgc cattgctaca 360 ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 420 tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 480 ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactq 540 cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 600 accaagtcat tctgagaata gtgtatqcgg cgaccgagtt gctcttgccc ggcgtcaaca 660 cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 720 tcggggcgaa aactctcaag gatcttaccg ctqttgagat ccagttcgat gtaacccact 780 cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 840 acaggaaggc aaaatgccgc aaaaaaggga ataaqggcga cacggaaatg ttgaatactc 900 atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 960 tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 1020 aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg 1080 cgtatcacga ggccctttcg tcttcaagaa ttaaaagqat ctagqtgaag atcctttttg 1140 ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 1200 tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 1260 aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 1320 tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 1380 agccgtagtt aggccaccac ttcaagaact ctgtagcacc qcctacatac ctcgctctgc 1440 taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc qggttggact 1500 caagacgata gttaccggat aaggcgcagc gqtcgggctg aacggggggt tcgtgcacac 1560 agcccagctt ggagcgaacg acctacaccg aactgaqata cctacagcqt gagctatgag 1620 aaagcgccac gcttcccgaa gggagaaagg cgqacaggta tccggtaagc ggcagggtcg 1680 gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 1740 tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 1800 gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt 1860 ttgctcacat gttctttcct gcgttatccc ctgattctqt ggataaccgt attaccqcct 1920 ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 1980 aggaagcgga agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac 2040 accgcatcag atctgatggt gcactctcag tacaatctgc tctgatgccg catagttaag 2100 ccagtatata cactccgcta tcgctacgtg actgggtcat ggctgcgccc cgacacccgc 2160 caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 2220 ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 2280 cgaggcccag cgattcgaac ttctgataga cttcgaaatt aatacgactc actataggga 2340 gaccacaacg gtttccctct agaaataatt ttgtttaact ttaagaagga gatatacata 2400 tgacctctcg ccgctccgtg aagtcgggtc cgcgggaggt tccgcgcgat gagtacgagg 2460 atctgtacta caccccgtct tcaggtatgg cgaqtcccga tagtccgcct gacacctccc 2520 gccgtggcgc cctacagaca cgctcgcgcc agaggggcga ggtccgtttc gtccagtacg 2580 gtcttgg atggcttca tcagctccgg WO 01/49832 PCT/EPO1/00060 52 acgagtcgga ttatgccctc tacgggggct cgtcttccga agacgacgaa cacccggagg 2640 tcccccggac gcggcgtccc gtttccgggg cggttttgtc cggcccgggg cctgcgcggg 2700 cgcctccgcc acccgctggg tccggagggg ccggacgcac acccaccacc gccccccggg 2760 ccccccgaac ccagcgggtg gcgtctaagg cccccgcggc cccggcggcg gagaccaccc 2820 gcggcaggaa atcggcccag ccagaatccg ccgcactccc agacgccccc gcgtcgacgg 2880 cgccaacccg atccaagaca cccgcgcagg ggctggccag aaagctgcac tttagcaccg 2940 cccccccaaa ccccgacgcg ccatggaccc cccgggtggc cggctttaac aagcgcgtct 3000 tctgcgccgc ggtcgggcgc ctggcggcca tgcatgcccg gatggcggct gtccagctct 3060 gggacatgtc gcgtccgcgc acagacgaag acctcaacga actccttggc atcaccacca 3120 tccgcgtgac ggtctgcgag ggcaaaaacc tgcttcagcg cgccaacgag ttggtgaatc 3180 cagacgtggt gcaggacgtc gacgcggcca cggcgactcg agggcgttct gcggcgtcgc 3240 gccccaccga gcgacctcga gccccagccc gctccgcttc tcgccccaga cggcccgtcg 3300 agggtaccga gctcggatcc actagtccag tgtggtggaa ttctgcagat atccagcaca 3360 gtggcggccg catgtccaat ttactgaccg tacaccaaaa tttgcctgca ttaccggtcg 3420 atgcaacgag tgatgaggtt cgcaagaacc tgatggacat gttcagggat cgccaggcgt 3480 tttctgagca tacctggaaa atgcttctgt ccgtttgccg gtcgtgggcg gcatggtgca 3540 agttgaataa ccggaaatgg tttcccgcag aacctgaaga tgttcgcgat tatcttctat 3600 atcttcaggc gcgcggtctg gcagtaaaaa ctatccagca acatttgggc cagctaaaca 3660 tgcttcatcg tcggtccggg ctgccacgac caagtgacag caatgctgtt tcactggtta 3720 tgcggcggat ccgaaaagaa aacgttgatg ccggtgaacg tgcaaaacag gctctagcgt 3780 tcgaacgcac tgatttcgac caggttcgtt cactcatgga aaatagcgat cgctgccagg 3840 atatacgtaa tctggcattt ctggggattg cttataacac cctgttacgt atagccgaaa 3900 ttgccaggat cagggttaaa gatatctcac gtactgacgg tgggagaatg ttaatccata 3960 ttggcagaac gaaaacgctg gttagcaccg caggtgtaga gaaggcactt agcctggqgg 4020 taactaaact ggtcgagcga tggatttccg tctctggtgt agctgatgat ccgaataact 4080 acctgttttg ccgggtcaga aaaaatggtg ttgccgcgcc atctgccacc agccagctat 4140 caactcgcgc cctggaaggg atttttgaag caactcatcg attgatttac ggcgctaagg 4200 atgactctgg tcagagatac ctggcctggt ctggacacag tgcccgtgtc ggagccgcgc 4260 gagatatggc ccgcgctgga gtttcaatac cggagatcat gcaagctggt ggctggacca 4320 atgtaaatat tgtcatgaac tatatccgta acctggatag tgaaacaggg gcaatggtgc 4380 gcctgctgga agatggcgat ggtatcgaag gtcgtggtag cgcttggcgt cacccgcagt 4440 tcggtggtta ataagcttat cgatgataag ctgtcaaaca tgagaatt 4488 <210> 18 <211> 1125 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TATcreStrepTag <220> <221> CDS <222> (1)..(1119) <400> 18 atg ggc tao ggc cgc aag aag cgc cgc caa cgc cgc cgc ggc atg tcc 48 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gin Arg Arg Arg Gly Met Ser 1 5 10 15 aat tta ctg acc gta cac caa aat ttg cct gca tta ccg gtc gat gca 96 Asn Leu Leu Thr Val His Gin Asn Leu Pro Ala Leu Pro Val Asp Ala 20 25 30 acg agt gat gag gtt cgc aag aac ctg atg gac atg ttc agg gat cgc 144 Thr Ser Asp Glu Val Arg Lys Asn Leu Met Asp Met Phe Arg Asp Arg 35 40 45 cag gcg ttt tct gag cat acc tgg aaa atg ctt ctg tcc gtt tgc cgg 192 Gin Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val Cys Arg 50 55 60 WO 01/49832 PCT/EPO1/00060 53 tcg tgg gcg gca tgg tgc aag ttg aat aac cgg aaa tgg ttt ccc gca 240 Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe Pro Ala 65 70 75 80 gaa cct gaa gat gtt cgc gat tat ctt cta tat ctt cag gcg cgc ggt 288 Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gln Ala Arg Gly 85 90 95 ctg aca gta aaa act atc cag caa cat ttg ggc cag cta aac atg ctt 336 Leu Thr Val Lys Thr Ile Gln Gln His Leu Gly Gln Leu Asn Met Leu 100 105 110 cat cgt cgg tcc ggg ctg cca cga cca agt gac agc aat gct gtt tca 384 His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp -Ser Asn Ala Val Ser 115 120 125 ctg gtt atg cgg cgg atc cga aaa gaa aac gtt gat gcc ggt gaa cgt 432 Leu Val Met Arg Arg Ile Arg Lys Glu Asn Val Asp Ala Gly Glu Arg 130 135 140 gca aaa cag gct cta gcg ttc gaa cgc act gat ttc gac cag gtt cgt 480 Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gln Val Arg 145 150 155 160 tca ctc atg gaa aat agc gat cgc tgc cag gat ata cgt aat ctg gca 528 Ser Leu Met Glu Asn Ser Asp Arg Cys Gln Asp Ile Arg Asn Leu Ala 165 170 175 ttt ctg ggg att got tat aac acc ctg tta cgt ata gcc gaa att gcc 576 Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu Arg Ile Ala Glu Ile Ala 180 185 190 agg atc agg gtt aaa gat atc tca cgt act gac ggt ggg aga atg tta 624 Arg Ile Arg Val Lys Asp Ile Ser Arg Thr Asp Gly Gly Arg Met Leu 195 200 205 atc cat att ggc aga acg aaa acg ctg gtt agc acc gca ggt gta gag 672 Ile His Ile Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly Val Glu 210 215 220 aag gca ctt ago ctg ggg gta act aaa ctg gtc