WO2003070931A2

WO2003070931A2 - Methods for conducting site-specific dna recombination

Info

Publication number: WO2003070931A2
Application number: PCT/EP2003/001680
Authority: WO
Inventors: Christopher Baum; Elke Will; Wolfram Ostertag; Hannes Klump; Bernhard Schiedlmeier
Original assignee: Vision 7 Gmbh
Priority date: 2002-02-21
Filing date: 2003-02-19
Publication date: 2003-08-28
Also published as: WO2003070931A3; AU2003208876A8; AU2003208876A1

Abstract

The invention relates to novel methods and kits for introducing a polypeptide having Cre recombinase activity into eukaryotic cells. The invention also relates to polypeptides having Cre recombinase activity and to a reporter system that, after polypeptides have been introduced into a corresponding cell, gives information about a successful DNA recombination. Lastly, the invention relates to kits for conducting and for detecting site-specific DNA recombination.

Description

Site-specific DNA recombination method

The present invention relates to novel methods and kits for introducing a polypeptide with Cre recombinase activity into eukaryotic cells. The invention further relates to polypeptides with Cre recombinase activity and a reporter system which, after introduction into a corresponding cell, provides information about successful DNA recombination. Finally, the invention relates to kits for the detection of site-specific DNA recombinations. State of the art

Sequence-specific recombinations that lead to directional insertion, cutting or inversion of nucleic acid segments can be of great benefit for a large number of applications. Some site-specific recombinases have already been found and characterized in bacteria, bacteriophages and yeasts. They belong to the family of λ integrases (also known as "tyrosine recombinases"), for which over 100 members have now been identified on the basis of sequence homologies. Recombinases recognize specific DNA sequences and catalyze the reciprocal (reciprocal) exchange of the DNA sections between these recognition sequences. The best investigated examples are the integrase from the bacteriophage λ, the bacterial recombinases XerC and XerD, the Flp recombinase from yeast and the Cre / lox system Cre recombinase from the bacteriophage Pl.

The function of the Cre / lox system in the multiplication cycle of the bacteriophage Pl lies, among other things, in the cyclization of the linear genome and the dissolution of dimeric phage plasmids in order to ensure efficient division of the phage genome during bacterial cell division (Austin et al. ( 1981) Cell 25: 729-36; Abremski et al. (1983) Cell 32: 1301-11). The target sequence of the Cre recombinase, the so-called loxP sequence, consists of 2 recombinase binding elements of 13 bp (base pairs) which flank a central sequence of 8 bp as "inverted repeats". The central 8 bp sequence determines the orientation of the 34 bp loxP sequence. For a recombination event, four Cre molecules and two loxP sequences form a cruciform intermediate structure which is resolved by the reciprocal strand exchange (Gou et al. (1997) Nature 389: 40-6). Because of its specificity, the Cre / lox system is a useful tool for many applications in genetic engineering (Sauer (1998), Methods 14: 381-392; Kilby et al. (1993) Trends Genet. 9: 413-21). The loxP sequences can, for example, be integrated into vectors or into the genome of other cells and serve there as a target sequence for targeted integrations, inversions or excisions. A section of DNA flanked by two loxP sequences with the same orientation (ie "floxed") is cut out by the Cre activity. The addition of an excess of "floxed" DNA to a target sequence with one or two loxP sites can result in integration of this DNA at the corresponding position. Lox sequences in opposite orientation, however, allow inversion of the flanked sequence. Apart from the Cre recombinase and the loxP sequences, no further factors are required for the recombination process (Abremski and Hoess (1984) JBC 259: 1509-14). This facilitates the application of the Cre / lox system in the different cell types and in cell-free systems.

A Cre-induced inactivation of genes after the development of an organism has enabled, for example, the functional examination of genes which are essential for the embryonic development of the corresponding organism. The removal of exogenous sequences is also made possible when their action is no longer desired. For example, primary hepatocytes and myogenic cells could be reversibly immortalized by expression of the floxed SV40 large T antigen and thus expanded indefinitely in vitro (Kobayashi et al. (2000) Science 287: 1258-62; Berghella et al. (1999) Hum Gene Therapy 10: 1607-17).

By cutting out a section of DNA, genes can also be activated, for example by placing them near an active pro motors (Lakso et al. (1992) PNAS 89: 6232-6). Cre-mediated activation of genes can also be achieved by inversion of DNA sections.

Another application that is becoming increasingly important is the targeted integration of transgenes (Gorman and Bullock (2000) Current opinion in Biotechnology 11: 455-60). Furthermore, with the help of the Cre / lox system, synthetic antibody libraries (Tsurushita et al. (1996) Gene 172: 59-63), directed chromosome translocations (Qin et al. (1994) PNAS 91: 1706-10) and mosaic genomes (Betz et al. (1996) Curr Biol 6: 1307-16) or generated humanized animal models by directed gene exchange (Zou et al. (1994) Curr Biol 4: 1099-103).

The use of the Cre / lox system in site-directed recombination of DNA in eukaryotic cells has also been described in the U.S. - Patent 4,959,317.

A remarkable feature of Cre recombinase is the ability to get into the cell nucleus and thus be able to initiate the recombination process independently of the dissolution of the nuclear membrane during mitosis. This is particularly useful for use in stationary, postmitotic eukaryotic cells. At first it was assumed that the Cre recombinase passively diffuses through the nuclear pores due to its small size of 38 kilodaltons. Some groups have merged classic nuclear localization sequences with Cre recombinase to increase the efficiency of nuclear transport (Gu et al. (1993) Cell 73: 1155-1164; Bergemann et al. (1995) NAR 23: 4451-56) , In 1999, Le et al. (NAR 27: 4703-9), however, showed that the Cre protein has endogenous nuclear localization signals, which is unusual for a protein that performs its function in seedless bacterial cells. The Cre / lox-specific recombination in intact cells was only possible in the previously established applications by introducing a Cre-coding nucleic acid into the target cells. The Cre gene was introduced, for example, by transfection of an expression vector or by infection with retro or adenoviruses (Bergemann et al. (1995) NAR 23: 4451-56; Kanegae et al. (1995) NAR 23: 3816-3821), or it was merged with the lox sequences by crossing with a Cre transgenic organism. Control of Cre expression or Cre activity was achieved in various ways with these approaches. For example, the Cre gene can be brought under the control of a promoter that is regulated in terms of time or tissue-specific (Gu et al. (1994) Science 265: 103-6).

An inducibility of Cre activity can be achieved by the expression of Cre fusion proteins with so-called hormone binding domains (HBDs) of the progesterone or estrogen receptor (Metzger et al. (1995) PNAS 92: 6991-5; Kellendonk et al. (1996) NAR 24: 1404-11). The Cre-HBD fusion protein is expressed constitutively in the cells, but it only reaches the nucleus after the corresponding steroid hormone has been added and can then initiate recombination. Hormone analogues are used for the induction, which only interact with the HBD of the fusion protein, but not with the endogenous steriod receptors. Nevertheless, the application of these steroids is not harmless. A further disadvantage of the system is that, on the one hand, the induced recombination is not complete even when large amounts of “inducer” are applied, and on the other hand, residual activity of the Cre recombinase could be observed even in the absence of the inducer (Kellendonk et al. (1999) J Mol Biol. 285: 175-82; Schwenk et al. (1998) NAR 26: 1427-32). This background activity is particularly noticeable in vi tro (Zhang et al. 1996 NAR 24: 543-8; Fuhrmann-Benzakein et al. 2000 NAR 28: e99; Cheng et al. 2000 NAR 28: el08).

With the help of the Tet system (Gossen and Bujard (1992) PNAS 89: 5547-51), Cre expression could be suppressed by the presence of tetracyclines (St-Onge et al. (1996) NAR 24: 3875-77) or induced (Saam and Gordon (1999) JBC 274: 38071-82). This method bypasses the application of questionable hormone analogues and instead uses a well-studied, non-toxic drug for induction. The Tet system has the disadvantage, however, that in addition to the "floxed" target sequence and the Cre gene under the tTA-responsive promoter, a further transgene is required, which is for the tet-repressor-transactivator fusion protein (tTA) or its reverse Form coded rtTA.