gag cga tgg att tcc 720 Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp Ile Ser 225 230 235 240 gtc tct ggt gta gct gat gat ccg aat aac tac ctg ttt tgc cgg gtc 768 Val Ser Gly Val Ala Asp Asp Pro Asn Asn Tyr Leu Phe Cys Arg Val 245 250 255 aga aaa aat ggt gtt gcc gcg cca tct gcc acc agc cag cta tca act 816 Arg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gln Leu Ser Thr 260 265 270 cgo gcc ctg gaa ggg att ttt gaa gca act cat cga ttg att tac ggc 864 Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr His Arg Leu Ile Tyr Gly 275 280 285 got aag gat gac tct ggt cag aga tac ctg gcc tgg tct gga cac agt 912 Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu Ala Trp Ser Gly His Ser 290 295 300 gcc cgt gtc gga gcc gcg cga gat atg gcc cgc got gga gtt tca ata 960 Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val Ser Ile 305 310 315 320 WO 01/49832 PCT/EPO1/00060 54 ccg gag atc atg caa gct ggt ggc tgg acc aat gta aat att gtc atg 1008 Pro Glu Ile Met Gln Ala Gly Gly Trp Thr Asn Val Asn Ile Val Met 325 330 335 aac tat atc cgt aac ctg gat agt gaa aca ggg gca atg gtg cgc ctg 1056 Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr Gly Ala Met Val Arg Leu 340 345 350 ctg gaa gat ggc gat ggt atc gaa ggt cgt ggt agc gct tgg cgt cac 1104 Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg Gly Ser Ala Trp Arg His 355 360 365 ccg cag ttc ggt ggt taataa 1125 Pro Gln Phe Gly Gly 370 <210> 19 <211> 373 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein TATcreStrepTag <400> 19 Met Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Met Ser 1 5 10 15 Asn Leu Leu Thr Val His Gln Asn Leu Pro Ala Leu Pro Val Asp Ala 20 25 30 Thr Ser Asp Glu Val Arg Lys Asn Leu Met Asp Met Phe Arg Asp Arg 35 40 45 Gln Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val Cys Arg 50 55 60 Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe Pro Ala 65 70 75 80 Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gln Ala Arg Gly 85 90 95 Leu Thr Val Lys Thr Ile Gln Gln His Leu Gly Gln Leu Asn Met Leu 100 105 110 His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp Ser Asn Ala Val Ser 115 120 125 Leu Val Met Arg Arg Ile Arg Lys Glu Asn Val Asp Ala Gly Glu Arg 130 135 140 Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gln Val Arg 145 150 155 160 Ser Leu Met Glu Asn Ser Asp Arg Cys Gln Asp Ile Arg Asn Leu Ala 165 170 175 Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu Arg Ile Ala Glu Ile Ala 180 185 190 Arg Ile Arg Val Lys Asp Ile Ser Arg Thr Asp Gly Gly Arg Met Leu 195 200 205 WO 01/49832 PCT/EPO1/00060 55 Ile His Ile Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly Val Glu 210 215 220 Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp Ile Ser 225 230 235 240 Val Ser Gly Val Ala Asp Asp Pro Asn Asn Tyr Leu Phe Cys Arg Val 245 250 255 Arg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gln Leu Ser Thr 260 265 270 Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr His Arg Leu Ile Tyr Gly 275 280 285 Ala Lys Asp Asp Ser Gly Gin Arg Tyr Leu Ala Trp Ser Gly His Ser 290 295 300 Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val Ser Ile 305 310 315 320 Pro Glu Ile Met Gin Ala Gly Gly Trp Thr Asn Val Asn Ile Val Met 325 330 335 Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr Gly Ala Met Val Arg Leu 340 345 350 Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg Gly Ser Ala Trp Arg His 355 360 365 Pro Gin Phe Gly Gly 370 <210> 20 <211> 2055 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22creStrepTag <220> <221> CDS <222> (1)..(2049) <400> 20 atg acc tct cgc cgc tcc gtg aag tcg ggt ccg cgg gag gtt ccg cgc 48 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 15 gat gag tac gag gat ctg tac tac acc ccg tct tca ggt atg gcg agt 96 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 ccc gat agt ccg cct gac acc tcc cgc cgt ggc gcc cta cag aca cgc 144 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gin Thr Arg 35 40 45 tcg cgc cag agg ggc gag gtc cgt ttc gtc cag tac gac gag tcg gat 192 Ser Arg Gin Arg Gly Glu Val Arg Phe Val Gin Tyr Asp Glu Ser Asp 50 55 60 WO 01/49832 PCT/EPO1/00060 56 tat gcc ctc tac ggg ggc tcg tct tcc gaa gac gac gaa cac ccg gag 240 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 gtc ccc cgg acg cgg cgt ccc gtt tcc ggg gcg gtt ttg tcc ggc ccg 288 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 ggg cct gcg cgg gcg cct ccg cca ccc gct ggg tcc gga ggg gcc gga 336 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 cgc aca ccc aco aoc gcc ccc cgg gcc ccc cga acc cag cgg gtg gcg 384 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gln Arg Val Ala 115 120 125 tct aag gcc ccc gcg gcc ccg gcg gcg gag acc acc cgc ggc agg aaa 432 Ser Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 tcg gcc cag cca gaa tcc. gcc gca ctc cca gac gcc ccc gcg tcg acg 480 Ser Ala Gln Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 gcg cca acc cga tcc aag aca ccc gcg cag ggg ctg gcc aga aag ctg 528 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gln Gly Leu Ala Arg Lys Leu 165 170 175 cac ttt agc acc gcc ccc cca aac ccc gac gcg cca tgg acc ccc cgg 576 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 gtg gcc ggc ttt aac aag cgc gtc ttc tgc gcc gcg gtc ggg cgc ctg 624 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 gcg gcc atg cat gcc cgg atg gcg gct gtc cag ctc tgg gac atg tcg 672 Ala Ala Met His Ala Arg Met Ala Ala Val Gln Leu Trp Asp Met Ser 210 215 220 cgt ccg cgc aca gac gaa gac ctc aac gaa ctc ctt ggc atc acc acc 720 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 - 230 235 240 atc cgc gtg acg gtc tgc gag ggc aaa aac ctg ctt cag cgc gcc aac 768 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gln Arg Ala Asn 245 250 255 gag ttg gtg aat cca gac gtg gtg cag gac gtc gac gcg gcc acg gcg 816 Glu Leu Val Asn Pro Asp Val Val Gln Asp Val Asp Ala Ala Thr Ala 260 265 270 act cga ggg cgt tct gcg gcg tcg cgc ccc acc gag cga cct cga gcc 864 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 , cca gcc cgc tcc gct tct cgc ccc aga cgg ccc gtc gag ggt acc gag 912 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 ctc gga tcc act agt cca gtg tgg tgg aat tct gca gat atc cag cac 960 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His 305 310 315 320 WO 01/49832 PCT/EPO1/00060 57 agt ggc ggc cgc atg tcc aat tta ctg acc gta cac caa aat ttg cct 1008 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gln Asn Leu Pro 325 330 335 gca tta ccg gtc gat gca acg agt gat gag gtt cgc aag aac ctg atg 1056 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 340, 345 350 gac atg ttc agg gat cgc cag gcg ttt tct gag cat acc tgg aaa atg 1104 Asp Met Phe Arg Asp Arg Gln Ala Phe Ser Glu His Thr Trp Lys Met 355 360 365 ctt ctg tcc gtt tgc cgg tcg tgg gcg gca tgg tgc aag ttg aat aac 1152 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 370 375 380 cgg aaa tgg ttt ccc gca gaa cct gaa gat gtt cgc gat tat ctt cta 1200 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 385 390 395 400 tat ctt cag gcg cgc ggt ctg gca gta aaa act atc cag caa cat ttg 1248 Tyr Leu Gln Ala Arg Gly Leu Ala Val Lys Thr Ile Gln Gln His Leu 405 410 415 ggc cag cta aac atg ctt cat cgt cgg tcc ggg ctg cca cga cca agt 1296 Gly Gln Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 420 425 430 gac agc aat got gtt tca ctg gtt atg cgg cgg atc cga aaa gaa aac 1344 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 435 440 445 gtt gat gcc ggt gaa cgt gca aaa cag gct cta gcg ttc gaa cgc act 1392 Val Asp Ala Gly Glu Arg Ala Lys Gln Ala Leu Ala Phe Glu Arg Thr 450 455 460 gat ttc gac cag gtt cgt tca ctc atg gaa aat ag gat cgc tgc cag 1440 Asp Phe Asp Gln Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gln 465 470 475 480 gat ata cgt aat ctg gca ttt ctg ggg att gct tat aac acc ctg tta 1488 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 485 490 495 cgt ata gcc gaa att gcc agg atc agg gtt aaa gat atc tca cgt act 1536 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 500 505 510 gac ggt ggg aga atg tta atc cat att ggc aga acg aaa acg ctg gtt 1584 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 515 520 525 agc acc gca ggt gta gag aag gca ctt agc ctg ggg gta act aaa ctg 1632 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 530 535 540 gtc gag cga tgg att tcc gtc tot ggt gta gct gat gat ccg aat aac 1680 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 545 550 555 560 tac ctg ttt tgc cgg gtc aga aaa aat ggt gtt gcc gcg cca tct gcc 1728 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 565 570 575 WO 01/49832 PCT/EPO1/00060 58 acc agc cag cta tca act cgc gcc ctg gaa ggg att ttt gaa gca act 1776 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 580 585 590 cat cga ttg att tac ggc gct aag gat gac tct ggt cag aga tac ctg 1824 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 595 600 605 gcc tgg tct gga cac agt gcc cgt gtc gga gcc gcg cga gat atg gcc 1872 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 610 615 620 cgc gct gga gtt tca ata ccg gag atc atg caa gct ggt ggcdtgg acc 1920 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 625 630 635 640 aat gta aat att gtc atg aac tat atc cgt aac ctg gat agt gaa aca 1968 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 645 650 655 ggg gca atg gtg cgc ctg ctg gaa gat ggc gat ggt atc gaa ggt cgt 2016 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg 660 665 670 ggt agc gct tgg cgt cac ccg cag ttc ggt ggt taataa 2055 Gly Ser Ala Trp Arg His Pro Gln Phe Gly Gly 675 680 <210> 21 <211> 683 <212> PRT <213> Artificial Sequence <223> Description of Artificial Sequence: DNA sequence coding for a fusion protein VP22creStrepTag <400> 21 Met Thr Ser Arg Arg Ser Val Lys Ser Gly Pro Arg Glu Val Pro Arg 1 5 10 15 Asp Glu Tyr Glu Asp Leu Tyr Tyr Thr Pro Ser Ser Gly Met Ala Ser 20 25 30 Pro Asp Ser Pro Pro Asp Thr Ser Arg Arg Gly Ala Leu Gln Thr Arg 35 40 45 Ser Arg Gln Arg Gly Glu Val Arg Phe Val Gln Tyr Asp Glu Ser Asp .50 55 60 Tyr Ala Leu Tyr Gly Gly Ser Ser Ser Glu Asp Asp Glu His Pro Glu 65 70 75 80 Val Pro Arg Thr Arg Arg Pro Val Ser Gly Ala Val Leu Ser Gly Pro 85 90 95 Gly Pro Ala Arg Ala Pro Pro Pro Pro Ala Gly Ser Gly Gly Ala Gly 100 105 110 Arg Thr Pro Thr Thr Ala Pro Arg Ala Pro Arg Thr Gln Arg Val Ala 115 120 125 Ser Lys Ala Pro Ala Ala Pro Ala Ala Glu Thr Thr Arg Gly Arg Lys 130 135 140 WO 01/49832 PCT/EPO1/00060 59 Ser Ala Gin Pro Glu Ser Ala Ala Leu Pro Asp Ala Pro Ala Ser Thr 145 150 155 160 Ala Pro Thr Arg Ser Lys Thr Pro Ala Gin Gly Leu Ala Arg Lys Leu 165 170 175 His Phe Ser Thr Ala Pro Pro Asn Pro Asp Ala Pro Trp Thr Pro Arg 180 185 190 Val Ala Gly Phe Asn Lys Arg Val Phe Cys Ala Ala Val Gly Arg Leu 195 200 205 Ala Ala Met His Ala Arg Met Ala Ala Val Gin Leu Trp Asp Met Ser 210 215 220 Arg Pro Arg Thr Asp Glu Asp Leu Asn Glu Leu Leu Gly Ile Thr Thr 225 230 235 240 Ile Arg Val Thr Val Cys Glu Gly Lys Asn Leu Leu Gin Arg Ala Asn 245 250 255 Glu Leu Val Asn Pro Asp Val Val Gin Asp Val Asp Ala Ala Thr Ala 260 265 270 Thr Arg Gly Arg Ser Ala Ala Ser Arg Pro Thr Glu Arg Pro Arg Ala 275 280 285 Pro Ala Arg Ser Ala Ser Arg Pro Arg Arg Pro Val Glu Gly Thr Glu 290 295 300 Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gin His 305 310 315 320 Ser Gly Gly Arg Met Ser Asn Leu Leu Thr Val His Gin Asn Leu Pro 325 330 335 Ala Leu Pro Val Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met 340 345 350 Asp Met Phe Arg Asp Arg Gin Ala Phe Ser Glu His Thr Trp Lys Met 355 360 365 Leu Leu Ser Val Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn 370 375 380 Arg Lys Trp Phe Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu 385 390 395 400 Tyr Leu Gin Ala Arg Gly Leu Ala Val Lys Thr Ile Gin Gin His Leu 405 410 415 Gly Gin Leu Asn Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser 420 425 430 Asp Ser Asn Ala Val Ser Leu Val Met Arg Arg Ile Arg Lys Glu Asn 435 440 445 Val Asp Ala Gly Glu Arg Ala Lys Gin Ala Leu Ala Phe Glu Arg Thr 450 455 460 Asp Phe Asp Gin Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gin 465 470 475 480 WO 01/49832 PCT/EPO1/00060 60 Asp Ile Arg Asn Leu Ala Phe Leu Gly Ile Ala Tyr Asn Thr Leu Leu 485 490 495 Arg Ile Ala Glu Ile Ala Arg Ile Arg Val Lys Asp Ile Ser Arg Thr 500 505 510 Asp Gly Gly Arg Met Leu Ile His Ile Gly Arg Thr Lys Thr Leu Val 515 520 525 Ser Thr Ala Gly Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu 530 535 540 Val Glu Arg Trp Ile Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn 545 550 555 560 Tyr Leu Phe Cys Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala 565 570 575 Thr Ser Gln Leu Ser Thr Arg Ala Leu Glu Gly Ile Phe Glu Ala Thr 580 585 590 His Arg Leu Ile Tyr Gly Ala Lys Asp Asp Ser Gly Gln Arg Tyr Leu 595 600 605 Ala Trp Ser Gly His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala 610 615 620 Arg Ala Gly Val Ser Ile Pro Glu Ile Met Gln Ala Gly Gly Trp Thr 625 630 635 640 Asn Val Asn Ile Val Met Asn Tyr Ile Arg Asn Leu Asp Ser Glu Thr 645 650 655 Gly Ala Met Val Arg Leu Leu Glu Asp Gly Asp Gly Ile Glu Gly Arg 660 665 670 Gly Ser Ala Trp Arg His Pro Gln Phe Gly Gly 675 680 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence:synthetic TAT protein <400> 22 Ala Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 23 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein WO 01/49832 PCT/EPO1/00060 61 <400> 23 Tyr Ala Arg Lys Ala Arg Arg Gln Ala Arg Arg 1 5 10 <210> 24 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein <400> 24 Tyr Ala Arg Ala Ala Ala Arg Gln Ala Arg Ala 1 5 10 <210> 25 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein <400> 25 Tyr Ala Arg Ala Ala Arg Arg Ala Ala Arg Arg 1 5 10 <210> 26 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein <400> 26 Tyr Ala Arg Ala Ala Arg Arg Ala Ala Arg Ala 1 5 10 <210> 27 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein <400> 27 Tyr Ala Arg Arg Arg Arg Arg Arg Arg Arg Arg 1 5 10 <210> 28 <211> 11 <212> PRT WO 01/49832 PCT/EPO1/00060 62 <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic TAT protein <400> 28 Tyr Ala Ala Ala Arg Arg Arg Arg Arg Arg Arg 1 5 10 <210> 29 <211> 4960 