The introduction of a Cre-coding nucleic acid generally carries considerable risks: On the one hand, there is a risk of insertion mutagenesis as a result of non-specific integration of the exogenous DNA into the genome of the target cell (Stocking et al. (1988) Cell 53: 869-79). Another risk factor is the permanent or prolonged expression of Cre recombinase associated with most systems. It has recently been shown in two independent studies that sustained expression of the Cre recombinase causes slowed growth and chromosomal aberrations in the cells examined (Silver and Livingston (2001) Mol Cell 8: 233-43; Loonstra et al (2001) PNAS 98: 9209-14). The dependence of the Cre-mediated cytotoxicity on its endonuclease activity suggests that cryptic loxP sequences found in the genomes of mammalian, yeast and bacterial cells are recognized and recombined when the recombinase is highly expressed. The object of the present invention is thus to provide methods for site-specific DNA recombination in eukaryotic cells which allow the introduction of a polypeptide with Cre recombinase activity into cells (preferably those which do not themselves have such an enzyme) and the disadvantages described of the methods established in the prior art, transfer of nucleic acids coding for Cre recombinase, do not have.

Presentation of the invention

It has now surprisingly been found that a (for example recombinantly produced) Cre recombinase, which has no additional, heterologous protein transduction domain, is added to the culture medium when intact eukaryotic cells, which have not been pretreated either electrically or chemically, and in the cell nucleus of the cells is able to catalyze a specific DNA recombination process of DNA regions which have corresponding recognition sequences. The recombination rate can be over 50% after just one application.

According to the invention, the object is thus achieved by an in-vitro method for site-specific DNA recombination in eukaryotic cells, in which a polypeptide with Cre recombinase activity, which does not include a heterologous protein transduction domain, is added to a eukaryotic cell culture, the cells of which (or their DNA) contain at least one DNA region (DNA section) which contains at least one recognition sequence which is recognized by the polypeptide with Cre recombinase activity, and the cells are cultivated under conditions which permit DNA recombination enable. As a rule, even lipophilic proteins with a molecular mass of more than 0.5 kD cannot pass through the cell membrane. Some larger proteins, such as the homeobox protein Antenna pedia (Antp) from the fruit fly Drosophila, the HIV proteins Tat and Vpr or the glycoprotein PreS2 from the hepatitis B virus (Ford et al. (2001) Gene Therapy 8: 1 -4; Schwarze et al. (2000) Trends in Cell Biol 10: 290-5; Oess and Hildt (2000) Gene Ther 7: 750-8), on the other hand, are able to get into intact cells through the plasma membrane. The mechanism of the so-called protein transduction is largely unclear. The amino acid sequences which mediate the presumably passive uptake could be limited to relatively short sections (11 to 16 amino acids) for Antp, Tat and PreS2. The transduction domains of

Tat and PreS2 can contain relatively large reporter proteins such as

Introduce galactosidase (ß-Gal, 120 kD) or the green fluorescent protein from the jellyfish Aeguorea victoria (GFP, 27 kD) into intact cells (Schwarze et al. (1999) Science 285: 1569-72; Oess and Hildt (2000) Gene Ther 7: 750-8).

According to a recently published work (Jo et al. (2001) Nature Biotechnology 19: 929-33), a Cre fusion protein with the membrane translocation sequence of the Kaposi fibroblast growth factor ("MTS" from FGF-4) was used to to achieve a specific recombination in vi tro and in vivo.

It is all the more surprising that the knowledge on which the invention is based is that a Cre recombinase without a heterologous transduction domain is also able to overcome the plasma membrane of the cell and to get into the cell interior (cf. Example 3).

The use according to the invention of a Cre protein without a heterologous protein transduction domain has an advantage over the use of the Cre-MTS fusion protein by Jo et al. (loc. cit.) the advantage that less heterologous peptide sequences that could possibly influence the target cell are "transduced". The efficiency of the recombination when the Cre protein is applied without a heterologous protein transduction domain in a serum-containing medium is as high as when the application described by Jo et al. Cre-MTS fusion protein shown in serum-free medium. Thus, cell types that are sensitive to serum deprivation (such as murine bone marrow cells) can also be efficiently transduced in serum-containing medium in the method according to the invention.

The use of such a membrane-permeable Cre recombinase opens up the possibility of carrying out directional recombination processes, it being possible to dispense with the introduction of a nucleic acid coding for Cre recombinase into the host cells, and the abovementioned disadvantages can thus be avoided. The polypeptide is also degraded relatively quickly in the host cells and is not - as with the introduction of a nucleic acid coding for the polypeptide - permanently reproduced over a longer period of time. This minimizes the risk of cytotoxic effects. There is also no possibility of non-specific integration of DNA into the genome of the host cells used. Another advantage of the invention is the faster procedure of the polypeptide transfer (less than 4 hours according to the invention), whereas after a nucleic acid transfer the Cre recombinase first has to be synthesized ribosomally. The specific DNA recombination can thus be carried out within a short and defined period of time using the method according to the invention.

In the context of the present invention, the term “DNA recombination” generally means a physical process, which leads to an exchange of DNA regions between two different DNA molecules or two different regions of a single DNA molecule and thus to a reorganization of the genetic starting material. In this context, a “site-specific DNA recombination” is a DNA recombination which is catalyzed by a polypeptide with enzymatic activity, which recognizes the DNA region to be recombined using defined DNA sequence segments (so-called recognition sequences) and one DNA strand exchange between two such recognition sequences (which can, however, be located on different DNA molecules / chromosomes) mediated.

According to the invention, the enzymatically active polypeptides which catalyze such a process can be polypeptides with Cre recombinase activity which interact with the specific recognition sequences on which they cut and religate the DNA. In the context of the present invention, "polypeptides with Cre recombinase activity" refer to polypeptides with enzymatic activity which are able to catalyze the same reaction as the Cre recombinase of bacteriophage P1 originating from the λ-integrase family of recombinases. The polypeptides can have the Cre recombinase activity as the main or secondary enzymatic activity. The polypeptides can also perform other enzymatic and non-enzymatic functions. Of course, a polypeptide with Cre recombinase activity, which can be used in the method according to the invention, can also be the Cre recombinase of bacteriophage PI itself. The recombination process catalyzed by the Cre recombinase-activity polypeptide can result in a directed insertion, cutting, exchange or inversion of the relevant DNA region to be recombined. The polypeptides with Cre recombinase activity has no heterologous protein transduction domains.

In the context of the invention, protein transduction domains are understood to be short amino acid sequences which can mediate the transition of a larger protein into an intact eukaryotic cell. These amino acid sequences, which can only consist of 11-16 amino acids, can be, for example, the corresponding transduction domains from the Tat protein, the Homobox protein Antennapedia or the PreS2 protein. The term "heterologous" clarifies that the amino acid region representing the protein transduction domain does not belong to the natural primary structure of the polypeptide with Cre recombinase activity.

According to a preferred embodiment of the present invention, the polypeptide with Cre recombinase activity has the amino acid sequences given in SEQ ID NO: 2 or SEQ ID NO: 4 or is a derivative, a homolog (for example with at least about 70% identity, preferably at least about 85% identity, with a degree of homology of at least about 95% being particularly preferred) or a fragment (which preferably has a length of at least 304 amino acids and in particular at least amino acids 37 to 340 of SEQ ID NO: 2) thereof. The designation "SEQ ID NO:" corresponds to the sequence code "<400>" according to WIPO Standard St.25.

In this case, a “derivative” is understood to mean a polypeptide of the same primary structure which, in comparison with the respective polypeptide according to the invention, has additional modifications of the peptide side chains. Such modifications are well known to those skilled in the art. For example, the glycosylation of asparagine, serine or threo- nin residues, the formation of disulfide bridges between cysteine residues, the covalent attachment of fluorescent markers (eg Alexa 488) or coenzymes such as biotin, lipoic acid or pyridoxal phosphate, or the phosphorylation of tyrosine, serine or threonine residues act. A "homolog" denotes a polypeptide whose primary structure differs from the primary structure of the respective polypeptide according to the invention by a maximum of approximately 30% (preferably a maximum of approximately 15%, with a maximum of approximately 5% being particularly preferred). In the case of a homologous protein, one or more amino acids of the original sequence can be exchanged for other amino acids. Furthermore, one or more amino acids of the original sequence can be deleted or additional amino acids can be inserted. In the present case, an “active fragment” is a polypeptide whose primary structure corresponds to a region of the primary structure of the respective polypeptide according to the invention, the active fragment comprising fewer amino acids than the polypeptide according to the invention. An active fragment of a polypeptide according to the invention has the same enzymatic activity as the polypeptide according to the invention, ie it catalyzes the same chemical reaction as the polypeptide according to the invention.