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pCMV-I-Cre-pA <400> 29 aaacagtccg atgtacgggc cagatatacg cgttgacatt gattattgac tagttattaa 60 tagtaatcaa ttacggggtc attagttcat agoccatata tggagttccg cgttacataa 120 cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata 180 atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggac 240 tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc 300 cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta 360 tgggactttc ctacttggca gtacatctac gtattagtca togotattac catggtgatg 420 cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacqggg atttccaagt 480 ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg gqactttcca 540 aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcqtgt acggtgqgag 600 gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactg gcttatcqaa 660 attaatacga ctcactatag ggagacccaa gctgactcta gacttaatta agcgttgggg 720 tgagtactcc ctctcaaaag cgggcatgac ttctgcgcta agattgtcag tttccaaaaa 780 cgaggaggat ttgatattca cctggcccgc ggtgatgcct ttgagggtgg ccgcgtccat 840 ctggtcagaa aagacaatct ttttgttgtc aagcttgagg tgtggcaggc ttgagatctg 900 gccatacact tgagtgacat tgacatccac tttgcctttc tctccacagg tgtccactcc 960 cagggcggcc tcgaccatgc ccaagaagaa gaggaaggtg tccaatttac tgaccgtaca 1020 ccaaaatttg cctgcattac cggtcgatgc aacgagtgat gaggttcgca agaacctgat 1080 ggacatgttc agggatcgcc aggcgttttc tgagcatacc tggaaaatgc ttctgtccgt 1140 ttgccggtcg tgggcggcat ggtgcaagtt gaataaccgg aaatggtttc ccgcagaacc 1200 tgaagatgtt cgcgattatc ttctatatct tcaggcgcgc ggtctggcag taaaaactat 1260 ccagcaacat ttgggccagc taaacatgct tcatcgtcgg tccgggctgc cacgaccaag 1320 tgacagcaat gctgtttcac tggttatgcg gcggatccga aaagaaaacg ttgatgccgg 1380 tgaacgtgca aaacaggctc tagcgttcga acgcactgat ttcgaccagg ttcgttcact 1440 catggaaaat agcgatcgct gccaggatat acgtaatctg gcatttctgg ggattgctta 1500 taacaccctg ttacgtatag ccgaaattgc caggatcagg gttaaagata tctcacgtac 1560 tgacggtggg agaatgttaa tccatattgg cagaacgaaa acgctggtta gcaccgcagg 1620 tgtagagaag gcacttagcc tgggggtaac taaactggtc gagcgatgga tttccgtctc 1680 tggtgtagct gatgatccga ataactacct gttttgccgg gtcagaaaaa atggtgttgc 1740 cgcgccatct gccaccagcc agctatcaac tcgcgccctg gaagggattt ttgaagcaa&1800 tcatcgattg atttacggcg ctaaggatga ctctggtcag agatacctgg cctggtctgg 1860 acacagtgcc cgtgtcggag ccgcgcgaga tatggcccgc gctggagttt caataccgga 1920 gatcatgcaa gctggtggct ggaccaatgt aaatattgtc atgaactata tccgtaacct 1980 ggatagtgaa acaggggcaa tggtgcgcct gctggaagat ggcgattagc cattaacgcg 2040 taaatgattg cagatccact agttctaggg ccgcgtcgac ctcgagatcc aggcgcggat 2100 caataaaaga tcattatttt caatagatct gtgtgttggt tttttgtgtg ccttggggga 2160 gggggaggcc agaatgaggc gcggccaagg gggaggggga ggccagaatg accttggggg 2220 agggggaggc cagaatgacc ttgggggagg gggaggccag aatgaggcgc gcccccgggt 2280 accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt 2340 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga 2400 ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat 2460 gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag 2520 tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga 2580 --- gtattagtca t-g-tattac WO 01/49832 PCT/EPO1/00060 63 cgcgccctga cgggcttgtc tgctcccggc atccgcttac aqacaagctg tgaccgtctc 2640 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacqaaaqgg 2700 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatgqttt cttagacgtc 2760 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 2820 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 2880 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 2940 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 3000 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 3060 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 3120 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 3180 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 3240 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca, acttacttct 3300 gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt 3360 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 3420 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 3480 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 3540 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 3600 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 3660 agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaataqac agatcgctga 3720 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 3780 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 3840 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 3900 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 3960 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 4020 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 4080 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 4140 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 4200 aagacgatag ttaccggata aggcgcagcg gtcggqctga acggggggtt cgtgcacaca 4260 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatqaga 4320 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 4380 aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 4440 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcqgag 4500 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 4560 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 4620 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 4680 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cqattcatta 4740 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 4800 tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat 4860 gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 4920 cgccaagcta gcccgggcta gcttgcatgc ctgcaggttt 4960 <210> 30 <211> 7332 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pOMV-I-beta-pA <400> 30 aaacagtccg atgtacgggc cagatatacg cgttgacatt gattattgac tagttattaa 60 tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg cgttacataa 120 cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata 180 atgacgtatq ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggac 240 tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc 300 cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta 360 tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg 420 cggttttggc agtacatcaa tgggcgtgga tagcgatttg actcacgggg atttccaagt 480 otocaccoca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca 540 aaatgtcgta acaactccgc cccattgacgcaaatgggcg gtaggcgtgt acggtgggaq 600 gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactq gcttatcgaa 660 attaatacga ctcactatag ggagacccaa gctgactcta gacttaatta agcgttggg 720 ttgttc- gatcaagag taccactc WO 01/49832 PCT/EPO1/00060 64 tgagtactcc ctctcaaaag cgggcatgac ttctgcgcta agattgtcag tttccaaaaa 780 cgaggaggat ttgatattca cctggcccgc ggtgatgcct ttgagggtgg ccqcgtccat 840 ctggtcagaa aagacaatct ttttgttgtc aagcttgagg tgtggcaggc ttgagatctg 900 gccatacact tgagtgacat tgacatccac tttgcctttc tctccacagg tgtccactcc 960 cagggcggcc gcaattcccg gggatcgaaa gagcctgcta aagcaaaaaa gaagtcacca 1020 tgtcgtttac tttgaccaac aagaacgtga ttttcgttgc cggtctggga ggcattggtc 1080 tggacaccag caaggagctg ctcaagcqcg atcccgtcgt tttacaacgt cgtgactggg 1140 aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc 1200 gtaatagcga agaggcccgc accgatcgcc cttcccaaca gttgcgcaqc ctgaatggcq 1260 aatggcgctt tgcctggttt ccggcaccag aagcggtgcc ggaaagctgg ctqgagtgcg 1320 atcttcctga ggccgatact qtcgtcgtcc cctcaaactq gcagatgcac ggttacqatg 1380 cgcccatcta caccaacgta acctatccca ttacggtcaa tccgccgttt gttcccacgg 1440 agaatccgac gggttgttac tcgctcacat ttaatgttga tgaaagctgg ctacaggaag 1500 gccagacgcg aattattttt gatggcgtta actcggcgtt tcatctgtgg tgcaacgggc 1560 gctgggtcgg ttacggccag gacagtcgtt tgccgtctga atttgacctg agcgcatttt 1620 tacgcgccgg agaaaaccgc ctcgcggtga tggtgctgcg ttggagtgac ggcagttatc 1680 tggaagatca ggatatgtgq cggatgagzg gcattttccg tgacgtctcg ttgctqcata 1740 aaccgactac acaaatcagc qatttccatg ttgccactcg ctttaatgat gatttcaqcc 1800 gcgctgtact ggaggctgaa gttcagatqt gcggcgagtt gcgtgactac ctacgggtaa 1860 cagtttcttt atggcaggqt gaaacgcagg tcgccagcgg accgcgcct ttcggcqgtg 1920 aaattatcga tgagcgtggt ggttatgccg atcgcgtcac actacgtctg aacgtcgaaa 1980 acccgaaact gtggagcgcc gaaatcccga atctctatcg tgcgqtggtt gaactgcaca 2040 ccgccgacgg cacgctgatt gaagcagaag cctgcgatgt cggtttccgc gaggtgcgga 2100 ttgaaaatgg tctgctgctg ctgaacgqca agccgttgct qattcgaggc gttaaccgtc 2160 acgagcatca tcctctgcat qgtcaggtca tqgatqagca gacgatggtq caggatatcc 2220 tgctgatgaa gcagaacaac tttaacgccg tgcgctgttc gcattatccg aaccatccgc 2280 tgtggtacac gctgtgcgac cgctacggcc tgtatgtggt ggatgaagcc aatattgaaa 2340 cccacggcat ggtgccaatg aatcgtctga ccgatgatcc gcgctggcta ccggcgatga 2400 gcgaacgcgt aacgcgaatg gtgcagcgcg atcgtaatca cccgaqtgtg atcatctggt 2460 cgctggggaa tgaatcaqgc cacggcgcta atcacgacgc gctgtatcgc tggatcaaat 2520 ctgtcgatcc ttcccgcccg gtgcagtatg aaggcggcgg agccgacacc acqgccaccg 2580 atattatttg cccgatgtac gcgcgcgtgg atgaagacca gcccttcccg gctgtgccga 2640 aatggtccat caaaaaatgg ctttcgctac ctggagagac gcgcccgctg atcctttgcg 2700 aatacgccca cgcgatgggt aacagtcttq gcggtttcqc taaatactgq caggcgtttc 2760 gtcagtatcc ccgtttacag qgcggcttcg tctgggactg ggtggatcag tcgctgatta 2820 aatatgatga aaacggcaac ccgtggtcgg cttacggcgg tgattttggc gatacgccga 2880 acgatcgcca gttctgtatg aacggtctgg tctttgccga ccgcacgccg catccagcgc 2940 tgacggaagc aaaacaccag cagcagtttt tccagttccg tttatccggg caaaccatcg 3000 aagtgaccag cgaatacctg ttccgtcata gcgataacga gctcctgcac tggatggtgg 3060 cgctggatgg taagccgctg gcaagcggtg aagtgcctct ggatgtcgct ccacaaggta 3120 aacagttgat tgaactgcct gaactaccgc agccggaqag cgccgggcaa ctctggctca 3180 cagtacgcgt agtgcaaccg aacgcgaccg catggtcaga agccgggcac atcagcgcct 3240 ggcagcagtg gcgtctggcg gaaaacctca gtgtgacqct ccccgccqcg tcccacgcca 3300 tcccgcatct gaccaccagc gaaatggatt tttgcatcga gctgggtaat aagcgttggc 3360 aatttaaccg ccagtcaggc tttctttcac agatgtggat tggcqataaa aaacaactgc 3420 tgacgccgct gcgcgatcag ttcacccgtg caccgctgga taacgacatt ggcgtaagtg 3480 aagcgacccg cattgaccct aacgcctggq tcgaacgctq gaaggcqgcg ggccattacc 3540 aggccgaagc agcgttgttg cagtgcacgg cagatacact tgctgatgcg gtgctgatta 3600 cgaccgctca cgcgtggcag catcagggga aaaccttatt tatcagccgg aaaacctacc 3660 ggattgatgg tagtggtcaa atggcgatta ccgttgatgt tgaagtggcg agcgatacac 3720 cgcatccggc gcggattggc ctgaactgcc agctggcgca ggtagcagag cgggtaaact 3780 ggctcggatt agggccgcaa gaaaactatc ccgaccgcct tactgccgcc tgttttgacc 3840 gctgggatct gccattgtca gacatgtata ccccgtacgt cttcccgagc gaaaacggtc 3900 tgcgctgcgg gacgcgcgaa ttgaattatg gcccacacca gtggcgcggc gacttccagt 3960 tcaacatcag ccgctacagt caacagcaac tgatggaaac cagccatcgc catctgctgc 4020 acgcggaaga aggcacatgg ctgaatatcg acggtttcca tatggggatt ggtggcgacg 4080 actcctggag cccgtcagta tcggcggaat tacagctgag cgccggtcgc taccattacc 4140 agttggtctg gtgtcaaaaa taataataac cgggcaggcc atgtctgccc gtatttcgcg 4200 taaggaaatc cattatgtac tatttaaaaa acacaaactt ttggatgttc ggtttattct 4260 ttttctttta cttttttatc atgggagcct acttcccgtt tttcccgatt tggctacatg 4320 acatcaacca tatcagcaaa agtgatacgg gtattatttt tgccgctatt tctctgttct 4380 cgctattatt ccaaccgctg tttggtctqctttctgacaa actcggcctc gactctaggc 4440 ggccgcgtcg acctcgagat ccaggcgcgg atcaataaaa gatcattatt ttcaatagat 4500 ctgtgtgttg gttttttgtg tgccttgggg gagggggagg ccagaatgag gcgcggccaa 4560 ctcagg- atcccgtcgt-- - WO 01/49832 PCT/EPO1/00060 65 gggggaqggg gaggccagaa tgaccttggg ggagqgggag gccagaatga ccttggqgga 4620 gggggaggcc agaatgaggc gcgcccccgq gtaccagct cgaattcact ggccgtcgtt 4680 ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcaqcacat 4740 ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacaq 4800 ttgcgcagcc tgaatggcga atggcgcctg atqcggtatt ttctccttac gcatctgtgc 4860 ggtatttcac accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta 4920 agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 4980 gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 5040 ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataqgtt 5100 aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc 5160 ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 5220 taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc 5280 cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgttttiig6 tcacccagaa 5340 acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa 5400 ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg 5460 atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa 5520 gagcaactcg gtcgccgcat acactattct cagaatgact tggttgata ctcaccagtc 5580 acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 5640 atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta 5700 accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag 5760 ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca 5820 acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata 5880 gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 5940 tggtttattg ctgataaatc tggagccggt gagcgtggqt ctcgcggtat cattgcagca 6000 ctggggccag atggtaagcc ctcccgtatc qtagttatct acacgacggg gagtcaggca 6060 actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg 6120 taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa 6180 tttaaaagga tctaggtgaa gatccttttt gataatctca tqaccaaaat cccttaacgt 6240 gagttttcgt tccactgagc gtcagacccc gtagaaaaqa tcaaaggatc ttcttgagat 6300 cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg 6360 gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga 6420 gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac 6480 tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt 6540 ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag 6600 cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggaqcgaac gacctacacc 6660 gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag 6720 gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca 6780 gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt 6840 cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc 6900 tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc 6960 cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc 7020 cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa 7080 ccgcctctcc ccgcgcgttg gccgattcat taatgcaqct gqcacgacag gtttcccgac 7140 tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc 7200 caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa 7260 tttcacacag gaaacagcta tgaccatgat tacgccaagc tagcccgggc tagcttgcat 7320 