The polypeptide with the amino acid sequence given in SEQ ID NO: 2 is a recombinant Cre recombinase (hereinafter referred to as "wtCre"), which is derived from the corresponding enzyme from the bacteriophage P1 by an amino acid exchange in position 1 (glycine instead of methionine). It has been shown that the polypeptide according to the invention can cross the plasma membrane of intact cells and penetrate into the cell nucleus, where, if there are corresponding recognition sequences of the genomic DNA of the cell located there, it catalyzes a DNA recombination. Surprisingly, the polypeptide was also without any heterologous domain. After external addition to a culture of mouse fibroblasts, they are able to catalyze a loxP-specific DNA recombination (Example 7). The polypeptide indicated in SEQ ID NO: 4 and designated "nlsCre" comprises the antibody epitope 9E10 (c-myc; amino acids 360-371) in addition to the amino acid sequence shown in SEQ ID NO: 2 for the purpose of better detection of the polypeptide in the cells. and an SV40 core localization sequence located at the N-terminus (amino acids 11-17). The core localization sequence is said to increase the efficiency of the transport of the polypeptide into the cell nucleus.

With regard to the eukaryotic cells in which the DNA recombination can be carried out, the method according to the invention is not subject to any restrictions. For example, cell cultures of isolated mammalian cells, such as mouse or pig cells, and isolated cells of human origin can serve as target cells. The target cells can come from various areas of the body. According to the invention, the cells are intact and do not require any chemical or physical pretreatment. According to a preferred embodiment of the present invention, the eukaryotic cells are human or murine cells. According to a particularly preferred embodiment, the human or murine cells are bone marrow cells or fibroblasts.

The cultivation conditions which allow a polypeptide with Cre recombinase activity to be successfully introduced into the eukaryotic cells (into the cell interior) and subsequent DNA recombination are dependent on the respectively selected cells in which the DNA recombination is to be carried out. They generally correspond to the cultivation conditions that the person skilled in the art applies to a cell culture of the corresponding cells would, and are therefore described in detail in the prior art. They include, among other things, the cultivation and propagation of the isolated cells in various conventional media. Dulbecco's modified Eagle's Medium (DMEM) or Eagle's Minimum Essential Medium (MEM) can be used as media. Those skilled in the art will understand that other media and cytokines can also be used to allow Cre transfer to the target cells. The media can contain antibiotics such as penicillin, streptomycin or kanamycin in the usual concentrations, cytokines (eg 11-3, 11-6, SCF) and other additives useful for the cultivation of cells such as fetal calf serum (FCS) or bovine serum albumin (BSA), contained in different concentrations.

The cells can be grown and cultivated in conventional culture dishes in the temperature range recommended for the respective cells. According to the invention, the polypeptide with Cre recombinase activity can be introduced into the cells by simply adding the polypeptide to the supernatant of the cell culture. The polypeptide can be in a buffered aqueous solution, e.g. in a PBS solution. Cell cultivation and the choice of alternative methods of addition which are suitable for the process according to the invention are within the range of the average skill of the person skilled in the art.

The efficiency of the transduction depends on the one hand on the concentration of the polypeptide with Cre recombinase activity used (see Example 4), on the other hand it was surprisingly found that the addition of glycerol to the transfer medium increases the uptake of the Cre recombinase and thus the recombination rate (see example 5). According to a preferred embodiment of the present invention, the Add the polypeptide with Cre recombinase activity in a concentration of 100 nM to 30 μM. The preferred glycerol concentration is 0.5 to 10% (v / v) based on the transfer medium. According to a particularly preferred embodiment of the invention, 0.66 to 1.66 μM Cre recombinase (nlsCre) and 1.7 to 4.2% (v / v) glycerol are used, as a result of which recombination rates of over 80%, with 1 , 66 μM Cre recombinase (nlsCre) and 4.2% (v / v) glycerol about 94%. After the addition of the polypeptide, the cells can preferably be incubated further for a period of 2-12 h under the selected conditions. The culture medium can then be exchanged for fresh nutrient medium.

In the present case, the recognition sequences which are recognized by the polypeptide with Cre recombinase activity can be nucleotide sequence sections which are known to the person skilled in the art as "loxP" sequences. These are sequence sections of 34 bp, which consist of two inverted repeats of 13 bp each (cf. SEQ ID NO: 5; bp 1-13 and 22-34), which are an asymmetrical intermediate element (spacer) flank by 8 bp (see SEQ ID NO: 5; bp 14-21). The intermediate element gives the entire loxP sequence section its orientation. Depending on the location and orientation of the loxP sequence sections to one another, the recombination results in different DNA arrangements; the flanked nucleotide sequence region can thus be cut out, exchanged, inserted or inverted in the course of the recombination. For example, if two loxP recognition sequences with identical orientation flank a certain DNA region, the recombination process catalyzed by the polypeptide with Cre recombinase activity results in a cutting out (or an exchange) of the DNA located ("floxed") between the loxP recognition sequences Area. The term "identical orientation" refers to an identical 5 '→ 3' base sequence of the intermediate elements of two loxP recognition sequences enclosed by the inverted repeats. All bases of the intermediate element with the exception of one position (position 18 in SEQ ID NO: 5) can vary, only recombinations between two loxP sequences with homologous intermediate elements being efficient (Hoess et al. (1986) NAR 14: 2287-2300). In the context of the present invention, the DNA region to be recombined can be located both on one or more chromosomes of a eukaryotic cell and on one or more mobile genetic elements, such as, for example, a plasmid. According to a preferred embodiment of the present invention, the recognition sequences are loxP sequences of identical orientation with the nucleotide sequence given in SEQ ID NO: 5. Included according to the invention are nucleotide sequences which differ from these sequences in terms of base exchanges, deletions and insertions of individual or more nucleotides. In each of the "inverted repeats", 8-10 bases of the 13 bases must match loxP in order to support Cre-mediated recombination (Abremski et al. (1988), J. Mol. Biol. 202: 59-66; Abremski and Hoess (1985), J. Mol. Biol. 184: 211-220).

The invention further relates to a polypeptide with Cre recombinase activity which has one of the amino acid sequences given in SEQ ID NO: 2 or SEQ ID NO: 4 or is a derivative, a homologue or a fragment thereof, the natural Cre recombinase consisting of the bacteriophage Pl is excluded.

The invention also relates to a method for producing a polypeptide with Cre recombinase activity. The subject is therefore also a method for producing a polypeptide with the sequence given in SEQ ID NO: 2 or SEQ ID NO: 4, in which a nucleic acid sequence coding for the amino acid sequence mentioned, preferably the sequence given in SEQ ID NO: 1 or SEQ ID NO: 3, is ligated into an expression vector, this is introduced into host cells suitable for the vector and the cells are expressed under to express the Polypeptide cultivated suitable conditions. If necessary, an insulation and cleaning step follows. The polypeptides with Cre recombinase activity shown under SEQ ID NO: 2 and SEQ ID NO: 4 were, for example, recombinantly produced and heterologously expressed as glutathione-S-transferase (GST) fusion protein in E. coli and purified by means of affinity chromatography (cf. . Example 1) . The fusion proteins were each incubated in the presence of thrombin in order to separate the GST portion from the Cre recombinase polypeptides. The expression of the polypeptides can of course also be carried out with the aid of other established methods or in other organisms such as in yeast or insect cells. Corresponding methods of heterologous expression of polypeptides as well as suitable purification strategies of the proteins or fusion proteins are sufficiently known in the prior art and include, inter alia, the baculovirus expression system, the 6xHis-tag expression system, the maltose binding protein (MBP) expression system.

The invention also relates to a nucleic acid which encodes a polypeptide with an amino acid sequence given in SEQ ID NO: 2 or SEQ ID NO: 4. The nucleic acids preferably have the nucleotide sequence given in SEQ ID NO: 1 or SEQ ID NO: 3, the degeneration of the genetic code being included according to the invention. Furthermore, the invention relates to isolated host cells which contain a polypeptide according to the invention or a nucleic acid according to the invention or which express a polypeptide according to the invention. With regard to the choice of host cells, the invention is not subject to any restrictions. kung, and in addition to bacterial cells (such as E. coli) also yeast cells (such as S. cerevisiae or P. pastoris), insect cells and (higher) Euraryonten cells such as CHO or BHK cells are included.

In addition, the invention relates to the use of a polypeptide with Cre recombinase activity for performing a site-specific DNA recombination in eukaryotic cells, in which cells which contain at least one DNA region which contains at least one recognition sequence which is derived from the polypeptide with Cre -Recombinase activity is detected, cultured in the presence of the polypeptide under conditions that allow recombination of DNA.

According to a further aspect, the invention further relates to a reporter system for the detection of DNA recombination in eukaryotic cells (for example triggered by the use of a polypeptide with recombinase activity), in which

(a) a first reporter gene is flanked by two recognition sequences of identical orientation and a second reporter gene is located downstream of the first reporter gene, an initiation codon and a ribosome binding site being located upstream of the two recognition sequences, which enable translation of the first reporter gene by a stop codon between the two recognition sequences is ended and no functional initiation codon is located in the region between the two reporter genes; and

(b) the site of the second reporter gene is brought into a position relative to the initiation codon by a site-specific DNA recombination, which enables translation of the second reporter gene; and (c) the gene products of the two reporter genes are to be distinguished from one another.

The reporter system allows a quick and quantitative detection of a site-specific DNA recombination in a eukaryotic cell. It opens up the possibility to immediately check whether a sufficiently high transduction efficiency was achieved under the given test conditions when transducing a polypeptide with recombinase activity. The reporter system thus allows an accompanying quality control of the Cre protein preparation and the transduction conditions (medium composition, time of incubation, temperature, etc.).

The recognition sequences which are recognized by a polypeptide with recombinase activity can be, for example, loxP- (cf. SEQ ID NO: 5), frt-recognition sequences or their homologous, of polypeptides with Cre or Flp recombinase. Act recognized sequences. The recognition sequences of the reporter system have an identical orientation to one another, which causes the DNA region flanked (“flocked”) to be excised. The excision removes the first reporter gene from the gene construct, the second reporter gene being brought into a position relative to the initiation codon and the ribosome binding site which allows translation (of the gene product) of the second reporter gene, ie the initiation codon and the second reporter gene should are present in a reading frame after DNA recombination. Since site-specific DNA recombinations run with base accuracy, an exact prediction of the expected recombination product can be made. When designing the reporter system, it is therefore possible for the person skilled in the art to select the base sequence in this regard and to ensure the functionality of the system. According to a preferred embodiment of the present invention, the recognition sequences are loxP recognition sequences with the nucleotide sequence given in SEQ ID NO: 5. Recognized sequences which are derived from the abovementioned sequences and differ from them by individually exchanged nucleotides are included according to the invention. In addition to the polypeptides with Cre recombinase activity, the polypeptides with recombinase activity which can be used in connection with the reporter system according to the invention can also include polypeptides which have the enzymatic activity of another recombinase, such as, for example, that of lambda Integrase Flp. Nucleotide sequences which can be used in eukaryotic cells as initiation codons, stop codons or ribosome binding sites are part of the standard knowledge of the person skilled in the art and can be found in relevant textbooks.

In the context of the present invention, reporter genes are genes which code for proteins which enable a qualitative and / or quantitative detection of their expression. Such reporter genes are adequately described in the prior art and include, inter alia, the genes coding for β-galactosidase, luciferase or chloramphenicol acetyltransferase. Carrying out the detection of the recombination that has taken place may require the disruption of the cells and / or the addition of additional substances whose biochemical conversion can be detected by the gene product of a reporter gene. The expression of the β-galactosidase can be, for example, both colorimetric (by staining the cells) by reacting the substrate o-nitrophenyl-β-D-galactoside (ONPG) or X-Gal, fluorometrically by reacting a 4-methylumbelliferyl -ß-galactopyranoside compound or by chemiluminescence using the reaction of a 1,2-dioxetane-galactopyranoside derivative. sen. Genes can also be used which impart resistance to the cells to cytotoxic or other substances which inhibit or inhibit growth. The expression of these genes is detected by culturing the cells under correspondingly selective conditions.

According to a preferred embodiment of the present invention, at least one of the reporter genes codes for a fluorescent protein. The measurement of the light emissions caused by luminescent proteins is particularly suitable for in vivo measurements, since the cells do not have to be disrupted and are therefore directly accessible for detection. For this reason, the measurement of fluorescence is associated with less time and material expenditure. Aliquots of the respective cell culture can be examined for the emission of light using a fluorescence microscope or by flow cytometry during culture growth.

According to a particularly preferred embodiment of the present invention, the fluorescent protein has one of the amino acid sequences given in SEQ ID NO: 6 or SEQ ID NO: 7 or is a derivative, a homologue or an active fragment thereof. This is the red fluorescent DsRedl protein from Discosoma sp. or the enhanced green fluorescent protein (eGFP), a variant of the GFP from Aeguorea victoria.

According to a further, particularly preferred embodiment of the present invention, the reporter system has the nucleotide sequence given in SEQ ID NO: 8. This reporter construct (SFr) was generated in which the DsRedl gene coding for a red fluorescent protein was flanked by loxP sequences with the same orientation. Downstream of the second loxP sequence is the open reading frame of an eGFP gene, which codes for the "enhanced green fluorescent protein" and has a deleted ATG start codon. A ribosome binding site and a potential ATG initiation codon in the reading frame of the DsRed gene are located before the first loxP sequence. The transitions are constructed in such a way that a loxP-specific recombination leads to excision of the DsRed gene and at the same time moves the eGFP gene into the correct reading frame for the ATG initiation codon (cf. FIG. 2). A Cre-specific recombination can be detected by fluorescence microscopy or flow cytometry. Flow cytometry enables the recombination rate to be determined precisely without the cells having to be treated beforehand.

The invention thus also relates to a method for detecting a site-specific DNA recombination in eukaryotic cells, which are preferably isolated cells, using a polypeptide with recombinase activity, in which the reporter system according to the invention and a polypeptide with recombinase activity in a eukaryotic cell and cultivates the cells under conditions that allow recombination of DNA, and subsequently detects the recombination process based on the gene product encoded by the second reporter gene (ie, for example, by a change or the occurrence of fluorescence, if at least one reporter gene encodes a fluorescent protein ). The term "isolated" in this context means that the cells are not in their physiological environment. In this case, the method is an in vitro method.

The reporter system according to the invention can also be used to detect recombination processes in which the polypeptide with recombinase activity is introduced into the cell according to the methods described in the prior art. According to According to a preferred embodiment of the present invention, the polypeptide with recombinase activity is introduced into the cell by transfection or by viral infection with a vector which contains a nucleic acid coding for the polypeptide with recombinase activity, the cells being cultivated under conditions which enable expression of the polypeptide with recombinase activity. The expression can be under the control of a constitutive or inducible promoter structure. An inducible promoter structure denotes a promoter structure in which the addition of certain substances results in a change in the transcription rate of the nucleotide sequence to be controlled (such as, for example, a gene). Furthermore, a Cre variant (for example a fusion with a hormone binding domain) which is only "activated" by adding a substance (for example a steroid hormone) can be expressed constitutively. A site-specific recombination preferably takes place only when these inducing substances are added. The reporter system makes it easier to control the inducibility of such a system. (Inducible promoter structures that can be used in the context of the method are sufficiently known to the person skilled in the art.)

The reporter system is of course also suitable for detecting recombination processes which were initiated by the method of ^' site-specific DNA recombination according to the invention and in which the polypeptide with recombinase activity was added to the culture supernatant of the eukaryotic cell culture. According to a preferred embodiment of the present invention, the polypeptide is a polypeptide with Cre recombinase activity, which has the amino acid sequences given in SEQ ID NO: 2 or SEQ ID NO: 4, or a derivative, a homologue or an active fragment thereof. According to a further preferred embodiment of the present invention, the recognition sequences are loxP sequences with the nucleotide sequence given in SEQ ID NO: 5.

As already described, the method can be carried out in the presence of glycerol (see above) in order to achieve an increase in the recombination rate.

The invention further relates to the use of the reporter system described for the detection of a site-specific DNA recombination in eukaryotic cells.

As part of an in vivo application, a polypeptide with Cre recombinase activity (without heterologous PTD, for example according to SEQ ID No.2 or 4) is injected, for example, into mice which either carry transgenic Cre recognition sequences and have been infected with recombinant viruses or have received a transplant (eg bone marrow) with such sequences. The injection can take place directly into the corresponding organ or into the bloodstream and, depending on the position of the recognition sequences, can result in partial inactivation or activation of genes or, for example, in a chromosomal translocation. The present invention thus also relates to the use of a polypeptide with Cre recombinase activity (see above) for the production of a pharmaceutical preparation for carrying out site-specific DNA recombination in eukaryotic cells in vivo. Accordingly, the subject of the invention is also a pharmaceutical preparation containing the inventive polypeptide with Cre recombinase activity (see above), which optionally additionally contains pharmaceutically acceptable auxiliaries and carriers.

In addition, the invention includes host cells which contain the reporter system according to the invention, as well as host cells which contain the reporter system according to the invention and the polypeptide according to the invention with Cre recombinase activity. With regard to the choice of host cells, the invention is not subject to any restrictions and, in addition to bacterial cells (such as E. coli), insect cells and (higher) euraryotic cells, such as murine and human cell lines CHO or BHK cells, are also included.

The invention also relates to kits for performing site-specific recombination.

Finally, the present invention relates to kits for carrying out a method for the detection of a site-specific DNA recombination in eukaryotic cells using a polypeptide with recombinase activity. In addition to the reporter system according to the invention, the kits can include contain a suitable transformation vector and various reagents which are useful in introducing the reporter system into the cells.