gccttcaggt tt 7332 <210> 31 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 31 atgccatggg ctacggccgc aagaagcgcc gccaacgcc ccgcggcatg tccaatttac 60 tgaccgtaca cc 72 <210> 32 <211> 25 SUBSTITUTE SHEET (RULE 26) WO 01/49832 PCT/EPO1/00060 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 32 tttcggatcc gccgcataac cagtg 25 <210> 33 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 33 tatatctaga ccatgggcta cggccgcaag aagc 34 <210> 34 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 34 gctaccacga ccttcgatac catcgccatc ttccagcagg cgc 43 <210> 35 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 35 taactagcgg ccgcatgtcc aatttactga ccgtacac 38 <210> 36 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 36 tcgagcggcc gccatcgcca tcttccagca ggcg 34 <210> 37 <211> 32 <212> DNA <213> Artificial Sequence <220> SUBSTITUTE SHEET (RULE 26) WO 01/49832 PCT/EPO1/00060 67 <223> Description of Artificial Sequence: primer <400> 37 tatatctaga catatgacct ctcgccgctc cg 32 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 38 ttccgaagac gacgaaacac c 21 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 39 tatattcgaa gcttattaac caccgaactg cg 32 <210> 40 <211> 4847 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: vector pGK-cre-pA <400> 40 aggtggcact tttcggqgaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 60 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 120 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 180 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 240 gttgggtgca cgagtgqgtt acatcgaact ggatctcaac agcggtaaga tccttgagag 300 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 360 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 420 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 480 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 540 gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt 600 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 660 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 720 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 780 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg qagccggtga 840 gcgtgggtct cgcggtatca ttgcaqcact ggggccagat ggtaagccct cccgtatcgt 900 agttatctac acgacgggga qtcaggcaac tatggatgaa cgaaatagac agatcgctga 960 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact ctatatact 1020 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 1080 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactqagcgt cagaccccgt 1140 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 1200 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccq gatcaagagc taccaactct 1260 ttttccgaag gtaactggct tcagcagagcgcagatacca aatactgtcc ttctagtgta 1320 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 1380 aatcctgtta ccagtggctg ctgccagtgg cataagtcg tgtcttaccg ggttggactc 1440 SUBSTITUTE SHEET (RULE 26) WO 01/49832 PCT/EPO1/00060 68 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 1500 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga 1560 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 1620 aacaggagag cgcacgaggg agcttccagg qggaaacgcc tggtatcttt atagtcctqt 1680 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag 1740 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctgqccttt 1800 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 1860 tgagtgagct gataccgctc gccqcagccg aacgaccgag cgcagcgagt cagtgagcga 1920 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 1980 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 2040 tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat 2100 gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 2160 cgccaagcgc gcaattaacc ctcactaaag ggaacaaaag ctgggtacq ggccccccct 2220 cgaggtcgac ggtatcgata agcttgatat cgaattctac cgggtaggqg aggcqctttt 2280 cccaaggcag tctggagcat gcgctttagc agccccgctg gcacttggcg ctacacaagt 2340 ggcctctggc ctcgcacaca ttccacatcc accggtagcg ccaaccggct ccgttctttg 2400 gtggcccctt cgcgccactt ctactcctcc cctagtcagg aagtttcccc cagcaagctc 2460 gcgtcgtgca ggacgtgaca aatggaagta gcacgtctca ctagtctcgt gcagatggac 2520 agcaccgctg agcaatggaa gcgggtagqc ctttggggca gcggccaata gcagctttgt 2580 tccttcgctt tctgggctca gaggctggga aggggtgggt ccgggggcgg gctcaggggc 2640 gggctcaggg gcgggcgggc goccgaaggt cctcccgagg cccggcattc tgcacgcttc 2700 aaaagcgcac gtctgccgcg ctgttctcct cttcctcatc tccgggcctt tcgacctgca 2760 gctcgaggtc gaccatgccc aagaagaaga ggaaqgtgtc caatttactg accgtacacc 2820 aaaatttgcc tgcattaccg gtcgatgcaa cgagtqatga ggttcgcaag aacctgatgg 2880 acatgttcag ggatcgccag gcgttttctg agcatacctg gaaaatgctt ctgtccgttt 2940 gccggtcgtg ggcggcatgg tgcaagttga ataaccggaa atggtttccc gcagaacctg 3000 aagatgttcg cgattatctt ctatatcttc aggcgcgcgg tctgqcagta aaaactatcc 3060 agcaacattt gggccagcta aacatgcttc atcgtcggtc cgggctgcca cgaccaagtg 3120 acagcaatgc tgtttcactq gttatgcggc ggatccgaaa agaaaacgtt gatgccggtg 3180 aacgtgcaaa acaggctcta gcgttcqaac gcactgattt cgaccaggtt cgttcactca 3240 tggaaaatag cgatcgctgc caggatatac gtaatctggc atttctgqgg attgcttata 3300 acaccctgtt acgtatagcc gaaattgcca ggatcagggt taaagatatc tcacgtactg 3360 acggtgggag aatgttaatc catattggca gaacgaaaac gctggttagc accgcaggtg 3420 tagagaaggc acttagcctg ggggtaacta aactggtcga gcgatggatt tccgtctctg 3480 gtgtagctga tgatccgaat aactacctgt tttgccgggt cagaaaaaat ggtgttgccg 3540 cgccatctgc caccagccag ctatcaactc gcgccctgga agggattttt gaagcaactc 3600 atcgattgat ttacggcgct aaggatgact ctggtcagag atacctggcc tggtctggac 3660 acagtgcccg tgtcggagcc gcgcgagata tggcccgcgc tggagtttca ataccggaga 3720 tcatgcaagc tggtggctgg accaatgtaa atattgtcat gaactatatc cgtaacctgg 3780 atagtgaaat aggggcaatg gtgcgcctgc tggaagatgg cgattagcca ttaacqcgta 3840 aatgattgca gatccactag ttctagagct cgctgatcag cctcgactgt gccttctagt 3900 tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact 3960 cccactgtcc tttcctaata aaatgaggaa attgcatcgc attqtctgag taggtgtcat 4020 tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc 4080 aggcatgctg gggatgcggt gggctctatg gcttctgagn nngaaagaac cagctggggc 4140 tcgagatcca ctagttctag cctcgaggct agagcggccg ccaccgcggt ggagctccaa 4200 ttcgccctat agtgagtcgt attacgcgcg ctcactggcc gtcgttttac aacgtcgtga 4260 ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 4320 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 4380 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcqggtgtgg tggttacgcg 4440 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 4500 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 4560 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 4620 acgtagtggg ccatcgccct gatagacgqt ttttcgccct ttgacgttgg agtccacgtt 4680 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 4740 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 4800 acaaaaattt aacgcgaatt ttaacaaaat attaacgctt acaattt 4847 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence SUBSTITUTE SHEET (RULE 26) WO 01/49832 PCT/EPO1/00060 69 <220> <223> Description of Artificial Sequence: primer <400> 41 catctccggg cctttcgacc tg 22 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 42 gcgatcggtg cgggcctctt c 21 SUBSTITUTE SHEET (RULE 26)

Claims (21)

1. Use of a fusion protein comprising (a) a site-specific DNA recombinase domain and (b) a protein transduction domain (PTD) for preparing an agent for inducing target gene alterations in a living organism or cell culture, wherein said living organism carries at least one or more recognition sites for said site-specific DNA recombinase integrated in an endogenous gene.

2. The use of claim 1, wherein the PTD is not derived from Antennapedia and preferably is a PTD derived from the VP22 protein of HSV or from the TAT protein of HIV.

3. Use of a fusion protein comprising (a) a site-specific DNA recombinase domain and (b) a protein transduction domain (PTD) being not, derived from Antennapedia and preferably being derived from the VP22 protein of HSV or from the TAT protein of HIV for preparing an agent for inducing target gene alterations in a living organism or cell culture, wherein said living organism carries at least one or more recognition sites for said site-specific DNA recombinase integrated in its genome.

4. The use of claim 3, wherein the recognition sites for said site specific recombinase is present within an endogenous gene or a transgene.

5. The use of any one of claims 2 to 4, wherein the TAT protein comprises (i) the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 10) or a mutant thereof including (ii) peptides having the amino sequences WO 01/49832 PCT/EPO1/00060 71 AGRKKRRQRRR (SEQ ID NO:22) YARKARRQARR (SEQ ID NO:23) YARAAARQARA (SEQ ID NO:24) YARAARRAARR (SEQ ID NO:25) YARAARRAARA (SEQ ID NO:26) YARRRRRRRRR (SEQ ID NO:27) YAAARRRRRRR (SEQ ID NO:28); preferably the TAT protein consists of one of the sequences shown in (i) or (ii) above.