According to a preferred embodiment of the invention, the above-mentioned kits also contain glycerin.

As already mentioned, the use of glycerol leads to an improvement in the protein transduction of the Cre recombinase and consequently to an increase in the recombination rate. In the context of the present invention it was found that this principle can also be applied to other proteins. The present invention therefore also relates to the use of glycerol for carrying out or improving protein transduction, including proteins without (additional) heterologous protein transduction domain, in cells, ie for introducing or introducing proteins into corresponding cells. In this context, 'improving protein transduction' means one Increase in transduction efficiency or transduction rate. The invention further relates to a method for protein transduction in which cells, in particular isolated cells, are cultivated with the protein to be reduced in the presence of glycerol, preferably in a proportion of 0.5 to 10% (v / v).

The invention is described in more detail below with the aid of examples.

Description of the figures:

Fig. 1: (A) Schematic representation of the polypeptides nlsCre, PTD-nlsCre, TLM-nlsCre and wtCre after their purification as a GST fusion protein and cleavage of the GST portion with thrombin. The only difference between the recombinant wtCre protein and the native Cre amino acid sequence (Accession No. P06956) is a glycine instead of methionine at position No. 1. The modified protein nlsCre has an amino acid exchange compared to wtCre (threonine instead of alanine ) at position 207, the additional SV40 core localization sequence ("NLS", amino acids 11-17 in SEQ ID NO: 4) at the N-terminus and a 9E10 (c-myc) epitope ("myc-tag", amino acids 360- 371 in SEQ ID NO: 4) at the C-terminus. In contrast, the proteins TLM-nlsCre and PTD-nlsCre additionally contain the known protein transduction domains PreS2-TLM from HBV and Tat-PTD from HIV-1. (B) SDS-PAGE for the detection of nlsCre, TLM-nlsCre, PTD-nlsCre and wtCre. The Cre proteins were expressed as GST fusion proteins in E. coli, affinity-purified and cleaved from the GST portion with thrombin. The protein preparations were separated by SDS-PAGE in a 12.5% gel and the proteins were then visualized by Coomassie staining.

Fig. 2: Reporter system for the detection of Cre recombinase activity. In the retroviral reporter construct SFr (SEQ ID NO: 8), the DsRedl gene (encoded for a red fluorescent protein) is flanked by loxP sequences with the same orientation. Distal to the second loxP sequence is the open reading frame of the eGFP gene (encoded for the "enhanced green fluorescent protein") in which the ATG start codon was deleted. A Kozak consensus sequence and a potential ATG initiation codon in the reading frame of the DsRed gene are located before the first loxP sequence. The transitions are constructed ized that a lox-specific recombination leads to excision of the DsRed gene and at the same time moves the eGFP gene into the correct reading frame for the ATG initiation codon. Cells that are stably transduced with this reporter construct show red fluorescence. After Cre / lox-specific recombination, eGFP is expressed in place of the DsRedl gene and the cells show green fluorescence.

3: Fluorescence microscope image of clonal reporter cells which had been cultured 2 days beforehand in medium with 800 nM recombinant, purified nlsCre protein. Cells with clear green fluorescence (shown here for clones 12 and 15) could be detected from all treated reporter cell clones, which were not observed in untreated cell populations. The non-homogeneous localization of the DsRedl protein in the cells is probably due to its tendency to aggregate (Clontech product information).

Fiα. 4: Detection of the lox-specific recombination at the chromosomal DNA level. (A) Positions of the primers for a PCR on the reporter construct SFr. A precise, Cre-mediated excision of the DsRedl gene leads to a template that is shortened by 735 bp. (B) Genomic DNA from untreated (-) or (+) reporter cells (clones 12 and 15) incubated with recombinant nlsCre protein was used as a "template" with the PCR primers pl and p2. In addition to the expected PCR product of 1099 bp for the non-recombined template, the product of 364 bp expected after specific recombination could be detected in the (+) samples. The identity of the visible bands was checked by sequence analysis.

5: Dependence of the recombination rate on the concentration of the nlsCre protein in the medium. (A) Reporter cells were made for Incubated for 6 hours in medium (MEM with 10% FCS) with different concentrations of nlsCre and analyzed 48 hours later for eGFP and DsRedl expression using flow cytometry (for evaluation see also Section B). The proportion of eGFP-positive cells is shown as a function of the nlsCre concentration in the medium. Under these conditions, a recombination rate of over 50% was achieved by adding 5 μM nlsCre. (B) Reporter cells were incubated for 6 hours with 2.5 μM nlsCre in serum-free medium (MEM without FCS). After 48 hours, the cells were analyzed by flow cytometry and the DsRedl expression was plotted against the eGFP expression using the "Cellquest" software (Becton Dickinson) and evaluated. While no eGFP expression could be detected in untreated cells (mock),> 50% of the nlsCre-treated cells were eGFP positive.

6: Cre / lox-specific recombination in murine bone marrow cells after addition of nlsCre protein to the medium. Schematic representation of the endogenously "floxed" C / EBPα locus before and after lox-specific recombination. By the first PCR with the

Primers p3 and p4 were able to detect the C / EBPα ^{fl / fl} locus in the genomic DNA of the bone marrow cells. With the second PCR (primers p5 and p6), it was only possible to detect the specific 400 bp product that arises after the excision of C / EBPα in the genomic DNA of nlsCre- or PTD-nlsCre-treated bone marrow cells. The 400 bp products were verified by sequence analysis.

Fig. 7: Specific recombination after adding unmodified Cre recombinase. Reporter cells were incubated with 1 μM of the wtCre protein for 3 hours. After two days, about 1.5% were able to express eGFP in the fluorescence microscope

Cells are detected. Examples

Cloning, annealing of oligonucleotides, phosphorylation of DNA fragments and the preparation of chromosomal DNA were carried out according to standard protocols (Ausubel et al. (1994) Current protocols in molecular biology John Wiley & Sons. New York, USA). PCR reactions were carried out with Taq polymerase (Qiagen) or platinum Pfxl polymerase (Gibco BRL) according to the recommendations of the corresponding company. Mung bean nuclease digestion was carried out according to the recommendation of Promega.

Example 1: Preparation of recombinant, purified Cre recombinase

Example la: Construction of vectors for the expression of Cre recombinase

As an expression vector for the production of GST-Cre fusion proteins in J57. coli, pGEX-2T (KT) was used (SEQ ID NO: 9), a modified pGEX-2T vector with the multicloning region from pEG (KT) (Mitchell et al. (1993) Yeast 9: 715-723). For the cloning of pGEX-nlsCre, pGEX-2T (KT) was linearized with Xhol, the overhangs were filled in with the Klenow fragment and then cut with iVcoI. A modified Cre gene (Bergemann et al. (1995) NAR 23: 4451-6) was isolated from R815 (Prassolov et al. (2001) Exp Hematol. 29: 756-65) with the restriction endonucleases iVcoI and Xbal, the Xbal overhang was also smoothed using the Klenow fragment. The Cre coding DNA fragment was then ligated with pGEX-2T (KT). '(: 11; 5'CATGGAACCGCCACCCGGATCGCCGATACGGGAGAAAATGGAAGACAGCGGG-3 SEQ ID NO;: (GGCGATCCGGGTGGCGGTTC-3 ¹ -GATCCCCGCTGTCTTCCATTTTCTCCCGTATC- and TLM) for the construction of pGEX-TLM TLM nlsCre the Oligonukleo- tide + were SEQ ID NO 5 10)' , for pGEX-PTD-nlsCre the oligonucleotides PTD + (SEQ ID NO: 12; 5'- GATCCTATGGCCGTAAAAAGCGCCGTCAGCGCCGCCGTCC-3 ') and PTD- (SEQ ID NO: 13; 5' -CATGGGACACGGCGGCGCTTCCTTGoryCG) 3 'and PGXCGGGCGGGCGGCGGGGCG''. The resulting 52 bp and 40 bp fragments were each inserted into the BamHI / Wcol linearized plasmid pGEX-nlsCre.

The introduced DNA fragments code for amino acid sequences from the PreS2 glycoprotein from HBV or from the tat protein from HIV-1. Both sequences were shown to be able to mediate the uptake of recombinant reporter proteins in cells (Oess and Hildt 2000 Gene Therapy 7: 750-8; Schwarze et al. 1999 Science 285: 1569-72). The modified Cre gene from R815 codes for the Cre recombinase from bacteriophage P1 with an amino acid exchange (threonine instead of alanine) at position 207, which additionally contains the SV40 core localization sequence (amino acids 11-17 in SEQ ID NO: 4) on the N Contains a 9E10 (c-myc) epitope (amino acids 360-371 in SEQ ID NO: 4) at the C-terminus. The modified Cre recombinase is referred to below as "nlsCre".

For the production of a Cre recombinase without C- and N-terminal modifications, a PCR with pGEX-nlsCre as template and the oligonucleotides Cre-N (SEQ ID NO: 14; 5'-GAAGAGGAAGGGATCCAATTTACTGACCG-3 ') and Cre-C was first used (SEQ ID NO: 15; 5'-CAGAAATAAGCTTTTGTTCCTAATCGCCATC-3 ') using Pfxl polymerase (Gibco Life Technologies). The resulting 1060 bp fragment was cut with the restriction endonucleases BamHI and Hin III, and the resulting 683 bp (Bam- HI-HindIII) and 355 bp (BamHI) fragments were successively inserted into the BamHI-HindIII opened vector pGEX-2T (KT). Furthermore, the base exchange that leads to the A207T mutation in nlsCre was carried out using oligonucleotides 207+ (SEQ ID NO: 16; 5 '-GGTTAGCACCGCAGGTGTAG-3') and 207- (SEQ ID NO: 17; 5 '- CTACACCTGCGGTGCTAACC-3 ^■ ) corrected using the "overlap extension method" (Ho et al. (1989) Gene 77: 51-59). The entire wtCre gene (SEQ ID NO: 1) in the resulting pGEX-wtCre vector was verified by sequence analysis.

After the expression, purification and thrombin digestion of the GST-wtCre fusion protein described in Example 1b, the “wtCre” protein (SEQ ID NO: 2) is shown, which is derived from the “natural” Cre recombinase described in the Bacteriophage Pl (Accession NO: P06956) only differs at position 1 (glycine instead of methionine).

Example Ib: Expression and Affinity Purification of the Cre Fusion Proteins

Transformants of the E. coli expression strain BL21-CodonPlus (DE3) -RP (Stratagene) with the expression plasmids pGEX-nlsCre, pGEX-TLM-nlsCre, pGEX-PTD-nlsCre and pGEX-wtCre were in 1 1 LB (+ 100 mg / 1 ampicillin and 50 mg / 1 chloramphenicol) cultivated up to an OD ₆₀₀ of 0.7 and induced for 8 hours at 25 degrees with 0.5 mM IPTG. The cells were disrupted in 40 ml PBS, 0.5% Triton-X-100, 0.5 mM Pefabloc (Röche Diagnostics GmbH) by ultrasound. After centrifugation at 4000 × g, the supernatant was incubated with 500 μl glutathione-Sepharose 4B (Amersham Pharmacia) for 3 hours at 4 ° C. using the rotary wheel. The Sepharose was washed 3 × 10 min in a rotary wheel with 40 ml PBS, pH 7.0. The identity of the GST-Cre fusion proteins was checked immunologically with the monoclonal anti-myc antibody (9E10). To split off the cre- Proteins from the GST portion were treated with 10 units of thrombin (Amersham Pharmacia) in 1 ml of PBS / lOOmM Na ₂ HP0 _{4 for} 16 hours at 25 degrees in a rotary wheel.

The Cre proteins released by thrombin digestion showed a running behavior in the SDS gel which corresponds to the expected molar masses (FIGS. 1, A and B). NlsCre, TLM-nlsCre, PTD-nlsCre and wtCre were obtained in a concentration of 100 to 500 ng / μl (2-12 μM).

Example 2; Representation of a reporter system for the detection of Cre activity

Example 2a: Construction of the retroviral reporter construct SFr (FIG. 2)

The construction of the reporter construct SFr (= SFß91-loxP-DsRedl-loxP-eGFP-wPRE, SEQ ID NO: 8) was carried out over several intermediate steps. All plasmid amplifications were carried out in RecA-deficient E. coli strains (DH5α or DH10B from Gibco BRL) at a growth temperature of 28 ° C.

1. The loxP sequence in front of the DsRed gene (loxPl) was obtained by hybridizing the oligonucleotides loxPl + (SEQ ID NO: 18; 5'- GGCCGCATGATAACTTCGTATAATGTATGCTATACGAAGTTATC-3 ') and loxPl- (SEQ ID NO: 19; 5' -CATGGATAACTACAT 3 '), the loxP sequence according to the DsRed gene (loxP2) by hybridization of the oligonucleotides loxP2 + (SEQ ID NO: 20; 5'- GATCTTAGTCGACGCGTATAACTTCGTATAATGTATGCTATACGAAGTTATCAGGCCTGCAC- 3'; and loxGTGATA: 5QGGTGATA: 5QGGTGATA: 5QGGTGATA: 5QGGTTATA- - GCATACATTATACGAAGTTATACGCGTCGACTAA-3 '). The loxP questions elements were then phosphorylated with polynucleotide kinase (MBI fermentas).

2. For the construction of pDsRedl-loxP2, pDsRedl-Cl (Clontech) was cut with Xmal, the overhangs were smoothed using the Klenow fragment, then digested with BgrIII and the loxP2 fragment was inserted into the vector prepared in this way.

3. pKS-loxPl-DsRedl (Cterm) -loxP2 resulted from a 3-fragment ligation of the loxPl fragment and the 326 bp Ncol-BamHI fragment from pDsRedl-loxP2 with the vector pBluescript (KS +) opened by Notl-BamKI (KS +) ( Stratagene). Subsequent insertion of the 423 bp-jVeol fragment from pDsRedl-Cl into the iVcoI-cut pKS-loxPl-DsRedl (Cterm) -loxP2 in the correct orientation gave the intermediate construct pKS-loxPl-DsRedl-loxP2.

4. The loxPl-DsRedl-loxP2 sequence was isolated from pKS by Notl / X al digestion and the overhangs were smoothed with mung bean nuclease (Promega). pSFß91-eGFP (day) (Wahlers et al.

(2001) Gene Ther 8: 477-86, Schambach et al. (2000) Mol. Ther. 2: 435-45) was linearized with iVcoI, the overhangs were smoothed with mung bean nuclease and the loxPl-DsRedl-loxP2 fragment was inserted. After checking the orientation and the

Transitions by means of sequence analysis could be isolated pSFß91-loxP-DsRedl-loxP-eGFP with an "in frame" transition between loxP2 and the eGFP gene. The "in frame" transition ensures the translation from eGFP to Cre-mediated excision through the correct positioning to the ATG start codon in front of loxPl.

5. To increase the expression of the retroviral reporter construct in the target cells, the HindIII fragment was analyzed using wPRE (woodchuck HBV posttranscriptional regulatory element, Zufferey et al. (1999) J Virol. 73: 2886-92) isolated from pKS-γwPRE (Schambach et al. (2000) Mol Ther. 2: 435-45) and inserted into the HindIII site of SFβ91-loxP-DsRedl-loxP-eGFP. The correct orientation was checked by restriction digestion.

Example 2b: Cloning of mouse fibroblasts after transduction with SFr

The packaging cell line Phoenix-gp (http://www.stanford.edu/ group / nolan /) was included with the reporter construct SFr and with expression plasmids for MoMuLV-gag / pol (the expression plasmid for gag / pol, pSVgag / pol the gagpol gene from MoMuLV under the control of the SV40 promoter) and for the ecotrophic coat protein from MoMuLV (Morita et al. (2000) Gene Ther. 7: 1063-66). The mouse fibroblast cell line SC-1 was infected with the virus-containing supernatants. After three days, SC-1 cells, in which the reporter construct was stably integrated, could be detected microscopically and flow-cytometrically by their red fluorescence. 5 SC-1 clones (clone 3, clone 8, clone 10, clone 12 and clone 15) could be isolated by single cell deposition, which show a stable expression of DsRedl. No spontaneous recombination could be observed in any of these clones during the observation period (weeks to months), which was manifested in the expression of eGFP.

To package the reporter construct SFr in ecotrophic viruses, Phoenix-gp packaging cells were cultivated in Dulbeccos' modified Eagle's Medium (DMEM) with 2 mM glutamine and 10% fetal calf serum (FCS, Sigma). The transfection of 10 ⁷ Phoenix gp with 10 μg expression plasmid for MoMuLV gag-pol, 5 μg SFr and 3 μg expression plasmid for MoMuLV-env was carried out after the Ca ₃ (P0 ₄ ) ₂ - Method (Ausrubel et al. (1994), see above). DMEM / FCS with 20 mM HEPES, pH 7.5 was used for transfection and harvesting of the supernatants after 44 hours. Have been infected

50 μl of the virus-containing supernatant in 500 μl DMEM / FCS / HEPES + 4 μg / ml protamine sulfate are added to 10 ⁵ SC-1 cells (ATCC NO CRL-1404) and centrifuged for 90 min at 20 ° C. and 800 × g.