6. The use of any one of claims 2 to 4, wherein the VP22 protein comprises the amino acid 16-157 of SEQ ID NO:14.

7. The use of any one of claims 1 to 6, wherein the site-specific DNA recombinase domain is selected from a recombinase protein derived from Cre, Flp, 4C31 recombinase, and R recombinase and preferably is Cre having amino acids 15 to 357 of SEQ ID NO: 2 or Flpe having amino acids 15 to 437 of SEQ ID NO: 4.

8. The use of any one of claims 1 to 7, wherein the protein transduction domain is fused to the N-terminal of the site-specific DNA recombinase domain.

9. The use of any one of claims 1 to 8, wherein the protein transduction domain is fused to the site-specific DNA recombinase domain through a direct chemical bond or through a linker molecule.

10. The use of any one of claim 9, wherein the linker molecule is a short peptide having 1 to 20, preferably 1 to 10 amino acid residues. WO 01/49832 PCT/EPO1/00060 72

11. The use of any one of claims 1 to 10, wherein said fusion protein further comprises additional functional sequences.

12. The use of claim 1, wherein the fusion protein has the sequence shown in SEQ ID NOs: 2, 4, 6 or 8.

13. The use of any one of claims 1 to 12, wherein the living organism is a vertebrate, preferably a rodent or a fish.

14. A method for inducing gene alterations in a living organism which comprises administering to said living organism, a fusion protein comprising a site-specific DNA recombinase domain and a protein transduction domain as defined in claims 1 to 12, wherein said living organism carries at least one or more recognition sites for said site specific DNA recombinase integrated in its genome.

15. A fusion protein comprising (a) a site-specific DNA recombinase domain as defined in claims 2 to 9 and (b) a protein transduction domain (PTD) as defined in claims 2 to 9 provided that when (a) is the wild-type Flp or Cre then (b) is not the full length VP22 protein of HSV.

16. The fusion of claim 15, wherein the (PTD) is derived from the TAT protein of HIV.

17. A DNA sequence coding for the fusion protein of claim 15 or 16, said DNA sequence preferably comprising the sequence shown in SEQ ID NOs:1, 3, 5, 7, 9, 11, 13, 18 and/or 20.

18. A vector comprising the DNA sequence of claim 17. WO 01/49832 PCT/EPO1/00060 73

19. A host cell transformed with the vector of claim 18 and/or comprising the DNA of claim 17.

20. A method for producing the fusion protein of claim 15 which comprises culturing the transformed host cell of claim 19 and isolating the fusion protein.

21. An injectable composition comprising the fusion protein as defined in claims 1 to 12 or 15 to 16.