The SC-1 reporter cells were cultivated in Eagle's Minimum Essential Medium (MEM, Sigma) with 2 M glutamine and 10% FCS at 37 ° C in the incubator.

Example 3: loxP-specific recombination after addition of purified Cre recombinase without a heterologous transduction domain

In order to investigate whether externally added Cre protein can trigger a lox-specific excision in the reporter cells, various SFr-transduced SC-1 clones (10 ⁵ cells per cell culture dish with a diameter of 1.5 cm) with affinity-rich incubated nlsCre, PTD-nlsCre or TLM-nlsCre (final concentration 0.8-1 μM in MEM with the supplements mentioned in Example 2 and 50 U / ml penicillin, 50 mg / ml streptomycin) in the incubator for 3-4 hours. After 48 hours, the proportion of eGFP-positive cells was determined by flow cytometry using the FACScaliber (Becton Dickinson). Surprisingly, the proportion of eGFP-positive cells after adding the nlsCre protein without a heterologous protein transduction domain was at least as high as after adding PTD-nlsCre and TLM-nlsCre (Table 1). (n = number of experiments; fluctuation range of the proportion of eGFP-positive cells) Table 1

Protein eGFP positive cells

nlsCre 3.2% (n = 6; 1.9-5.4%)

PTD-nlsCre 2.5% (n = 6; 1.9-3.5%)

TLM-nlsCre 2.1% (n = 4; 0.5-3.9%)

After the addition of 0.8 μM nlsCre protein to various clonal reporter cells (clones 3, 8, 10, 12 and 15), microscopic examination of all the batches revealed that after only 24 h some cells with a weak green fluorescence were detected after 48 Hours became clearer (see Fig. 3). The eGFP-positive cells showed no or significantly reduced red fluorescence compared to the surrounding cells. The proportion of eGFP-positive cells was between 2 and 4% according to flow cytometric analysis. In contrast, no eGFP-positive cells could be detected among the control cells.

To detect the Cre-specific recombination at the DNA level, chromosomal DNA was isolated from the nlsCre-treated mixed populations of clones 12 (4% eGFP positive) and 15 (2.5% eGFP positive). The chromosomal DNA was used as a template for a polymerase chain reaction in which the (+) primer pl (SEQ ID NO: 22; 5 '-ACGCCGAAACCGCGCCGCGCGTC-3') 173 bp before the first loxP sequence and (-) Primer p2 (SEQ ID NO: 23; 5'-GCAGATGAACTTCAGGGTCAGCTTGC-3 ') attaches 154 bp after the second lox sequence (see FIG. 4A). In the first PCR, the mixed populations show, in addition to the 1099 bp product that can be expected from the presentation of the non-recombined reporter construct, another product of 364 bp that corresponds to the length of the expected product from the recombined presentation (ie after excision of the DsRedl -Gens). The 364 bp product is missing when genomic see DNA from the untreated reporter cells was used as a template (Fig. 4B). The sequence analysis of the PCR products isolated from the gel confirmed the precise, Cre / lox-specific recombination.

This example clearly shows that the nlsCre protein without a heterologous protein transduction domain reaches the cell nucleus of the reporter cells after external addition and initiates a specific recombination there.

Example 4: Efficient loxP-specific recombination using nlsCre

In order to increase the efficiency of recombination by nlsCre, higher concentrations of the purified protein were first used and the incubation was extended.

For this purpose, reporter cells with 1.0, 1.5, 2.5 and 5.0 μM nlsCre concentrations in MEM (with 2 mM glutamine, 10% FCS, 50 U / ml penicillin and 50 mg / ml streptomycin) were used for 6 hours incubated at 37 ° C and the medium was exchanged for fresh MEM. After two days, the proportion of eGFP-positive cells was determined by flow cytometry using a FACScaliber.

As expected, the recombination efficiency increases with increasing nlsCre concentration. Incubation with 5 μM nlsCre resulted in a recombination rate of over 50% (FIG. 5A). If the incubation with nlsCre was carried out in serum-free medium (MEM with 2 mM glutamine and 50 U / ml penicillin, 50 mg / ml streptomycin), a recombination rate of over 50% could be measured after adding 2.5 μM nlsCre (Fig. 5B). A reduction in recombination efficiency in the presence of serum (here 40% versus 53% after the addition of 2.5 μM nlsCre) may possibly be due to an aggregation of the recombinant protein with serum proteins.

Example 5; Increase in Cre's efficiency in SC1 reporter cells by glycerin

In order to improve the efficiency with which nlsCre is taken up in SCI reporter cells, glycerin or dimethyl sulfoxide (DMSO) was added to the batches.

SCl reporter cells were treated with nlsCre protein in the final concentrations given in Table 2 in the transfer medium (Eagles's Minimal essential Medium (Sig a) with 10% fetal calf serum (FCS), 2 mM glutamine, 50 U / ml penicillin, 50 μg / ml of streptomycin and the amount of glycerol or DMSO given in Table 2) for 6 hours at 37 ° C. The cells were then treated with trypsin / EDTA (Gibco Life Technologies) and transferred to a new cell culture vessel. The proportion of eGFP-positive cells was determined two days later using FACS analysis.

Table 2:

The experimental results in Table 2 show that the presence of glycerol during nlsCre protein transduction leads to a significant increase in the recombination rate in the SC1 reporter cells. For example, 0.66 μM nlsCre with a simultaneous addition of 4.2% glycerol is sufficient to achieve a specific recombination in over 80% of the reporter cells. Without the glycerol addition, approximately ten times the nls-Cre concentration is necessary for a comparable specific recombination rate (Example 4, FIG. 5A). In contrast, the presence of DMSO only leads to a comparatively small increase in the recombination rate.

The influence of glycerol on the recombination rate in the reporter cells was also confirmed for a commercially available Cre protein (New England Biolabs, NEB). This Cre protein is supplied in 50% glycerol and was first dialyzed against transfer medium for the comparative experiments. The NEB dialyzed Cre protein was then incubated with SCI reporter cells as previously described. The dialyzed Cre protein in a concentration of 0.22 μM did not lead to any measurable recombination in the reporter cells. A concentration of 4.2% (v / v) glycerol and 0.22 μM Cre protein in the transfer medium led to eGFP expression in 62% of the cells after 2 days of incubation.

The activity of the Cre protein of NEB, which differs from the native Cre of bacteriophage P1 by only two additional amino acids, also shows that no heterologous sequences are required for efficient Cre protein transduction. Example 6; Externally added nlsCre protein can initiate a loxP-specific excision in murine bone marrow cells

Bone marrow cells from a C57B1 / 6 mouse strain, in which the endogenous C / EBPα gene is flanked with loxP sequences (Zhang et al. (2001) Blood 98: 792a-793a, see FIG. 6) were initially by rinsing out Ober - and lower leg bone prepared. Aliquots of 2 × 10 ⁶ cells were run for 7 hours at 37 ° C. in 500 μl of a 1: 1 mixture of 2xDMDM (with doubly concentrated cytokines (see below), 100 U / ml penicillin, 100 mg / ml streptomycin) and PBS (mock) or PBS were incubated with purified, recombinant nlsCre protein. The final concentrations were 1.5 μM nlsCre and 1.5 μM PTD-nlsCre. The cells were centrifuged and the medium was against IMDM (with 20% FCS, 0.1% bovine serum albumin, 2 mM glutamine, 5 ng / ml human IL-6; 10 ng / ml rough IL-3 and 50 ng / ml murine SCF; all recombinant growth factors from R&D Systems) replaced. After culturing the cells for one week at 37 ° C. in an incubator, genomic DNA from the three batches was prepared and used as a template for two different polymerase chain reactions (PCRs).

The first PCR using the oligonucleotides p3 (SEQ ID NO: 24, 5 ^' -TGGCCTGGAGACGCAATGA-3') and p4 (SEQ ID NO: 25; 5'- CGCAGAGATTGTGCGTCTTT-3 ') serves to detect the non-recombined allele C / EBPα ^{£ 1 / fl} , which as a template results in a 269 bp fragment as a PCR product. This product could not be detected in all batches containing the genomic DNA of the C / EBPαflfl ^mouse strain, but not in the negative control without a DNA template (FIG. 6). For the second PCR, the oligonucleotides p5 (SEQ ID NO: 26; 5 '-GCCTGGTAAGCCTAGCAATCCT-3') and p6 (SEQ ID NO: 27; 5 '-TGGAAACTTGGGTTGGGTGT-3') were used, which contain a 400 bp fragment with the recombined template (ie after excision of the C / EBPα gene) and theoretically a 6.6 kb fragment with the non-recombined template. While the 6.6 kb fragment did not arise under the chosen conditions (standard approach with Qiagen Taq polymerase; 30 sec denaturation, 45 sec annealing at 60 ° C. and 45 sec extension phase per cycle), a 400 bp product was obtained only detected in the batches whose template originated from cells which had been incubated with recombinant nlsCre or PTD-nlsCre (FIG. 6). Sequencing the 400 bp PCR

Products confirmed the correct excision of C / EBPα.

This example shows that the direct transfer of the recombinant, purified Cre protein is not only suitable for a specific recombination of the reporter construct SFr in the mouse fibroblast cell line SC-1, but in principle also for the recombination of another template (here the " floxed "

C / EBPα gene) can be used in primary cells (here mouse bone marrow).

Example 7; LoxP-specific recombination after transduction of unmodified Cre protein

The investigations set out in Examples 3, 4 and 5 show a Cre-specific recombination in clonal reporter cells to which recombinant, purified Cre protein was supplied via the culture medium. The basic property of Cre recombinase to get into intact cells is independent of the known protein transduction domains Tat-PTD or PreS2-TLM. To investigate whether the "artificially added" amino acid sequences (the SV40-NLS at the N-terminus or the 9E10 epitope at the C-terminus) of the modified nlsCre protein used here mediate this property, a Cre protein should be tested without modifications become. Reporter cells were incubated with 1 μM of the wtCre protein (see Example 1) for 3 hours. After two days, eGFP-positive cells could be detected in the fluorescence microscope (FIG. 7). The average recombination rate is around 1.5% (n = 7; 0.6-2.5%).

Since the transduction of the Cre protein is obviously independent of heterologous amino acid sequences, the Cre recombinase from the bacteriophage PI probably has an endogenous protein transduction domain. The slightly higher recombination efficiency of nlsCre under the same conditions (see Table 1) can be attributed to the acceleration of the core transport by the SV40-NLS.

Claims

claims

1. In vitro method for site-specific DNA recombination in eukaryotic cells, in which one

(a) Adding a polypeptide with Cre recombinase activity, which does not comprise a heterologous protein transduction domain, to a eukaryotic cell culture, the cells of which contain at least one DNA region which contains at least one recognition sequence which is recognized by the polypeptide with Cre recombinase activity will, and one

(b) culturing the cells under conditions that allow DNA recombination.

2. The method according to claim 1, characterized in that the polypeptide with Cre recombinase activity has one of the amino acid sequences given in SEQ ID NO: 2 or SEQ ID NO: 4 or is a derivative, a homologue or an active fragment thereof.

3. The method according to any one of claims 1 to 2, characterized in that the eukaryotic cells are human or murine cells.

4. The method according to claim 3, characterized in that the human or murine cells are bone marrow cells or fibroblasts.

5. The method according to any one of claims 1 to 4, characterized in that the polypeptide with Cre recombinase Activity on the culture supernatant of the eukaryotic cell culture.

6. The method according to claim 5, characterized in that adding the polypeptide with Cre recombinase activity in a concentration of 100 nM to 30 μM.

7. The method according to claim 6, characterized in that glycerol is added to the culture supernatant of the eukaryotic cell culture.

8. The method according to claim 7, characterized in that the glycerol concentration is 0.5 to 10% (v / v).

9. The method according to any one of claims 1 to 8, characterized in that the recognition sequences are loxP sequences with the nucleotide sequence given in SEQ ID NO: 5.

10. Use of a polypeptide with Cre recombinase activity, which does not contain a heterologous transduction domain, for performing a site-specific DNA recombination in eukaryotic cells, in which cells which contain at least one DNA region which contains at least one recognition sequence which is from the polypeptide with Cre recombinase activity is recognized, cultured in the presence of the polypeptide under conditions that allow DNA recombination.

11. Use according to claim 10, characterized in that the recognition sequences are loxP sequences with the nucleotide sequence given in SEQ ID NO: 5.

12. Use of a polypeptide with Cre recombinase activity, which does not contain a heterologous transduction domain, for the production of a pharmaceutical preparation for carrying out site-specific DNA recombination in eukaryotic cells in vivo.

13. Polypeptide with Cre recombinase activity, characterized in that the polypeptide has one of the amino acid sequences given in SEQ ID NO: 2 or SEQ ID NO: 4 or a derivative, a homologue or an active fragment thereof, with the exception of the natural Cre -Recombinase from the bacteriophage Pl.

14. Nucleic acid encoding a polypeptide with Cre recombinase activity, characterized in that the nucleic acid has one of the nucleotide sequences given in SEQ ID NO: 1 or SEQ ID NO: 3.

15. An isolated cell containing a polypeptide with Cre recombinase activity according to claim 13.

16. An isolated cell containing a nucleic acid according to claim 14.

17. Cell according to claim 15 or 16, characterized in that it is a bacterial cell or a eukaryotic cell.

18. Cell according to claim 17, characterized in that it is an E. coli cell, a yeast cell or an insect cell.

19. Reporter system for the detection of a site-specific DNA recombination in eukaryotic cells. records that the reporter system is a DNA construct in which

(a) a first reporter gene flanked by two recombinase recognition sequences in a manner which results in excision of said first reporter gene in the presence of a polypeptide with recombinase activity, and

(b) a second reporter gene is located downstream of the first reporter gene, an initiation codon and a ribosome binding site being located upstream of the two recognition sequences, which enable translation of the first reporter gene, which is terminated by a stop codon between the two recognition sequences, and in the region no functional initiation codon is located between the two reporter genes; and

(c) the second reporter gene is brought into a position relative to the initiation codon by a site-specific DNA recombination, which enables translation of the second reporter gene; and

(d) the gene products of the two reporter genes are to be distinguished from one another.

20. Reporter system according to claim 19, characterized in that the recognition sequences are loxP sequences with the nucleotide sequence given in SEQ ID NO: 5.

21. Reporter system according to claims 19 or 20, characterized in that at least one of the reporter genes codes for a fluorescent protein.

22. Reporter system according to claim 21, characterized in that the fluorescent protein has the sequence given in SEQ ID NO: 6 or SEQ ID NO: 7.

23. Reporter system according to claims 19 to 22, characterized in that the reporter system has the sequence given in SEQ ID NO: 8.

24. In vi ro method for the detection of site-specific DNA recombination in eukaryotic cells using a polypeptide with recombinase activity, in which

(a) introducing a reporter system according to claims 19 to 23 and a polypeptide with recombinase activity into a eukaryotic cell and culturing the cells under conditions which enable recombination of DNA; and you

(b) Detects a recombination process based on the gene product encoded by the second reporter gene.

25. The method according to claim 24, characterized in that the polypeptide with recombinase activity is introduced into the cells by transfection or viral infection with a vector which contains a nucleic acid sequence coding for the polypeptide, the cells being cultivated under conditions, which allow expression of the polypeptide.

26. The method according to claim 24, characterized in that the polypeptide with recombinase activity is introduced into the cells by adding the polypeptide with recombinase activity to the culture supernatant of the eukaryotic cell culture.

27. The method according to claim 26, characterized in that the polypeptide with recombinase activity is a polypeptide according to claim 13.

28. The method according to claim 24 to 27, characterized in that the cells are cultivated in the presence of glycerol.

29. The method according to claim 28, characterized in that the glycerol concentration is 0.5 to 10% (v / v).

30. The method according to any one of claims 24 to 29, characterized in that the recognition sequences are loxP sequences with the nucleotide sequence given in SEQ ID NO: 5.

31. Use of a reporter system according to claims 19 to 23 for detecting a site-specific DNA recombination in eukaryotic cells.

32. An isolated host cell containing a reporter system according to claims 19 to 23.

33. Host cell according to claim 32, characterized in that the cell additionally contains a polypeptide with Cre recombinase activity according to claim 13.

34. Cell according to claim 32 or 33, characterized in that it is a bacterial cell or a eukaryotic cell.

35. Cell according to claim 34, characterized in that it is an E. coli cell, a murine or human cell.

36. A method for producing a polypeptide with Cre recombinase activity according to claim 13, characterized in that a nucleic acid sequence coding for the amino acid sequence according to SEQ ID NO: 2 or SEQ ID NO: 4 is ligated into an expression vector, this is introduced into host cells and culturing the cells under conditions suitable for expression of the polypeptide.

37. The method according to claim 36, characterized in that the nucleic acid sequence is the sequence given in SEQ ID NO: 1 or SEQ ID NO: 3.

38. Kit for carrying out a method according to claims 1 to 9.

39. Kit for performing a method according to claims 24 to 30.

40. Pharmaceutical preparation for performing site-specific DNA recombination in eukaryotic cells.

41. Pharmaceutical preparation according to claim 40, characterized in that the preparation additionally contains pharmaceutically acceptable auxiliaries and / or carriers.

42. Use of glycerin to perform or improve protein transduction.